sign in sign up
<<
Home , Agaricomycotina, Archaeosporales, Aspergillus felis, Candida albicans, Candida dubliniensis, Candida glabrata

IDENTIFICATION OF CULTURE-NEGATIVE FUNGI IN BLOOD AND RESPIRATORY SAMPLES

Farida P. Sidiq

A Dissertation

Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

May 2014

Committee:

Scott O. Rogers, Advisor

W. Robert Midden

Graduate Faculty Representative

George Bullerjahn

Raymond Larsen

Vipaporn Phuntumart © 2014

Farida P. Sidiq

All Rights Reserved iii

ABSTRACT

Scott O. Rogers, Advisor

Fungi were identified as early as the 1800’s as potential human , and have since been shown as being capable of causing in both immunocompetent and immunocompromised people.

Clinical diagnosis of fungal infections has largely relied upon traditional microbiological culture techniques and examination of positive cultures and histopathological specimens utilizing microscopy.

The first has been shown to be highly insensitive and prone to result in frequent false negatives. This is complicated by atypical and organisms that are morphologically indistinguishable in tissues.

Delays in diagnosis of fungal infections and inaccurate identification of infectious organisms contribute to increased morbidity and mortality in immunocompromised patients who exhibit increased vulnerability to by normally nonpathogenic fungi.

In this study we have retrospectively examined one-hundred culture negative whole blood samples and one-hundred culture negative respiratory samples obtained from the clinical microbiology lab at the University of Michigan Hospital in Ann Arbor, MI. Samples were obtained from randomized, heterogeneous patient populations collected between 2005 and 2006. Specimens were tested utilizing cetyltrimethylammonium bromide (CTAB) DNA extraction and polymerase chain reaction amplification of internal transcribed spacer (ITS) regions of ribosomal DNA utilizing panfungal ITS primers. Positive amplicons were sequenced and compared to reference sequences in the NCBI Genbank database utilizing the BLASTn program. After testing was complete, patient characteristics including age, gender, hospital location, and length of stay were revealed and examined for potential correlations between fungal identified and specific patient variables. Phylogenetic analysis was also performed to infer potential evolutionary relationships between the fungal species found. Our results demonstrate that basic molecular biological techniques can be utilized in clinical laboratories for rapid and sensitive identification of fungal pathogens in samples reported as culture negative for fungal pathogens, which can facilitate rapid diagnosis and appropriate treatments. iv

This work is dedicated to my students, who helped me realize that

to love teaching, is to love learning,

and that laughter is necessary to do both well. v

ACKNOWLEDGMENTS

I would first like to thank my advisor, Dr. Scott O. Rogers, who didn’t know what he was getting into when he welcomed me into his lab. I don’t think you can separate the quality of one’s research from the character of the people you work with, and for this I am grateful to have worked with and for him. I would also like to thank the rest of my committee, namely Dr. W. Robert Midden, Dr. Vipaporn

Phuntumart, Dr. Raymond Larsen and Dr. George Bullerjahn, for their extreme patience and understanding regarding the pace of my progress towards completion of my degree. I would also like to acknowledge the University of Michigan for partial funding of this project; particularly Mary A. M.

Rogers for the organization of, access to patient data, and original idea for this study, and Duane W.

Newton, for clinical samples from the University of Michigan Hospital and for answers to countless e- mails about clinical diagnostics.

There are too many people to name that have helped me through my long career at BGSU so I will only name a few: special thanks to the original members of the Rogers’ lab that helped me with everything from calculations to sterile technique to PCR, including Tom D’Elia, Ram Veerapaneni, Gang

Zhang, Armeria Vicol, Shin, and Chia-Jui Tsai; support staff such as Linda Treeger, Chris Hess, Steve

Queen and Lorraine; micro guru Sheila Kratzner and Dr. Don Deters for help and guidance with teaching

Bio 313, which influenced my belief in the importance of this research. There are three women I must thank in particular without whose support I would never have finished: Lorena Harris-Palacios, Zeynep

Kocer and Irina Shilova. All are good friends, BGSU PhD graduates, and role models for women in science everywhere. Lastly, I must thank my family for believing in me, even when I didn’t. vi

TABLE OF CONTENTS

Page

CHAPTER 1. INTRODUCTION ...... 1

1.1 What are fungi? Classification in the tree of ...... 1

1.1.2 Fungal phylogeny ...... 3

1.1.3 Cryptomycota ...... 12

1.2 History of fungi as pathogens ...... 13

1.2.1 Pathogenicity: Pre-, co- and potential virulence factors . 13

1.2.2 Thermally dimorphic fungi ...... 16

1.2.3 Increases in the number of immunocompromised patients and

opportunistic fungi ...... 16

1.3 Rationale for this dissertation ...... 19

1.4 Objectives ...... 19

1.5 Literature cited ...... 20

CHAPTER 2. MATERIALS AND METHODS ...... 34

2.1 Clinical diagnosis of fungal infections...... 34

2.1.1 Phenotypic identification ...... 34

2.1.2 Molecular identification of fungi ...... 39

2.1.3 Antifungal resistance ...... 39

2.2 Sample collection, transportation and information ...... 42

2.2.1 Sample collection and transportation ...... 42

2.2.2 Sample and patient information ...... 42

2.3 CTAB DNA extraction ...... 45

2.4 PCR targeting internal transcribed spacers (ITS) 1and 2 in ribosomal DNA (rDNA) .. 46

2.5 PCR purification, gel extracts and cloning ...... 48

2.6 BLASTn searches using NCBI database ...... 50 vii

2.7 Phylogenetic analysis ...... 50

2.8 Literature cited ...... 51

CHAPTER 3. RESULTS AND DISCUSSION ...... 61

3.1 Detection of fungal DNA in whole blood and respiratory samples and phylogenetic

analysis of organisms found ...... 61

3.1.1 BLASTn identification and patient information ...... 61

3.1.2 Phylogenetic analysis ...... 64

3.1.3 Clinical review of organisms found ...... 68

3.1.3.1 Dematiaceous fungi ...... 68

3.1.3.2 Hyaline and species ...... 70

3.2 Discussion ...... 74

3.2.1 Patient variables ...... 74

3.2.2 Environmental variables ...... 77

3.2.3 Clinical applications ...... 78

3.2.4 The era of genomics ...... 79

3.3 Conclusions ...... 80

3.4 Literature cited ...... 82

APPENDIX A. USEFUL FUNGAL DATABASES ...... 100

APPENDIX B. BOWLING GREEN STATE UNIVERSITY HUMAN SUBJECT REVIEW

BOARD APPROVAL ...... 101

APPENDIX C. COMPLETE PATIENT INFORMATION ...... 102

APPENDIX D. REFERENCE SEQUENCES ...... 107

APPENDIX E. SEQUENCES FROM THIS STUDY ...... 117 viii

LIST OF FIGURES

Figure Page

1.1 Painting of what may have looked like during the early period ...... 2

1.2 Examples of different fungal morphologies. Adopted from Cavalier-Smith, 2001 ...... 2

1.3 Ernst Haeckel’s 1866 geneological tree with three Kingdoms: Plantae,

Protista and Animalia ...... 4

1.4 Adaptation of Whittaker’s 1969 Five- phylogeny based on modes of nutrition... 6

1.5 Fungal phylogeny adapted from Hibbet, et al. 2007 ...... 7

1.6 The bracket Irpex lacteus ...... 18

2.1 Schematic representation of rDNA and internal transcribed spacer (ITS) regions and

panfungal primers ...... 47

3.1 Neighbor-Joining tree utilizing ITS1 sequences for patients 612 (BAL), 614 (sputum), and

802 (sputum) ...... 65

3.2 Neighbor-Joining tree utilizing ITS 2 sequences for patients 235 (blood),

406 (blood), 533 (sputum), 534 (sputum), and 611 (BAL) ...... 66

3.3 Neighbor-Joining tree utilizing ITS 1 and ITS 2 sequences for patients 223 (blood),

527 (BAL), 626 (sputum), and 632 (a,b) (sputum) ...... 67 ix

LIST OF TABLES

Table Page

1.1 Selected ‘dual use’ virulence factors in neoformans ...... 14

2.1 EORTC/MSG Criteria for proven invasive fungal disease except for endemic mycoses .... 35

2.2 EORTC/MSG Criteria for probable invasive fungal disease except for endemic mycoses. 36

2.3 EORTC/MSG Criteria for the diagnosis of endemic mycoses ...... 38

2.4 Hospital locations samples were collected...... 44

2.5 Panfungal ITS primers used ...... 47

2.6 NCBI reference organisms used for phylogenetic analysis ...... 51

3.1 Summary of patient information, L.O.S., organisms found and sample type ...... 62

3.2 Average patient L.O.S. (t-test) ...... 63

3.3 Frequency of patients in ICU (Fisher’s exact chi-square) ...... 63

3.4 Frequency of male and female patients (Fisher’s exact chi-square) ...... 63

3.5 Average patient age (t-test) ...... 63 1

CHAPTER 1. INTRODUCTION

1.1 What are fungi? Classification in the tree of life

Four-hundred million ago, during the early Devonian period, fungi ruled the world.

Prototaxites, a pillar-like fungus three feet wide and more than twenty-five feet tall, was the largest organism on land (Boyce et al., 2007; Kesseler, 2007; Zax, 2007) (Figure 1.1). At the same time, non- vascularized (, liverworts and ), some of the earliest to colonize land, grew to a height of only three feet tall. Primitive (four-legged vertebrates) and wingless also crawled the land.

In August, 2000, in the Malheur National Forest in Oregon, an organism 2400 years old, covering 2200 acres and approximately 3.5 miles across was discovered. It was Armillaria solidipes

(formerly Armillaria ostoyae), also known as the honey (Cheater, 2001). This mycelial mat, mostly 3 feet underground, had been efficiently recycling litter for more than 2000 years. Before this discovery the largest known organism on was the same species, spanning 1500 acres in

Washington State (Smith et al., 1992).

What are fungi and what are some of the general characteristics that separate them from other organisms? 1) They are with membrane bound nuclei (uni-bi-or-multinucleate, homo or heterokaryotic, haploid, diploid or dikaryotic), 2) They have non-discoid plate-like mitochondrial cristae,

3) They use glycogen as a storage carbohydrate, 4) They are unicellular or multicellular, forming net-like mycelia, single-celled , sclerotia and other forms (Figure 1.2), 5) They have chitinous cell walls, 6)

They feed by osmotrophy (the extracellular digestion and uptake of nutrients by osmosis), 7) They reproduce sexually, asexually, or parasexually , 8) They exist as mutualists, saprotrophs and/or parasites,

9) They are ubiquitous, and 10) They use the alpha-aminoadipic acid lysine biosynthesis pathway

(Webster, 2007; Cavalier-Smith, 1987; Cornell et al., 2007; Griffin, 1994). It is obviously not easy to 2

Figure 1.1 Painting of what Prototaxites may have looked like during the early Devonian period.

Painting by Mary Parrish, from the Museum of Natural History.

Figure 1.2 Examples of different fungal morphologies. Adopted from Cavalier-Smith, 2001.

3

provide a succinct description of organisms best known for their production of alcohol, spoilage of

foods.and as additions to grocery shopping lists.

The typical fungal is between 30 and 40 Mb (million base pairs) (Stajich, 2009),

although they range from less than 3 Mb (Akiyoshi, et al.) to over 790 Mb (Hijri and Sanders, 2005). In

comparison, the human genome is approximately 3.2 Gbp (billion base pairs), the fruit fly (Drosophila

melanogaster) genome is 130 Mb, and Arabidopsis thaliana, a model plant in molecular genetics, is 157

Mb. Compared to other eukaryotic organisms, their are (on average) relatively small, but the

diversity of their lifestyles, metabolic pathways, and reproductive modes make them a complex Kingdom

of life to understand.

How old are fungi? A brief summary of the planet and origins of life can give us a better estimate

of their ancient lineage. The planet was formed approximately 4.5 billion years ago (bya), there was water

on the planet 4.4 bya, eubacteria and archaebacteria diverged 3.0 to 3.5 bya, an oxidation event that

increased oxygen in the atmosphere occurred about 2.7 bya, mitochondria appeared 2.2 to 2.4 bya,

eukaryotes appeared 2.4 bya, appeared 1.9 bya, fungi appeared 1.3 to 1.5 bya, and

appeared 700 million years ago (Rogers, 2012; Hedges 2004). In contrast, Homo sapiens, or modern

humans, appeared 200,000 years ago (McDougall et al., 2005).

1.1.2 Fungal phylogeny

In 1866, the German biologist Ernst Haeckel created the term “phylogeny” in his book Generelle

Morphologie der Organismen, a treatise based on Darwin’s concept of geneology. He categorized organisms into plants, or animals based on the concept of the “tree of life.” Fungi were generally considered members of the plant Kingdom based on the observations that they grew in soil and were non- motile (Figure 1.3).

According to modern molecular analysis, fungi are generally accepted as the closest sister-group to animals (Baldauf, 1993) with both arising from single-celled flagellated protists (Steenkamp, 2005)

4

Figure 1.3 Ernst Haeckel’s 1866 geneological tree with three Kingdoms: Plantae,

Protista and Animalia. Fungi are included in Kingdom Plantae under Jnophyta. 5

although Whittaker’s 5-kingdom classification system in 1969 was the first that grouped fungi into their

own Kingdom separate from those of plants and protists (Whittaker, 1969) (Figure 1.4). In 1987,

Cavalier-Smith described a super-group called the Opisthokonta, (this includes fungi as well as animals) eukaryotic organisms characterized by the presence of posteriorly uniflagellated cells arising from sporangia often inhabiting aquatic environments (Cavalier-Smith, 1987). Spermatozoa in animals and of fungal chytrids are examples of cell types that separate this group from organisms with anterior or biflagellated cells. Coupled with sister Mycetozoa (slime molds) and (lobose amoeba), the three form the super-group Unikonta (Cavalier-Smith, 2002).

For the past 20 years, scientists have estimated that there are approximately 1.5 million fungal

species (Hawksworth, 1991, 2001) based on mathematical ratios of fungal to plant species in specific and

limited geographic areas. In 2011, Meredith Blackwell surmised that there may be up to 5 million species

of fungi on the planet (based on a 2005 paper by O’Brien) after inclusion of previously unsampled

habitats such as both tropics and polar regions, newly discovered species associated with insects and the

inclusion of molecular methods of detection for species recognition without culture (Blackwell, 2011). A

2011 paper by Hibbett and colleagues calculates that, based on the average of 1200 new fungal species

described each , it would take 1170 years to complete a fungal inventory based on Hawksworth’s

estimates and 2800-4100 years based on O’Brien’s (Hibbet et al., 2011).

Although there are continued debates amongst taxonomists about fungal classifications, seven

phyla are currently accepted as included within the “true fungi” based on a 2007 sixty-six author paper:

the , , Neocallimastigiomycota, , ,

Ascomycota and (Hibbett et al., 2007) (Figure 1.5). The Microsporidians are a recent addition to the fungal kingdom, after much debate about whether they were fungi (Fisher et al., 2005), a sister group to fungi (Liu, 2006), or protozoans (Asmuth et al., 1994). They are obligate intracellular parasites of animals with severely reduced genomes that penetrate host cells using polar tubes. They forcibly inject their protoplast into the host cell and make contact sans cell walls, interacting with the host 6

Figure 1.4 Adaptation of Whittaker’s 1969 Five-Kingdom phylogeny based on modes of nutrition (adopted from http://evolution- textbook.org/content/free/figures/o5_EVOW_Art/15_EVOW_CH05.jpg). 7

ROZELLA

MICROSPORIDIA

- - - -

-

- ENTOMOPHTHOROMYCOTINA

-Blastocladiales BLASTOCLADIOMYCOTA

-

-

-Neocallimastigales

-Monoblepharidales CHYTRIDIOMYCOTA

-Chytridiales

- GLOMEROMYCOTA

-

ASCOMYCOTA

BASIDIOMYCOTA

Figure 1.5 Fungal phylogeny adapted from Hibbet et al., 2007. Classic phyla are shown in bold.

Subphyla are shown in regular type. Branch lengths are not proportional to evolutionary distance.

Dashed lines represent uncertain classification of Rozella species. 8

via their plasma membrane. Lacking mitochondria, centrioles, obvious 5.8S rRNA and with reduced proteomes they have been studied intensively by both parasitologists and evolutionary biologists due to their similarities to protozoa and their rapid genomic sequence evolution (Akiyoshi, 2009). The latter has delayed the final placement of Microsporidians into Fungi until very recently. They are becoming increasingly common as human pathogens in immunocompromised (and sometimes immunocompetent) patients, and are working their way as almost unstoppable pathogens through fisheries and honeybee colonies (believed to be involved in the recent honeybee colony collapse disasters), but are difficult to study because presently they cannot be cultured (Williams, 2009). Taxonomically they are the least ordered, having no as of yet agreed upon divisions of or .

Prior to the inclusion of Microsporidia as a distinct within the Eumycota, the

Chytridiomycota were generally described as the earliest diverging fungal and are characterized by life cycles including uniflagellated zoospores that enable them to live in aquatic environments. Some have cell walls containing both cellulose and , a trait they share with some , although most have components characteristic of other true fungi. Scientists surmise that these unicellular, flagellated fungi would be the most advantageous in early evolutionary history that places the origins of life in aquatic environments. Later colonization of land by plants and fungi may have allowed a transition to growth and cellular patterns that allowed attachment to substrate and growth on land. Phylum

Chytridiomycota is taxonomically divided into two classes, the and

Monoblepharidomycetes. The class Chytridiomycetes contains three orders: Chytridiales, Rhizophydiales, and Spizellomycetales. Batrachochytrium dendrobatidis, the only member of Rhizophydiales, is the species identified as being responsible for the global decline in amphibian species with mortality rates reported up to 100% in some species (Rosenblum, 2010). Class contains only one order, Monoblepharidales. None of the Chytridiomycota have been identified as agents of human disease. 9

Phylum Neocallimastigomycota is home to the anaerobes found in the digestive tract of herbivores. It contains only one class, Neocallimastigomycetes, and one order, Neocallimastigales.

Formerly included in the Chytridiomycota, they also have flagellated zoospores and lack mitochondria, but possess organelles called hydrogenosomes (reduced mitochondria) that serve in ATP production.

Phylum Blastocladiomycota also contains only one class, Blastocladiomycetes, and one order,

Blastocladiales. They are facultative anaerobes and generally saprotrophs. They were also formerly included in the Chytridomycota, but based on several characteristics, such as sporic instead of zygotic , have been separated from the Euchytrids (James, 2006).

The next phylum (Glomeromycota), and 4 subphyla (Mucormycotina, Entomophthoromycotina,

Zoopagomycotina, and Kickxellomycotina), were previously grouped under the phylum which has since been disbanded due to analyses demonstrating polyphyletic origins, although in clinical settings the term is still used (White, 2006; Liu, 2009). They are generally described as the non- flagellated basal fungi with wide aseptate hyphae. Phylum Glomeromycota contains the obligately symbiotic vesicular-arbuscular mycorrhizae, arguably the most important fungi in botany and agriculture as they form mutualistic associations with approximately 80% of most known plants (Schüßler et al.,

2001). They are also the fungi believed to be involved in facilitating the early colonization of land by plants (Heckman, 2001). Four-hundred and sixty million year old fossilized glomealean fungi have been reported from the dolomite of Wisconsin suggesting that they were present before vascular plants appeared (Redecker, 2000). The phylum contains only one class, Glomeromycetes, which contains the orders Archaeosporales, Diversisporales, , and Paraglomeralis (). The

Glomeromycota are believed to be the closest relatives to the Ascomycetes and Basidiomycetes and have never been identified as causing human infection.

The Mucormycotina contains the orders Mucorales, Endogenales, and .

The first two are generally saprotrophs, and the third contains facultative ectomycorrhizae. Many of the 10

species responsible for what is still termed clinical are found within the Mucorales, largely

contained in the and genera.

Entomophthoromycotina contains the order Entomophthorales most widely known as

pathogens, although there have been a few members of this subphylum that have been known to infect

humans, most notably from the genera and Basidiobolus (Galgoczy, 2005; Wuppenhorst,

2010). Rhinocerebral zygomycosis, caused by members of both Mucormycotina and

Entomophthoromycotina occurs most frequently with people suffering from diabetic ketoacidosis, as well

as people with .

The Zoopagomycotina contain the Zoopagales, endo- and ectoparasites of small animals and

fungi (Hibbett, 2007). The genera Piptocephalis and Syncephalis are the most notable mycoparasites,

capable of infecting members of the Mucorales and Ascomycota (Webster, 2007).

The Kickxellomycotina contains the orders Kickxellales, Dimargaritales (saprotrophs and mycoparasites), Harpellales and Asellariales (insect commensals or pathogens). The last four orders have formerly been known as the trichomycetes (Weber, 2010).

The phyla listed above constitute less than 3% of known fungi (Stajich, 2009), with the remainder categorized in the subkingdom , so named because during mating nuclear fusion does not immediately occur resulting in hyphae containing separate nuclei from both parents. The nuclei progress through haploid separately, followed by cytokinesis, to produce long filaments consisting of dikaryotic cells. This subkingdom encompasses the Ascomycetes and Basidiomycetes, the former being the largest phylum in the fungal kingdom and the latter being the second largest. For this reason, only a brief review will be presented of the relevant subphyla, classes, and organisms for each.

The Ascomycetes account for over 60% of known fungi (Stajich, 2009) and can be broken down into three subphyla: the Taphrinomycota (Archiascomycetes), the (Hemiascomycetes), and the (Euascomycetes). These are the archetypal yeasts and molds that play roles in every ecosystem as saprotrophs, mutualists, and pathogens. 11

The are believed to be the oldest clade amongst the ascomycetes and contain both yeasts and filamentous fungi. It contains the biotrophic plant genera Taphrina and

Protomyces, the fission Scizosaccharomyces, and the pathogenic Pneumocystis species. As human pathogens the Pneumocystis clade is the most important, as causative agents of Pneumocystic in people with AIDs (autoimmune deficiency syndrome, or HIV infections) and other immunodeficiencies. They live as both cyst-like and trophic cells in mammalian lungs similar to some of the life stages of protozoan pathogens; this caused them to be misclassified until rRNA analysis in 1988 placed them solidly in the fungal Kingdom (Edman et al., 1988). Instead of the stereotypical ergosterol that is commonly found in fungal membranes, they have cholesterol, which makes them resistant to treatment with . Another oddity is that instead of having between 50-150 copies of tandem rRNA gene operons like most haploid fungi, they contain only two.

The Saccharomycotina subphylum encompasses only one order, the which contains the industrial and common yeasts, including the most well known genera, and

Candida. Saccharomyces could arguably be called one of the most economically important fungi in food biology, being responsible for beer brewing, wine production, and bread making. It was also the first eukaryotic to have its complete genome sequenced and published in 1996, providing a basis for the study of eukaryotic genomics (Goffeau et al., 1996). Interestingly, there is a phylogenetic split amongst the Candida species which places C. glabrata evolutionarily closer to than to (Herrero, 2005; Dujon, 2005).

Candida albicans is the most recognizable species in the Candida clade. One of the few pathogenic dimorphic fungi not found in the Plectomycetes of the Pezizomycotina, it is capable of growth as a yeast, hyphae, or pseudo-hyphae with several methods of reproduction such as budding, forming or arthrospores. It is a normal commensal in the gastrointestinal and respiratory tracts of humans. 12

The Pezizomycotina is the largest of all the subphyla containing filamentous fungi.With nine

classes, eleven subclasses, and over fifty orders according to Hibbet’s 2007 , it contains:

Neurospora crassa, the bread () that was the organism used to demonstrate the one-gene-one-

enzyme hypothesis (which turns out not to be true any longer) in molecular biology; Geomyces

destructans, the fungus responsible for bat white nose syndrome that has killed more than one-million

domestic bats in the United States (Blehert, 2011), and fumigatus, one of the species most

widely involved in invasive fungal infections in immunocompromised patients. The most important

organisms in medical can be found clustered in the class and order

Onygenales, dimorphic pathogens that can infect otherwise healthy people. These infections often are

difficult to treat because of the close evolutionary relationship between fungi and animals. Drugs

developed to kill fungal cells also have toxic effects on cells.

The Basidiomycota comprise the remaining 30-plus percent of fungi, containing the subphyla

Pucciniomycotina, Ustilagomycotina, and . Most Puccinomycotina are obligate plant

parasites commonly known as “rusts” and Ustilagomycotina, also known as “smuts”, are parasitic on

grasses and sedges (Stajich, 2009). The Agaricomycotina is home to the popularly known and

bracket fungi, serving as food sources and wood decomposers, respectively. Many also are vital to many

plant species, forming mycorrhizal associations with the plant roots. Surprisingly, this subphylum is also

home to the highly pathogenic and dangerous Cryptococcus species.

1.1.3 Cryptomycota

A 2011 paper by Jones and colleagues proposes the term “cryptomycota” for Rozella species, fungi that acquire cell walls from their hosts and don’t conform to the biochemical definition of fungi as containing chitin (Jones et al., 2011). Most closely related to chytrids, some scientists place them as the earliest diverging fungi alongside the microsporidia, promising more debate about molecular taxonomy and phylogeny in the near future. 13

1.2 History of fungi as pathogens

1.2.1. Pathogenicity: Pre-adaptation, co-evolution and potential virulence factors

Fungi are predicted to be the second most speciose on Earth (Mora et al., 2011) and according to the estimated number of fungal species that exist only a few hundred have been implicated in human disease (Kwong-Chung and Bennett, 1992). Alternatively, 270,000 are estimated to be pathogenic to plants and approximately 50,000 species are pathogenic to insects (Hawksworth and Rossman, 1997).

There are several factors shared throughout the fungal Kingdom that may be involved in pathogenic potential. A 2001 review on aspects of fungal pathogenesis in humans lists growth at elevated temperatures (thermotolerance), adherence, penetration and dissemination factors, nutritional and metabolic factors, necrotic factors and morphology (phenotypic and antigenic switching) as factors that are absolutely required for fungal virulence (Van Burik and Magee, 2001). Multiple evolutionary events have enabled fungi to adapt to diverse lifestyles including as “true” pathogens, commensals and obligate parasites.

As soil-dwelling organisms, fungi are constantly exposed to environmental predators including a myriad of , amoebae (protozoans) and . Using as a model organism, Casadevall and colleagues have proposed the terms “ready-made” virulence and “dual purpose” virulence in describing virulence factors that arise in response to environmental stress. Defenses against phagocytosis by amoebae may have naturally increased the virulence traits of free-living organisms that do not rely on the host for reproduction or nutrition. Fungal infections of mammalian species are often first initiated in the lungs, where phagocytic macrophages engulf the fungi in a manner similar to environmental predators (Casadevall, et al., 2003). Macrophage lysis, phagosomal extrusion, and host cell to cell transfer have all been documented as strategies to avoid and counteract host immune defenses as result of pre-adaptation due to environmental stressors (Alvarez and Casadevall, 2007) (Table

1.1 ).

14

Table 1.1 Selected‘dual use’ virulence factors in Cryptococcus neoformans (adapted from

Casadevall et al., 2003).

Attribute In the environment In pathogenesis

Capsule Prevents desiccation (Aksenov et al., Antiphagocytic (Kozel et al., 1988)

1973) Immunomodulator (Vecchiarelli, 2000)

Protection against amoeba

(Steenbergen et al., 2001)

Laccase Lignin degradation (Lazera et al., Interference with oxidative burst (Liu et al.,

1996) 1999)

Melanin Ultraviolet shielding (Wang and Antiphagocytic (Wang et al., 1995)

Casadevall, 1994) Resistance to oxidative killing (Wang et al.,

Heat and cold tolerance (Rosas and 1995)

Casadevall, 1997) Anti-fungal drug resistance (van Duin and

Protection against heavy metals Casadevall, 2002)

(Garcia-Rivera and Casadevall, 2001)

Phenotypic switching Generation of strain diversity? Immune evasion (Fries et al., 2001,

Goldman et al., 1998)

Proteases Nutritional function (Chen et al., 1996) Tissue damage (Chen and Casadevall, 1999)

Mating type (Wickes, 2002) regulation (Wickes, 2002)

Urease Nitrogen scavenging (Cox, et al., 2000) Intracellular growth (Cox et al., 2003) 15

In contrast, commensal and fungal species are under selective pressures directly related to the host, which they need for nutrition, transmission, and reproduction. Candida albicans is a human commensal that responds to different selective pressures based on which part of the body it inhabits (Romani et al., 2003) and has a long history as a mammalian commensal. Sequence analysis based on nucleotide frequencies dates the relationship as far back as 3-16 million years ago (Lott et al., 2005). A major distinction between Candida albicans and other pathogenic fungi is that it is rarely found in soil, although Hube (2004) mentions that this is surprising since it has no metabolic requirements that make it dependent on the host. Unlike the pre-adapted fungi, it is dependent on the host for transmission and can be spread through physical contact.

Pneumocystis jirovecii (formerly carinii) was first mistakenly identified as a protozoan in 1909

(Chagas, 1909) and purportedly caused pneumonic epidemics in European orphanages after World War II

(Calderóne-Sandubete et al., 2002). Once primarily discussed as a singular species (P. carinii) primarily in reference to human infection, recent studies have shown host-specificity in mammals. The identification of stenoxenous organisms, parasites having a narrow range of potential hosts, has led to the development of research on co-phylogeny (the study of evolutionary relationships between ecologically related organisms where the host phylogeny is independent and the other phylogeny is dependent)

(Aliouat-Denis et al., 2008; Chabé et al., 2011). One study has shown detection of Pneumocystis in newborn-mice as young as one hour old, which indicates the possibility of vertical transmission and contagion from other hosts and not from the environment. Two items of particular interest regarding co- evolution with Pneumocystis and humans are the possibility that Pneumocystis species must scavenge amino acids from the lungs of hosts due to a lack of enzymes necessary for their synthesis (Hauser et al.,

2010) and another study notes that they lack known virulence factors (Cissé et al., 2013).

Overall, the reduced genomes of Pneumocystis species, their non-cultivability outside the host, the presence of cholesterol in cell walls, and the lack of an identified external reservoir similar to Candida 16

species strongly suggests that Pneumocystis species are obligate parasites that have co-evolved with mammalian hosts.

1.2.2 Thermally dimorphic fungi

Fungi were identified as early as the 1800’s as potential pathogens when Augustino Bossi discovered a mold causing silkworm disease in 1835, and further discoveries in 1837, 1842 and 1847 revealed fungi as being pathogenic to humans (Chakrabarti, 2005). Historically, the trends in species causing fungal infections have been the dimorphic fungi: capsulatum, Paracoccidioides brasiliensis, Penecillium marnefii, Sporothrix schenkii, , and immitis. These organisms exist as non-pathogenic mycelia in soil but convert to pathogenic yeasts once inhaled by a mammalian host (except Coccidioides which turns into a yeast-like spherule) (Klein, 2007).

These fungi are encountered in the environment with contact being incidental and the initial site of infection being the lungs. Many of them are endemic to specific geographic locations and can infect immunocompetent individuals. For example, P. brasiliensis is endemic to South America, P. marnefii is found in Southeast Asia, and Coccidioides is found in the American Southwest and Northern Mexico. It has also been shown that these pathogens can remain latent in hosts for decades and emerge when immune defenses become compromised (D’Enfert, 2009).

1.2.3 Increases in the numbers of immunocompromised patients and opportunistic fungi

Both innate and adaptive immunity are involved in host defenses against fungi, from complement proteins to pathogen specific antibodies. The complex interactions between the two systems normally provide adequate protection from the fungi encountered every day. With an arsenal of physical barriers such as skin and mucosal surfaces, molecules with pattern recognition receptors (PRRs) that bind pathogen associated molecular patterns (PAMPs) and induce effector responses, phagocytic cells, organs that clear immune complexes; defects in any of these natural defenses can allow commensals, environmental saprophytes and latent organisms the opportunity to cause disease ranging from superficial 17

infection by , such as occurs in athlete’s foot and ringworm, to life-threatening systemic

infection.

Eighty years after Bossi’s discovery of silkworm disease, medical communities saw opportunistic

fungal pathogens begin to flourish, or more accurately, immune systems fail to respond to fungal

challenge. In the 1960’s, complications arose because of medical advances and treatments that increased

the numbers of imunocompromised patients. The emergence of normally non-pathogenic fungi and

commensals as causative agents of disease became a serious concern with advances in transplant

surgeries, immunosuppressive therapies, increasing numbers of patients with underlying primary disease

such as hematological malignancies and cancer, and especially with the emergence of AIDS. The

development of oropharyngeal (thrush), pneumocystic pneumonia, and

coccidiomycosis even became diagnostic indicators of immunosuppression in people with AIDS (Ampel,

1996; Smart, 1998; Richardson, 1991). An analysis of National Center for Health Statistics multiple-

cause-of- records from the period 1980-1997 reported that multiple-cause mortality due to invasive

mycoses increased over 300% and that mortality from invasive (IA) increased over 350%

(McNeil, 2001).

Invasive aspergillosis (IA) and (IC) are the most frequently encountered

opportunistic fungal systemic in people with impaired immunity. IA occurs most frequently in

people with haematological malignancies and transplants (BMT) whereas IC appears often

in intensive care units (ICU), solid- transplant recipients, BMT populations, those receiving prolonged parenteral nutrition and other patient subpopulations (Pfaller, 2006). They are also the two most frequent fungi involved in nosocomial fungal infections with only minimal immune suppression required for IC but moderate to severe suppression required for IA (Perlroth, 2007). Aspergillus fumigatus and Candida albicans are the species that historically have been the etiological agents of IA and IC, but new opportunists are emerging from related species (Pfaller, 2004). 18

Non-Aspergillus fungal infections in organ transplant patients are on the rise, with other opportunists including hyalohyphomycetes such as Scedosporium species and phaeohyphomycetes including Cladosporium displaying more dissemination and poorer outcomes (Husain, 2003). A 2006 outbreak of keratitis in users of a Bausch and Lomb contact lens solution resulted in world- wide recall of the product and several cases of disease requiring corneal transplants were reported (Chang,

2006). Every year documented cases of new emerging fungal pathogens are published in the medical literature, from unusual agents such as Irpex lacteus, a bracket mushroom (Figure 1.6) (Buzina, 2005) to

Kodamaea ohmeri, a teleomorph of Candida guilliermondii var. membranaefaciens used in in the food industry (Shaaban et al., 2010) . A 2008 estimate in the Bulletin of the Atomic Scientists states that 10 million people, or 3.6% of the population, are immunocompromised in the United States (Kahn, 2008) promising that more opportunists are likely to emerge.

Figure 1.6 The bracket fungus Irpex lacteus (Kuo, 2007). 19

1.3 Rationale for this dissertation

The increases in opportunistic fungal infections due to advances in invasive medical procedures

and immunosuppressive therapies and exponential increases in immunocompromised populations have

led to the need to accurately identify fungal pathogens as quickly and specifically as possible. Patient

morbidity and mortality statistics show that delays in diagnosis and appropriate treatment contribute

significantly to poor prognosis. Heterogeneous populations at risk predispose subsets of patients to

infections with specific pathogens that show different susceptibilities to antifungal chemotherapeutics.

Prophylactic usage of antimycotic medicines has contributed to the emergence of new and unusual

opportunistic pathogens that have become more difficult to identify using traditional clinical testing based

on microscopic examination of morphology and reproductive structures.

The addition of basic molecular techniques based on DNA extraction, PCR amplification and

sequencing of multicopy rDNA internal transcribed spacer regions can provide essential improvements to

laboratory identification of uncommon and emerging fungal pathogens. This study can contribute to

analysis of the “culture negative phenomena” that produces false-negatives based on culture in the elusive

search for fungal pathogens.

1.4 Objectives

The present study retrospectively re-tested blood and respiratory samples that were reported to be culture-negative for bacterial and fungal pathogens in a clinical laboratory. The specific objectives were as follows:

• To utilize the cetyltrimethylammonium bromide (CTAB) DNA extraction technique developed

by S. O. Rogers and colleagues (1994, 1989, 1985) to extract high-quality DNA without

excessive pre-lysis steps that increase possibilities for contamination,

• to use polymerase chain reaction (PCR) nucleic acid amplification targeting multi-copy

ribosomal DNA (rDNA) internal transcribed spacer regions (ITS) using panfungal ITS primers, 20

• to sequence and compare positive amplicons to the National Center for Biotechnology

Information (NCBI) nucleic acid database for identification of fungi to a species level,

• to compare PCR-positive and culture-negative samples to patient information such as age, length

of stay, and gender to identify possible correlations between potential fungal pathogens and

subsets of heterogeneous, randomized patient populations,

• to perform multiple sequence analysis (MSA) using MAFFT version 5.7 (Katoh, et al., 2005)

and phylogenetic analysis using the MEGA version 5 software (Tamura et al., 2011) to infer

evolutionary relationships between fungal species found.

1.5 Literature cited

Akiyoshi, D. E., Morrison, H. G., Lei, S., Feng, X., Zhang, Q., Corradi, N., Mayanja, H., Tumwine, J. K.,

Keeling, P. J., Weiss, L. M. and S. Tzipori.(2009). Genomic survey of the non-cultivatable opportunistic

human pathogen, Enterocytozoon beineusi. PLoS Pathog. 5(1): e1000261.

Doi:10.1371/journal.ppat.1000261.

Aliouat-Denis, C. M., Chabé, M., Demanche, C., Aliouat, E. M., Viscogliosi, E., Guillot, J., Delhaes, L.

and E. Dei-Cas. (2008). Pneumocystis species, co-evolution and pathogenic power. Infect. Genet. Evol. 8:

708-726.

Alvarez, M. and A. Casadevall. (2007). Cell-to-cell spread and massive vacuole formation after

Cryptococcus neoformans infection of murine macrophages. BMC Immunol. 8:16 doi:10.1186/1471-

2172-8-16.

Ampel, N. M. (1996). Emerging disease issues and fungal pathogens associated with HIV infection.

Emerg. Infect. Dis. 2: 109-115.

21

Asmuth, D. M., DeGirolami, P. C., Federman, M., Ezratty, C. R., Pleskow, D. K., Desai, G. and C. A.

Wanke. (1994). Clinical features of microsporidosis in patients with AIDS. Clin. Infect. Dis. 18: 819-825.

Baldauf, S. L. and J. D. Palmer. (1993). Animals and fungi are each other’s closest relatives: congruent evidence from multiple proteins. Proc. Natl. Acad. Sci. 90: 11558-11562.

Blackwell, M. (2011). The Fungi: 1, 2, 3 … 5.1 million species? Am. J. Bot. 98: 426-438.

Blackwell, M. (2000). Terrestrial life—fungal from the start? Science. 15: 1884-1885.

Blehert, D. S., Lorch, L. M., Ballman, A. E., Cryan, P. M. and C. U. Meteyer. (2011). Bat White-Nose

Syndrome in North America. Microbe. 6: 267-273.

Boyce, C. K., Hotton, C. L., Fogel, M. L., Cody, G. D., Hazen, R. M. and A. H. Knoll. (2007). Devonian landscape heterogeneity recorded by a giant fungus. Geology. 35: 399-402.

Buzina, W., Lass-Flörl, C., Kropshofer, G., Freund, M. C. and E. Marth. (2005). The polypore mushroom

Irpex lacteus, a new causative agent of fungal infections. J. Clin. Microbiol. 43: 2009-2011.

Calderóne-Sandubete, E. J., Varela-Aguilar, J. M., Medrano-Ortega, F. J., Nieto-Guerrer, V.,

Respaldizasalas, N., de la Horra-Padilla, C. and E. Dei-Cas. (2002). Historical perspective on

Pneumocystis carinii infection. . 153: 303-310.

22

Casadevall, A., Steenbergen, J. N. and J. D. Nosanchuk. (2003). ‘Ready made’ virulence and ‘dual use’

virulence factors in pathogenic environmental fungi- the Cryptococcus neoformans paradigm. Curr. Opin.

Microbiol. 6: 332-337.

Cavalier-Smith, T. (1987). “The origin of fungi and pseudofungi.” In Alan D. M. Rayner (ed.)

Evolutionary Biology of Fungi, Cambridge University Press, Cambridge. 339-353.

Cavalier-Smith, T. (1998). A revised six-kingdom system of life. Biol. Rev. 73: 203-266.

Cavalier-Smith, T. (2001). “What are fungi?” In McLaughlin, D. J., McLaughlin, E. G. and P. A. Lemke

(eds.) The Mycota VII Part A: and Evolution. Springer-Verlag, Berlin, Heidelberg, New

York. 3-37.

Cavalier-Smith, T. (2002). The phagotrophic origin of eukaryotes and phylogenetic classification of

Protozoa. Int. J. Syst. Evol. Biol. 52: 297-354.

Chabé, M., Aliout-Denis, C. M., Delhaes, L., Aliouat, E. M., Viscogliosi, E. and E. Dei-Cas. (2011).

Pneumocystis: from a doubtful unique entity to a group of highly diversified fungal species. FEMS Yeast

Res. 11: 2-17.

Chagas, C. (1909). Nova tripanozomiazaea humana. Mem. I Oswaldo Crua. 1: 159-218.

Chakrabarti, A. and M. R. Shivaprakash. Microbiology of systemic fungal infections. (2005). J. Postgrad.

Med. 51: 16-20. 23

Cheater, M. (Dec.2000/ Jan. 2001). Biggest fungus found among us. Natl. Wild. 39: 8.

Chen, L.-C. and A. Casadevall. (1999). Variants of Cryptococcus neoformans strain elicit different inflammatory response in mice. Lab. Immunol. 6: 266-268.

Cissé, O. H., Pagni, M. and P. M. Hauser. (2013). De novo assembly of the genome from a single bronchoalveolar lavage fluid specimen from a patient. mBIO 4(1):e00428-12.

Doi:10.11.28/mBIO.00428-12.

Cornell, M. J., Alam, I., Soanes, D. M., Wong, H. M., Hedeler, C., Paton, N. W., Rattray, M., Hubbard, S.

J., Talbot, N. J. and S. G. Oliver. (2007). Comparative genome analysis across a kingdom of eukaryotic organisms: specialization and diversification in the Fungi. Genome Res. 17: 1809-1822.

Cox, G. M., Harrison, T. S., MaDade, H. C., Taborda, C. P., Heinrich, G., Casadevall, A. and J. R.

Perfect. (2003). Superoxide dismutase influences the virulence of Cryptococcus neoformans by affecting growth within macrophages. Infect. Immun. 71: 173-180.

D’Enfert, C. (2009). Hidden killers: persistence of opportunistic fungal pathogens in the human host.

Curr. Opin. Microbiol. 12: 358-364.

Dujon, B. (2005). Hemiascomycetous yeasts at the forefront of comparative genomics. Curr. Opin. Gen.

Dev. 15: 614-620.

Edman, J. C., Kovacs, J. A., Masur, H., Santi, D. V., Elwood, H. J. and M. L. Sogin. (1988). Ribosomal

RNA sequence shows Pneumocystis carinii to be a member of the fungi. . 334: 519-522. 24

Fisher, W. M. and J. D. Palmer. (2005). Evidence from small-subunit ribosomal RNA sequences for a

fungal origin of Microsporidia. Mol. Phylogenet. Evol. 36: 606-622.

Fries, B. C., Taborda, C. P., Serfass, E. and A. Casadevall. (2001). Phenotypic switching of Cryptococcus

neoformans occurs in vivo and influences the outcome of infection. J. Clin. Invest. 108: 1639-1648.

Galgóczy, L. (2005). Molecular characterization of opportunistic pathogenic zygomycetes. Acta Biol.

Szeg. 49: 1-7.

Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldman, H., Galibert, F., Hoheisel, J.

D., Jacq, C., Johnston, M., Louis, E. J., Mewes, H. W., Murakami, Y., Philippsen, P., Tettelin, H. and S.

G. Oliver. (1996). Life with 6000 genes. Science. 274: 546, 563-567.

Goldman, D. L., Fries, B. C., Franzot, S. P., Montella, L. and A. Casadevall. (1998). Phenotypic

switching in the human Cryptococcus neoformans is associated with changes in

virulence and pulmonary inflammatory response in rodents. Proc. Natl. Acad. Sci. USA. 95: 14967-

14972.

Griffin, D. H. (1994). Fungal Physiology (2nd Edition). Wiley-Liss, Inc. New York, New York.

Haeckel, E. (1866). Generelle Morpholgie der Organismen. Reimer, Berlin.

25

Hauser, P. M., Burdet, F. X., Cissé, O. H., Keller, L., Taffé, P., Sanglard, D. and M. Pagni. (2010).

Comparative genomics suggests that the fungal pathogen Pneumocystis is an obligate parasite scavenging

amino acids from its host’s lungs. PLoS ONE 5(12): e15152. doi:10.1371/journal.pone.0015152.

Hawksworth, D. L. (2001). The magnitude of fungal diversity: the 1.5 million species estimate revisited.

Mycol. Res. 105: 1422-1432.

Heckman, D. L., Geiser, D. M., Eidell, B. R., Stauffer, R. L., Kardos, N. L. and S. B. Hedges. (2001).

Molecular evidence for the early colonization of land by fungi and plants. Science. 293: 1129-1133.

Hedges, S. B., Blair, J. E., Venturi, M. L. and J. L. Shoe. (2004). A molecular timescale of eukaryotic

evolution and the rise of complex multicellular life. BMC Evol. Biol. 4:2.

http://www.biomedcentral.com/1471-2148/4/2.

Herrero, E. (2005). Evolutionary relationships between Saccharomyces cerevisiae and other fungal species as determined from genome comparisons. Rev. Iberoam. Micol. 22: 217-222.

Hibbett, D. S., Ohman, A., Glotzer, D., Nuhn, M., Kirk, P. and R. H. Nilsson. (2011). Progress in molecular and morphological taxon discovery in Fungi and options for formal classification of environmental sequences. Fungal Biol. Rev. 25: 38-47.

Hibbett, D. S., Binder, M., Bischoff, J. F., Blackwell, M., Cannon, P. F., Eriksson, O. E., Huhndorf, S.,

James, T., Kirk, P. M., Lücking, R., Limbsch, H. T., Lutzoni, F., Matheny, P. B., Mclaughlin, D. J.,

Powell, M. J., Redhead, S., Schoch, C. L., Spatafora, J. W., Stalpers, J. A., Vilgalys, R., Aime,, M. C.,

Aptroot, A., Bauer, R., Begerow, D., Benny, G. L., Castlebury, L. A., Crous, P. W., Dai, Y.-C., Gams, 26

W., Geiser, D. M., Griffith, G. W., Gueidan, C., Hawksworth, D. L., Hestmark, G., Hosaka, K., Humber,

R. A., Hyde, K. D., Ironside, J. E., Ko҃ ljalg, U., Jurtzman, C. P., Larsson, K. H., Lichtwardt, R., Longcore,

J., Miądlikowska, J., Miller, A., Moncalvo, J. M., Mozley-Standridge, S., Oberwinkler, F., Parmasto, E.,

Reeb, V., Rogers, J. D., Roux, C., Ryvarden, L., Sampaio, J. P., Schüßler, A., Sugiyama, J., Thorn, R.

G., Tibell, L., Untereiner, W. A.,Walker, C., Weng, Z., Weir, A., Weiss, M.,White, M. M., Winka, K.,

Yao, Y.-J. and N. Zhang. (2007). A higher-level phylogenetic classification of the Fungi. Mycolog. Res.

111: 509-547.

Hijri, M. and I. R. Sanders. (2005). Low gene copy number shows that arbuscular mycorrhizal fungi inheirit genetically different nuclei. Nature. 433: 160-163.

Hube, B. (2004). From commensal to pathogen: stage-and-tissue-specific gene expression of Candida albicans. Curr. Opin. Microbiol. 7: 336-341.

Husain, S., Alexander, B. D., Munoz, P.,Avery, R. K., Houston, S., Pruett, T., Jacobs, R., Dominguez, E.

A., Tollemar, J. G., Baumgarten, K., You, C. M., Wagener, M. M., Linden, P., Kusne, S. and N. Singh.

(2003). Opportunistic mycelial fungal infections in organ transplant recipients: emerging importance of non-Aspergillus mycelial fungi. Mycel. Fungi. And Transplant. 37: 221-229.

James, T. Y., Kauff, F., Schoch, C. L., Matheny, P. B., Hofstetter, V., Cox, C. J., Celio, G., Gueidan, C.,

Fraker, E., Miadlikowska, J., Lumbsch, H. T., Rauhut, A., Reeb, V., Arnold, A. E., Amtoft, A., Stajich, J.

E., Hosaka, K., Sung, G.-H., Johnson, D., O’Rourke, B., Crockett, M., Binder, M., Curtis, J. M., Slot, J.

C., Wang, Z., Wilson, A. W., Schüßler, A., Longcore, J. E., O’Donnell, K., Mozley-Standridge, S.,

Porter, D., Letcher, P. M., Powell, M. J., Taylor, J. W., White, M. M., Griffith, G. W., Davies, D. R.,

Humber, R. A., Morton, J. B., Sugiyama, J., Rossman, A. Y., Rogers, J. D., Pfister, D. H., Hewitt, D., 27

Hansen, K., Hambleton, S., Shoemaker, R. S., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Spotts, R. A.,

Serdani, M., Crous, P. W., Hughes, K. W., Matsuura, K., Langer, E., Langer, G., Untereiner, W. A.,

Lücking, R., Büdel, B., Gesier, D. M., Aptroot, A., Diederich, P., Schmitt, I., Schultz, M., Yahr, R.,

Hibbett, D. S., Lutzoni, F., McLaughlin, D. J., Spatafora, J. W. and R. Vilgalys. (2008). Reconstructing the early using a six-gene phylogeny. Nature. 443: 818-822.

James, T.Y., P. M. Letcher, Longcore, J. E., Mozley-Standridge, S. E., Powell, M. J., Griffith, G. W. and

R. Vilgalys. (2006). A molecular phylogeny of flagellated fungi (Chytridiomycota) and description of a new phylum (Blastoclamidiomycota). Mycologia. 98: 860-871.

Jones, M. D. M., Forn, I., Gadelha, C., Egan, M. J., Bass, D., Massana, R. and T. A. Richards. (2011).

Discovery of novel intermediate forms redefines the fungal tree of life. Nature. 474: 200-205.

Kahn, L. H. (2008). The growing number of immunocompromised. Bulletin of the atomic scientists. http://www.thebulletin.org/node/160 retrieved 11/02/2009.

Kami, M., Murashige, N., Fujihara, T., Sakagami, N. and Y. Tanaka. (2005). The mechanism for low

yield of in invasive aspergilloisis; the clinical importance of antigen detection tests

revisited. Bone Marr. Transpl. 36:85-86.

Katoh, K., Toh, H. and T. Miyata. (2005). MAFFT version 5: improvement in accuracy of multiple

sequence analysis. Nuc. Acid Res. 33: 511-518.

Kessler, R. (2007). Humungous fungus (No longer among us). Natl. Hist. 116: 16.

28

Klein B. S. and B. Tebbets. (2007). Dimorphism and virulence in fungi. Curr. Opin. Microbiol. 10: 314-

319.

Kozel, T. R., Pfrommer, G. S. T., Guerlain, A. S., Highison, B. A. and G. J. Highison. (1988). Role of the

capsule in phagocytosis of Cryptococcus neoformans. Rev. Infect. Dis. 10: S436-S439.

Kuo, M. (2007). Irpex lacteus. Retrieved from the MushroomExpert.com website:

www.mushroomexpert.com/irpex_lacteus_html.

Liu, Y., Steenkamp, E. T., Brinkmann, H., Forget, L., Philippe, H. and B. F. Lang. (2009). Phylogenomic

analyses predict sistergroup relationship of nucleariids and Fungi and of zygomycetes with

significant support. BMC Evol. Biol. 9: 272. http://www.biomedcentral.com/1471-2148/9/272.

Liu, Y. J., Hodson, M. C. and B. D. Hall. (2006). Loss of the happened only once in the fungal

lineage: phylogenetic structure of Kingdom Fungi inferred from RNA polymerase II subunit genes. BMC

Evol. Biol. 6: 74. http://www.biomedcentral.com/1471-2148/6/74.

Liu, L., Trewari, R. P. and P. R. Williamson. (1999). Laccase protects Cryptococcus neoformans from antifungal activity of alveolar machrophages. Infect. Immun. 67: 6034-6039.

McDougall, I., Brown, F. H. and J. G. Fleagle. (2005). Stratigraphic placement and age of modern humans from Kibish, Ethiopia. Nature. 433: 733-736.

29

McNeil, M. M., Nash, S. L., Hajjeh, R. A., Phelan, M. A., Conn, L. A., Plikaytis, B. D. and D. W.

Warnock. (2001). Trends in mortality due to invasive mycotic diseases in the United States, 1980-1997.

Clin. Infect. Dis. 33: 641-647.

O’Brien, H. E., Parrent, J. L., Jackson, J. A., Moncalvo, J.-M. and R. Vilgalys. (2005). Fungal community

analysis by large-scale sequencing of environmental samples. Appl. Environ. Microbiol. 71: 5544-5550.

Perfect, J. R. and W. A. Schell. (1996). The new fungal opportunists are coming. Clin. Infect. Dis. 22:

(suppl 2): S112-118.

Perlroth, J., Choi, B. and B. Spellberg. (2007). Nosocomial fungal infections: epidemiology, diagnosis, and treatment. Med. Mycol. 45: 321-346.

Pfaller, M. A., Pappas, P. G. and J. R. Wingard. (2006). Invasive fungal pathogens: current epidemiological trends. Clin. Infect. Dis. 43: S3-14.

Pfaller, M. A. and D. J. Diekema. (2004). Rare and emerging opportunistic fungal pathogens: concern for resistance beyond Candida albicans and Aspergillus fumigatus. J. Clin. Microbiol. 42: 4419-4431.

Redecker, D., Kodner, R. and L. E. Graham. (2000). Glomalean fungi from the Ordovician. Science. 289:

1920-1921.

Reedy, J. L., Bastidas, R. J. and J. Heitman. (2007). The virulence of human pathogenic fungi: notes from the south of France. Cell Host and Microb. 2: 77-83.

30

Richardson, M. D. (1991). Opportunistic and pathogenic fungi. J. Antimicrob. Chemother. 28(suppl A):

1-11.

Rogers, S. O. (2012). Integrated . CRC press, Boca Raton, Fl.

Rogers, S. O. (1994). Phylogenetic and taxonomic information from herbarium and mummified DNA. In

R. P. Adams, J. Miller, E. Goldenberg and J. E. Adams (eds.) Conservation of Plant Genes II: Utilization

of Ancient and Modern DNA. Missouri Botanical Gardens Press, Saint Louis. 47-67.

Rogers, S. O., Rehner, S., Bledsoe, C., Mueller, G. J. and J. F. Ammirati. (1989). Extraction of DNA from

Basidiomycetes for ribosomal DNA hybridizations. Can. J. Bot. 67: 1235-1243.

Rogers. S. O. and A. J. Bendich. (1985). Extraction of total cellular DNA from plants, and fungi. In

S. B. Gelvin and R. A. Schilperoort (eds.) Plant Molecular Biology Manual (2nd edition), Kluwer

Academic Press, Dordrecht, the Netherlands, D1:1-8.

Romani, L., Bistoni, F. and P. Pucceti. (2003). Adaptation of Candida albicans to the host environment: the role of morphogenesis in virulence and survival in mammalian hosts. Curr. Opin. Microbiol. 6: 338-

343.

Rosenblum, E. B., Voyles, J., Poorten, T. J. and J. E. Stajich. (2010). The deadly Chytrid fungus: a story of an emerging pathogen. PLos Pathog. 6(1): e1000550.doi:10.1371/jpurnal.ppat.1000550.

Schüßler, A., Schwarzott, D. and C. Walker. (2001). A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol. Res. 105: 1413-1421. 31

Shaaban, H., Choo, H. F., Boghossian, J. and G. Perez. (2010). ohmeri in an

immunocompetent patient treated with micafungin: case report and review of the literature.

Mycopathologia.170: 223-228.

Smart, T. (1998). The OI report: A critical review of the treatment and prophylaxis of AIDS-related opportunistic infections (OIs). Candida and other pathogenic fungi. http//aidsinfonyc.org/tag//comp/ois98/12.html. Retrieved 2/26/2008.

Smith, M. L., Bruhn, J. N. and J. B. Anderson. (1992). The fungus Armillaria bulbosa is among the largest and oldest living organisms. Nature. 356: 428-431.

Stajich, J. E., Berbee, M. L., Blackwell, M., Hibbett, D. S., James, T. Y., Spatafora, J. W. and J. W.

Taylor. (2009). Primer-the Fungi. Curr. Biol. 19: R840-R845.

Steenkamp, E. T., Wright, J. and S. L. Baldauf. (2005). The protistan origin of animals and fungi. Mol.

Biol. Evol. 23: 93-106.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and S. Kumar. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol. Biol. Evol. 28: 2731-2739.

Van Burik, J. A. and P. T. Magee. (2001). Aspects of fungal pathogenesis in humans. Ann. Rev.

Microbiol. 55: 743-772.

32

Van Duin, D., Casadevall, A. and J. D. Nosanchuk. (2002). Melanization affects the susceptibility of

Cryptococcus neoformans and to amphotericin B and . Antimicrob.

Agents Chemother. 46: 3394-4000.

Vecchiarelli, A. (2000). Immunoregulation by capsular components of Cryptococcus neoformans . Med.

Mycol. 38: 407-417.

Wang, Y., Aisen, P. and A. Casadevall. (1995). Cryptococcus neoformans and virulence:

mechanism of action. Infect. Immun. 63: 3131-3136.

Warnock, D. W. (2006). Fungal diseases: an evolving public health challenge. Med. Mycol. 44:697-705.

Weber, R. W. S. (2010). Recent developments in the molecular taxonomy of fungi. In T. Anke and D.

Weber (eds.) Physiology and Genetics: Selected Basic and Applied Aspects, The Mycota: A

Comprehensive Treatise on Fungi as Experimental Systems for Basic and Applied Research. Springer,

Berlin, Heidelberg. 1-15.

Webster, J. and R. W. S. Weber. (2007). Introduction to Fungi (3rd Edition). Cambridge University Press,

New York.

White, M. M., James, T. Y., O’Donnell, K., Cafaro, M. J., Tanabe, Y. and J. Sugiyama. (2006).

Phylogeny of the Zygomycota based on nuclear ribosomal sequence data. Mycologia. 98: 872-884.

Whittaker, R. H. (1969). New concepts of Kingdoms of organisms. Science. 163: 150-160.

33

Wickes, B. L. (2002). The role of and morphology in Cryptococcus neoformans pathogenesis. Int. J. Med. Microbiol. 292: 1-17.

Williams, B. A. P. (2009). Unique physiology of host-parasite interactions in microsporidia infections.

Cell. Microbiol. 11: 1551-1560.

Wisplinghoff, H., Bischoff, T., Tallent, S. M., Seifert, H., Wenzel, R. P. and M. B. Edmond. (2004).

Nosocomial bloodstream infections in US hospitals: Analysis of 24,179 cases from a prospective nationwide surveillance study. Clin. Infect. Dis. 39: 309-317.

Wüppenhorst, N., Lee, M.-K., Rappold, E., Kayser, G., Beckervordersandforth, J., de With, K. and A.

Serr. (2010). Rhino-orbitocerebral Zygomycosis caused by Conidiobolus incongruous in an immunocompromised patient in Germany. J. Clin. Microbiol. 48: 4322-4325.

Zax, D. (Jul. 2007). When mushrooms ruled the earth? Smithsonian. 38: 31.

34

CHAPTER 2. MATERIALS AND METHODS

2.1 Clinical diagnosis of fungal infections

2.1.1 Phenotypic identification

There has been some difficulty in obtaining consensus from the international community as far as

diagnostic criteria for proven, probable, and possible invasive fungal infections (IFI), which is of

particular importance to heterogeneous populations at risk. The European Organization for Research and

Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Disease Mycoses Study Group (EORTC/MSG) published guidelines for definitions of IFIs in 2002, with revisions published in 2008 (Table 2.1, Table 2.2, Table 2.3) (Ascioglu et al., 2002; De

Pauw et al., 2008). The mainstays for proven IFI have been from phenotypic identification based on histology or positive cultures from normally sterile body sites (Ruhnke et al., 2003).

There are several problems with these two approaches. The first is that many of the patients with suspected infections may not be healthy enough for invasive biopsy procedures due to immunosuppressive therapies or conditions. Physical trauma to skin and exposure to opportunistic pathogens in hospital environments makes biopsy a procedure with inherent risk. There have also been reports on misidentification of fungi in histological and cytological samples (Sangoi et al., 2009;

Schofield et al., 2007). Non-invasive procedures such as computed tomography scans (CTs) can reveal

mycetomas and nephrotic lesions, but it may be too late for effective treatment.

The second and most serious problem with reliance on culture is that there have been numerous

reports about false-negatives, with sensitivities ranging from only 8.3% in a retrospective study

comparing β-D-Glucan testing and blood culture to 31% for central nervous system (CNS) fungal

infections, the majority of which were in immunocompetent patients, over a 17 year study in India

(Obayashi, 2008; Sundaram, 2006). A 15-year autopsy study of IFIs at a tertiary care center in Texas of 35

Table 2.1 EORTC/MSG Criteria for proven invasive fungal disease except for endemic mycoses

Analysis and specimen Moldsa Yeastsa

Microscopic Histopathologic, cytopathologic, or direct Histopathologic, cytopathologic, or direct analysis: microscopic examinationb of a specimen microscopic examinationb of a specimen sterile obtained by needle aspiration or biopsy in obtained by needle aspiration or biopsy from a material which hyphae or melanized yeast-like normally sterile site (other than mucous forms are seen accompanied by evidence membranes) showing yeast cells—for of associated tissue damage example, Cryptococcus species indicated by encapsulated budding yeasts or Candida species showing pseudohyphae or true hyphaec

Culture Sterile Recovery of a mold or “black yeast” by Recovery of a yeast by culture of a sample material culture of a specimen obtained by a sterile obtained by a sterile procedure (including a procedure from a normally sterile and freshly placed [<24 h ago] drain) from a clinically or radiologically abnormal site normally sterile site showing a clinical or consistent with an infectious disease radiological abnormality consistent with an process, excluding bronchoalveolar lavage infectious disease process fluid, a cranial sinus cavity specimen, and urine

Blood Blood culture that yields a moldd (e.g., Blood culture that yields yeast (e.g., Fusarium species) in the context of a Cryptococcus or Candida species) or yeast-like compatible infectious disease process fungi (e.g., species)

Serological Not applicable Cryptococcal antigen in CSF indicates analysis: CSF disseminated

aIf culture is available, append the identification at the or species level from the culture results. bTissue and cells submitted for histopathologic or cytopathologic studies should be stained by Grocott- Gomorri methenamine silver stain or by periodic acid Schiff stain, to facilitate inspection of fungal structures. Whenever possible, wet mounts of specimens from foci related to invasive fungal disease should be stained with a fluorescent dye (e.g., calcofluor or blankophor). cCandida, Trichosporon, and yeast-like species and Blastoschizomyces capitatus may also form pseudohyphae or true hyphae. dRecovery of Aspergillus species from blood cultures invariably represents contamination.

(Adopted from author’s manuscript De Pauw et al., 2009)

36

Table 2.2 EORTC/MSG Criteria for probable invasive fungal disease except for endemic mycoses

Host factorsa Recent history of (<0.5 × 109 neutrophils/L [<500 neutrophils/mm3] for >10 days) temporally related to the onset of fungal disease Receipt of an allogeneic stem cell transplant Prolonged use of corticosteroids (excluding among patients with allergic bronchopulmonary aspergillosis) at a mean minimum dose of 0.3 mg/kg/day of prednisone equivalent for >3 weeks Treatment with other recognized T cell immunosuppressants, such as cyclosporine, TNF-α blockers, specific monoclonal antibodies (such as alemtuzumab), or nucleoside analogues during the past 90 days Inherited severe (such as chronic granulomatous disease or severe combined immunodeficiency)

Clinical criteriab Lower respiratory tract fungal diseasec The presence of 1 of the following 3 signs on CT: Dense, well-circumscribed lesions(s) with or without a halo sign Air-crescent sign Cavity Tracheobronchitis Tracheobronchial ulceration, nodule, pseudomembrane, plaque, or eschar seen on bronchoscopic analysis Sinonasal infection Imaging showing sinusitis plus at least 1 of the following 3 signs: Acute localized pain (including pain radiating to the eye) Nasal ulcer with black eschar Extension from the paranasal sinus across bony barriers, including into the orbit CNS infection 1 of the following 2 signs: Focal lesions on imaging Meningeal enhancement on MRI or CT Disseminated candidiasisd At least 1 of the following 2 entities after an episode of candidemia within the previous 2 weeks: Small, target-like abscesses (bull's-eye lesions) in liver or spleen Progressive retinal exudates on ophthalmologic examination

Mycological criteria Direct test (cytology, direct microscopy, or culture) Mold in sputum, bronchoalveolar lavage fluid, bronchial brush, or sinus aspirate samples, indicated By 1 of the following: Presence of fungal elements indicating a mold Recovery by culture of a mold (e.g., Aspergillus, Fusarium, Zygomycetes, or Scedosporium 37

species)

Indirect tests (detection of antigen or cell-wall constituents)e Aspergillosis Galactomannan antigen detected in plasma, serum, bronchoalveolar lavage fluid, or CSF Invasive fungal disease other than cryptococcosis and zygomycoses β-d-glucan detected in serum

NOTE. Probable IFD requires the presence of a host factor, a clinical criterion, and a mycological criterion. Cases that meet the criteria for a host factor and a clinical criterion but for which mycological criteria are absent are considered possible IFD.

aHost factors are not synonymous with risk factors and are characteristics by which individuals predisposed to invasive fungal diseases can be recognized. They are intended primarily to apply to patients given treatment for malignant disease and to recipients of allogeneic hematopoietic stem cell and solid-organ transplants. These host factors are also applicable to patients who receive corticosteroids and other T cell suppressants as well as to patients with primary immunodeficiencies. bMust be consistent with the mycological findings, if any, and must be temporally related to current episode. cEvery reasonable attempt should be made to exclude an alternative etiology. dThe presence of signs and symptoms consistent with sepsis syndrome indicates acute disseminated disease, whereas their absence denotes chronic disseminated disease.

e These tests are primarily applicable to aspergillosis and candidiasis and are not useful in diagnosing infections due to Cryptococcus species or Zygomycetes (e.g., Rhizopus, Mucor, or species). Detection of nucleic acid is not included, because there are as yet no validated or standardized methods.

(Adopted from author’s manuscript, De Pauw et al., 2009)

38

Table 2.3 EORTC/MSG Criteria for the diagnosis of endemic mycoses

Diagnosis and criteria Proven endemic In a host with an illness consistent with an endemic mycosis, 1 of the following: Recovery in culture from a specimen obtained from the affected site or from blood Histopathologic or direct microscopic demonstration of appropriate morphologic forms with a truly distinctive appearance characteristic of dimorphic fungi, such as Coccidioides species spherules, Blastomyces dermatitidis thick-walled broad-based budding yeasts, Paracoccidioides brasiliensis multiple budding yeast cells, and, in the case of histoplasmosis, the presence of characteristic intracellular yeast forms in a in a peripheral blood smear or in tissue macrophages For , demonstration of coccidioidal antibody in CSF, or a 2-dilution rise measured in 2 consecutive blood samples tested concurrently in the setting of an ongoing infectious disease process For , demonstration in 2 consecutive serum samples of a precipitin band to paracoccidioidin concurrently in the setting of an ongoing infectious disease process Probable endemic mycosis Presence of a host factor, including but not limited to those specified in Table (2.2), plus a clinical picture consistent with endemic mycosis and mycological evidence, such as a positive Histoplasma antigen test result from urine, blood, or CSF

NOTE. Endemic mycoses include histoplasmosis, , coccidioidomycosis, paracoccidioidomycosis, , and infection due to Penicillium marneffei. Onset within 3 months after presentation defines a primary pulmonary infection. There is no category of possible endemic mycosis, as such, because neither host factors nor clinical features are sufficiently specific; such cases are considered to be of value too limited to include in clinical trials, epidemiological studies, or evaluations of diagnostic tests.

(Adopted from author’s manuscript, De Pauw et al., 2009)

39

patients with hematologic malignancies revealed that 60% of the histologically proven IFIs were culture- negative and that 75% of them were not diagnosed antemortem (Chamilos, 2006). An autopsy review of over seven-hundred patients with hemotologic malignances dating from 1980 to 1990 reported that out of ninety-one patients with histologically proven invasive aspergillosis only one patient had positive blood cultures (Kami, 2005). A 28-year study of systemic mycoses in autopsy material in Germany (where the autopsy frequency declined from 80% to less than 30% over the time specified) identified 47 IFIs of which only 3 were diagnosed before death (Koch, 2003).

A third problem is that highly qualified personnel are necessary for phenotypic identification, which is largely based on colony characteristics and reproductive structures. Cultures may also exhibit

atypical morphology (Brandt et al., 2009), fail to sporulate (Punder et al., 2007) or require lengthy incubation until colony growth necessitating alternatives to culture (Balajee, 2007). Several studies have also shown that the presence of more than one species in a sample may contribute to culture-negativity

(Abu-Said et al., 1997; Alam et al., 2007; Ahmad et al., 2002).

A clinical laboratory identification guide for fungi says that P. brasiliensis mycelia may take

three weeks to grow and that H. capsulatum mycelial forms may take up to eight weeks (Larone, 2002).

In addition, many cryptic species are being identified and described that are phenotypically

indistinguishable from close relations (O’ Donnell, 2000; Gilgado, 2005; Balagee, 2005). Histologically,

disparate species may appear morphologically similar in tissues; both Fusarium species and

Pseudallesheria boydii may appear identical to Aspergillus (Idemyor, 2003; Bibashi, 2009). The use of

basic molecular techniques reduces the need for specialized technicians as the list of fungal pathogens

continues to grow.

2.1.2 Molecular identification of fungi

Researchers and clinicians have used several protocols for molecular testing to detect fungal

DNA or molecular markers including DNA microarrays, species specific probes, mannan, galactomannan

and β-D-glucan exoantigen testing, and PCR based analysis (Boudewjins, 2006; Einsele, 1997; Erjavec, 40

2002; Mitchell, 1994; Sandhu, 1995; Obayashi, 2008; Speiss, 2007). Many of the earlier techniques involved targeting of specific species such as Candida albicans and Aspergillus fumigatus. While this is useful in the majority of cases, it fails to identify some of the less common opportunistic pathogens, more of which are identified every year.

In PCR based diagnostics, several target regions have been utilized for identification including the D1-D2 Large Subunit rDNA, ITS 1 and 2 regions, and mitochondrial DNA (Einsele, 1995; Hinrikson,

2005; Mitchell, 1994; Sandhu, 1995). Molecular genotyping utilizing rDNA subunit and ITS sequences has already been shown to be effective in identifying diverse fungi (Hendolin, 2000; Henry, 2000;

Moriera-Oliveira, 2005; Zhao, 2001). A multinational, multilaboratory consortium including NCBI, the

National Library of Medicine, and the National Institutes of Health in the United States showed that among six different DNA regions considered as potential universal DNA barcode markers, (including three protein coding genes and the rRNA cistron regions including the large subunit (LSU), the small subunit (SSU) and internal transcribed spacer regions) the ITS regions were superior for identification of the broadest range of fungi with clear inter- and intraspecific uncomformity (Schoch et al., 2012).

Furthermore, online resources such as NCBI, ITS databases including the Fungal Metagenomics

Website (biotech.inbre.alaska.edu/fungal_portal/?program=fungal_its_fasta), the CBS Fungal

Biodiversity Center and the Westmead Millenium Institute (www.mycologylab.org/biolomicsid.aspx), sequencing projects at the MIT Broad and J. Craig Venter Institutes, as well as phylogenomic resources such as the NSF funded Assembling the Fungal Tree of Life (AFTOL) database are increasing the numbers of available archived fungal sequences for comparison (see appendix).

2.1.3 Antifungal resistance

Antifungal resistance, similar to antibiotic resistance in bacteria, has emerged as a serious problem. Prophylactic and prolonged usage of antifungal medications in immunocompromised patients has generated resistant strains and species and it has been shown that some species are intrinsically more resistant to certain classes of antifungals (Howard, 2009; Luzzati 2000; McGinnis, 1998; O’Donnell, 41

2008; Serena, 2004). Molecular analysis of clinical isolates has demonstrated morphological misidentification of non-fumigatus Aspergillus species (Balagee, 2006; Katz 2005) and novel species continue to be identified (Barrs, et al., 2013).

Breakthrough infections (infection with a different organism detected after infection that led to initiation of therapy or an infection that develops >72 hours after initiation of preventive therapy) are of serious concern when empiric therapy is started without accurate knowledge of the species involved; delays in salvage therapy (treatment of infected individuals who are refractory or intolerant to initial therapy administered for at least 7 days) also adversely affect patient outcome (Imhoff et al., 2004;

Nguyen et al., 1996; Dockrell, 2008; Baden et al., 2003; Segal et al., 2005). Studies have shown that earlier initiation of antifungal therapy (within hours) can decrease mortality rates in patients with IFIs

(Garey et al., 2006; Morrell et al., 2005).

These reports show the importance of identifying infectious organisms as specifically as possible for effective selection and treatment with appropriate chemotherapeutics. This is where the use of molecular techniques is a critical addition for successful and timely clinical diagnosis.

42

2.2 Sample collection, transportation and information

2.2.1 Sample collection and transportation

Samples were collected aseptically by hospital personnel for use in the University of Michigan

Hospital Clinical Microbiology and Virology Laboratories (Ann Arbor). After clinical testing using the

BacT/Alert blood culture instrument (bioMerieux, Inc.) and standard microbiological culture techniques samples of 100 culture-negative blood (for bacteria and fungi) and 100 culture negative (for bacteria) respiratory samples were obtained from randomized patients in heterogeneous populations in the hospital within a one year period between 2005 and 2006. Only one respiratory or blood sample was obtained from each patient without re-sampling. Approval from the University of Michigan Hospital was obtained through Duane Newton, PhD. the head of the clinical laboratory, and Mary A. M. Rogers, PhD. Human

Subject Review Board approval was obtained from the Office of Research Compliance at Bowling Green

State University (see appendix).

Samples were transported on ice from the University of Michigan hospital to the BGSU laboratory and were stored at -20° C. Multiple 200 µl aliquots were prepared in sterilized 1.5 ml centrifuge tubes for each of the 200 samples using aseptic technique in a sterile Class II biosafety laminar flow hood. Pre-sterilized single-use needles were used for blood preparations and pre-sterilized aerosol- resistant pipet tips were used for preparation of respiratory samples. Aliquots were stored at -20°C until use.

2.2.2 Sample and patient information

Thirty-seven whole-blood samples were cultured anaerobically and sixty-three samples were cultured aerobically using BacT/Alert FAN (bioMerieux, Inc.) media (Baron et al., 2005). Collection volumes ranged between 1 mL (pediatric) to 10 mL (adult) and cultures were held for an average five of days before samples were considered culture-negative for fungal and bacterial pathogens.

Respiratory samples consisted of brochoalveolar lavage (BAL, n=25), sinus (n=1) and sputum

(n=74) specimens and were cultured aerobically by University of Michigan Hospital personnel. Volumes 43

collected were between 2 and 10 mL and preliminary results were reported within 18- 24 hours. Cultures

were considered negative for bacterial pathogens after two days if no growth was observed.

Patient age ranged from less than one-year old to ninety-one years old. Fifty-nine patients were

between the ages of <1 to 20 years-old (29.5%), thirty patients were between 21 and 40 years-old (15%), sixty-two patients were between 42 and 60 years-old (31%), forty-two patients were between 61 and 80 years-old (21%), and seven patients were between 81 and 91 years-old (3.5%). One-hundred and three patients were male (51.5%) and ninety-seven patients were female (48.5%).

One-hundred and thirty-seven samples were collected from non-Intensive Care Units (ICU)

(68.5%) and sixty-three samples were collected from ICU units (31.5%) (Table 2.4).

Length of stay (L.O.S.) information was available for seventy-six patient samples. The shortest

L.O.S. was one day (emergency services) and the longest L.O.S. was three-hundred and seven days

(neonatal ICU). Average L.O.S. was 17.93 days out of a sum total of 1363 days in hospital.

(See appendix for detailed patient information).

Statistical analysis will be conducted on results utilizing Quickcalcs online software

(www.graphpad.com/quickcalcs/). Unpaired t-tests will be used for comparison of means for patient

L.O.S. (PCR positive patients versus PCR negative patients) as well as for comparisons of patient age

(blood samples versus respiratory samples). The two-tailed p-value, 95% confidence interval, t-value and standard error will be reported for each test in addition to the means and standard deviations. Fisher’s exact chi-square analysis with a 2x2 contingency table will be used for categorical data to compare the frequency of patients in ICU (PCR positive patients versus PCR negative patients) as well as the frequency of male and female patients. A two-tailed p-value will be reported for each test.

44

Table 2.4 Hospital locations samples were collected

Freq. Percent Adult Hospital 1 0.50 Cardiology 10 5.00 Cardiology ICU 7 3.50 Cardiothoracic Surgery ICU 4 2.00 Children’s Hospital 12 6.00 Children’s Hospital Admitting 3 1.50 Dermatology/ General Surgery 3 1.50 Dialysis 1 0.50 Emergency Services 22 11.00 Gastrointestinal 4 2.0 General Medicine 6 3.0 Hematology/ Oncology 9 4.5 Hospital Admitting 9 4.50 Infectious Disease 1 0.50 Kidney/ Pancreas Transplant 1 0.50 Medical ICU 16 8.00 Neonatal ICU 6 3.00 Neurosurgery 7 3.50 Opthalmology 1 0.50 Orthopedic Surgery 1 0.50 Outpatient 7 3.50 Pediatric ICU 14 7.00 Pediatric Cardiology 6 3.00 Pediatric Urology/ Nephrology 1 0.50 Peritoneal Dialysis 1 0.50 Physical Medicine/ Rehab 1 0.50 Pulmonary 19 9.50 Surgical ICU 15 7.50 Trauma Burn ICU 1 0.50 Trauma Burn Acute Care 2 1.00 Urology/ Surgery Transplant 1 0.50 Vascular Surgery 4 2.00 Total 200 100.00

45

2.3 CTAB DNA extraction

A cetyltrimethylammonium bromide (CTAB) DNA extraction method (Rogers, 1989, 1994,

Rogers and Bendich, 1994) was used with slight modifications. Briefly, samples were incubated for 20

minutes at 65°C with 200 µl of pre-heated (65°C) 2x CTAB buffer (2% CTAB (w/v), 100 mM Tris (pH

8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl). Samples were briefly cooled on ice before the addition of an equal volume of 24:1 chloroform/isoamyl alcohol. Samples were shaken by hand until no separate phases were visible and then centrifuged at 16,000 xg for 5 minutes. The top aqueous phase was removed by pipet and transferred to a sterile microcentrifuge tube. A 5% CTAB solution (5% CTAB (w/v), 0.7M

NaCl) measuring one-fifth of the total volume of the supernatant was added, followed by the addition of

24:1 chloroform/isoamyl alcohol equal to the volume of the supernatant. Samples were shaken for several minutes until no separate phases were visible, and centrifuged (as above) for 5 minutes. The top aqueous phase was removed by pipet and placed in a new sterile centrifuge tube. An equal volume of pre-chilled (-

20° C) isopropanol was added to the supernatant, gently inverted several times, and samples were stored at -20° C overnight for DNA precipitation. The next day, after precipitation, samples were centrifuged (as above) for 5 minutes to pellet the DNA. The supernatant was carefully removed by pipet and the DNA pellet was resuspended in 30 µl (for small pellets) or 50 µl (for larger pellets) of High-Salt TE buffer (10 mM Tris (pH 8.0), 1 mM EDTA (pH 8.0), 1 M NaCl) and incubated for 10 minutes at 65°C. The tubes were agitated by hand several times during incubation to assure rehydration. Two times the total volume of pre-chilled (-20°C) 100% ethanol was added to the tubes and the tubes were inverted gently by hand several times before centrifugation (as above) for 5 minutes. The supernatant was removed by pipeting and an equal volume of pre-chilled 80% ethanol was added to the tubes. They were gently inverted and centrifuged (as above) for 5 minutes. The ethanol was removed by pipet and the samples were dessicated at 30°C for 15 minutes in a vacufuge after being partially covered with parafilm. After the samples were completely dried, 30 µl of 0.1x TE buffer (1x TE buffer, 10 mM Tris (pH 8.0), 1 mM EDTA (pH 8.0) diluted 1:9) was added to the samples to resuspend DNA. Then, the DNA samples were stored at -20°C. 46

A positive control of blood or respiratory samples spiked with Aspergillus flavus cells from the

BGSU microbiology laboratory or Aspergillus fumigatus ATCC® MYA-4609™ cells and 200 µl of distilled, sterilized water were included with each round of DNA extracts. Fungi for positive controls were routinely subcultured on Difco™ (per 1 liter: 10.0 g enzymatic digest of casein,

20.0 g dextrose, 20.0 g agar, pH 7.0, Becton, Dickson and Company, Sparks, MD). Samples negative for fungi after nucleic acid amplification were also considered negative controls.

2.4 PCR targeting internal transcribed spacers (ITS) 1 and 2 in ribosomal DNA

(rDNA)

Primer combinations targeting the ITS1 (ITS 2/ITS 5), the ITS2 (ITS 3/ITS 4Z or ITS4FS), or

both regions (ITS 4Z or ITS4FS/ ITS 5, LS266/ V9D) were used to amplify PCR products utilizing a Bio-

Rad PTC-100 Peltier Thermal Cycler (Table 2.2) (see Desnos-Ollivier et al., 2006 for explanation).

Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA) with standard

desalting at 200 nanomol synthesis scale. Each reaction consisted of 5-10 µl genomic extract

(approximately 1-10 ng), 20 mM (NH4)2SO4, 50 pM each primer, 1.5 mM MgCl2, 200 µM each dNTP, 2

units Native Taq DNA polymerase (Fermentas, Glen Burnie, MD) in a final volume of 50 µl. Multiple

PCR programs were used to optimize primer combinations. PCR programs consisted of the following

steps: 95°C for 1 minute, followed by 35 cycles of 94°C for 1 minute, annealing temperature (50°C,

52°C, or 55°C) for 4 minutes, 72°C for 4 minutes, and a final extension of 72°C for 10 minutes. PCR

products were visualized on 1% agarose gels in TBE (90 mM Tris-borate, 2 mM EDTA, pH 8.0) with 0.5

µg/ml ethidium bromide and viewed with UV light. Photographs were taken with a digital camera and transferred to computer for analysis.

47

LS266 ITS3 ITS4Z/4FS V9D

SSU (18S) 5.8S LSU (28S)

ITS1 ITS2

ITS5 ITS1 ITS2

Figure 2.1 Schematic representation of rDNA and internal transcribed spacer (ITS) regions and

panfungal primers. Arrows indicate location and orientation of primers used in this study. SSU

represents small subunit and LSU represents large subunit.

Table 2.5 Panfungal ITS primers used

Primer Name Sequence 5’ to 3’ Reference ITS 2 GCT GCG TTC TTC ATC GAT White et al., 1990 GC ITS 3 GCA TCG ATG AAG AAC GCA White et al., 1990 GC ITS 4(FS) TCC TCC GCT TAT TNA TAT Sidiq, unpublished GC ITS 4(Z) TCC TCC GCT TAT TRA TAT Zhang, unpublished GC ITS 5 GGA AGT AAA AGT CGT AAC White et al., 1990 AAG G LS266 GCA TTC CCA AAC AAC TCG Masclaux et al., 1995 ACT C V9D TTA AGT CCC TGC CCT TTG G. S. de Hoog and A. H. G. TA van den Ende, 1998

*Note: Letters underlined and in bold indicate degenerate bases at the respective locations, where N= A,

C, G or T and R= A or G. Original primer by White et al., 1990 had a G at the modified position. ITS 4Z

was modified by Gang Zhang, PhD and ITS 4FS was modified by the author in order to identify more

fungal species. Panfungal primer ITS1 was not used because it caused non-specific amplification in blood samples (data not shown). 48

2.5 PCR purification, gel extracts and cloning

PCR products with single bands were purified using a QIAquick PCR purification kit (QIAGEN,

Valencia) using the microcentrifuge protocol. Briefly, 200 µl of Buffer PB were added to 40 µl of PCR

product and mixed. The sample was added to a 2 ml QIAgen collection tube and centrifuged for 1 minute

at 16,000 xg. The flow-through was discarded and the filter column was replaced into the collection tube.

Next, 750 µl of Buffer PE was added to the column and the sample was centrifuged for 60 seconds (as

above). Collection tubes were discarded and columns were placed in a pre-sterilized 1.5 ml microcentrifuge tube. Finally, 30 µl of Buffer EB (10 mM Tris-Cl, pH 8.5) was added to the tubes and centrifuged for 1 minute (as above). Purified products were stored at -20° C. Samples were visualized on

1% agarose gels in TBE (90 mM Tris-borate, 2 mM EDTA, pH 8.0) with 0.5 µg/ml ethidium bromide and viewed with UV light. Photographs were taken with a digital camera and transferred to computer for analysis.

PCR products with multiple bands were run on 1% standard agarose gels (as above). Each band was excised, and purified using a QIAquick Gel Extraction kit using a microcentrifuge protocol. Three volumes of Buffer QG were added to 1 volume of gel and samples were incubated at 50° C for 10 minutes or longer, with vortexing every 2-3 minutes until samples were homogenously dissolved. One volume of room temperature 100% isopropanol was added to the product and mixed with gentle inversion. The samples were transferred to Qiaquick spin columns in 2 ml collection tubes and centrifuged for 1 minute at 16,000 xg. Subsequent steps are as listed above for the QIAquick PCR purification protocol.

PCR products with intense bands were cloned into pCR2.1-TOPO vectors (TOPO TA Cloning kit for sequencing, Invitrogen, Carlsbad, CA). The cloning reaction consisted of 4 µl of PCR product, 1 µl of salt solution (1.2 M NaCl, 0.06 M MgCl 2), 1 µl of vector (10 ng/µl DNA in 50% glycerol, 50

mM Tris-HCl, pH 7.4, 1 mM ethylenediaminetetraacetic acid (EDTA), 2 mM dithiothreitol (DTT), 0.1%

Triton X-100, 100 µg/ml bovine serum albumin (BSA), 30 µM phenol red) and was performed at room 49

temperature for 20 minutes. Cloning products were stored overnight at -20° C if transformation was not immediately performed. For transformation, 4 µl of the cloning products were added to a vial of One

Shot™ Chemically Competent E. coli cells that were thawed on ice. Cells were incubated on ice with the cloning products for at least 15 minutes and were then heat-shocked at 42° C for 30 seconds, cooled on

ice for 10 minutes before addition of 200 µl room temperature S.O.C. media (2% tryptone, 0.5% yeast

extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2). Samples were incubated horizontally at 37° C with

shaking for 90 minutes. Then 20 µl of room temperature S.O.C. media was added to pre-warmed (37° C)

Luria-Bertani Difco™ LB Agar, Miller (per 1 liter: 10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl, 15.0 g agar, pH 7.0, Becton, Dickson and Company, Sparks, MD) ampicillin selection plates (50 µg ampicillin sodium salt/ml, Sigma-aldrich, St. Louis, MO) supplemented with 40 µl X-gal (5-bromo-4-chloro-3- indoxyl-beta-D-galactopyranoside, 20 mg/ ml, Gold Biotechnology, St. Louis, MO). Duplicate spread plates were then prepared for each sample using 50 µl and 75 µl of transformed cells and were then incubated overnight at 37° C. Blue/white screening was used to analyze successful transformants and at least 10 white colonies were selected from each plate and subcultured on Luria-Bertani agar (Difco™ LB

Agar as described above) supplemented with 50 µg/ ml ampicillin. After overnight incubation, 5-10 colonies were selected for each cloning reaction and inoculated into 4 ml Difco™ LB broth, Miller (per 1 liter: 10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl, pH 7.0) with 50 µg/ ml ampicillin and incubated overnight at 37° C with shaking. Then, 1 ml of each sample exhibiting turbidity was removed and were isolated using the Cyclo-Prep miniprep plasmid DNA purification kit (Amresco, Solon,

OH). Plasmids were then analyzed for inserts using digestion with EcoR1 or by colony PCR using a native Taq DNA polymerase (Fermentas, Inc., Glen Burnie, MD). Colony PCR consisted of 50 µl reactions containing the following components: 1x Taq buffer with (NH4)2SO4 (750 mM Tris-HCl (pH

8.8), 200 mM (NH4)2SO4, 1% Tween 20) 200 μM each dNTP, 1.25 units Taq polymerase, 1.5 mM MgCl2

and 0.5 μM of M13 primers (M13F(-20): GTA AAA CGA CGG CCA G, M13 reverse: CAG GAA ACA

GCT ATG AC). Colonies were added directly to the PCR mixture and PCR was performed using the 50

following program: 95 °C for 4 minutes, 30 cycles of 95 ˚C for 1 minute, 45 °C for 2 minutes, 72 °C for

2 minutes, and final extension at 72 °C for 10 minutes. Samples were held at 4 °C until checked by

electrophoresis or subsequently stored at -20° C. All purified PCR and plasmid isolations were

commercially sequenced with appropriate primers by Geneway, LLC (Hayward, CA).

2.6 BLASTn searches using NCBI database

ITS sequences retrieved from Geneway were compared to GenBank entries in the National

Center for Biotechnology Information (NCBI) database. The BLASTn program was used with default

parameters and sequences with at least 95% maximum identity were used to identify fungal species found

in clinical samples.

2.7 Phylogenetic analyses

Following alignment using MAFFT version 5.7 (Katoh et al., 2005), the sequences were

examined, and small manual adjustments were made as needed. Phylogenetic analysis was performed

with MEGA version 5 (Tamura et al., 2011) using the Neighbor-Joining method with the Tamura-Nei defaults. Sequences were aligned using ITS 1, 5.8S and ITS 2. Sequences covering only ITS 1 or ITS 2 were aligned separately. Five hundred replications were used for bootstrap support. Reference organisms for phylogenetic analysis obtained from the NCBI nucleotide database are listed in Table 2.2 and sequences are listed in the appendix.

51

Table 2.6 NCBI reference organisms used for phylogenetic analysis Organism Order Accession number capsulatus var. farciminosus AF322387 Alternaria alternata Pleosporales JQ781820 Aspergillus flavus AF138287 Aspergillus fumigatus Eurotiales EF67971 Aspergillus niger Eurotiales AF109327 Candida albicans Saccharomycetales AF217609 Saccharomycetales AJ249484 Saccharomycetales GU199447 Cladosporium cladosporioides Capnodiales DQ780410 Engyodontium album HQ115665 Fusarium culmorum Hypocreales AF484956 Fusarium oxysporum Hypocreales AF055220 Neurospora crassa Sordariales GU327635 Paracoccidioides brasiliensis Onygenales AF322389 Saccharomyces cerevisiae Saccharomycetales GQ376090 Stachybotrys chartarum Hypocreales AF206273 rubrum Onygenales UI8352

2.8 Literature cited

Abu-Said, D., Anaissie, E., Uzon, O., Raad, I., Pinzcowski, H. and Z. U. Khan. (1997). The epidemiology of hematogenous candidiasis caused by different Candida species. Clin. Infect. Dis. 24: 1122-1128.

Acioglu, S., Rex, J. H., Bennett, J. E., Bille, J., Crokaert, F., Denning, D. W., Donnelly, J. P., Edwards, J.

E., Erjavec, Z., Fiere, D., Lortholary, O., Maertens, J., Meis, J. F., Patterson, T. F., Ritter, J., Selleslag,

D., Shah, P. M., Stevens, D. A., Walsh, T. J. and the Invasive Fungal Infections Cooperative Group of the

European Organization for Research and Treatment of Cancer and Mycoses Study Group of the National

Institute of Allergy and Infectious Diseases. (2002). Defining opportunistic invasive fungal infections in 52

immunocompromised patients with cancer and hematopoetic stem cell transplants: an international

consensus. Clin. Infect. Dis. 34: 7-14.

Ahmad, S., Khan, Z., Mustafa, A. S. and Z. U. Khan. (2002). Seminested PCR for diagnosis of

candidemia: comparison with culture, antigen detection, and biochemical methods for species

identification. J. Clin. Microbiol. 40: 2483-2489.

Alam, F. F., Mustafa, A. S. and Z. U. Khan. (2007). Comparative evaluation of (1,3)-beta-D-glucan, mannan, and anti-mannan antibodies, and Candida species-specific snPCR in patients with candidemia.

BMC Infect. Dis. 7: 103. doi:10.1186/1471-2334-7-103.

Balagee, S. A., Sigler, L. and M. E. Brandt. (2007). DNA and the classical way: identification of medically important molds in the 21st century. Med. Mycol. 45: 475-490.

Balagee, S. A., Gribskov, J., Brandt, M., Ito, J., Fothergill, A. and K. A. Marr. (2005). Mistaken identity:

Neosartorya pseudofischeri and its anamorph masquerading as Aspergillus fumigatus. J. Clin. Microbiol.

43: 5996-5999.

Balagee, S. A., Nickle, D., Varga, J. and K. A. Marr. (2006). Molecular studies reveal frequent

misidentification of Aspergillus fumigatus by morphotyping. Euk. Cell. 5: 1705-1712.

Barrs, V. R., van Doorn, T. M., Houbraken, J., Kidd, S. E., Martin, P., Pinheiro, M. D., Richardson, M.,

Varga, J. and R. A.Samson. (2013). Aspergillus felis sp. nov., an emerging agent of invasive aspergillosis

in humans, cats and dogs. PLoS ONE. 8(6): e64871. doi:10.1371/journal.pone.0064871.

53

Bibashi E., de Hoog, G. E., Kostopoulo, E., Tsivitanidou, M., Sevastidou, J. and P. Geleris. (2009).

Invasive infection caused by in an immunocompetent patient. Hippokratica. 13:

184-186.

Boden, L. R., Katz, J. J., Fishman, J. A., Koziol, C., DelVecchio, A., Doran, M. and R. H. Rubin. (2003).

Salvage therapy with for invasive fungal infections in patients failin g or intolerant to

standard antifungal therapy. Transplantation. 76: 1632-1637.

Boudewijns, M., Verweij, P. E. and W. J. G. Melchers. (2006). Molecular diagnosis of invasive

aspergillosis: the long and winding road. Future Microbiol. 1: 283-293.

Brandt, M. E., Gade, L., McCloskey, C. B. and S. A. Balajee. (2009). Atypical Aspergillus flavus isolates associated with chronic azole therapy. J. Clin. Microbiol. 47: 3372-3375.

Chamilos, G., Luna, M., Lewis, R. E., Bodey, G. P., Chemaly, R., Tarrand, J. J., Safdar, A., Raad, I. I. and D. P. Kontoyiannis. (2006). Invasive fungal infections in patients with hematologic malignancies in a tertiary care center: an autopsy study over a 15-year period (1989-2003). Haematologica. 91: 986-989.

Chen, S. C.-A., Blyth, C. C., Sorrell, T. C. and M. A. Slavin. (2011). Pneumonia and lung infections due to emerging and unusual fungal pathogens. Semin. Respir. Crit. Care Med. 32: 703-716.

De Pauw, B., Walsh, T. J., Donnelly, J. P., Stevens, D. A., Edwards, J. E., Calandra, T., Pappas, P. G.,

Maertens, J., Lortholary, O., Kauffman, C. A., Denning, D. W., Patterson, T. F., Maschmeyer, G., Bille,

J., Dismukes, W. E., Herbrecht, R., Hope, W. W., Kibbler, C. C., Kullberg, B. J., Marr, K. A., Mun҃ oz, P.,

Odds, F. C., Perfect, J. R., Restrepo, A., Ruhnke, M., Segal, B. H., Sobel, J. D., Sorrell, T.C., Viscoli, C., 54

Wingard, J. R., Zaoutis, T. and J. E. Bennett. (2008). Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/ Invasive Fungal Infections

Cooperative Group and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus group.

Clin. Infect. Dis. 46: 1813-1821.

Dockrell, D. H. (2008). Salvage therapy for invasive aspergillosis. J. Antimicrob. Chemother. 61(suppl.

1): i41-i44.

Einsele, H., Hebart, H., Roller, G., Löffler, J., Rothenhofer, I., Müller, C. A., Bowden, R. A., van Burik,

J.-A., Engelhard, D., Kanz, L. and U. Schumacher. (1997). Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35: 1353-1360.

Erjavec, Z. and P. E. Verweij. (2002). Recent progress in the diagnosis of fungal infections in the immunocompromised host. Drug Resist. Upd. 5:3-10.

Garey, K. W., Rege, M., Pai, M. P., Mingo, D. E., Suda, K. J., Turpin, R. S. and D. T. Beardon. (2006).

Time to initiation of therapy impacts patient mortality in patients with candidemia: a multi- institutional study. Lan. Infect. Dis. 43: 25-31.

Hendolin, P. H., Paulin, L., Koukila-Kähkölä, P., Anttila, V.-J., Malmberg, H., Richardson, M. and J.

Ylikoski. (2000). Panfungal PCR and multiplex liquid hybridization for detection of fungi in tissue specimens. J. Clin. Microbiol. 38: 4186-4192.

Henry, T., Iwen, O. and S. H. Hinrichs. (2000). Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38: 1510-1515. 55

Hinrikson, H. P., Hurst, S. F., Lott, T. J., Warnock, D. W. and C. J. Morrison. (2005). Asessment of

ribosomal large-subunit D1-D2, internal transcribed spacer 1, and internal transcribed spacer 2 regions as targets for molecular identification of medically important Aspergillus species. J. Clin. Microbiol. 43:

2093-2103.

Howard, S. J., Cerar, D., Anderson, M. J., Albarrag, A., Fisher, M. C., Pasqualotto, A. C., Laverdiere, M.,

Arendrup, M. C., Perlin, D. S. and D. W. Denning. (2009). Frequency and evolution of azole resistance in

Aspergillus fumigatus associated with treatment failure. Emerg. Infect. Dis. 15: 1068-1076.

Idemyor, V. ( 2003). Emerging opportunistic fungal infections: where are we heading? J. Nat. Med.

Assoc. 95: 1211-1215.

Imhof, A., Balagee, S. A., Fredericks, D. N., Englund, J. A. and K. A. Marr. (2004). Breakthrough fungal infections in stem cell transplant recipients receiving voriconazole. Clin. Infect. Dis. 39: 743-746.

Kami, M., Murashige, N., Fujihara, T., Sakagami, N. and Y. Tanaka. (2005).The mechanism for low yield of blood culture in invasive aspergilloisis; the clinical importance of antigen detection tests revisited.

Bone Marr. Transpl. 36:85-86.

Katoh, K., Toh, H. and T. Miyata. (2005). MAFFT version 5: improvement in accuracy of multiple sequence analysis. Nuc. Acid Res. 33: 511-518.

56

Katz, M. E., Dougall, A. M.,Weeks, K. and B. F. Cheetham. (2005). Multiple genetically distinct groups

revealed among clinical isolated identified as atypical Aspergillus fumigatus. J. Clin. Microbiol. 43: 551-

555.

Koch, S., Höhne, F.-M. and H.-J. Tietz. (2003). Incidence of systemic mycoses in autopsy material.

Mycoses. 47: 40-46.

Larone, D. H. (2002). Medically Important Fungi (4th Edition). ASM press, Washington D.C. 150, 154.

Luzzati, R., Amalfitano, G., Lazzarini, L., Soldani, F., Bellino, S., Solbiati, M., Danzi, M. C., Vento, S.,

Todeschini, G., Vivenza, C. and E. Concia. (2000). Nosocomial candidemia in non-neutropenic patients at an Italian tertiary care hospital. Eur. J. Clin. Microbiol. Infect. Dis. 19: 602-607.

Masclaux, F., Guého, E., de Hoog, G. S. and R. Christen. (1995). Phylogenetic relationships of human- pathogenic Cladosporium (Xylohypha) species inferred from partial LSU rRNA sequences. J. Med. Vet.

Mycol. 33: 327-338.

McGinnis, M. R. and L. Pasarell. (1998). In vitro testing of susceptibilities of filamentous ascomycetes to voriconazole, , and amphotericin B, with consideration of phylogenetic implications. J. Clin.

Microbiol. 36: 2353-2355.

Mitchell, T. G., Sandin, R. L., Bowman, B. H., Meyer, W. and W. G. Merz. (1994). Molecular mycology:

DNA probes and applications of PCR technology. J. Med. Vet. Mycol. 32: S1: 351-366. .

57

Moreira-Oliveira, M. S., Mikami, Y., Miyaji, M., Imai, T., Schreiber, A. Z. and M. L. Moretti. (2005).

Diagnosis of candidemia by polymerase chain reaction and blood culture: prospective study in a high-risk population and identification of variables associated with the development of candidemia. Eur. J. Clin.

Infect. Dis. 24: 721-726.

Morrell, M., Fraser, V. J. and M. H. Kolleff. (2005). Delaying the empiric treatment of Candida bloodstream infection until positive blood culture results are obtained: a potential risk factor for hospital mortality. Antimicrob. Agents Chemother. 49: 3640-3645.

Nguyen, M. H., Peacock, J. E. Jr., Morris, A. J., Tanner, D. C., Nguyen, M. L., Snydman, D. R.,

Wagener, M. M., Rinaldi, M. G. and V. L. Yu. (1996).The changing face of candidemia: emergence of non-Candida albicans species and antifungal resistance. Am. J. Med. 100: 617-623.

Obayashi, T., Negishi, K., Suzuki, T. and N. Funata. (2008). Reappraisal of the serum (1→3)-ß-D-glucan assay for the diagnosis of invasive fungal infections- a study based on autopsy cases from 6 years. Clin.

Infect. Dis. 46: 1864-1870.

O’Donnell, K. O., Sutton, D. A., Fothergill, A., McCarthy, D., Rinaldi, M. G., Brandt, M. E., Zhang, N. and D. M. Geiser. (2008). Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani species complex. J. Clin. Microbiol. 6: 2477-2490.

Pounder, J. I., Simmon, K. E., Barton, C. A., Hohmann, S. L., Brandt, M. E. and C. A. Petti. (2007).

Discovering potential pathogens among fungi identified as nonsporulating molds. J. Clin. Microbiol. 45:

568-571. 58

Rogers, S. O. (1994). Phylogenetic and taxonomic information from herbarium and mummified DNA. In

R. P. Adams, J. Miller, E. Goldenberg and J. E. Adams (eds.) Conservation of Plant Genes II: Utilization

of Ancient and Modern DNA. Missouri Botanical Gardens Press, Saint Louis, 47- 67.

Rogers. S. O. and A. J. Bendich. (1994). Extraction of total cellular DNA from plants, algae and fungi. In

S. B. Gelvin and R. A. Schilperoort (eds.) Plant Molecular Biology Manual (2nd edition), Kluwer

Academic Press, Dordrecht, the Netherlands, D1:1-8.

Rogers, S. O., Rehner, S., Bledsoe, C., Mueller, G. J. and J. F. Ammirati. (1989). Extraction of DNA from

Basidiomycetes for ribosomal DNA hybridizations. Can. J. Bot. 67: 1235-1243.

Ruhnke, M., Böhme, A., Buchheidt, D., Donhuijsen, K., Einsele, H., Enzensberger, R., Glasmacher, A.,

Gümbel, H., Heussel, C.-P., Karthaus, M., Lambrecht, E., Südhoff, T. and H. Szelényi. (2003). Diagnosis of invasive fungal infections in hematology and oncology. Guidelines of the Infectious Diseases Working

Party (AGIHO) of the German Society of Hematology and Oncology (DGHO). Ann. Hematol. 82(suppl.

2): S141-S148.

Sandhu, G. S., Kline, B. C., Stockman, L. and G. D. Roberts. (1995). Molecular probes for diagnosis of fungal infections. J. Clin. Microbiol. 33: 2913-2919.

Sangoi, A. R., Rogers, W. M., Longacre, T. A., Montoya, J. G., Baron E. J. and N. Banaei. (2009).

Challenges and pitfalls of morphological identification of fungal infections in histologic and cytological specimens: a ten-year retrospective review at a single institution. Am. J. Clin. Pathol. 131: 364-375.

59

Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. L., Levesque, C. A., Chen, W. and

Fungal Barcoding Consortium. (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a

universal DNA barcode marker for fungi. Proc. Nat. Acad. Sci. 109: 6241-6246.

Schofield, C. M., Murray, C. K., Horvath, E. E., Cancio, L. C., Kim, S. H., Wolf, S. E. and D. R.

Hospenthal. (2007). Correlation of culture with histopathology in fungal burn wound colonization and

infection. Burns. 33: 341-346.

Segal, B. H., Barnhart, L. A., Anderson, V. L., Walsh, T. J., Malech, H. L. and S. M. Holland. (2005).

Posaconazole as salvage therapy in patients with chronic granulomatous disease and invasive filamentous

fungal infection. Clin. Infect. Dis. 40: 1684-1688.

Serena, C., Pastor, F. J., Ortoneda, M., Capilla, J., Nolard, N. and J. Guarro. (2004). In vitro antifungal susceptibilities of uncommon Basidiomycetous yeasts. Antimicrob. Ag. Chemother. 48: 2724-2726.

Speiss, B., Seifarth, W., Hummel, M., Frank, O., Fabarius, A., Zheng, C., Mörz, H., Hehlmann, R. and D.

Buchheidt. (2007). DNA microarray-based detection and identification of fungal pathogens in clinical samples from neutropenic patients. J. Clin. Microbiol. 45: 3743-3753.

Sundarum, C., Umbala, P., Laxmi, V., Purohit, A. K., Prasad, V. S. S. V., Panigrahi, M., Sahu, B. P.,

Sarathi, M. V., Kaul, S., Borghain, R., Meena, A. K., Jayalakshmi, S. S., Suvarna, A., Mohandas, S. and

J. M. K. Murthy. (2006). Pathology of fungal infections of the central nervous system: 17 years’ experience from Southern India. Histopathology. 49: 396-405.

60

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and S. Kumar. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol. Biol. Evol. 28: 2731-2739.

White, T. J., Bruns, T., Lee, S. and J. Taylor. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for . In M. S. Innis and D. H. Gelfand (eds.) PCR Protocols: a Guide to Methods and Applications. Academic Press, New York. 315-322. 61

CHAPTER 3. RESULTS AND DISCUSSION

3.1 Detection of fungal DNA in whole blood and respiratory samples and

phylogenetic analysis of organisms found.

A total of one-hundred culture-negative (for bacteria and fungi) whole- blood samples and one- hundred respiratory samples culture-negative for bacteria collected from the University of Michigan

Hospital between 2005 and 2006 were retrospectively tested for the presence of fungal DNA utilizing

CTAB DNA extraction and PCR amplification of internal transcribed spacer (ITS) regions of ribosomal

DNA. After successful amplification and sequencing of rDNA regions, positive amplicons were identified using the BLASTn program of the National Center for Biotechnology Information database using default settings. Fungal species (or genera, where applicable) were compared with patient information including hospital locations where samples were collected, length of stay (for whole blood samples), gender and to assess potential correlations between patient demographics and organisms found.

3.1.1. BLASTn identification and patient information

Fungal DNA was detected in three whole-blood samples and nine respiratory samples

representing eight distinct fungal species. Species identified in blood included Engyodontium album (99%

maximum identity), Gibberella zeae (anamorph Fusarium graminearum 100% maximum identity), and

Cladosporium cladosporioides (100% maximum identity). The E. album was found in a 57 year-old

female in the hematology/oncology ward with a length of stay (L.O.S.) of 20 days, G. zeae in a 62 year-

old female in the dermatology/general surgery ward with L.O.S. of 13 days and C. cladosporioides in a

pediatric female less than 1 year-old in neonatal ICU with L.O.S. 2 days (Table 3.1).

Species identified in respiratory samples included Candida albicans (99%, 100%, 100% and

100% maximum identity), Aspergillus flavus (100% maximum identity), Aspergillus fumigatus (100%

maximum identity), Engyodontium album (97% maximum identity), Candida glabrata (98% maximum

identity), Alternaria alternata (99% maximum identity) and an uncultured Dothidiomycete closest to 62

Aureobasidium (99% maximum identity). Candida albicans was identified in four different patient

samples (one concurrently with C. glabrata). It was found in a 44 year-old male patient in the ICU, a 21 year-old male patient in the pulmonary unit, a 75 year-old female patient in cardiology, and a 73 year-old female patient in the pulmonary unit (also with C. glabrata). Aspergillus flavus was found in a 68 year- old male patient in the ICU, A. fumigatus in a 52 year-old female patient in the ICU, E. album in a 54 year-old female patient in the cardiology ICU, A. alternata was found in a 20 year-old female patient in the ICU and the unknown Dothidiomycete (with the highest probability being Aureobasidium pullulans) was found in a 77 year-old female patient in the ICU (Table 3.1). Tables 3.2, 3.3, 3.4 and 3.5 compare patient characteristics and PCR positive patient subsets.

Table 3.1 Summary of patient information, L.O.S., organisms found and sample type.

Patient Gender Age Hospital Location L.O.S. Organism Sample ID (years) (days) type 223 Female 57 Hematology/oncology 20 E. album Blood 235 Female 62 Dermatology/ General 13 G. zeae Blood surgery 406 Female <1 Neonatal ICU 2 C. cladosporioides Blood 527 Male 44 Medical ICU - C. albicans BAL 533 Male 21 Pulmonary - C. albicans Sputum 534 Male 68 Medical ICU - A. flavus Sputum 611 Female 52 Medical ICU - A. fumigatus BAL 612 Female 52 Medical ICU - Aureobasidium BAL (pullulans) 614 Female 54 Cardiology ICU - E. album Sputum 626 Female 75 Cardiology - C. albicans Sputum 632 Female 73 Pulmonary - C. albicans, C. Sputum (a,b) glabrata 802 Female 20 Medical ICU - A. alternata Sputum

Note: Patient 632 designations a and b are used to discriminate between the two species found in the

patient sample which are utilized separately in phylogenetic analysis. BAL stands for bronchoalveolar

lavage. Dashes indicate no L.O.S. information provided for sample. 63

Table 3.2 Average patient L.O.S. (t-test)

Patient population Mean days Standard deviation

PCR positive patients 18.191 42.495

PCR negative patients 11.66 9.07

Two-tailed p-value = 0.7923 95% Confidence Interval = -42.70192 to 55.76392 t-value = 0.2643

Standard error = 24.709

Table 3.3 Frequency of patients in ICU (Fisher’s exact chi-square)

Patient population ICU yes ICU no

PCR positive patients 7 5

PCR negative patients 56 132

Two-tailed p-value = 0.0537

Table 3.4 Frequency of male and female patients (Fisher’s exact chi-square)

Patient population Respiratory Blood

Male 53 50

Female 47 50

Two-tailed p-value = 0.7773

Table 3.5 Average patient age (t-test)

Type of sample Mean age Standard deviation

Blood 37.66 25.79688

Respiratory 41.6 26.46858

Two-tailed p-value = 0.2877 95% Confidence interval= -11.22864 to 3.3486416 t-value = 1.0660

Standard error= 3.696 64

3.1.2. Phylogenetic analysis

Thirteen ITS sequences from twelve patient samples were combined with the closest matches

from NCBI’s BLASTn results to infer species identification. All organisms found were in Phylum

Ascomycota falling within either the Saccharomycetales (Candida species) or Pezizomycotina subphyla.

In the latter, organisms identified were within the classes Dothidiomycetes (Aureobasidium,

Cladosporium, Alternaria), Eurotiomycetes (Aspergillus species) and (Engyodontium,

Gibberella/Fusarium). Reference sequences from related taxa were combined with the species identified to generate multiple sequence alignments (MSA) using MAFFT version 5.7 (Katoh et al., 2005) and small manual adjustments were made.

Phylogenetic trees from MSAs were generated using MEGA version 5 software (Tamura et. al.,

2011) using Neighbor-Joining algorithms. Bootstrap consensus trees were inferred from 500 replications.

Cladograms for ITS 1 (Figure 3.1), ITS 2 (Figure 3.2) and ITS 1 and 2 (Figure 3.3) are shown. 65 Figure 3.1 Neighbor-Joining tree utilizing ITS 1 sequences for patients 612 (BAL), 614 (sputum), and 802 (sputum). 614 Uncultured fungus clone f1Fc227 (GU721192) 100 Fungal sp. BMP2899 (HQ832973) 51 Engyodontium album (HQ115665) 99 Stachybotrys chartarum strain UAMH 6417 (AF206273) Fusarium culmorum strain BK985T (AF484956) 91 Aspergillus fumigatus strain WM 06.98 (EF567971) Aspergillus flavus (AF138287)

93 Paracoccidioides brasiliensis (AF322389) 98 Ajellomyces capsulatus var. farciminosus (AF322387) 612 Aureobasidium proteae strain CPC 2826 (JN712493)

100 Uncultured fungus clone MOTU_2827_G2Q8WDE03C6WP5 (JN905448) Aureobasidium pullulans strain M20 (JF340246) 802 Alternaria alternata isolate A69A (JQ781820)

100 Uncultured soil fungus bl30 (JQ666349) Alternaria arborescens strain C47.1 (JQ936187) Candida dubliniensis (AJ249484) 100 Candida albicans (AF217609)

0.05 Multiple Sequence Alignments (MSA) were generated using MAFFT version 5.7 (Katoh et al., 2005) from the bioinformatics toolkit at the Max Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/sections/alignment). Neighbor-Joining trees from MSAs were generated using MEGA version 5 software (Tamura et al., 2011) based on ITS regions amplified. Bootstrap consensus trees were inferred from 500 replications, and branches with less than 50% were collapsed. Accession numbers for reference organisms are shown in parentheses. Evolutionary distances were computed using the Tamura-Nei method. Panfungal primer pair ITS 2 and ITS 5 was used for amplification. 66 Figure 3.2 Neighbor-Joining tree utilizing ITS 2 sequences for patients 235 (blood), 406 (blood), and 533 (sputum).

100 611 63 Aspergillus fumigatus strain WM 06.98 (EF567971) 97 Aspergillus niger isolate C5334 (AF109327) 534 88 100 Aspergillus flavus (AF138287) 92 Paracoccidiodes brasiliensis (AF322389)

85 Ajellomyces capsulatus var. farciminosus (AF322387) 92 (U18352) Aureobasidium pullulans strain ATCC MYA-4643 (HQ999960) 100 406 Cladosporium cladosporioides strain ST1 (DQ780410)

80 Neurospora crassa strain ATCC MYA-4619 (GU327635) Stachybotrys chartarum strain UAMH 6417 (AF206273) 74 Fusarium oxysporum isolate r414 (HQ649821) 78

93 235 100 Fusarium culmorum strain BK985T (AF484956) Saccharomyces cerevisiae isolate UOA/HCPF 8620 (GQ376090) Candida dubliniensis (AJ249484) 533 100 100 Candida albicans (AF217609)

0.1 Multiple Sequence Alignments (MSA) were generated using MAFFT version 5.7 (Katoh et al., 2005) from the bioinformatics toolkit at the Max Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/sections/alignment). Neighbor-Joining trees from MSAs were generated using MEGA version 5 software (Tamura et al., 2011) based on ITS regions amplified. Bootstrap consensus trees were inferred from 500 replications, and branches with less than 50% support were collapsed. Accession numbers for reference organisms are shown in parentheses. Evolutionary distances were computed using the Tamura-Nei method. Panfungal primer pair ITS 3 and (ITS 4Z or ITS 4FS) was used for amplification. <<67>

67 Figure 3.3 Neighbor-Joining tree utilizing ITS 1 and ITS 2 sequences for patients 223 (blood), 527 (BAL), 626 (sputum), and 632 (a,b) (sputum). 100 Aspergillus fumigatus strain WM 06.98 (EF567971)

98 Aspergillus niger isolate C5334 (AF109327) Paracoccidioides brasiliensis (AF322389) 100 100 Ajellomyces capsulatus var. farciminosus (AF322387) 53 Trichophyton rubrum (U18352) Neurospora crassa strain ATCC MYA-4619 (GU327635)

100 99 Fusarium culmorum strain BK985T (AF484956)

98 223 100 Engyodontium album isolate 1066 (AM921716) Cladosporium cladosporioides strain ST1 (DQ780410) 100 632b 100 Candida glabrata strain W56873 (GU199447) Saccharomyces cerevisiae isolate UOA/HCPF 8620 (GQ376090) Candida dubliniensis isolate M334a (AJ249484)

76 Candida albicans (AF217609) 99 632a

100 527

64 626

0.05

Multiple Sequence Alignments (MSA) were generated using MAFFT version 5.7 (Katoh, et al., 2005) from the bioinformatics toolkit at the Max Planck Institute for Developmental Biology (http://toolkit.tuebingen.mpg.de/sections/alignment). Neighbor-Joining trees from MSAs were generated using MEGA version 5 software (Tamura et al., 2011) based on ITS regions amplified. Bootstrap consensus trees were inferred from 500 replications, and branches with less than 50% support were collapsed. Accession numbers for reference organisms are shown in parentheses. Evolutionary distances were computed using the Tamura-Nei method. Panfungal primer pairs LS266/V9D or (ITS 4Z or ITS 4FS) and ITS 5 were used for amplification.

<<65667<<7 68

3.1.3 Clinical review of organisms found

There are many different factors in analyzing whether fungi are likely pathogens in clinical

settings or simply ubiquitous organisms constantly present in macro and microenvironments that are

relatively harmless in consideration of disease. As mentioned before, dimorphic fungi in the Onygenales

are considered serious and potentially life-threatening organisms when isolated in clinical settings, whether patients are immunocompromised or without obvious risk factors. Many of them are also geographically restricted and clinical samples are tested for these fungi in endemic areas.

One important factor in clinical diagnosis and medical terminology is the concentration of melanin in the fungal cell wall. are biological compounds found in many different organisms that can physiologically protect organisms from cellular lysis (Bloomfield and Alexander, 1967), ionizing radiation (Dadachova et al., 2007) and even phagocytosis (da Silva et al., 2006). Accordingly, fungi are categorized as either dematiaceous or hyaline.

3.1.3.1 Dematiaceous fungi

Fungi with hyphae or yeast-like cells that appear brown in tissue are termed dematiaceous and potentially cause , and mycetomas (Gomez and Nosanchuk,

2003). They are commonly considered contaminants because of their ubiquity in the environment and their environmental role as saprobes. For example, a twenty-nine year review of laboratory records at the

M. D. Anderson Cancer Center in Houston, Texas associated only 11% (39 out of 348) of dematiaceous clinical isolates as associated with human disease (Ben-Ami et al., 2009). Infections caused by these organisms are rare, but the genera and species involved have been identified in over 100 species spanning

60 genera and most people that develop serious disease have few risk factors or are immunocompetent

(Brandt and Warnock, 2003).

The three dematiaceous fungi identified were Cladosporium cladosporioides (found in blood),

Aureobasidium (pullulans) (found in bronchoalveolar lavage) and Alternaria alternata (found in sputum).

They are often implicated in allergic disease but have been documented as being capable of causing more 69

serious infection (Revankar and Sutton, 2010; Dixon and Polak-Wyss, 1991). They are all taxonomically

classified within the Dothidiomycete class of the Pezizomycotina in the orders Capnodiales

(Cladosporium), Dothidiales (Aureobasidium) and Pleosporales (Alternaria).

The genus Cladosporium has undergone a great deal of taxonomic review in recent years, and

Cladosporium species sensu strictu are dematiaceous (mitosporic or asexual fungi) with

coronate scar types and teleomorphs of Davidiella species (Crous et al., 2007). Cladosporium

cladosporioides has rarely been shown to cause disease, although there are case reports in the medical literature including keratitis (Chew et al., 2009), as well as cutaneous and subcutaneous phaeohyphomycosis (Duquia et al., 2009; Gugnani et al., 2000). In the 2012 fungal outbreak due to contamination at a compounding pharmacy, a Cladosporium species was identified in at least one of the cases (http://www.cdc.gov/HAI/outbreaks/currentsituation/ reported 2/24/12). Surgical removal of cutaneous lesions is the general treatment, whereas subcutaneous infections may require extended treatment with chemotherapeutics.

The genus Aureobasidium has been shown to contain only one species, A. pullulans, with four

varieties: pullulans, melanigenum, subglaciale and namibiae. The first two varieties are the ones that have

been identified in mycoses, while the other two have only recently been isolated as taxonomic novelties

(Zalar et al., 2008). Aureobasidium has been implicated in catheter-related septicemia (Huang et al.,

2008; Kaczmarski et al., 1986) pediatric fungemia (Hawkes, 2005; Mershon-Shier et al., 2011),

peritonitis (Pritchard and Muir, 1987; Caporale et al., 1996; Clark et al., 1995; Iban҃ ez et al., 1997), and

meningitis (Huttova et al, 1998; Krcméry et al., 1998), as well as other diseases.

based on length of incubation, media selection, and concurrent infection with other pathogens has been

shown to contribute to delayed identification or initial misidentification with similar organisms

(Bolignano and Criseo, 2003; Chan et al., 2011; Pikazis et al., 2009). The increasing reports of this

saprobe as an opportunistic pathogen make molecular identification clinically important. Currently, there

is no standardized treatment for infection with Aureobasidium. 70

Alternaria alternata has primarily been identified in cutaneous and subcutaneous mycoses, largely in solid-organ transplant recipients including kidney (Romano et al., 2005; Vermeire et al., 2010) liver (Luque et al., 2006) and even composite tissue allografts (Bonatti et al., 2007). Subcutaneous phaeohyphomycosis has even been reported in an immunocompetent patient due to traumatic implantation (Sood et al., 2007). The most common pre-disposing factors in immunocompromised patients are frequent contact with dirt, diabetes mellitus, and skin trauma (Gallelli et al., 2006) Clinical presentation may include nodular swelling or ulcerative lesions requiring surgical intervention and antifungal chemotherapeutics.

3.1.3.2 Hyaline molds and Candida species

Hyaline molds, conversely, are species that are not heavily pigmented in tissues. The hyalohyphomycetes found in this research were Gibberella zeae, Engyodontium album, Aspergillus fumigatus and Aspergillus flavus. They are all members of the Pezizomycotina spanning two taxonomic classes: Sordariomycetes (G. zeae and E. album, order Hypocreales) and Eurotiomycetes (Aspergillus species, order Eurotiales).

Although the Gibberella zeae/Fusarium graminearum species we identified has not been reported as a human pathogen, it has been identified as one of the top ten fungal pathogens in plant pathology

(Dean et al., 2012) causing head blight in small grains. Many other phytopathogenic organisms in the

Fusarium species complex have been reported in human infection. A 2007 review of Fusarium infections in immunocompromised patients identified twelve species associated with disease with the three most numerous species being Fusarium solani, Fusarium oxysporum and Fusarium verticilliodes (Nucci and

Anaissie, 2007). Nosocomial fusariosis has also been reported due to colonization of a hospital water system by multiple species (Anaissie et al., 2001) and a phylogenetic analysis utilizing both multilocus sequence typing and amplified polymorphic length fragments revealed a clonal lineage of Fusarium oxysporum isolates from both patients at a Texas hospital and water supplies at three other geographically disparate hospitals in Texas, Maryland, and Washington (O’Donnell et al., 2004). Nucci and Anaissie 71

(2006) reported Fusarium species as being involved in keratitis, endophthalmitis, sinusitis, pneumonia, skin infection, fungemia and disseminated infection.

Some studies list Fusarium species as being only second to Aspergilli in cases of invasive hyalohyphomycosis (Dignani and Anaissie, 2004; Anaissie et al., 1988) and Fusarium species are listed as amongst the fungi most resistant to antifungal medications (Walsh et al., 2004; Hiemenz et al., 1990;

Alastruey-Izquierdo et al., 2008; O’Donnell et al., 2008). Systemic and disseminated infections in immunocompromised populations, particularly those with hematological malignancies, have mortality rates between 79% to 100% (Nucci et al., 2003; Nucci et al., 2004). Cutaneous nodules associated with disseminated infection often require surgical excision.

Engyodontium album, which was previously categorized in the genus and later

Tritirachium, was placed into its own genus in the 1970’s (Vuillemim, 1912; Limber, 1940; De Hoog,

1978). Very few case reports have been submitted in the literature, but it has been implicated in fungemia in a patient with AIDS (Macêdo, et al., 2007) and prosthetic valve replacement (Augustinsky et al.,

1990). Of all the correlations between patient data and species found this may be the most significant, having been found both times in 50 year-old female patients located in hemotology/oncology wards and in cardiology ICU units (sputum). One sequence (614) was somewhat different than the NCBI reference sequence, which may indicate a new species or variant (Figure 3.1).

Aspergillus fumigatus is second only to Candida species as the most frequent agent of invasive fungal infections and causes approximately 80% of all cases of invasive aspergillosis. Some factors that predispose them to higher levels of virulence compared to other Aspergilli include thermotolerance, size, and rates. There have been reports of it being able to survive at temperatures between

55°C and 75°C (Beffa et al., 1998, Ryckeboer et al., 2003) and has been shown to germinate faster than both A. flavus and A. niger at temperatures of 20°C, 30˚C, 37°C and 41°C (Araujo and Rodrigues, 2004).

Its spore size ranges from 2-3.5 μm, which allows it to reach lower respiratory passages while Aspergillus flavus range from 3-6 μm and are more associated with upper respiratory infections (Pasqualotto, 72

2009). Aspergillus fumigatus causes the majority of cases in allergic fungal sinusitis, allergic

bronchopulmonary aspergillosis (ABPA), chronic cavitary aspergillosis (CCA) and pulmonary

mycetomas. Conidial shifts to germination have been shown to produce the largest number of allergens

of any known organism (Federova et al., 2008). resistance has also been found in nonculturable

A. fumigatus respiratory samples in patients with chronic fungal disease, including those suffering from

ABPA and chronic pulmonary aspergillosis (Denning et al., 2011).

Aspergillus flavus is known as an opportunistic plant pathogen, attacking a broad range of agricultural crops and is the second leading cause of aspergillosis in humans and animals (Ascioglu et al.,

2002; Denning, 1998, 1991; Denning et al. 2003; Yu et al., 2005). It has less plant host specificity than both A. fumigatus and A. nidulans (St. Leger et al., 2000) and produces the most carcinogenic hepatotoxin currently known, aflatoxin B1 (Squire, 1989). Five studies conducted between 1967 and 2001 using mice as animal models utilizing intravenous inoculation for pathogenicity comparisons between Aspergillus species all demonstrated that A. flavus was more virulent than A. fumigatus (Ford et al., 1967; Nobre,

1977; Denning et al., 1997; Johnson et al., 2000; Mosquera et al., 2001), although the usual route of entry is via paranasal and pulmonary exposure.

Aspergillus flavus has been reported as the predominant Aspergillus species in tropical countries

with arid and semi-arid climates (Abdalla, 1988; Gupta et al., 1993; Adhikari et al., 2004) and a

retrospective analysis of published cases of chronic invasive sinus aspergillosis (CISA) between 1980 and

2009 in the medical literature revealed that most cases in North America were caused by A. fumigatus,

while A. flavus was the predominant pathogen worldwide (Webb and Vikram, 2010). It also noted that

North American cases tended to involve older patients with less favorable outcome and higher mortality

rates.

Infections by A. flavus tend to be cutaneous and subcutaneous as well as causing allergic

response. Chronic granulomatous sinusitis is particular to A. flavus infection in the same manner that

allergic bronchopulmonary aspergillosis is associated with A. fumigatus. 73

Aspergillus and Candida species have received the most attention and research focus in the field

of invasive mycoses, being the two most frequently encountered pathogens. Both have been reported as

notoriously difficult to recover from blood culture, even in cases of positive histology and disseminated

disease discovered at autopsy (Tarrand et al., 2003; Verweij and Meis, 2000; Barnes and Marr, 2007;

Berenguer et al., 1993). Candida species have been reported as the fourth leading cause of nosocomial

blood stream infections (BSI) in the United States (Wisplinghoff et al., 2004) and a study of death

certificates in the United States identified BSI’s as the tenth leading cause of death (Fried et al., 2003).

One nosocomial aspergillosis study has shown that less than one colony forming unit (CFU) per cubic

meter is enough to cause infection in high risk patients and that construction activities in or near hospitals

are likely causes of some nosocomial outbreaks (Vonberg and Gastmeier, 2006). From 1979-2000 sepsis due to fungal infections rose over two-hundred percent (Martin et al., 2003).

Nosocomial candidemia has become so widespread in intensive care units that antifungal prophylactics, particularly fluconazole, were once routinely given to patients at risk for fungal infections.

A national nosocomial infection study shows, however, that the numbers of cases of candidemia in intensive care units are decreasing even though the total number of cases are increasing, which means that nosocomial candidemia is spreading outside of the ICU into the general population and outpatient setting

(Trick et al., 2002; Hajjeh, et al., 2004; Kollef et al., 2008; Sofair et al., 2006). Studies have shown that

Candida species can be spread both among patients as well as between patients and hospital staff

(Admundsdottir et al., 2008; Bliss et al., 2008; Mean et al., 2008). They have also been implicated in polymicrobial bloodstream infections with bacteria, sometimes involving multiple Candida species (Klotz et al., 2007).

Both Candida species found in this study are commensals in humans, although out of the four patients that tested positive by PCR only one of them was in an Intensive Care Unit. Interestingly, the branch length in Figure 3.3 for 632b indicates that it may also be a new species or variant of C. glabrata.

An important consideration is that some of the test limitations with aerobic respiratory cultures is that 74

yeasts are considered normal upper respiratory flora, so even if fungal cultures had been ordered, they

may have been dismissed as potential pathogens. The most important factor is the immune status of the

host, as they are normally non-pathogenic and produce disease only in patients with compromised

immune systems, although and are common when the is only

slightly impaired. The other three locations of patients that tested positive for Candida were two from the

pulmonary ward and one from cardiology. Further consideration of patient information would be required

for consideration of these organisms as potential pathogens.

3.2 Discussion

The results of this study demonstrate that CTAB DNA extraction coupled with panfungal PCR and rDNA ITS analysis is sensitive enough to detect culture-negative organisms and specific enough to identify organisms down to a species level. Searches in the medical literature suggest that all of the species identified (except Gibberella zeae, as of June 2013) are capable of causing disease, which supports the premise that ubiquitous organisms should not be summarily dismissed as contaminants. The epidemiology of fungal infections continues to change as a growing number of fungal species are demonstrated as potential human pathogens. There is no indication that the list of fungi capable of causing human disease is lessening. It has been expanding for several decades and based on the diversity of fungal lifestyles, osmotrophic , and constant adaptation to changing environments, it will continue to do so. There are several variables likely to play a part.

3.2.1 Patient variables

The small sampling size and limited number of positive results in this analysis (3% for whole- blood samples and 9% for respiratory samples) made it difficult to produce a multivariate analysis with statistical significance. However, a general discussion of comparisons between total patient population and PCR-positive patient subsets is warranted. Additionally, the fact that individuals who were hospitalized (some from unknown causes) were shown to have fungi in their blood and sputum warrants further detailed examination. 75

Our values for patient L.O.S. did not follow trends in the literature, which indicate that patients with fungal infections on average have a longer L.O.S. than patients without fungal infections. The most likely reason our results are conflicting is that there were only three data points used in calculations for

PCR positive samples out of a total of seventy-six patients with L.O.S. data (approximately 3.9%). In our analysis the total patient population had a longer mean L.O.S. than PCR positive patients (17.93 days versus 11.66 days). Length of cold storage likely played a factor as cold storage of serum samples has been shown to decrease repeatability of detection of galactomannan signal by up to fifty percent (Johnson et al., 2013). The time necessary for optimization of DNA extraction for blood samples potentially contributed to delays in processing that may have reduced detectability of fungal DNA.

The frequency and percentage of patients in ICU locations showed significant increases in total

PCR positive patients as well as the subset for respiratory samples compared to total patient data. Only

31.5% (sixty-three out of two hundred) of total samples were collected from ICU locations, but 58.33%

(seven out of twelve) of all PCR positive patients and 66.6% (six out of nine) of patients with positive respiratory samples were overrepresented in patient samples. Only one out of three (33.3%) positive blood samples came from an ICU location. The overall trend in our analysis concurs with the literature that identifies increased instances of fungal infections in ICU locations.

The role of gender as a patient variable for predisposition towards fungal infections usually refers to male patients being more likely to develop disease. Again, our results conflict with the general trends.

Fifty-one percent of our total population was male, yet 100% of our positive blood samples (three out of three) and 66.6% (six out of nine) of our positive respiratory samples occurred in female patients.

Seventy-five percent (nine out of twelve) of the total number of PCR positive patients were female. Two out of the three positive male patients (66.6%) came from ICU locations whereas five out of nine (55.5%) of the female patients came from ICUs. Future studies specifically comparing gender and hospital location would be useful to investigate these anomalies. 76

Comparisons of average patient age between total populations and PCR positive patients follow our statistics reported for ICU patients. The mean age for all patients was 39.63 years whereas the mean age for all PCR positive patients was 54.81 years and patients with PCR positive respiratory samples was

53.77. Again, average age of PCR positive blood samples was higher than in all patients at 39.66 years.

General reviews of multivariate patient analyses for invasive fungal infections include patient information outside of our study, particularly mortality rates, primary diagnosis, and overall costs of IFIs as well as other variables useful in broader analyses of patient information. One study analyzing the economic impact of aspergillosis across patient subgroups based on the 2003 Nationwide Inpatient

Sample (NIS) and fiscal year 2003 Medicare Provider Analysis and Review (MedPAR) reported that patients diagnosed with primary or secondary aspergillosis had higher mean age (55.6 years versus 48.2 years), L.O.S. (17.7 days versus 7.9 days) and mortality rate (17.1 percent versus 2.2 percent) than their non-aspergillosis counterparts (Tong et al., 2009).

An analysis based on the National Hospital Discharge Survey (NHDS) and Maryland Hospital

Discharge Data Survey (MDHDDS) estimated first-year direct health costs due to four major systemic fungal infections (candidiasis, aspergillosis, cryptococcus and histoplasmosis) as almost eight times greater than costs in normal patient populations ($31,200 versus $4,094). Fungal infections accounted for

0.24% (2.6 billion dollars) of the 1998 total health expenditures in the United States (1.1 trillion dollars) even though fungal infections occur in only 0.03% of the total U.S. population (Wilson et al., 2002).

A retrospective Australian study compared hematology patients with scedosporiosis to hematology patients without fungal infection to examine differences in hospital costs, L.O.S. and mortality. Multivariate analysis showed that hospital costs were almost two times greater in patients with fungal infection, with a longer L.O.S. of an average thirteen days, and an in-patient mortality rate thirty- eight times higher than their non-scedosporosis counterparts (Heng et al., 2012). 77

3.2.2 Environmental variables

There have been hypotheses offered that suggest that climate change and global warming will

increase the number of fungal infections in mammals due to decreases in the temperature gradient

between host and environment. This may reduce the effectiveness of endothermy as a primary host

defense against fungal infection. The authors also posit that these changes will decrease geographic

restrictions of pathogenic species and increase selection for thermotolerance in fungal species which may

also enable increased transition of plant to animal pathogenicity (Garcia-Solache and Casadevall, 2010).

Global geographic variations in drug susceptibility to fluconazole and voriconazole have been

reported in an 8.5 year surveillance study focused on Candida species and other yeasts (Pfaller et al.,

2007). They also report that 33% of the non-Candida yeasts were unidentified, suggesting among other

factors that there are shortcomings in the use of commercial identification systems in clinical laboratories.

Emerging drug resistance has even been tied to agricultural practices. Azoles are the only

antifungal compounds used in both agriculture and clinical settings and studies in Europe have

demonstrated the emergence of azole resistance in Aspergillus fumigatus as correlated with widespread

agricultural usage (Verweij et al., 2009; Hof, 2008; Meneau and Sanglard, 2005).

Institutional variables such as hospital construction and type of air filtration system have been

shown to be related to incidences of fungal infections, most notably with nosocomial IA. One

experimental study showed a decreased incidence of IA (from 13.2% to 1.6%) in high-risk patients after relocation of an adult hematology unit and installation of positive pressure isolation systems in addition to laminar air flow (Bénet et al., 2007). In a different outbreak of nosocomial IA that coincided with hospital construction projects a hematology unit was relocated, impermeable barriers were installed at the construction site, and high-risk patients were prophylactically treated with voriconazole to prevent breakthrough infection (Chang et al., 2008). The authors suggest a pre-emptive approach to prevention of nosocomial outbreak including concerted communications between clinicians, administrators and 78

construction engineers. Utilization of these strategies, however, would have to take into account potential

increases in antifungal drug resistance if a prophylactic protocol is used.

3.2.3 Clinical applications

Clinical diagnosticians have begun focusing more on the use of molecular techniques in

combination with traditional reliance on culture and microscopy as indicators of both negative predictive

values (NPV, certainty of negative results) and positive predictive values (PPV, certainty of positive

results) of potential fungal infection. A prospective multicenter study published in March, 2013 by Lass-

Flörl and colleagues examined 206 microscopy negative BAL, tissue and fluid specimens in non-disease- specific patient populations. Patient records were reviewed and patients meeting the EORTC/MSG guidelines for proven, probable, or possible cases of IFI were selected. CTAB DNA extraction and ITS 3 and 4 primers amplifying the rDNA ITS2 region were used for analysis and results showed that broad- range PCR was comparable to microscopy with concordance between the two as greater than 80% (Lass-

Flörl et al., 2013). A five-year study examining the implementation of ITS sequence analysis to clinical mold isolates showed that ITS analysis successfully identified 78.6% of isolates with 57.1% at species level, whereas extended phenotypic characterization of isolates identified only 47.6% of isolates, with only 13.3% as species specific (Ciardo et al., 2010).

A prospective evaluation of Aspergillus PCR correlated with EORTC/MSG diagnostic classifications showed that the inclusion of two consecutive PCR positive samples for diagnosis of proven or probable fungal infection resulted in a negative predictive value of 100%, which could have reduced the costs of unnecessary empiric drug administration by up to 37% and subsequent patient exposure to chemotherapeutic toxicity (Halliday et al., 2005).

A report from a German tertiary care hospital compared overall survival (OS) rates in patients with IFIs receiving myelosuppressive (treatment that slows the production of blood cells) from 1995 to 2006. OS increased and mortality rates decreased during the period from 2002-2006 due to controlled primary disease and earlier administration of newer antifungals based on the inclusion of 79

molecular diagnostics, including panfungal BAL PCR and detection of GM (Hahn-Ast et al., 2010). A study from Japan also tested the clinical applicability of species-specific PCR and panfungal PCR in addition to culture, serodiagnostic tests, computed tomography and bronchoscopy in order to address shortcomings inherent in each diagnostic test. PCR in particular was useful for its specificity for identification of less common fungal species and selection of appropriate antifungal therapy (Sugawara et al., 2013).

3.2.4 The era of genomics

As the list of sequenced fungal genomes grows, comparative genomic analyses (CGA) are being used more frequently to identify differences between pathogenic and non-pathogenic fungi. Specific gene families have already been identified as being involved in pathogenicity which may allow researchers to predict which species or clades may be more likely to become emerging pathogens. One study comparing

Coccidioides to other organisms in the Onygenales revealed decreases in gene families associated with plant digestion and increases in gene families associated with digestion of animal proteins (Sharpton et al., 2009). Another study notes that gene duplications and gene family expansions occur more frequently in subtelomeric regions and that unlike bacterial pathogens horizontal gene transfer (HGT) does not appear to have significantly contributed to the development of fungal virulence (Moran et al., 2011).

Research on the human mycobiome (the collection of all the fungal communities present in the human body) which includes non-culture-based molecular testing has revealed diverse fungal communities in anatomical niches such as the mouth (Ghannoum et al., 2010), nasal mucosa (Buzina et al., 2002), scalp (Park et al., 2012) and vagina (Drell et al., 2013). Ghannoum’s study raises the possibility that normally cultivable organisms exist in low levels in healthy individuals in difficult to culture states. Mycobiome applications towards specific patient populations such as those suffering from acute graft-versus-host disease (van der Velden et al., 2013), (Moyes and

Naglik, 2012) and lung transplant recipients (Charlson et al., 2012) are already underway. 80

3.3 Conclusions

What makes this study unique is that instead of targeting specific populations for molecular analysis starting with previous knowledge of patient demographics such as underlying diagnosis, total

parenteral nutrition (TPN) usage, indwelling devices, antibiotic administration or other risk factors

already associated with increased incidence of fungal infection, we performed molecular testing devoid of

patient information and later compared results with limited patient data excluding culture as a criteria for

potential diagnosis. The blind nature of this study served to demonstrate the sensitivity of basic molecular

techniques that can easily be included in diagnostic settings, with less training than is necessary for

specialized technicians that identify fungi based on phenotypic growth.

The speed at which molecular biology is changing as genomics and metagenomics become

common areas of study promises that much more will be understood about the fungal Kingdom.

Continued phylogenetic analysis will allow a better understanding of relationships between fungi and will

undoubtedly lead to a better understanding of taxonomic relations as well as provide a bridge between

clinicians, academics and evolutionary biologists to collaborate in both medical and environmental

mycology.

Although currently not included in the EORTC/MSG and FDA guidelines used as a baseline for

medical criteria, the continued streamlining and standardization of DNA extraction techniques and PCR

presents the possibility that it may soon be included with traditional microbiological techniques to address

the needs of patients at risk. The European Aspergillus PCR Initiative (EAPCRI) has been working to

standardize protocols for DNA extraction and PCR for diagnosis of IA (White et al., 2006; White and

Barnes, 2009; White et al., 2010; White et al., 2011) to aid physicians tasked with the challenge of

diagnosing potential and nonspecific fungal infection. The question is not if PCR will be included in

criteria for diagnosis of fungal infection, but how soon standardization will be achieved through

longitudinal and multilateral studies on prospective applications. Although PPVs are widely variable,

NPVs remain high and PCR in conjunction with culture and histology may allow physicians to more 81

rapidly and accurately rule out potential IFIs in patient subgroups and avoid unnecessary empiric and

prophylactic therapy or more accurately categorize high-risk patients with possible and probable fungal infection so that they can be quickly and appropriately treated.

The most important issues revealed in this research are that basic molecular techniques can be applied to clinical samples and that they can be used to identify both well-studied and emerging fungal pathogens. Approximately 10,000 cultures are ordered annually at the University of Michigan Hospital where the samples were obtained and molecular testing in conjunction with standard clinical microbiological technique has the potential to save hundreds of annually. If our results are applicable to this population, fungi might potentially be detected in 300 to 900 of these patients.

Additional testing and medical evaluation could then be focused on these patients for the possibility of fungal infections. 82

3.4 Literature cited

Abdalla, M. H. (1988). Prevalence of airborne Aspergillus flavus in Khartoum (Sudan) airspora with

reference to dusty weather and inoculum survival in simulated summer conditions. Mycopathologia.

104:137-141.

Adhikari, A., Sen, M. M., Gupta-Bhattacharya, S., and S. Chanda. (2004). Airborne viable, non-viable,

and allergenic fungi in a rural agricultural area of India: a 2-year study at five outdoor sampling stations.

Sci. Total Environ. 326: 123-141.

Admundsdottir, L. R., Erlendsdottir, H., Haraldsson, G., Gus, H., Xu, J. and M. Gottfredsson. (2008).

Molecular epidemiology of candidemia: evidence of clusters of smoldering nosocomial infections. Clin.

Infect. Dis. 47: e17-e24.

Alastruey-Izquierdo, A., Cuenca-Estrella, M., Monzon, A., Mellado, E. and J. L. Rodriquez-Judela.

(2008). Antifungal susceptibility profile of clinical Fusarium spp. Isolates identified by molecular methods. J. Antimicrob. Chemother. 61: 805-809.

Aksenov, S. I., Babyeva, I. P. and V. I. Golubev. (1973).On the mechanisms of of micro- organisms to conditions of extreme low humidity. Life Sci. Space Res. 11: 55-61.

Araujo, R. and A. G. Rodrigues. (2004). Variability of germinative potential among pathogenic species of

Aspergillus. J Clin. Microbiol. 42: 4335-4337.

Ascioglu, S., Rex, J. H., de Pauw, B., Bennett, J. E., Bille, J., Crokaert, F., Denning, D. W., Donnelly, J.

P., Edwards, J. E., Erjavec, Z., Fiere, D., Lortholary, O., Maertens, J., Selleslag, D., Stevens, D. A. and T. 83

J. Walsh. (2002). Defining opportunistic invasive fungal infections in immunocompromised patients with

cancer: An international consensus. Clin. Infect. Dis. 34: 7-14.

Barnes, P. D. and K. A. Marr. (2007). Risks, diagnosis and outcomes of invasive fungal infections in haematopoietic stem cell transplant recipients. Br. J. Haematol. 139: 519-531.

Beffa, T., Staib, F., Fischer, J.L., Lyon, P. F., Gumowski, P., Marfenina, O. E., Dunoyer-Geindre, S.,

Georgen, F., Roch-Susuki, R., Gallaz, L. and J. P. Latgé. (1998). Mycological control and surveillance of biological waste and compost. Med. Mycol. 36(suppl. 1): 137-145.

Bénet, T., Nicolle, M.-C., Thiebaut, A., Piens, M.-A., Nicolini, F.-E., Thomas, X., Picot, S., Michallet, M. and P. Vanhems. Reduction of invasive aspergillosis incidence among immunocompromised patients after control of environmental exposure. Clin. Infect. Dis. 45: 682-686.

Berenguer, J., Buck, M., Witebsky, F., Stock, F., Pizzo, P. A. and T. J. Walsh. (1993). Lysis- centrifugation blood cultures in the detection of tissue-proven invasive candidiasis: disseminated versus single-organ infection. Diagn. Microbiol. Infect. Dis. 17: 103-109.

Bliss, J. M., Basavegowda, K. P., Watson, W. J., Sheikh, A. U. and R. M. Ryan. (2008). Vertical and horizontal transmission of Candida albicans in very low birth weight infants using DNA fingerprinting techniques. Pediatr. Infect. Dis. J. 27:231-235.

Bodey, G., Bueltmann, B., Duguid, W., Gibbs, D., Hanak, H., Hotchi, M., Mall, G., Martino, P., Meunier,

F., Milliken, S., Naoe, S., Okudaira, M., Scevola, D. and J. van’t Wout. (1992). Fungal infections in cancer patients: An international autopsy survey. Eur. J. Clin. Microbiol. Infect. Dis. 11: 99-109. 84

Buzina, W., Braun, H., Freudenschuss, K., Lackner, A., Habermann, W. and H. Stammberger. (2002).

Fungal - as found in nasal mucosa. Med. Mycol. 41: 149-161.

Caporale, N. E., Calegari, L., Perez, D. and E. Gezuele. (1996). Peritoneal catheter colonization and peritonitis with Aureobasidium pullulans. Perit. Dial. Int. 16: 97-98.

Chang, C. C., Cheng, A. C., Devitt, B., Hughes, A. J., Campbell, P., Styles, K., Low, J. and E. Athan.

(2008). Successful control of an outbreak of invasive aspergillosis in a regional haematology unit during hospital construction works. J. Hosp. Infect. 69: 33-38.

Charleson, E. S., Diamond, J. M., Bittinger, K., Fitzgerald, A. S., Yadav, A., Haas, A. R., Bushman, F. D. and R. G. Collman. (2012). Lung-enriched organisms and aberrant bacterial and fungal microbiota after lung transplant. Am. J. Respir. Crit. Care Med. 186: 536-545.

Chen, L.-C., Blank, E. and A. Casadevall. (1996). Extracellular proteinase activity of Cryptococcus neoformans. Clin. Diagn. Lab. Immunol. 3: 570-574.

Ciardo, D. E., Lucke, K., Imhof, A., Bloemberg, G. V. and E. C. Böttger. (2010). Systematic internal transcribed spacer sequence analysis for identification of clinical mold isolates in diagnostic mycology: a

5-year study. J. Clin. Microbiol. 48: 2809-2813.

Clark, E. C., Silver, S. M., Hollick, G. E. and M. G. Rinaldi. (1995). Continuous ambulatory peritoneal dialysis complicated by Aureobasidium pullulans peritonitis. Am. J. Nephrol. 15: 353-355. 85

Cox, G. M., Mukherjee, J., Cole, G. T., Casadevall, A. and J. R. Perfect. (2000). Urease as a virulence factor in experimental cryptococcosis. Infect. Immun. 68: 443-448.

Cui, L., Morris, A. and E. Ghedin. (2013). The human mycobiome in health and disease. Genome Med.

30: 63.

De Hoog, G.S. (1978). Notes on some fungicolous hyphomycetes and their relatives. Persoonia, 10(1),

33-81.

Dean, R., Van Kan, J. A. L., Pretorius, Z. A., Hammond-Kosack, K. E., Di Pietro, A., Spanu, P. D., Rudd,

J.J., Dickman, M., Kahmann, R., Ellis, J. and G. D. Foster. (2012). The Top 10 fungal pathogens in molecular plant pathology. Mol. Pl. Pathol. 13(4): 414-430.

Denning, D. W., Radford, S. A., Oakley, K. L., Hall, L., Johnson, E. M. and D. W. Warnock. (1997).

Correlation between in vitro susceptibility testing to itraconazole and in vivo outcome of Aspergillus fumigatus infection. J. Antimicrob. Chemother. 40: 401-414.

Denning, D. W. (1998). Invasive aspergillosis. Clin. Infect. Dis. 26: 781-805.

Denning, D. W., Follansbee S., Scolaro, M., Norris, S., Edelstein, D. and D. A. Stevens. (1991).

Pulmonary aspergillosis in AIDS. N. Eng. J. Med. 324: 654-662.

Denning, D. W., Riniotis, K., Dobrashian, R. and H. Sambatakou. (2003). Chronic cavitary and fibrosing pulmonary and pleural aspergillosis: Case series, proposed nomenclature and review. Clin. Infect. Dis.

37(suppl. 3): S265-S280. 86

Denning, D. W., Park, S., Lass-Flörl, C., Fraczek, M. G., Kirwan, M., Gore, R., Smith, J., Bueod, A.,

Moore, C. B., Bowyer, P. and D. S. Perlin. (2011). High-frequency triazole resistance found in nonculturable Aspergillus fumigatus from lungs of patients with chronic fungal disease. Clin. Infect. Dis.

52: 1123-1129.

Drell, T., Lillsaar, T., Tummeleht, L., Simm, J., Aaspo҃ llu, A., Väin, E., Saarma, I., Salumets, A.,

Donders, G.G.G. and M. Metsis. (2013). Characterization of the vaginal micro- and mycobiome in asymptomatic reproductive-age Estonian women. PLoS ONE 8(1): e54379.

Doi:10.1371/journal.pone.0054379.

Federova, N. D., Khaldi, N., Joardar, V. S., Maiti, R., Amedeo, P., Anderson, M. J., Crabtree, J., Silva, J.

C., Badger, J. H., Albarraq, A., Angiuolis, S., Bussey, H., Bowyer, P., Cotty, P. J., Dyer, P. S., Egan, A.,

Galens, K., Fraser-Ligget, C. M., Haas, B. J., Inman, J. M., Kent, R., Lemieux, S., Malarazi, I., Orvis, J.,

Roemer, T., Ronning, C. M., Sundarum, J. P., Sutton, G., Venter, J. C., White, O. R., Whitty, B. R.,

Youngman, P., Wolfe, K. H., Goldman, G. H., Wortman, J. R., Jiang, B. and D. W. Denning. (2008).

Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. PLoS Genet 4(4): e1000046. doi:10.1371/journal.pgen.1000046.

Ford, S. and L. Friedman. (1967). Experimental study of the pathogenicity of aspergilli for mice. J

Bacteriol. 94: 928-933.

Freid, V. M., Prager, K., MacKay, A. P. and H. Xia. Health, United States, 2003. Hyattsville, Maryland:

National Center for Health Statistics. 87

Gallelli, B., Vivani, M., Nebuloni, M.., Marzano, A. V., Pozzi, C., Piergiorgio, M. and G. B. Fogazzi.

(2006). Skin infection due to Alternaria species in kidney allograft recipients: report of a new case and review of the literature. J. Nephrol. 19(5): 668-672.

Garcia-Rivera, J. and A. Casadevall. (2001). Melanization of Cryptococcus neoformans reduces its suscsptibility to the antimicrobial effects of silver nitrate. Med. Mycol. 37: 175-181.

Ghannoum, M. A., Jurevic, R. J., Mukherjee, P. K., Cui, F., Sikaroodi, M., Naqvi, A. and P. M. Gillevet.

(2010). Characterization of the oral fungal microbiome (Mycobiome) in healthy individuals. PLos Pathog

6(1): e1000713.doi:10.1371/journal.ppat.1000713.

Guinea, J., Padilla, C., Escribano, P., Mun҃ oz, P., Padilla, B., Gijón, P. and E. Bouza. (2013). Evaluation of MycAssay™ Aspergillus for diagnosis of invasive pulmonary aspergillosis in patients without hematological cancer. PLoS ONE 8(4): e61545.doi:10.1371/journal.pone.0061545.

Gupta, S. K., Pereira, B. M., and A. B. Singh. (1993). Survey of airborne culturable and non-culturable fungi at different sites in Delhi metropolis. Asian Pac. J. Allergy Immunol. 11: 19-28.

Hahn-Ast, C., Glasmacher, A., Mückter, S., Schmitz, A., Kraemer, A., Marklein, G., Brossart, P. and M. von Lillienfeld-Toal. (2010). Overall survival and fungal infection-related mortality in patients with invasive fungal infection and neutropenia after myelosuppressive chemotherapy in a tertiary care centre from 1995-2006. J. Antimicrob. Chemother. 65: 761-768.

Halliday, C., Hoile, R., Sorrell, T., James, G., Yadav, S., Shaw, P., Bleakley, M., Bradstock, K. and S.

Chen. (2005). Role of prospective screening of blood for invasive aspergillosis by polymerase chain 88

reaction in febrile neutropenic recipients of haematopoietic stem cell transplants and patients with acute leukemia. Br. J. Haem. 132: 478-486.

Hajjeh, R. A., Sofair, A. N., Harrison, L. H., Lyon, G. M., Arthington-Skaggs, B. A., Mirza, S. A.,

Phelan, M., Morgan, J., Lee-Yang, W., Ciblak, M. A., Benjamin, L. E., Sanza, L. T., Huie, S., Yeo, S. F.,

Brandt, M. E. and D. W. Warnock. (2004). Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates collected from 1998-2000 in a population-based active surveillance program. J. Clin. Microbiol. 42: 1519-1527.

Hawksworth, D. L. and A. Y. Rossman. (1997). Where are all the undescribed fungi? Phytopathology. 87:

888-891.

Heng, S.-C., Slavin, M. A., Chen, S. C.-A., Heath, C. H., Nguyen, Q., Billah, B., Nation, R. L. and D. C.

M. Kong. (2012). Hospital costs, length of stay and mortality attributable to invasive scedosporosis in haematology patients. J. Antimicrob. Chemother. 67: 2274-2282.

Hiemenz, J. W., Kennedy, B. and K. Kwon-Chung. (1990). Invasive fusariosis associated with an injury with a stingray barb. J. Med. Vet. Mycol. 28: 209-213.

Hof, H. (2008). Is there a serious risk of resistance development to azoles among fungi due to widespread use and long-term application of azole antifungals in medicine? Drug Resist. Update. 11: 25-31.

Horvath, L. L., George, B. J., Murray, C. K., Harrison, L. S. and D. R. Hospenthal. (2004). Direct comparison of the BACTEC 9240 and BacT/ALERT 3D automated blood culture systems for Candida growth detection. J. Clin. Microbiol. 42: 115-118. 89

Huffnagle, G.B. and M.C. Noverr. (2013). The emerging world of the fungal microbiome. Trends

Microbiol. 21: 334-340.

Huttova, M., Kralinsky, K., Horn, J., Marinova, I., Iligova, K., Fric, J., Spanik, S. Jr., Filka, J., Uher, J.,

Kurak, J. and V. Krcmery, Jr. (1998). Prospective study of nosocomial in children-

report of 10 cases. Scand. J. Infect. Dis. 30: 485-487.

Ibanez, P. R., Chacon, J., Fidalgo, A., Martin, J., Paraiso, V. and J. L. Munoz-Bellido. (1997). Peritonitis by Aureobasidium pullulans in continuous ambulatory peritoneal dialysis. Nephrol. Dial. Transplant. 12:

1544-1545.

Johnson, E. M., Oakley, K. L., Radford, S. A., Moore, C. B., Warn, P., Warnock, D. W. and D. W.

Denning. (2000). Lack of correlation of in vitro amphotericin B susceptibility testing with outcome in a murine model of Aspergillus. J Antimicrob. Chemother. 45: 85-93.

Johnson, G.L., Sarker, S.-J., Hill, K., Tsitsikas, D.A., Morin, A., Bustin, S.A. and S.G. Agrawal. (2013).

Significant decline in galactomannan signal during storage of clinical serum samples. Int. J. Mol.

Sciences. 14: 12970-12977.

Katoh, K., Kuma, K., Toh, H. and T. Miyata. (2005). MAFFT version 5: Improvement in accuracy of multiple sequence analysis. Nuc. Acid Res. 33: 511-518. 90

Klotz, S. A., Chasin, B. S., Powell, B., Gaur, N. K. and P. N. Lipke. (2007). Polymicrobial bloodstream

infections involving Candida species: analysis of patients and review of the literature. Diag. Microbiol.

Infect. Dis. 59: 401-406.

Kourkoumpetis, T. K., Fuchs, B. B., Coleman, J. J., Desalermos, A. and E. Mylonakis. (2012).

Polymerase chain reaction-based assays for the diagnosis of invasive fungal infections. Clin. Infect. Dis.

54: 1322-1331.

Kollef, M. H., Napolitano, L. M., Solomkin, J. S., Wunderink, R. G., Bae, I. G., Fowler, V. G., Balk, R.

A., Stevens, D. L., Rahal, J. J., Shorr, A. F., Linden, P. K. and S. T. Micek. (2008). Health-care-

associated infection (HAI): a critical appraisal of the emerging threat- proceedings of the HAI summit.

Clin. Infect. Dis. 47(suppl. 2): S55-S99.

Krcmery, V., Spanik, S., Jr., Danisovicova, A., Jesenska, Z. and M. Blahova. (1994). Aureobasidium mansoni meningitis in a leukemia patient successfully treated with amphotericin B. Chemotherapy. 40:

70-71.

Kwon-Chung, K. J. and J. E. Bennett. (1992). Medical Mycology. Philadelphia: Lea & Febiger.

Lass-Flörl, C., Griff, K., Mayr, A., Petzer, A., Gastl, G., Bonatti, H., Freund, M., Kropshofer, G., Dierich,

M. P. and D. Nachbaur. (2005). Epidemiology and outcome of infections due to Aspergillus terreus: 10- year single centre experience. Br. J. Haem. 131: 201-207.

Lass-Flörl, C., Mutschlechner, W., Aigner, M., Grif, K., Marth, C., Girschikofsky, M., Grander, W.,

Greil, R., Russ, G., Cerkl, P., Eller, M., Kropshofer, G., Eschertzhuber, S., Kathrein, H., Schmid, S., Beer, 91

R., Lorenz, I., Theurl, I. and D. Nachbaur. (2013). Utility of PCR in diagnosis of invasive fungal

infections: real-life data from a multicenter study. J. Clin. Microbiol. 51: 863-868.

Lazera, M. S., Pires, F. D. A., Camillo-Coura, L., Nishikawa, M. M., Bezerra, C. C., Trilles, L. and B.

Wanke. (1996). Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming

hollows in living trees. J. Med. Vet. Mycol. 34: 127-131.

Lilac, D. (2012). Unraveling fungal immunity through primary immune deficiencies. Curr. Opin.

Microbiol. 15: 420-426.

Limber, D.B. (1940). A new form of the genus Moniliaceae. Mycologia, 32: 23-30.

Loose, D. S., Stover, E. P., Restrepo, A., Stevens, D. A. and D. Feldman. (1983). Estradiol binds to a

receptor-like cytosol binding protein and initiates a biological response in Paracoccidioides brasiliensis.

Proc. Natl. Acad. Sci. USA. 80: 7659-7663.

Lott, T. J., Fundyga, R. E., Kuykendall, R. J. and J. Arnold. (2005). The human commensal yeast,

Candida albicans, has an ancient origin. Fung. Genet. Biol. 42: 444-451.

McClelland, E. E., Hobbs, L. M., Rivera, J., Casadevall, A., Potts, W. K., Smith, J. M. and J. J. Ory.

(2013).The role of host gender in the pathogenesis of Cryptococcus neoformans infections. PLoS ONE

8(5): e63632.doi:10.1371/journal.pone.0063632.

Mean, M., Marchetti, O. and T. Calandra. (2008). Bench-to-bedside review: Candida infections in the intensive care unit. Crit. Care. 12: 204-212. 92

Meneau, I. and D. Sanglard. (2005). Azole and fungicide resistance in clinical and environmental

Aspergillus fumigatus isolates. Med. Mycol. 43(suppl 1): S307-S311.

Mora, C., Tittensor, D. P., Simpson, A. G. B. and B. Worm. (2011). How many species are there on earth and in the ocean? PLoS Biol 9(8): e1001127.doi:10.1371/journal.pbio.1001127.

Moran, G. P., Coleman, D. C. and D. J. Sullivan. (2011). Comparative genomics and the evolution of pathogenicity in human pathogenic fungi. Euk. Cell. 10: 34-42.

Mosquera, J., Warn, P. A., Morrissey, J., Moore, C. B., Gil-Lamaignere, C. and D. W. Denning. (2001).

Susceptibility testing of Aspergillus flavus: inoculum dependence with itraconazole and lack of correlation between susceptibility to amphotericin B in vitro and outcome in vivo. Antimicrob. Agents

Chemother. 45: 1456-1462.

Moyes, D.L. and J.R. Naglik. (2012). The mycobiome: influencing IBD severity. Cell Host Microbe. 11:

551-552.

Nobre, G. (1977). Sensitivity to 5-fluorocytoseine and virulence for mice of some human isolates of

Aspergillus. Mycopathologia. 62: 57-60.

Nucci, M., Enaissie, E. J., Quieroz-Telles, F., Martins, C. A., Trabasso, P., Solza, C., Magnini, C.,

Simo҃ es, B. P., Colombo, A. L., Vaz, J., Levy, C. E., Costa, S., Moriera, V. A., Oliviera, J. S., Paraguay,

N., Duboc, G., Voltarelli, J. C., Maoilino, A., Pasquin, R. and C. A. Souza. (2003). Outcome predictors of

84 patients with hematological malignancies and Fusarium infection. Cancer. 98: 315-319. 93

Nucci, M., Marr, K. A.., Quieroz-Telles, F., Martins, C. A., Trabasso, P., Costa, S., Voltarelli, J. C.,

Colombo, A. L., Imhof, A., Pasquini, R., Maiolino, A., Souza, C. A., and E. J. Anaissie. (2004).

Fusarium infection in hematopoietic stem cell transplant recipients. Clin. Infect. Dis. 38: 1237-1242.

O’Donnell, K., Sutton, D. A., McCarthy, D., Rinaldi, M. G., Brandt, M. E., Zhang, N. and D. M. Gesier.

(2008). Molecular phylogenetic diversity, multilocus haplotype nomenclature and in vitro antifungal resistance within the Fusarium solani complex. J. Clin. Microbiol. 46: 2477-2490.

O’Donnell, K., Sutton, D.A., Rinaldi, M.G., Magnon, K. C., Cox, P. A., Revankar, S. G., Sanche, S.,

Greiser, D. M., Juba, J. H., van Burik, J. A., Padhye A., Anaissie, E. J., Francesconi, A., Walsh, T. J. and

J. S. Robinson. (2004). Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: Evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. J. Clin. Microbiol. 42: 5109-5120.

Ok, M., Einsele, H. and J. Loeffler. (2011). Genetic susceptibility to Aspergillus fumigatus infections. Int.

J. Med. Microbiol. 301: 445-452.

Pappagianis, D. (1988). Epidemiology of coccidioidomycosis. Curr. Top. Med. Mycol. 2: 199-238.

Park, H.K., Ha, M.H., Park, S.G., Kim, M.N., Kim, B.J. and W. Kim. (2012). Characterization of the fungal microbiota (mycobiome) in healthy and dandruff-afflicted human scalps. PLoS ONE: 7(2):e32847. doi: 10.1371/journal.pone.0032847. 94

Pasqualotto, A. (2009). Difference in pathogenicity and clinical syndromes due to Aspergillus fumigatus

and Aspergillus flavus. Med. Mycol. 47(suppl. I): S261-S270.

Pfaller, M.A., Diekema, D.J., Gibbs, D. L., Newell, V.A., Meis, J.F., Gould, I.M., Fu, W., Colombo, A.L.,

Rodriguez-Noriega, E. and the Global Antifungal Surveillance Group. (2007). Results from the

ARTEMIS DISK global antifungal surveillance study, 1997 to 2005: an 8.5-year analysis of

susceptibilities of Candida species and other yeast species to fluconazole and voriconazole determined by

CLSI standardized disk diffusion testing. J. Clin. Microbiol. 45: 1735-1745.

Pfaller, M. A. and D. J. Diekema. (2010). Epidemiology of invasive mycoses in North America. Clin.

Rev. Microbiol. 36: 1-53.

Pritchard, C. and D. B. Muir. (1987). Black Fungi: a survey of dematiaceous hyalohyphomycetes from

clinical specimens identified over a five year period in a reference library. Pathology. 19(3): 281-284.

Procop, G. W. and G. D. Roberts. (2004). Emerging fungal diseases: the importance of the host. Clin.

Lab. Med. 24: 691-719.

Robert, V. A. and A. Casadevall. (2009). Vertebrate endothermy restricts most fungi as potential

pathogens. J. Infect. Dis. 200: 1623-1626.

Romani, L. (2004). Immunity to fungal infections. Nature Rev. Immunol. 4: 1-13.

Rosas, A. L. and A. Casadevall. (1997). Melanization affects susceptibility of Cryptococcus neoformans to heat and cold. FEMS Microbiol. Lett. 153: 265-272. 95

Ryckeboer, J., Mergaert, J., Coosemans, J., Deprins, K. and J. Swings. (2003). Microbial aspects of

biowaste during composting in a monitored compost bin. J. Appl. Microbial. 94(1): 127-137.

Sharpton, T. J., Stajich, J. E., Rounsley, S. D., Gardner, M. J., Wortman, J. R., Jordar, V. S., Maiti, R.,

Kodira, C. D., Neafsey, D. E., Zeng, Q., Hung, C.-Y., McMahan, C., Muszewska, A., Grynberg, M.,

Mandel, M. A., Kellner, E. M., Barker, G. T., Henn, M. R., Birren, B. W. and J. W. Taylor. (2009).

Comparative genomic analyses of the human fungal pathogens Coccidioides and their relatives. Gen. Res.

19: 1722-1731.

Sofair, A. N., Lyon, G. M., Huie-White, S., Reiss, E., Harrison, L. H., Sanza, L. T., Artington-Skaggs, B.

A. and S. K. Fridkin. (2006). Epidemiology of community-onset candidemia in Connecticut and

Maryland. Clin. Infect. Dis. 43: 32-39.

Squire, R. A. (1989). Ranking animal carcinogens: a proposed regulatory approach. Science. 214: 887-

891.

St. Leger, R. J., Screen, S. E. and B. Shams-Pirzadeh. (2000). Lack of host specialization in Aspergillus flavus. Appl. Environ. Microbiol. 66: 320-324.

Steenbergen, J. N., Shuman, H. A. and A. Casadevall. (2001). Cryptococcus neoformans interactions with

amoebae suggest an explanation for its virulence and intracellular pathogenic strategy in macrophages.

Proc. Natl. Acad. USA. 18: 15245-15250. 96

Sugawara, Y., Nakase, K., Nakamura, A., Ohishi, K., Sugimoto, Y., Fujeida, A., Monma, F., Suzuki, K.,

Masuya, M., Mutsushima, Y., Wada, H., Nobori, T. and N. Katayama. (2013). Clinical utility of a panfungal polymerase chain reaction assay for invasive fungal diseases in patients with haematological disorders. Eur. J. Haem. 90: 331-339.

Tarrand, J. J., Lichterfeld, M., Warraich, I., Luna, M., Han, X. Y., May, G. S. and D. P. Kontoyiannis.

(2003). Diagnosis of invasive septate mold infections. A correlation of microbiological culture and histologic or cytologic examination. Am. J. Clin. Pathol. 119: 854-858.

Tong, K. B., Lau, C. J., Murtagh, K., Layton, A. J. and R. Seifeldin. (2009). The economic impact of aspergillosis: analysis of hospital expenditures across patient subgroups. Int. J. Infect. Dis. 13: 24-36.

Torelli, R., Sanguinetti, M., Moody, A., Pagano, L., Caira, M., De Carolis, E., Fuso, L., De Pascale, G.,

Bello, G., Antonelli, M., Fadda, G. and B. Posteraro. (2011). Diagnosis of invasive aspergillosis by a commercial real-time PCR assay for Aspergillus DNA in bronchoalveolar lavage fluid samples from high-risk patients compared to a galactomannan enzyme immunoassay. J. Clin. Microbiol. 49: 4273-4278.

Trick, W. E., Fridkin, S. K., Edwards, J. R., Hajjeh, R. A. and R. P. Gaynes. The National Nosocomial

Infections Surveillance System Hospitals. (2002). Secular trend of hospital-acquired candidemia among intensive care patients in the United States during 1989-1999. Clin. Infect. Dis. 35:622-630.

Van der Velden, W.J., Netea, M.G., de Haan, A.F., Huls, G.A., Donnelly, J.P. and N.M. Blijlevens. Role of the mycobiome in human acute graft-versus-host disease. Biol. Blood Marrow Transplant. 19: 329-

332. 97

Verweij, P. E., Snelders, E., Kema, G. H., Mellado, E. and W. J. Melchers. (2009). Azole resistance in

Aspergillus fumigatus: a side-effect of environmental fungicide use? Lancet. Infect. Dis. 9: 789-795.

Verweij, P. E. and J. F. Meis. (2000). Microbiological diagnosis of invasive fungal infections in transplant recipients. Transpl. Infect. Dis. 2: 80-87.

Vonberg, R. P. and P. Gastmeier. (2006). Nosocomial aspergillosis in outbreak settings. J. Hosp. Infect.

63: 246-254.

Vuillemim, P. (1912). Beauveria, nouveau genera de Verticillacees. Bull. Soc. Bot. Fr., 59: 34-40.

Walsh, T. J., Grol, A., Fleming, R., Roilides, E. and E. J. Anaissie. (2004). Infections due to uncommon medically important fungal pathogens. Clin. Microbiol. Infect. 10(suppl. 1): 48-66.

Wang Y. and A. Casadevall. (1994). Decreased susceptibility of melanized Cryptococcus neoformans to

UV light. Appl. Environ. Microbiol. 60: 3864-3866.

Warnock, D. W. (2007). Trends in the epidemiology of invasive fungal infections. Jpn. J. Med. Mycol.

48: 1-12.

Webb, B. J. and H. R. Vikram. (2010). Chronic invasive sinus aspergillosis in immunocompetent hosts: A geographic comparison. Mycopathologia. 170: 403-410. 98

White, P. L., Linton, C. J., Perry, M. D., Johnson, E. M. and R. A. Barnes. (2006). The evolution and evaluation of a whole blood polymerase chain reaction assay for the detection of invasive aspergillosis in hematology patients in a routine clinical setting. Clin. Infect. Dis. 42: 479-486.

White, P. L. and R. A. Barnes. (2009). Aspergillus PCR. In J.-P. Latge and W. J. Steinbach (eds.),

Aspergillus fumigatus and aspergillosis. ASM Press, Washington, D. C. 373-390.

White, P. L., Bretagne, S., Klingspor, L, Melchers, W.J., McCulloch, E., Schulz, B., Finnstrom, N.,

Mengoli, C., Barnes, R.A., Donnelly, J.P., Loeffler, J.; European Aspergillus PCR Initiative. (2010).

Aspergillus PCR: one step closer towards standardization. J. Clin. Microbiol. 48: 1231-1240.

White, P. L., Mengoli, C., Bretagne, S., Cuenca-Estrella, M., Finnstrom, N., Klingspor, L., Melchers, W.

J. G., McCulloch, E., Barnes, R. A., Donnelly, J. P. and J. Loeffler on behalf of the European Aspergillus

PCR initiative (EAPCRI). (2011). Evaluation of Aspergillus PCR protocols for testing serum specimens.

J. Clin. Microbiol. 49: 3842-3848.

Wilson, L. S., Reyes, C. M., Stolpman, M., Speckman, J., Allen, K. and J. Benney. (2002). The direct cost and incidence of systemic fungal infections. Value in Health. 5: 26-34.

Wisplinghoff, H., Bischoff, T., Tallent, S. M., Wenzel, R. P. and M. B. Edmond. (2004). Nosocomial bloodstream infections in US Hospitals: Analysis of 24,179 cases from a prospective nationwide surveillance study. Clin. Infect. Dis. 39: 309-317. 99

Yu, J., Cleveland, T. E., Nierman, W. C. and J. W. Bennett. (2005). Aspergillus flavus genomics: gateway to human and animal health, food safety, and crop resistance to diseases. Rev. Iberoam. Micol. 22: 194-

202. 100

APPENDIX A. USEFUL FUNGAL DATABASES

Fungal genome resource: http://gene.genetics.uga.edu/

Fungal genome initiative: http://www-genome.wi.mit.edu/seq/fgi/

Sanger Center: fungal genomes http://www.sanger.ac.uk/Projects/Fungi

National human genome research institute: fungal genomes http://www.genome.gov/11008243

Comprehensive yeast genome database: http://www.mips.biochem.mpg.de/projects/fungi

Fungal genomics laboratory: http://www.fungalgenomics.ncsu.edu

NCBI genome project: http://www.ncbi.nlm.nih.gov/genomeprj

NCBI taxonomy project: http://www.ncbi.nlm.nih.gov/Taxonomy

The Fungal Tree of Life Project: www.tolweb.org/tree/phylogeny.html

Fungal 18S Ribosomal RNA Refseq Targeted Loci Project: www.ncbi.nlm.nih.gov/genomes/static/refseq- target.html

References:

Ma, L-J and D. Federova. (2010). A practical guide to fungal genome projects: strategy, technology, cost and completion. Mycology. 1: 9-24. Appendix lists >100 fungal genome projects underway.

Wackett, L.P. (2003). Fungal genomes: An annotated selection of World Wide Web sites relevant to the topics in Environmental Microbiology. Env. Microbiol. 5: 1221-1222. 101

APPENDIX B. BOWLING GREEN STATE UNIVERSITY HUMAN SUBJECT

REVIEW BOARD APPROVAL 102

APPENDIX C. COMPLETE PATIENT INFORMATION

Patient information on whole blood samples

Patient ID Age Gender ICU (Y/N) Aerobic (AE) Hospital Location Length of (years) (F/M) vs. Anaerobic Stay (AN) (Days) 101 25 M N AN Emergency services 5 102 34 M Y AE Surgical ICU 5 103 67 M N AN Hematology/ Oncology 28 104 23 M N AE Emergency services 105 54 M N AN Gastrointestinal 4 106 35 M N AE Adult hospital −7 107 55 M N AN Pulmonary 4 108 51 M N AE Hematology/ Oncology 4 109 91 M N AN Cardiology 5 110 44 M N AE Dialysis 111 54 M Y AN Surgical ICU 63 112 49 M N AE Orthopedic surgery −8 113 73 M Y AN Medical ICU 11 114 33 M Y AE Cardiology ICU 2 115 63 M N AN Hematology/ Oncology 14 116 69 M N AE Hospital Admitting 2 117 62 M N AN Cardiology 50 118 72 M N AE Emergency services 4 119 52 M N AN Emergency services 1 120 50 M N AE Emergency services 9 121 58 M N AN Hematology/ Oncology 4 122 29 M N AE Hematology/ Oncology - 123 68 M N AN Emergency services 4 124 53 M Y AE Cardiothoracic surgery 7 ICU 125 37 M N AN Infectious disease 4 126 77 M N AE Kidney/Pancreas - Transplant 127 22 M N AE Peritoneal Dialysis - 128 48 M Y AE Surgical ICU 97 129 58 M N AN Hospital admitting 9 130 32 M N AN General medicine 2 131 48 M N AE Cardiology 10 132 47 M Y AN Cardiothoracic surgery 11 ICU 133 35 M N AE Hospital admitting 4 134 47 M Y AN Cardiology ICU 36 135 39 M N AE Urology/Surgery 4 transplant 201 46 F N AE Cardiology 9 202 47 F N AN Emergency services 3 103

203 85 F N AE Emergency services - 204 51 F N AN General medicine 8 205 57 F N AE General medicine 9 206 34 F N AN Emergency services 1 207 48 F N AE Emergency services - 208 46 F N AN Pulmonary 8 209 63 F N AE Gastrointestinal 61 210 27 F N AN Gastrointestinal 9 211 81 F N AE Cardiothoracic surgery - 212 25 F N AN Outpatient - 213 31 F N AE Trauma burn acute - care 214 46 F N AN Hematology/ Oncology - 215 48 F N AE Neurosurgery - 216 53 F N AN General medicine 4 217 48 F Y AE Medical ICU 19 218 42 F N AN Emergency services - 219 71 F N AN Hospital admitting - 220 38 F N AE General medicine 7 221 60 F N AE Pulmonary 14 222 74 F N AN Neurosurgery 6 223 57 F N AE Hematology/ Oncology 20 224 80 F N AN Pulmonary 3 225 78 F N AE General medicine 10 226 49 F N AN Gastrointestinal 6 227 46 F N AE Cardiology 12 228 25 F N AN Hospital admitting 4 229 49 F N AE Outpatient - 230 70 F N AN Hospital admitting - 231 70 F Y AE Medical ICU 27 232 50 F N AN Dermatology/ General 7 surgery 233 42 F N AE Emergency services 7 234 72 F N AN Cardiology 4 235 62 F N AE Dermatology/ General 13 surgery 301 1 M N AE Outpatient - 302 0 M N AE Children’s hospital 24 303 5 M N AE Emergency services - 304 8 M N AE Outpatient - 305 7 M Y AE Pediatric ICU 4 306 18 M Y AE Medical ICU 26 307 7 M N AE Children’s hospital 5 308 11 M N AN Children’s hospital 1 309 0 M N AE Emergency services - 310 4 M N AN Pediatric urology/ - Nephrology 311 0 M N AE Outpatient - 104

312 0 M N AE Emergency services 2 313 1 M N AE Children’s hospital 6 admitting 314 0 M N AE Emergency services - 315 14 M N AE Children’s hospital 10 401 4 F N AE Emergency services - 402 20 F N AN Children’s hospital 176 403 3 F N AE Children’s hospital 33 404 0 F N AE Children’s hospital 3 405 1 F N AE Children’s hospital 18 406 0 F Y AE Neonatal ICU 2 407 10 F N AE Emergency services 1 408 0 F Y AE Neonatal ICU 2 409 12 F N AE Children’s hospital 4 admitting 410 1 F N AE Children’s hospital 2 411 7 F N AE Children’s hospital 6 412 0 F N AE Pediatric cardiology 32 413 1 F N AE Children’s hospital 3 admitting 414 0 F Y AE Neonatal ICU 307 415 6 F Y AE Pediatric ICU 7

Note: Age = 0 means patient is less than 1 year old. Rows shaded in gray represent samples where fungal

DNA was found.

Patient information on respiratory samples

Patient ID Age Gender ICU (Y/N) Specimen Type Hospital Location (years) (F/M) 501 55 M N Sputum Cardiology 502 54 M Y BAL Medical ICU 503 57 M N Sputum Pulmonary 504 23 M N Sputum Emergency services 505 77 M N Sputum Hospital admitting 506 57 M N Sputum Vascular surgery 507 46 M Y BAL Medical ICU 508 65 M N Sputum Neurosurgery 509 81 M Y BAL Surgical ICU 510 32 M N Sinus Outpatient 511 83 M N Sputum Hospital admitting 512 25 M N Sputum Emergency services 513 86 M N Sputum Outpatient 514 61 M N Sputum Cardiothoracic surgery 515 45 M N Sputum Hospital admitting 105

516 57 M Y Sputum Medical ICU 517 57 M N Sputum Oncology 518 40 M N Sputum Vascular surgery 519 66 M Y Sputum Surgical ICU 520 28 M Y Sputum Surgical ICU 521 61 M Y BAL Surgical ICU 522 32 M N Sputum Pulmonary 523 47 M N Sputum Cardiothoracic surgery 524 64 M Y Sputum Cardiology ICU 525 59 M N BAL Pulmonary 526 25 M N Sputum Cardiology 527 44 M Y BAL Medical ICU 528 36 M N BAL Neurosurgery 529 56 M N BAL Trauma burn acute care 530 65 M Y BAL Medical ICU 531 52 M N BAL Dermatology/ General surgery 532 61 M Y BAL Medical ICU 533 21 M N Sputum Pulmonary 534 68 M Y Sputum Medical ICU 535 67 M N Sputum Cardiology 601 57 F Y BAL Cardiology ICU 602 58 F Y BAL Surgical ICU 603 60 F Y Sputum Surgical ICU 604 57 F N Sputum Neurosurgery 605 85 F N Sputum Pulmonary 606 53 F Y BAL Surgical ICU 607 67 F N Sputum Pulmonary 608 73 F N Sputum Neurosurgery 609 79 F N Sputum Pulmonary 610 60 F N Sputum Vascular surgery 611 52 F Y BAL Medical ICU 612 77 F Y BAL Medical ICU 613 63 F N BAL Pulmonary 614 54 F Y Sputum Cardiology ICU 615 43 F Y Sputum Cardiology ICU 616 35 F Y BAL Surgical ICU 617 62 F N BAL Pulmonary 618 57 F N Sputum Vascular surgery 619 69 F N Sputum Neurosurgery 620 43 F N Sputum Pulmonary 621 60 F N Sputum Pulmonary 622 23 F Y Sputum Trauma burn ICU 623 62 F N Sputum Ophthalmology 624 56 F N Sputum Pulmonary 625 68 F N Sputum Pulmonary 626 75 F N Sputum Cardiology 627 63 F Y Sputum Cardiothoracic surgery ICU 628 56 F Y BAL Medical ICU 106

629 40 F Y BAL Cardiothoracic surgery ICU 630 63 F Y BAL Surgical ICU 631 68 F Y Sputum Surgical ICU 632 73 F N Sputum Pulmonary 633 75 F N Sputum Cardiothoracic surgery 634 53 F Y Sputum Cardiology ICU 635 24 F Y BAL Surgical ICU 701 17 M Y Sputum Pediatric ICU 702 0 M Y Sputum Neonatal ICU 703 8 M N Sputum Emergency services 704 0 M N Sputum Children’s hospital 705 18 M Y BAL Surgical ICU 706 17 M Y Sputum Pediatric ICU 707 19 M N Sputum Physical medicine/ rehab 708 3 M Y Sputum Pediatric ICU 709 19 M N Sputum Pulmonary 710 0 M Y Sputum Neonatal ICU 711 0 M N Sputum Pediatric cardiology 712 13 M N Sputum Emergency services 713 0 M Y Sputum Pediatric ICU 714 13 M N Sputum Children’s hospital 715 0 M Y Sputum Pediatric ICU 801 20 F N Sputum Hematology/ oncology 802 20 F Y Sputum Medical ICU 803 0 F Y Sputum Pediatric ICU 804 0 F Y Sputum Pediatric ICU 805 0 F N Sputum Pediatric cardiology 806 14 F Y Sputum Pediatric ICU 807 9 F Y Sputum Pediatric ICU 808 1 F N Sputum Pediatric cardiology 809 0 F Y Sputum Pediatric ICU 810 3 F N Sputum Pediatric cardiology 811 0 F Y Sputum Pediatric ICU 812 1 M Y Sputum Pediatric ICU 813 0 M Y Sputum Neonatal ICU 814 0 M N Sputum Pediatric cardiology 815 49 F Y BAL Medical ICU

Note: Age = 0 means patient is less than 1 year old. Rows shaded in gray represent samples where fungal

DNA was found. 107

APPENDIX D. REFERENCE SEQUENCES

>gi|12584196|gb|AF322387.1| Ajellomyces capsulatus var. farciminosus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer

2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTCCGTAGGTGAACCTGCGGAAGGATCATTACCACGCCGTGGGGGGCTGGGAGCCTCTGACC

GGGAACCCCCCCACCCCCCTACCCGGCCACCCTTGTCTACCGGACCTGTTGCCTCGGCGGGCC

TGCAGCGATGCTGCCGGGGGAGCTTCTCCTCCCCGGGCCCGTGTCCGCCGGGGACACCGCAA

GAACCGTCGGTGAACGATTGGCGTCTGAGCATGAGAGCGATAATAATCCAGTCAAAACTTTC

AACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTG

AATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGG

GGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCGTCGTCC

CCCCTCGACCGGCGGGACGTGCCCGAAATGCAGTGGCGGTGTCGAGTTCCGGTGCCCGAGCG

TATGGGGCTTTGCCACCCGCTCTGGAGGCCCGGCCGGCTCCGGCCCACCATGTCAACCCCCCT

CTCACACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT

>gi|394785561|gb|JQ781820.1| Alternaria alternata isolate A69A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCG

GGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTT

GTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCG

TCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG

AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA

ACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCA

AGCTTTGCTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGC 108

AGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCAT

CCATTAAGCCTTTTTTTCAA

>gi|4927228|gb|AF138287.1| Aspergillus flavus 18S ribosomal RNA gene, partial sequence; internal

transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and

28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCC

CACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCT

CAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAANTCTGAG

TTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCAGGCATCGATGAA

GAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGA

ACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATC

AAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGC

GGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCG

GCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGC

TGAACTTAAGCATATCAATAAGCGGAGGA

>gi|148535445|gb|EF567971.1| Aspergillus fumigatus strain WM 06.98 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGC

TTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGC

CGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGT

TAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT

AAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTG 109

GTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGG

GCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCC

TCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACT

TTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

>gi|6580799|gb|AF109327.1| Aspergillus niger isolate C5334 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

ATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCT

TCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCG

CCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCA

GTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA

TAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCT

GGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTG

GGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATC

CTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCC

AACCATTCTTTCCAGGTTGACCT

>gi|6815813|gb|AF217609.1| Candida albicans 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and

28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCT

TTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAA

TTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTT

GGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGT 110

GAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGA

GCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAA

GACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTG

CGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGC

TGAACTTAAGCATATCAATAAGCGGAGGA

>gi|5870339|emb|AJ249484.1| Candida dubliniensis 18S rRNA (partial), 5.8S rRNA and 25S rRNA

(partial) genes, internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2), isolate

M334a

TCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTGTT

TTGGACAAACTTGCTTTGGCGGTGGGCCTCTACCTGCCGCCAGAGGACATAAACTTACAACCA

AATTTTTTATAAACTTGTCACGAGATTATTTTTAATAGTCAAAACTTTCAACAACGGATCTCTT

GGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGT

GAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGA

GCGTCGTTTCTCCCTCAAACCCCTAGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAA

AGATGATAGTGGTAAGGCGGAGATGCTTGACAATGGCTTAGGTGTAACCAAAAACATTGCTA

AGGCGGTCTCTGGCGTCGCCCATTTTATTCTTCAAACTTTGACCTCAAATCAGGTAGGACTACC

CGCTGAACTTAAGCATATCAATAAGCGGAGGA

>gi|281021784|gb|GU199447.1| Candida glabrata strain W56873 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGGAAGGATCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAG

AGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCT

GTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGG 111

AGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATC

ACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTT

CGTTGGGGGAAAGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAATATT

TTTTATTTTAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTC

AACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTG

AATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGG

GGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTC

TCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTC

TCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAAC

TCGGTGTTGATCTAGGGAGGGATTAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTT

AAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

>gi|110934729|gb|DQ780410.1| Cladosporium cladosporioides strain ST1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

ATCATTACAAGTGACCCCGGCTACGGCCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGT

TGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCG

TAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGG

TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG

TGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTT

CGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCC

TCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGT

GTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACC 112

>gi|304651407|gb|HQ115665.1| Engyodontium album isolate MC_A31 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTCGCTACTACCGATTGAATGGCTCAGTGAGGCGTCCGGACTGGCCCAGGGAGGTGGGCAA

CTACCACCCAGGGCCGGAAAGCTCTCCAAACTCGGTCATTTAGAGGAAGTAAAAGTCGTAA

CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAT

GTGAACATACCTTTACGTTGCTTCGGCGGAGCCGCCCCGGCGCCCGGAACCTCTTCGGTTTC

GCGGCCCGGAACCAGGCGCCCGCCGGAGGCCACAAACTCTTTTGTTTTTACAGTTTCTTCTG

AGTGTGCCGCAAGGCAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC

ATCGAATCTTTGAACGCACATTGCGCCCGCCAGAATTCTGGCGGGCATGCCTGTTCGAGCGT

CATTTCAACCCTCGAGCTCCCCTCTTTTGGGAGAGCCCGGCGTTGGGGACCCGGCGCTAACA

CCGCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATATCCACT

CGCACCGGGACCCGGGCGCGGCCACGCCGTTAAACACCCCACCTTCCGAATGTTGACCTCGA

ATCAGGTAGGAATACCCGCTGAACTTAA

>gi|19569156|gb|AF484956.1| Fusarium culmorum strain BK985T 18S ribosomal RNA gene, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and 28S ribosomal RNA gene, partial sequence

CGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAA

ACCCCTGTGAACATACCTTATGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAAAGGGAC

GGCCCGCCGCAGGAACCTTAAACTCTGTTTTTAGTGGAACTTCTGAGTATAAAAAACAAAT

AAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAAT

GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCG

CCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTT 113

GGTGTTGGGAGCTGCAGTCCTGCTGCACTCCCCAAATACATTGGCGGTCACGTCGAGCTTC

CATAGCGTAGTAATTTACATATCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCA

ACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA

GC

>gi|317184064|gb|HQ649821.1| Fusarium oxysporum isolate r414 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTC

CCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACG

GGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCAT

AAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCA

AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACAT

TGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACA

GCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCT

TCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCC

CAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

>gi|283509338|gb|GU327635.1| Neurospora crassa strain ATCC MYA-4619 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCACAAACCATC

GCGAATCTTACCCGTACGGTTGCCTCGGCGCTGGCGGTCCGGAAAGGCCTTCGGGCCCTCC

CGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTGCCCGCCGGAGTGCCGAAACTAAACTCTT 114

GATATTTTATGTCTCTCTGAGTAAACTTTTAAATAAGTCAAAACTTTCAACAACGGATCTCT

TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT

CAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGTATTCTGGCGAGCATGCCT

GTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGG

TCCCTCAAAATCAGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAACTCTACATCGCTAT

GGTCGTGCGGCGGGTTCTTGCCGTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGT

AGGAATACCCGCTGAACTTAA

>gi|12584198|gb|AF322389.1| Paracoccidioides brasiliensis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTCCGTAGGTAAACCTGCGGAAGGATCATTAACGCGCCGTGGGGGGACGGGGCCCGATCG

GGTTCCCGGCCCTCTCACCTGGCCACCCTTGTCTATTCTACCTGTTGCTTCGGCGGGCCTGC

AGCGATGCTGCCGGGGGGGCTCGGCCTCCCGGGCTCGTGCCCGCCGGGGACACCGTTGAAC

TTCTGGTTCGGAGCTTTGACGTCTGAGACCTATCATAATCAGTAAAAACTTTCAACAACGGA

TCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG

AATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATG

CCTGTCCGAGCGTCATTTCAACCCTCAAGCGCGGCTTGCGTGTTGGGCCCGCGTCCCCCCGT

GGACGTGCCCGAAATGCAGCGGCGGCGTCGCGTTCCGGTGCCCGAGCGTATGGGGCTTCGT

CACACGCTCTCAGAGGCCCGGCCGACTCCGGCCCCACTCATCGACCCCGGCGGGGGGGAA

AAAGGTGTCCTCTCTCGATCGACACCCTTCCCCCTTGCCGACCAAGGTTGACCTCGGATCA

GGTAGGGATACCCGCTGAACTT 115

>gi|256575410|gb|GQ376090.1| Saccharomyces cerevisiae isolate UOA/HCPF 8620 18S ribosomal

RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAAAATGTAACAAGGTTTCGTAGGCGAAGCTGAGGAGGAGGATCATTAAGAAATTTAATA

ATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGA

CAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAA

GTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAA

ACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTC

GAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGT

CAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATC

TCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAA

TTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGC

CTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGT

TAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGT

GCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAATCTGCGGCTAATCTTTTTT

TATAGCTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCT

TAAAGTTGACCTCAAT

>gi|11493844|gb|AF206273.1| Stachybotrys chartarum strain UAMH 6417 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA ribosomal RNA gene, partial sequence

CGCCCGTCGCTACTACCGATTGAATGGCTTAGTGAGGCGTTCGGACTGGTCCAGGGAGGTG

GGCAACTACCACCCAGGACCGGAAAGTTCTCCAAACTTGGTCATTTAGAGGAAGTAAAAG

TCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCA

AACCCTTATGTGAACCGTACCTATCGTTGCTTCGGCGGGAACGCCCCGGCGCCCTGCGCCC 116

GGATCCAGGCGCCCGCCGGAGACCCCAAACTCTTGTGTTTTTTTCAGTATTCTCTGAGTGGC

AAACGCAAAAATAAATCAAAACTTTTAACAACGGATCTCTTGGCTCTGGCATCGATGAAGA

ACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA

ACGCACATTGCGCCCGTTAGCATTCTAGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCT

CAGGGTCCCCGTTCCGGCGGGGAACCTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCG

TCCCCCAAATTCAGTGGCGGTCTCGCTGCAGCCTCCCCTGCGTAGTAGTTACAACCTCGCAT

CGGAGCTCAGCGCGGCCACGCCGTAAAACCCCCGACTTTCTGAACGTTGACCTCGGATCAG

GTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGA

TTGCCTT

>gi|639440|gb|U18352.1|TRU18352 Trichophyton rubrum 5.8S rRNA gene, complete sequence, and

ITS1 and ITS2

AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAG

GCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCG

CCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCC

CTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGC

CGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAG

CACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAG

CGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCAC

ATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGC

CCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAA

GCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCA

GGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGAT

CAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCG 117

APPENDIX E. SEQUENCES FROM THIS STUDY

>223_ Accession number KF798202

TTGTAGTGCGTCCTGGACTAGGCCCAGGGAGGTGGGCAACTACCACCCAGGGCCGGAAAGC

TCTCCAAACTCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAG

CGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTTTACGTTGCTT

CGGCGGAGCCGCCCCGGCGCCCGGAACCTCTTCGGTTTCGCGGCCCGGAACCAGGCGCCCG

CCGGAGGCCACAAACTCTTTTGTTTTTACAGTTTCTTCTGAGTGTGCCGCAAGGCAAAATAC

AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGA

AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTG

CGCCCGCCAGAATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTCCCCT

CTTTTGGGAGAGCCCGGCGTTGGGGACCCGGCGCTAACACCGCCGGCCCCGAAATGGAGTG

GCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATATCCACTCGCACCGGGACCCGGGCGCGGC

CACGCCGTTAAACACCCCACCTTCCGAATGTTGACCTCGAATCAGGTAGGAATACCCGCTGA

ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGA

GTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCAGGGCCCGAGTTGTAATTTGTAGA

GGATGCTTTTGGCGAGGCGCCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGA

GCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTTGGG

GAATGCA

>527_Accession number KF803254

GCCCTTGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACT

GATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCA

GCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTA

CTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGA

AATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTG 118

CGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGT

TTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCT

TTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATAT

CTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCG

GAGGAAAGGGC

>533_Accession number KF803255

ACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATC

AACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCG

CATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCA

TCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAAGGCATGCCTGTTTGAGCGTC

GTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGAC

GGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCG

GCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCT

GAACTTAAG

>626_Accession number KF803256

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTG

CTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGC

CGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATA

GTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCG

ATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCT

CTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTG

TTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACA 119

ATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAA

ACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

>632a_Accession number KF803257

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCAC

CACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGT

CTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTT

TCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATA

TGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCG

GAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATA

CGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGG

TCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCAACGTATATCTTCATACTTTGACCT

CAACTCAGGTAG

>632b_Accession number KF825541

CATTACAGATTTTAATTGTTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGT

AGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCT

TAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGATCCGACAAAGACCTGGGAGT

GTGCGTGGATCTCTCTATTCCAAAGGATGTGTTTTATCACACAACTCGACACTTTCTAATTAC

TACACACAGTGGAGTTTACTTTACTAGTATTCTTTTGTTCATTGGGGGAAAGCTCTCTTTCGG

GAGGGAGTTCTCCCAATGGATGCAAACACAAACAAATATTTTTTTATTTTAACTAATTCAGT

CAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTT

CTCGCATCGATGAATAACGCAGCGAAATGCGATACATAATGTGAATTGCATAATTCCGTGAA

TCATCGAATCAATGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGC

GTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTT 120

GAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCT

CGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAG

GGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAA

ATCAGTAGGGTTACCCGCTGAACTTAAGCATATCAATAGGCGGAGGGAAGGA

>611_Accession number KF825542

CATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGG

CCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTC

TGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCA

GGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAGGGC

>534_Accession number KF825543

CATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGG

GCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCT

CTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATC

AGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAGGGC

>235_Accession number FJ223846

CATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGCAGTCCTGCTGCACTCCCCAAATA

CATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGTC

GCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGC

TGAACTTAAGCATATCAATAAGCGGAGGAAAGGGCGAATTCCGCAGA 121

>406_Accession number FJ223846

CATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCG

ACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAG

GCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTG

AACTTAAGCATATCAATAAGCGGAGGAAAGGGC

>802_Accession number KF825544

CATTACACAAATATGGAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCA

CCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAA

ACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGAT

CTCTTGGTTCTGGCATCGATGAAGGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCAT

CGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCA

TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTACTTTGCTGGAGACTCGCCTT

AAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGC

>614_Accession number KF825545

CATTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTTTACGTTGCTTCGGCGGAGC

CGCCCCGGCGCCCGGAACCTCTTCGGTTTCGCGGCCCGGAACCAGGCGCCCGCCGGAGGCC

ACAAACTCTTTTGTTTTTACAGTTTCTTCTGAGTGTGCCGCAAGGCAAACATACAAATGAATC

ACAACATGCAAGCAATCCGTTCCCTGGG

>612_Accession number KF825546

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTA

AGGGTGCTCAGCGCCCGACCTCCAACCCTTTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGA

CCGCTCGGTCTCGAGCCGCTGGGGATTCGTCCCAGGCGAGCGCCCGCCAGAGTTAAACCAA 122

ACTCTTGTTATTTAACCGGTCGTCTGAGTTAAAATTTTGAATAAATCAAAACTTTCAACAACG

GATCTCTTGGTCCTCGCATCGATGAACGCAGC