DOCSLIB.ORG

Actinopterygii: Cyprinidae) in Iran with Description of a New Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Actinopterygii: Cyprinidae) in Iran with Description of a New Species Iran. J. Ichthyol. (September 2017), 4(3): 231-269 Received: July 27, 2017 © 2017 Iranian Society of Ichthyology Accepted: September 10, 2017 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.22034/iji.v4i3.23902.015 http://www.ijichthyol.org Research Article Mitochondrial phylogeny and taxonomic status of the Capoeta damascina species group (Actinopterygii: Cyprinidae) in Iran with description of a new species Halimeh ZAREIAN, Hamid Reza ESMAEILI* Ichthyology and Molecular Systematics Research Laboratory, Zoology Section, Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran. * Email: [email protected] Abstract: The members of the genus Capoeta show an abstruse taxonomic status, a complex evolutionary history with the highest diversification in the Middle East and are closely related to the genus Luciobarbus. Our molecular and morphological results confirm the existence of eight species within the Capoeta damascina group in Iran. In this paper all eight recognized species are reviewed, and diagnoses are presented for all species. Capoeta birunii is considered as new species from Zayandehrud drainage basins. This species is distinguished from other small scaled Capoeta in the C. damascina group by a combination of morphological and molecular characters. Keywords: Capoeta, Molecular analyses, Systematics, Distribution. Citation: Zareian, H. & Esmaeili, H.R. 2017. Mitochondrial phylogeny and taxonomic status the Capoeta damascina species group (Actinopterygii: Cyprinidae) in Iran with description of a new species. Iranian Journal of Ichthyology 4(3): 231-269. Introduction includes about 34 species widely distributed in many Iran has one of the most diverse and species-rich river drainages and basins in southwest Asia except freshwater ichthyofaunas in the Middle East the Arabian Peninsula (Jouladeh-Roudbar et al. 2015; (Esmaeili et al. 2017). However, unresolved Alwan et al. 2016a; Ghanavi et al. 2016; Keivany et taxonomic problems could result in higher fish al. 2016; Esmaeili et al. 2016, 2017; Zareian et al. diversity including cyprinid fishes of the genus 2016a, b; Eschmeyer & Fricke 2017). They have Capoeta Valenciennes, 1842 (Kücük et al. 2009; been classified into three groups, namely the Esmaeili et al. 2017). Members of the genus Capoeta C. capoeta, C. damascina and C. trutta species groups exist in the Middle East and southwest Asia. This (see Jouladeh-Roudbar et al. 2015; Alwan et al. region is an important crossroads of biotic exchange 2016a; Ghanavi et al. 2016; Zareian et al. 2016a, b). with complex geological events such as novel The Capoeta damascina species group, orogeny (Durand et al. 2002; Krupp et al. 2009) morphologically characterized by having small which is the consequence of the ongoing northward scales, was originally defined by Schöter et al. convergence of the African, Arabian and Indian (2009), and is an important issue in taxonomic study plates towards Eurasia (Zhao & Xie 2016) resulting of cyprinid fishes in recent years. Alwan et al. (2011, in isolated river basins promoting speciation events. 2016a, b) studied the Capoeta damascina species As presently recognized, the genus Capoeta group using COI and LSU genes, using a few Iranian 231 Iran. J. Ichthyol. (September 2017), 4(3): 231-269 Fig.1. Map of Iran showing different basins (M= Maharlu). After Esmaeili et al. (2017). specimens and later Ghanavi et al. (2016) studied populations which were not identified as any diversity of Capoeta species in Iran using the cytb described species (Ghanavi et al. 2016). Three of gene. The latter study proposed the presence of five these suggested new taxa were small scaled Capoeta new species of Capoeta in Iranian basins, three of distributed in the Tigris River tributaries of the them belong to the C. damascina species group and Persian Gulf basin, traditionally identified as then Jouladeh-Roudbar et al. (2017) described those C. damascina or C. saadii (Jouladeh-Roudbar et al. three new small scaled Capoeta. 2015b; Esmaeili et al. 2010; 2017). The Capoeta damascina species group occurs in Hence, the main aim of this study is to clarify the the entire Levant, Mesopotamia, Orontes, Iran and taxonomic status of the Capoeta damascina species the southern and eastern parts of Turkey. In Iran, it is group in Iran, to provide a taxonomic review and reported from the Tigris (part of the Tigris-Euphrates mitochondrial phylogeny on this group and describe River system), Namak Lake, Esfahan, Kor, Maharlu, one new species. Persis, Kerman-Nain and Hormuz basins (Coad 1995; 2008; Esmaeili et al. 2010, 2015, 2017). The Materials and Methods taxonomic status of this group is largely unsettled Taxon sampling: Fish samples were collected from (Krupp & Schneider 1989; Esmaeili et al. 2010; endorheic (Caspian Sea, Urmia Lake, Namak Lake, 2017; Alwan et al. 2016a, b; Zareian et al. 2016a, b). Kor, Kavir, Zayandehrud: Esfahan) and exorheic A detailed study of the populations of the Capoeta (Persis: Mond, Tigris, flowing into the Persian Gulf) damascina species group in Iran found some basins (Fig. 1). After anesthesia (using Clove oil), 232 Zareian and Esmaeili - Phylogeny and taxonomy of Capoeta damascina species group in Iran Table 1. Primer used in this study. Name Sequence Gene Reference FishF1 5'TCAACCAACCACAAAGACATTGGCAC3' FishR1 5'TAGACTTCTGGGTGGCCAAAGAATCA3' COI Ward et al. 2005 L14724 5'GTGACTTGAAAAACCACCGTTG3' H15915 5'CAACGATCTCCGGTTTAGAAGAC3' cytb Xiao et al. 2001 GluF 5'AACCACCGTTGTATTCAACTACAA3' H15560 5`TAGGCRAATAGG AAR TATCA3` cytb Machordom & Doadrio 2001 specimens were fixed in 10% formaldehyde and later oxidase subunit 1: 650 bp) and cytochrome b (cytb: stored in 70% ethanol for the morphological study. 900 bp) region were amplified using a primer pairs The right pectoral fin or tissue from below the dorsal listed in Table 1. fin on the right side of each specimen was removed Purification and sequencing of the PCR products using sterile techniques and utensils and preserved in were conducted at Macrogen Korea Laboratories 96% ethanol and numbered separately at the using aforementioned primer pairs. Data processing sampling sites for the molecular study implied by and sequence assembly was done in BioEdit 7.2.5 sterile techniques. (Hall 1999) and MEGA6 (Tamura et al. 2013) was Morphological analyses: Twenty-two morphometric used to create a DNA sequence alignment using measurements were conducted with an electronic Clustal W program for COI and cytb. No indications digital caliper, to the nearest 0.01mm. For measuring of unexpected stop-codons occurred in any sequence. fish greater than 200mm total length, a ruler or a All generated DNA barcodes and cytb are deposited measuring tape was used. All measurements were in the NCBI GenBank, and given with their made point to point, and never by projections. respective accession numbers (Table 2). The most Measurements and counts mainly followed Hubbs & appropriate sequence evolution model for the given Lagler (1958), Krupp (1983) and Kottelat & Freyhof data was determined with Modeltest (Posada & (2007). Fin ray counts separate unbranched and Crandall 1998) as implemented in the MEGA6 branched rays. The last two branched rays software. The model with the lowest BIC (Bayesian articulating on a single pterygiophore in the dorsal Information Criterion) scores is considered to best and anal fins are counted as "1½". Principle describe the substitution pattern. To explore species Components and Discriminant Factor analysis were phylogenetic affinities, we generated Maximum performed using SPSS software (Ver. 22). Likelihood phylogenetic trees with 10,000 bootstrap Abbreviations: SL, standard length; HL, lateral head replicates in RaxML software 7.2.5 (Stamatakis length; ALL, scale rows between lateral line and 2006) under the GTR+G model of nucleotide dorsal fin origin, BLL, scale rows between lateral substitution, with fast bootstrap for both genes and line and anal fin origin, NMW, Naturhistorisches also Bayesian analysis (BA) of nucleotide sequences Museum Wien, Vienna; ZM-CBSU, Zoological was performed, using the Markov Chain Monte Carlo Museum of Shiraz University, Collection of Biology algorithm (MCMC), with 10,000,000 generations Department, Shiraz. under the most generalizing model (GTR+G+I) using Molecular analyses: DNA extraction from either Mr. Bayes 3.1.1 (Huelsenbeck & Ronquist 2001). muscle tissues or fin clips were done using the Salt Screening for diagnostic nucleotide substitutions was method (Bruford et al. 1992). The standard vertebrate performed manually from the sequence alignment. DNA barcode region of the COI (cytochrome c Cyprinus carpio was used as outgroup. 233 Iran. J. Ichthyol. (September 2017), 4(3): 231-269 Table 2. List of species used in this study with museum number. * indicate accession numbers of COI genes and others are cytb gene accession numbers. Species Basin Museum N. Accession N. Species Basin Museum N. Accession N. C. buhsei Namak ZM-CBSU 1289 KU564292* C. anamisensis Minab ZM-CBSU 1416 KU312342* MF621312 KU312379 C. buhsei Namak ZM-CBSU 1290 KU564293* C. anamisensis Minab ZM-CBSU 1417 KU312343* MF621311 KU312380 C. buhsei Namak ZM-CBSU 1292 MF621275* C. anamisensis Hasan Langi ZM-CBSU 1475 KU312341* MF621310 KU312381 C. buhsei Namak ZM-CBSU 1299 KU312349* C. pyragyi Tigris ZM-CBSU 1474 MF621294* KU312369 MF621321 C. buhsei Namak ZM-CBSU 1300 KU312350* C. pyragyi Tigris ZM-CBSU 1470 MF621293* KU312370 MF621322 C. coadi Tigris ZM-CBSU 1447 KU564297* C. shajariani Tigris ZM-CBSU 1835 MF621299* KU564303
Load more

Recommended publications
  • Review and Updated Checklist of Freshwater Fishes of Iran: Taxonomy, Distribution and Conservation Status
    Iran. J. Ichthyol. (March 2017), 4(Suppl. 1): 1–114 Received: October 18, 2016 © 2017 Iranian Society of Ichthyology Accepted: February 30, 2017 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.7508/iji.2017 http://www.ijichthyol.org Review and updated checklist of freshwater fishes of Iran: Taxonomy, distribution and conservation status Hamid Reza ESMAEILI1*, Hamidreza MEHRABAN1, Keivan ABBASI2, Yazdan KEIVANY3, Brian W. COAD4 1Ichthyology and Molecular Systematics Research Laboratory, Zoology Section, Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran 2Inland Waters Aquaculture Research Center. Iranian Fisheries Sciences Research Institute. Agricultural Research, Education and Extension Organization, Bandar Anzali, Iran 3Department of Natural Resources (Fisheries Division), Isfahan University of Technology, Isfahan 84156-83111, Iran 4Canadian Museum of Nature, Ottawa, Ontario, K1P 6P4 Canada *Email: [email protected] Abstract: This checklist aims to reviews and summarize the results of the systematic and zoogeographical research on the Iranian inland ichthyofauna that has been carried out for more than 200 years. Since the work of J.J. Heckel (1846-1849), the number of valid species has increased significantly and the systematic status of many of the species has changed, and reorganization and updating of the published information has become essential. Here we take the opportunity to provide a new and updated checklist of freshwater fishes of Iran based on literature and taxon occurrence data obtained from natural history and new fish collections. This article lists 288 species in 107 genera, 28 families, 22 orders and 3 classes reported from different Iranian basins. However, presence of 23 reported species in Iranian waters needs confirmation by specimens.
    [Show full text]
  • 3D Morphology of Pharyngeal Dentition of the Genus Capoeta (Cyprinidae): Implications for Taxonomy and Phylogeny
    Accepted: 26 January 2018 DOI: 10.1111/jzs.12217 ORIGINAL ARTICLE 3D morphology of pharyngeal dentition of the genus Capoeta (Cyprinidae): Implications for taxonomy and phylogeny Anna Ayvazyan1 | Davit Vasilyan2,3 | Madelaine Bohme€ 1,4 1Department of Geosciences, Eberhard- Karls-University Tubingen,€ Tubingen,€ Abstract Germany Capoeta is a herbivorous cyprinid fish genus, widely distributed in water bodies of 2JURASSICA Museum, Porrentruy, Western Asia. Recent species show a distinct biogeographic pattern with endemic Switzerland 3Universite de Fribourg, Fribourg, distribution in large fluvial drainage basins. As other cyprinids, the species of this Switzerland genus are characterized by the presence of the pharyngeal bone with pharyngeal 4 Senckenberg Center for Human Evolution teeth. Despite this, the detailed morphology of the pharyngeal teeth, its interspecific and Palaeoenvironment (HEP), Tubingen,€ Germany and topologic variations, and the importance for taxonomy and phylogeny of the genus Capoeta are still not established. For the first time, a detailed comprehensive Correspondence Anna Ayvazyan study of the pharyngeal dentition of 10 Capoeta species has been provided. The Email: [email protected] morphologic study of the pharyngeal dentition bases on the 3D microtomography Funding information and follows the purpose to evaluate the potential taxonomic and phylogenetic sig- This work was funded by the German nals of these elements, as well as to study interspecific and topologic variations of Academic Exchange Service (DAAD) and the SYNTHESYS Grant (ES-TAF-5970) to the the pharyngeal teeth. In this study, we propose a new methodology to categorize National Museum of Natural Sciences of the studied pharyngeal teeth in 18 shape classes. The results of this study show Madrid (MNCN).
    [Show full text]
  • Phylogenetic Relationships of Freshwater Fishes of the Genus Capoeta (Actinopterygii, Cyprinidae) in Iran
    Received: 3 May 2016 | Revised: 8 August 2016 | Accepted: 9 August 2016 DOI: 10.1002/ece3.2411 ORIGINAL RESEARCH Phylogenetic relationships of freshwater fishes of the genus Capoeta (Actinopterygii, Cyprinidae) in Iran Hamid Reza Ghanavi | Elena G. Gonzalez | Ignacio Doadrio Museo Nacional de Ciencias Naturales, Biodiversity and Evolutionary Abstract Biology Department, CSIC, Madrid, Spain The Middle East contains a great diversity of Capoeta species, but their taxonomy re- Correspondence mains poorly described. We used mitochondrial history to examine diversity of the Hamid Reza Ghanavi, Department of algae- scraping cyprinid Capoeta in Iran, applying the species- delimiting approaches Biology, Lund University, Lund, Sweden. Email: [email protected] General Mixed Yule- Coalescent (GMYC) and Poisson Tree Process (PTP) as well as haplotype network analyses. Using the BEAST program, we also examined temporal divergence patterns of Capoeta. The monophyly of the genus and the existence of three previously described main clades (Mesopotamian, Anatolian- Iranian, and Aralo- Caspian) were confirmed. However, the phylogeny proposed novel taxonomic findings within Capoeta. Results of GMYC, bPTP, and phylogenetic analyses were similar and suggested that species diversity in Iran is currently underestimated. At least four can- didate species, Capoeta sp4, Capoeta sp5, Capoeta sp6, and Capoeta sp7, are awaiting description. Capoeta capoeta comprises a species complex with distinct genetic line- ages. The divergence times of the three main Capoeta clades are estimated to have occurred around 15.6–12.4 Mya, consistent with a Mio- Pleistocene origin of the di- versity of Capoeta in Iran. The changes in Caspian Sea levels associated with climate fluctuations and geomorphological events such as the uplift of the Zagros and Alborz Mountains may account for the complex speciation patterns in Capoeta in Iran.
    [Show full text]
  • New Data on the Distribution and Conservation Status of the Two Endemic Scrapers in the Turkish Mediterranean Sea Drainages (Teleostei: Cyprinidae)
    International Journal of Zoology and Animal Biology ISSN: 2639-216X New Data on the Distribution and Conservation Status of the Two Endemic Scrapers in the Turkish Mediterranean Sea Drainages (Teleostei: Cyprinidae) Kaya C1*, Kucuk F2 and Turan D1 Research Article 1 Recep Tayyip Erdogan University, Turkey Volume 2 Issue 6 2Isparta University of Applied Sciences, Turkey Received Date: October 31, 2019 Published Date: November 13, 2019 *Corresponding author: Cuneyt Kaya, Faculty of Fisheries and Aquatic Sciences, DOI: 10.23880/izab-16000185 Recep Tayyip Erdogan University, 53100 Rize, Turkey, Tel: +904642233385; Email: [email protected] Abstract In the scope of this study, exact distribution of the two endemic Capoeta species in the Turkish Mediterranean Sea drainages was presented. Fishes were caught with pulsed DC electro-fishing equipment from 28 sampling sites throughout Turkish Mediterranean Sea drainages between Göksu River and stream Boğa. The findings of the study demonstrate that Capoeta antalyensis inhabits in Köprüçay and Aksu rivers, and streams Boğa and Gündoğdu, all around Antalya. Capoeta caelestis widely distributed in coastal stream and rivers between Stream Dim (Alanya) in the west and Göksu River (Silifke) in the east. Metric and meristic characters were collected from the fish samples which obtained in the field for Capoeta caelestis and Capoeta antalyensis, and museum material for Capoeta damascina. In this way, morphologic features of the species revealed and Capoeta caelestis compared with Capoeta damascina to remove the hesitations about the validity of the species. The conservation status of Capoeta antalyensis was recommended to uplist from Vulnerable to Endangered. Keywords: Freshwater Fish Species; Anatolia; Pisces; Capoeta antalyensis; C.
    [Show full text]
  • Article Taxonomic Review of the Genus Capoeta Valenciennes, 1842 (Actinopterygii, Cyprinidae) from Central Iran with the Description of a New Species
    FishTaxa (2016) 1(3): 166-175 E-ISSN: 2458-942X Journal homepage: www.fishtaxa.com © 2016 FISHTAXA. All rights reserved Article Taxonomic review of the genus Capoeta Valenciennes, 1842 (Actinopterygii, Cyprinidae) from central Iran with the description of a new species Arash JOULADEH-ROUDBAR1, Soheil EAGDERI1, Hamid Reza GHANAVI2*, Ignacio DOADRIO3 1Department of Fisheries, Faculty of Natural Resources, University of Tehran, Karaj, Alborz, Iran. 2Department of Biology, Lund University, Lund, Sweden. 3Biodiversity and Evolutionary Biology Department, Museo Nacional de Ciencias Naturales-CSIC, Madrid, Spain. Corresponding author: *E-mail: [email protected] Abstract The genus Capoeta in Iran is highly diversified with 14 species and is one of the most important freshwater fauna components of the country. Central Iran is a region with high number of endemism in other freshwater fish species, though the present species was recognized as C. aculeata (Valenciennes, 1844), widely distributed within Kavir and Namak basins. However previous phylogenetic and phylogeographic studies found that populations of Nam River, a tributary of the Hableh River in central Iran are different from the other species. In this study, the mentioned population is described as a new species based on morphologic and genetic characters. Keywords: Inland freshwater of Iran, Nam River, Algae-scraping cyprinid, Capoeta. Zoobank: urn:lsid:zoobank.org:pub:3697C9D3-5194-4D33-8B6B-23917465711D urn:lsid:zoobank.org:act:7C7ACA92-B63D-44A0-A2BA-9D9FE955A2D0 Introduction There are 257 fish species in Iranian inland waters under 106 genera, 29 families and Cyprinidae with 111 species (43.19%) is the most diverse family in the country (Jouladeh-Roudbar et al.
    [Show full text]
  • Checklists of Parasites of Fishes of Salah Al-Din Province, Iraq
    Vol. 2 (2): 180-218, 2018 Checklists of Parasites of Fishes of Salah Al-Din Province, Iraq Furhan T. Mhaisen1*, Kefah N. Abdul-Ameer2 & Zeyad K. Hamdan3 1Tegnervägen 6B, 641 36 Katrineholm, Sweden 2Department of Biology, College of Education for Pure Science, University of Baghdad, Iraq 3Department of Biology, College of Education for Pure Science, University of Tikrit, Iraq *Corresponding author: [email protected] Abstract: Literature reviews of reports concerning the parasitic fauna of fishes of Salah Al-Din province, Iraq till the end of 2017 showed that a total of 115 parasite species are so far known from 25 valid fish species investigated for parasitic infections. The parasitic fauna included two myzozoans, one choanozoan, seven ciliophorans, 24 myxozoans, eight trematodes, 34 monogeneans, 12 cestodes, 11 nematodes, five acanthocephalans, two annelids and nine crustaceans. The infection with some trematodes and nematodes occurred with larval stages, while the remaining infections were either with trophozoites or adult parasites. Among the inspected fishes, Cyprinion macrostomum was infected with the highest number of parasite species (29 parasite species), followed by Carasobarbus luteus (26 species) and Arabibarbus grypus (22 species) while six fish species (Alburnus caeruleus, A. sellal, Barbus lacerta, Cyprinion kais, Hemigrammocapoeta elegans and Mastacembelus mastacembelus) were infected with only one parasite species each. The myxozoan Myxobolus oviformis was the commonest parasite species as it was reported from 10 fish species, followed by both the myxozoan M. pfeifferi and the trematode Ascocotyle coleostoma which were reported from eight fish host species each and then by both the cestode Schyzocotyle acheilognathi and the nematode Contracaecum sp.
    [Show full text]
  • Karyological Analysis of Cyprinion Macrostomum Heckel, 1843, from Godarkhosh River, Ilam Province, Iran
    Karyological analysis of Cyprinion macrostomum Heckel, 1843, from Godarkhosh River, Ilam Province, Iran Item Type article Authors Nasri, M.; Keivany, Y.; Dorafshan, S. Download date 02/10/2021 18:07:24 Link to Item http://hdl.handle.net/1834/37566 Iranian Journal of Fisheries Sciences 14(3) 786-796 2015 Karyological analysis of Cyprinion macrostomum Heckel, 1843, from Godarkhosh River, Ilam Province, Iran Nasri M.; Keivany Y.*; Dorafshan S. Received: May 2012 Accepted: December 2014 Abstract In this study, for the first time in Iran, the karyotype of bigmouth Lotak, Cyprinion macrostomum Heckel, 1843, was investigated through examining metaphase chromosomes of seven fish with mean weight 30±5g caught by electrofishing from Godarkhosh River in Ilam Province. To stimulate cell divisions, fish were injected intraperitoneally two times by phytohemagglutinin (PHA). The cell divisions were arrested in metaphase stage by intraperitoneal injection of colchicine. Well-separated cells were obtained from kidney and gill filament and chromosome spreads were prepared and stained with giemsa. Karyotype was obtained as 2n=50. The karyotype consisted of 5 metacentric, 12 submetacentric and 8 telocentric chromosome pairs. Centromeric index, arm ratio and Fundamental Number (FN) were determined as 0-50, 1-∞, and 84, respectively. Keywords: Bigmouth lotak, Cyprinion macrostomum, Godarkhosh River; Iran, Karyotype. Downloaded from jifro.ir at 1:12 +0330 on Thursday February 22nd 2018 Department of Natural Resources (Fisheries Division), Isfahan University of Technology, Isfahan 84156-83111, Iran. *Corresponding author's email: [email protected] 787 Nasri et al., Karyological analysis of Cyprinion macrostomum Heckel, 1843, from… Introduction 1983). In addition, we can pursuit ancestral The genus Cyprinion (Cyprinidae) karyological changes and fixation in comprises nine species, among which five various new species (Winkler et al., 2004).
    [Show full text]
  • Fish Exploitation at the Sea of Galilee (Israel) by Early Fisher
    FISH EXPLOITATION AT THE SEA OF GALILEE (ISRAEL) BY EARLY FISHER- HUNTER-GATHERERS (23,000 B.P.): ECOLOGICAL, ECONOMICAL AND CULTURAL IMPLICATIONS THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY by Irit Zohar SUBMITTED TO THE SENATE OF TEL-AVIV UNIVERSITY November, 2003 FISH EXPLOITATION AT THE SEA OF GALILEE (ISRAEL) BY EARLY FISHER- HUNTER-GATHERERS (23,000 B.P.): ECOLOGICAL, ECONOMICAL AND CULTURAL IMPLICATIONS THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY by Irit Zohar SUBMITTED TO THE SENATE OF TEL-AVIV UNIVERSITY November, 2003 This work was carried out under the supervision of Prof. Tamar Dayan and Prof. Israel Hershkovitz Copyright © 2003 TABLE OF CONTENTS Page CHAPTER 1: INTRODUCTION AND STATEMENT OF PURPOSE 1 1.1 Introduction 1 1.2 Cultural setting 2 1.3 Environmental setting 4 1.4 Outline of research objectives 5 CHAPTER 2: FISH TAPHONOMY 6 2.1 Introduction 6 2.2 Naturally deposited fish 7 2.3 Culturally deposited fish 9 CHAPTER 3: SITE SELECTION AND FIELD TECHNIQUES 11 3.1. The archaeological site of Ohalo-II 11 3.2. Fish natural accumulation 13 3.3 Ethnographic study of fish procurement methods 14 CHAPTER 4: METHODS 18 4.1 Recovery bias 18 4.2 Sampling bias 18 4.3 Identification of fish remains 19 4.4 Fish osteological characteristics 20 4.5 Quantification analysis 20 4.5.1 Taxonomic composition and diversity 21 4.5.2 Body part frequency 22 4.5.3 Survival index (SI) 22 4.5.4 Fragmentation index 23 4.5.5 WMI of fragmentation 24 4.5.6 Fish exploitation index 24 4.5.7 Bone modification 25 4.5.8 Bone spatial distribution 26 Page 4.5.9 Analytic calculations 26 4.6 Osteological measurements 29 4.6.1 Body mass estimation 29 4.6.2 Vertebrae diameter 31 CHAPTER 5: FISH REMAINS RECOVERED AT OHALO-II 32 5.1.
    [Show full text]
  • A Bibliography of the Fishes of the Tigris-Euphrates Basin
    A Bibliography of the Fishes of the Tigris-Euphrates Basin Bibliographie der Fische des Euphrat - Tigris - Beckens by Brian W. Coad and Lalth A. J. al·Hassan Introduction The Tigris-Euphrates basin is the major drainage basin of the Middle East, flowing through Turkey, Syria, Iraq and Iran. Its ichthyofauna provides a useful source of food and has been studied by biologists and systematists. The literature on this fauna is scattered through journals and books published in the Middle East and in many foreign countries and this is the first attempt to bring it all together. The bibliography comprises the principal systematic, distributional and biological works on the freshwater fishes ofthe Tigris-Euphrates basin. Some extralimital papers are included to facilitate study of this fauna as are revisio­ nary works which have an application to this basin. A more extensive bibliography on the fishes of Iran and their environ­ ment is in preparation (CoAD, MS). CoAD and KURU (1986) provide a bibliography on the fishes ofTurkey. Usually, the titel was cited in its original language. How­ ever, for articles in Arabic and Russian the title was translated into English or, if available, the title of the English summary was used. EinfUhrung Das Euphrat - Tigris - Becken ist das wichtigste Gewiisser­ system des Mittleren Ostens. das die Liinder Tiirkei. Syrien. lrak und Iran umfaBt. Die Fischfauna dieser Gewiisser stellt eine wichtige Nahrungsgrundlage in den Anrainerstaaten dar und ist und war der Gegenstand zahlreicher biologischer Untersuchun­ gen. Diese Literatur ist auf zahlreiche Zeitschriften und Biicher sowohl im Nahen und Mittleren Osten selbst. als auch im Aus­ land verstreut.
    [Show full text]
  • Strontium and Oxygen Isotope Analyses Reveal Late Cretaceous Shark Teeth in Iron Age Strata in the Southern Levant
    fevo-08-570032 December 11, 2020 Time: 20:56 # 1 ORIGINAL RESEARCH published: 17 December 2020 doi: 10.3389/fevo.2020.570032 Strontium and Oxygen Isotope Analyses Reveal Late Cretaceous Shark Teeth in Iron Age Strata in the Southern Levant Thomas Tütken1*, Michael Weber1, Irit Zohar2,3, Hassan Helmy4, Nicolas Bourgon5, Omri Lernau3, Klaus Peter Jochum6 and Guy Sisma-Ventura7* 1 Institute of Geosciences, Johannes Gutenberg University of Mainz, Mainz, Germany, 2 Beit Margolin, Oranim Academic College, Kiryat Tivon, Israel, 3 Zinman Institute of Archaeology, University of Haifa, Haifa, Israel, 4 Department of Geology, Minia University, Minia, Egypt, 5 Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany, 6 Department of Climate Geochemistry, Max Planck Institute for Chemistry, Mainz, Germany, 7 Oceanographic and Limnological Research, Haifa, Israel Skeletal remains in archaeological strata are often assumed to be of similar ages. Here we show that combined Sr and O isotope analyses can serve as a powerful tool for assessing fish provenance and even for identifying fossil fish teeth in archaeological Edited by: contexts. For this purpose, we established a reference Sr and O isotope dataset of Brooke Crowley, extant fish teeth from major water bodies in the Southern Levant. Fossil shark teeth were University of Cincinnati, United States identified within Iron Age cultural layers dating to 8–9th century BCE in the City of David, Reviewed by: Jerusalem, although the reason for their presence remains unclear. Their enameloid Laszlo Kocsis, 87 86 18 Universiti Brunei Darussalam, Brunei Sr/ Sr and d OPO4 values [0.7075 ± 0.0001 (1 SD, n = 7) and 19.6 ± 0.9 Malte Willmes, (1 SD, n = 6), respectively], are both much lower than values typical for modern marineh University of California, Santa Cruz, United States sharks from the Mediterranean Sea [0.7092 and 22.5–24.6 (n = 2), respectively].
    [Show full text]
  • Spirulina Platensis Türünün Bakir, Kadmiyum Ve Toksisite Seviyesinin Belirlenmesi
    T.C. NEVŞEHİR HACI BEKTAŞ VELİ ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ MERSİN İLİ TATLI SU BALIK FAUNASI Tezi Hazırlayan Gizem TEMİZ Tezi Yöneten Dr. Öğr. Üyesi Sevil SUNGUR Biyoloji Anabilim Dalı Yüksek Lisans Tezi HAZİRAN 2019 NEVŞEHİR T.C. NEVŞEHİR HACI BEKTAŞ VELİ ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ MERSİN İLİ TATLI SU BALIK FAUNASI Tezi Hazırlayan Gizem TEMİZ Tezi Yöneten Dr. Öğr. Üyesi Sevil SUNGUR Biyoloji Anabilim Dalı Yüksek Lisans Tezi HAZİRAN 2019 NEVŞEHİR TEŞEKKÜR Yüksek lisans öğrenimim ve tez çalışmam süresince bilgilerini benimle paylaşmaktan kaçınmayan, her türlü konuda desteğini benden esirgemeyen ve güler yüzünü hiç eksik etmeyen değerli danışman hocam Dr. Sevil SUNGUR’a, Tez çalışmam süresince her türlü konuda desteğini benden esirgemeyen Prof. Dr. Erdoğan ÇİÇEK’e, Arazi çalışmalarım sırasında yardımlarından dolayı Selda ÖZTÜRK, Burak SEÇER’e, Teknik ve idari yardımlarından dolayı Nevşehir Hacı Bektaş Veli Üniversitesi, Fen- Edebiyat Fakültesi Dekanlığına, Biyoloji Bölüm Başkanlığı’na ve Fen Bilimleri Enstitüsü’ne teşekkür eder, Öğrenim hayatım ve tüm yaşamım boyunca maddi ve manevi olarak her zaman desteklerini hissettiren değerli aileme minnettarlığımı sunarım. Bu çalışma materyallerinin bir kısmının, Orman ve Su İşleri Bakanlığı tarafından yürütülmekte olan, Ulusal Biyolojik Çeşitlilik Envanter ve İzleme Projesi (UBENİS) kapsamında Mersin İli Karasal ve İç Su Ekosistemleri Biyolojik Çeşitlilik Envanter ve İzleme İşi için yürütülmüş olan arazi çalışmaları sırasında elde edilmiş olması nedeniyle, Orman ve Su İşleri Bakanlığı, Doğa Koruma ve Milli Parklar Genel Müdürlüğü, Orman ve Su İşleri Bakanlığı 5 Bölge Müdürlüğü ve Mersin Şube Müdürlüğü’ne teşekkür ederim. iii MERSIN İLI TATLI SU BALIK FAUNASI (Yüksek Lisans Tezi) Gizem TEMİZ NEVŞEHİR HACI BEKTAŞ VELİ ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ Haziran 2019 ÖZET Bu çalışmada Mersin ilinin tatlı su balık faunası Mayıs 2017-Eylül 2018 tarihleri arasında yapılan arazi çalışmalarında toplanan örneklerin morfolojik karakterlere dayalı teşhisi ile belirlenmiştir.
    [Show full text]
  • Growth and Reproductive Biology of Capoeta Damascina (Valenciennes, 1842) from a Tributary of Tigris
    Iranian Journal of Fisheries Sciences 14(4) 956-969 2015 Growth and reproductive biology of Capoeta damascina (Valenciennes, 1842) from a tributary of Tigris Bahrami Kamangar B.1*; Ghaderi E.2; Hoseinpour H.3 Received: October 2013 Accepted: July 2015 Abstract Growth and reproductive attributes were determined for Capoeta damascina, an endemic fish species from west of Iran. A total of 147 specimens of both sexes were sampled monthly from November 2008 to October 2009. The overall sex ratio was female biased. Males were aged 0-4 years and females 0-5 years. The von Bertalanffy -1 growth parameters were estimated as; Linf=34.81 cm, k=0.27 year , t0=-0.65 for males -1 plus unsexed samples, Linf =46.29 cm, k=0.22 year , t0 =-0.59 for females plus unsexed -1 samples and Linf =67.52 cm, k=0.12 year , t0=-0.79 for whole samples. The length- weight relationships were W=0.021L2.815 for males, W=0.022L2.824 for females and W=0.020L2.836 for combined sexes, all of which exhibited a negative allometric growth. Spawning season started in May, ascending to June and ended in July for both sexes. Length at 50% maturity was estimated as 12.35 cm for males and 15.14 cm for females. Fecundity ranged from 1551 (2 years old) to 20523 (5 years old) eggs per fish. Losing of large individuals and decreasing in size at first maturity were observed in the studied population compared to data reported from other C. damascina populations, which could reflect an effect of overexploitation.
    [Show full text]