Iran. J. Ichthyol. (September 2017), 4(3): 231-269 Received: July 27, 2017 © 2017 Iranian Society of Ichthyology Accepted: September 10, 2017 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.22034/iji.v4i3.23902.015 http://www.ijichthyol.org Research Article Mitochondrial phylogeny and taxonomic status of the Capoeta damascina species group (Actinopterygii: Cyprinidae) in Iran with description of a new species Halimeh ZAREIAN, Hamid Reza ESMAEILI* Ichthyology and Molecular Systematics Research Laboratory, Zoology Section, Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran. * Email: [email protected] Abstract: The members of the genus Capoeta show an abstruse taxonomic status, a complex evolutionary history with the highest diversification in the Middle East and are closely related to the genus Luciobarbus. Our molecular and morphological results confirm the existence of eight species within the Capoeta damascina group in Iran. In this paper all eight recognized species are reviewed, and diagnoses are presented for all species. Capoeta birunii is considered as new species from Zayandehrud drainage basins. This species is distinguished from other small scaled Capoeta in the C. damascina group by a combination of morphological and molecular characters. Keywords: Capoeta, Molecular analyses, Systematics, Distribution. Citation: Zareian, H. & Esmaeili, H.R. 2017. Mitochondrial phylogeny and taxonomic status the Capoeta damascina species group (Actinopterygii: Cyprinidae) in Iran with description of a new species. Iranian Journal of Ichthyology 4(3): 231-269. Introduction includes about 34 species widely distributed in many Iran has one of the most diverse and species-rich river drainages and basins in southwest Asia except freshwater ichthyofaunas in the Middle East the Arabian Peninsula (Jouladeh-Roudbar et al. 2015; (Esmaeili et al. 2017). However, unresolved Alwan et al. 2016a; Ghanavi et al. 2016; Keivany et taxonomic problems could result in higher fish al. 2016; Esmaeili et al. 2016, 2017; Zareian et al. diversity including cyprinid fishes of the genus 2016a, b; Eschmeyer & Fricke 2017). They have Capoeta Valenciennes, 1842 (Kücük et al. 2009; been classified into three groups, namely the Esmaeili et al. 2017). Members of the genus Capoeta C. capoeta, C. damascina and C. trutta species groups exist in the Middle East and southwest Asia. This (see Jouladeh-Roudbar et al. 2015; Alwan et al. region is an important crossroads of biotic exchange 2016a; Ghanavi et al. 2016; Zareian et al. 2016a, b). with complex geological events such as novel The Capoeta damascina species group, orogeny (Durand et al. 2002; Krupp et al. 2009) morphologically characterized by having small which is the consequence of the ongoing northward scales, was originally defined by Schöter et al. convergence of the African, Arabian and Indian (2009), and is an important issue in taxonomic study plates towards Eurasia (Zhao & Xie 2016) resulting of cyprinid fishes in recent years. Alwan et al. (2011, in isolated river basins promoting speciation events. 2016a, b) studied the Capoeta damascina species As presently recognized, the genus Capoeta group using COI and LSU genes, using a few Iranian 231 Iran. J. Ichthyol. (September 2017), 4(3): 231-269 Fig.1. Map of Iran showing different basins (M= Maharlu). After Esmaeili et al. (2017). specimens and later Ghanavi et al. (2016) studied populations which were not identified as any diversity of Capoeta species in Iran using the cytb described species (Ghanavi et al. 2016). Three of gene. The latter study proposed the presence of five these suggested new taxa were small scaled Capoeta new species of Capoeta in Iranian basins, three of distributed in the Tigris River tributaries of the them belong to the C. damascina species group and Persian Gulf basin, traditionally identified as then Jouladeh-Roudbar et al. (2017) described those C. damascina or C. saadii (Jouladeh-Roudbar et al. three new small scaled Capoeta. 2015b; Esmaeili et al. 2010; 2017). The Capoeta damascina species group occurs in Hence, the main aim of this study is to clarify the the entire Levant, Mesopotamia, Orontes, Iran and taxonomic status of the Capoeta damascina species the southern and eastern parts of Turkey. In Iran, it is group in Iran, to provide a taxonomic review and reported from the Tigris (part of the Tigris-Euphrates mitochondrial phylogeny on this group and describe River system), Namak Lake, Esfahan, Kor, Maharlu, one new species. Persis, Kerman-Nain and Hormuz basins (Coad 1995; 2008; Esmaeili et al. 2010, 2015, 2017). The Materials and Methods taxonomic status of this group is largely unsettled Taxon sampling: Fish samples were collected from (Krupp & Schneider 1989; Esmaeili et al. 2010; endorheic (Caspian Sea, Urmia Lake, Namak Lake, 2017; Alwan et al. 2016a, b; Zareian et al. 2016a, b). Kor, Kavir, Zayandehrud: Esfahan) and exorheic A detailed study of the populations of the Capoeta (Persis: Mond, Tigris, flowing into the Persian Gulf) damascina species group in Iran found some basins (Fig. 1). After anesthesia (using Clove oil), 232 Zareian and Esmaeili - Phylogeny and taxonomy of Capoeta damascina species group in Iran Table 1. Primer used in this study. Name Sequence Gene Reference FishF1 5'TCAACCAACCACAAAGACATTGGCAC3' FishR1 5'TAGACTTCTGGGTGGCCAAAGAATCA3' COI Ward et al. 2005 L14724 5'GTGACTTGAAAAACCACCGTTG3' H15915 5'CAACGATCTCCGGTTTAGAAGAC3' cytb Xiao et al. 2001 GluF 5'AACCACCGTTGTATTCAACTACAA3' H15560 5`TAGGCRAATAGG AAR TATCA3` cytb Machordom & Doadrio 2001 specimens were fixed in 10% formaldehyde and later oxidase subunit 1: 650 bp) and cytochrome b (cytb: stored in 70% ethanol for the morphological study. 900 bp) region were amplified using a primer pairs The right pectoral fin or tissue from below the dorsal listed in Table 1. fin on the right side of each specimen was removed Purification and sequencing of the PCR products using sterile techniques and utensils and preserved in were conducted at Macrogen Korea Laboratories 96% ethanol and numbered separately at the using aforementioned primer pairs. Data processing sampling sites for the molecular study implied by and sequence assembly was done in BioEdit 7.2.5 sterile techniques. (Hall 1999) and MEGA6 (Tamura et al. 2013) was Morphological analyses: Twenty-two morphometric used to create a DNA sequence alignment using measurements were conducted with an electronic Clustal W program for COI and cytb. No indications digital caliper, to the nearest 0.01mm. For measuring of unexpected stop-codons occurred in any sequence. fish greater than 200mm total length, a ruler or a All generated DNA barcodes and cytb are deposited measuring tape was used. All measurements were in the NCBI GenBank, and given with their made point to point, and never by projections. respective accession numbers (Table 2). The most Measurements and counts mainly followed Hubbs & appropriate sequence evolution model for the given Lagler (1958), Krupp (1983) and Kottelat & Freyhof data was determined with Modeltest (Posada & (2007). Fin ray counts separate unbranched and Crandall 1998) as implemented in the MEGA6 branched rays. The last two branched rays software. The model with the lowest BIC (Bayesian articulating on a single pterygiophore in the dorsal Information Criterion) scores is considered to best and anal fins are counted as "1½". Principle describe the substitution pattern. To explore species Components and Discriminant Factor analysis were phylogenetic affinities, we generated Maximum performed using SPSS software (Ver. 22). Likelihood phylogenetic trees with 10,000 bootstrap Abbreviations: SL, standard length; HL, lateral head replicates in RaxML software 7.2.5 (Stamatakis length; ALL, scale rows between lateral line and 2006) under the GTR+G model of nucleotide dorsal fin origin, BLL, scale rows between lateral substitution, with fast bootstrap for both genes and line and anal fin origin, NMW, Naturhistorisches also Bayesian analysis (BA) of nucleotide sequences Museum Wien, Vienna; ZM-CBSU, Zoological was performed, using the Markov Chain Monte Carlo Museum of Shiraz University, Collection of Biology algorithm (MCMC), with 10,000,000 generations Department, Shiraz. under the most generalizing model (GTR+G+I) using Molecular analyses: DNA extraction from either Mr. Bayes 3.1.1 (Huelsenbeck & Ronquist 2001). muscle tissues or fin clips were done using the Salt Screening for diagnostic nucleotide substitutions was method (Bruford et al. 1992). The standard vertebrate performed manually from the sequence alignment. DNA barcode region of the COI (cytochrome c Cyprinus carpio was used as outgroup. 233 Iran. J. Ichthyol. (September 2017), 4(3): 231-269 Table 2. List of species used in this study with museum number. * indicate accession numbers of COI genes and others are cytb gene accession numbers. Species Basin Museum N. Accession N. Species Basin Museum N. Accession N. C. buhsei Namak ZM-CBSU 1289 KU564292* C. anamisensis Minab ZM-CBSU 1416 KU312342* MF621312 KU312379 C. buhsei Namak ZM-CBSU 1290 KU564293* C. anamisensis Minab ZM-CBSU 1417 KU312343* MF621311 KU312380 C. buhsei Namak ZM-CBSU 1292 MF621275* C. anamisensis Hasan Langi ZM-CBSU 1475 KU312341* MF621310 KU312381 C. buhsei Namak ZM-CBSU 1299 KU312349* C. pyragyi Tigris ZM-CBSU 1474 MF621294* KU312369 MF621321 C. buhsei Namak ZM-CBSU 1300 KU312350* C. pyragyi Tigris ZM-CBSU 1470 MF621293* KU312370 MF621322 C. coadi Tigris ZM-CBSU 1447 KU564297* C. shajariani Tigris ZM-CBSU 1835 MF621299* KU564303