DOCSLIB.ORG

Pre-Activation of the P53 Pathway Through Nutlin-3A Sensitises Sarcomas to Drozitumab Therapy Oncology Reports, 2013; 30(1):471-477

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pre-Activation of the P53 Pathway Through Nutlin-3A Sensitises Sarcomas to Drozitumab Therapy Oncology Reports, 2013; 30(1):471-477 PUBLISHED VERSION Pishas, K.I., Neuhaus, S.J., Clayer, M.T., Adwal, A., Brown, M.P., Evdokiou, A., Callen, D.F., Neilsen, P.M. Pre-activation of the p53 pathway through Nutlin-3a sensitises sarcomas to drozitumab therapy Oncology Reports, 2013; 30(1):471-477 DOI: 10.3892/or.2013.2454 PERMISSIONS http://www.spandidos-publications.com/pages/info_for_authors 10. Author self-archiving Authors are encouraged to submit the final publisher’s version PDF of their manuscript to their institution’s repository 6 months following publication, as well as to their funding body’s archive. A link to the published version on the Spandidos Publications website must be included with full citation details and acknowledgement of the journal as the original source. Authors that have purchased open access can add the final publisher's PDF to their institutional repository and funding body's archive immediately. 16th April 2015 http://hdl.handle.net/2440/80828 ONCOLOGY REPORTS 30: 471-477, 2013 Pre-activation of the p53 pathway through Nutlin-3a sensitises sarcomas to drozitumab therapy KATHLEEN I. PISHAS1,2, SUSAN J. NEUHAUS1,3, MARK T. CLAYER4, ALAKNANDA ADWAL1, MICHAEL P. BROWN1,5, ANDREAS EVDOKIOU1,6, DAVID F. CALLEN1 and PAUL M. NEILSEN1,2 1Centre for Personalised Cancer Medicine, The University of Adelaide; 2Sarcoma Research Group, Discipline of Medicine, The University of Adelaide; 3 Department of Surgery, The University of Adelaide, Royal Adelaide Hospital; 4Department of Orthopaedics and Trauma, Royal Adelaide Hospital; 5Cancer Clinical Trials Unit, Royal Adelaide Hospital; 6Discipline of Surgery, The University of Adelaide, Basil Hetzel Institute, Adelaide, South Australia, Australia Received February 7, 2013; Accepted March 20, 2013 DOI: 10.3892/or.2013.2454 Abstract. The present study evaluated the efficacy of droz- Activation of the extrinsic pathway of apoptosis through itumab, a human monoclonal agonistic antibody directed the use of recombinant ligand and agonistic monoclonal anti- against death receptor 5 (DR5), as a new therapeutic avenue bodies directed against TRAIL receptors DR4 (TRAIL-R1) for the targeted treatment of bone and soft-tissue sarcomas. and/or DR5 (TRAIL-R2) has been explored as a promising new The antitumour activity of drozitumab as a monotherapy or targeted therapy for numerous types of malignancies. Based in combination with Nutlin-3a was evaluated in a panel of on their selective ability to induce apoptosis in a variety of sarcoma cell lines in vitro and human sarcoma patient samples human cancer cell lines and xenografts while sparing normal ex vivo. Knockdown experiments were used to investigate the cells (1), several agents are currently undergoing phase I and central role of p53 as a regulator of drozitumab cytotoxicity. II clinical testing both as single agents and in combination Pre-activation of the p53 pathway through Nutlin-3a upregu- with traditional chemotherapies. These include monoclonal lated DR5, subsequently sensitising sarcoma cell lines and agonistic antibodies which specifically target either DR5, human sarcoma specimens to the pro-apoptotic effects of drozitumab (Genetech) (2), lexatumumab (Human Genome drozitumab. Silencing of p53 strongly decreased DR5 mRNA Sciences) (3-6), conatumumab (Amgen) (7-10), tigatuzumab expression resulting in abrogation of drozitumab-induced (humanized IgG1 antibody; Daiichi-Sankyo) and LBY135 apoptosis. Our study provides the first pre-clinical evaluation [chimeric (mouse/human) IgG1 antibody; Novartis] (11) or of combination therapy using p53-activating agents with droz- DR4, mapatumumab (Human Genome Sciences) (12-17) or itumab to further sensitise sarcomas to the cytotoxic effects of both cognate receptors as well as three decoy receptors of DR5 antibody therapy. recombinant human TRAIL (rhApo2L/TRAIL) (dulanermin, Amgen/Genentech) (18). Introduction Results from early trials have established that DR4 and DR5 agonistic antibodies can be considered safe and are well Sarcomas represent a diverse group of heterogeneous mesen- tolerated with responses not limited to histological subtype. chymal neoplasms that affect ~200,000 individuals worldwide However, the clinical efficacy of these agonistic antibodies as each year. There has been limited improvement in overall monotherapeutic agents has proven to be quite poor, with only 5-year survival rates for sarcoma patients over the past 30 a few patients showing partial or complete responses (19). Out years, particularly for patients with metastatic disease. As such, of the 41 evaluable patients who participated in dose escala- the use of molecular-targeted therapies has emerged as a prom- tion phase I clinically testing of drozitumab, partial responses ising new therapeutic approach for the treatment of sarcomas. were reported in only 3 patients (chondrosarcoma, colorectal cancer and ovarian cancer) (2). These findings reflect cell culture studies which indicate that only a small subset of sarcoma cell lines are highly sensitive to DR5 agonistic anti- Correspondence to: Dr Paul M. Neilsen, Sarcoma Research Group bodies (20-23). and Centre for Personalised Cancer Medicine, Level 3 Hanson The poor clinical efficacy of drozitumab as a monotherapy Institute, The University of Adelaide, Frome Road, Adelaide 5000, warrants further investigation into combinational therapeutic South Australia, Australia approaches involving drozitumab with other systemic thera- E-mail: [email protected] pies to synergistically drive tumour regression. Furthermore, additional mechanistic studies are required to completely Key words: Nutlin-3a, drozitumab, TP53, sarcoma delineate the fundamental regulators of drozitumab. A broad spectrum of apoptosis regulatory molecules (FLIP, XIAP 472 PISHAS et al: Nutlin-3a SENSITISES SARCOMAS TO DROZITUMAB THERAPY Table I. Primer sequences utilised in this study. Primer sequence 5'→3' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Forward Reverse PPIG (housekeeping) CAGATGCAGCTAGCAAACCGTTTG CTCTTCAGTAGCACTTTCGGAATCAGAGG DR5 (TRAIL-R2) CGCTGCACCAGGTGTGATT GTGCCTTCTTCGCACTGACA p21 (CDKN1A) TGGACCTGGAGACTCTCAGGGTCG TTAGGGCTTCCTCTTGGAGAAGATC PUMA (BBC3) ACGACCTCAACGCACAGTACG TCCCATGATGAGATTGTACAGGAC p53 exons 2-4 GTGTCTCATGCTGGATCCCCACT GGATACGGCCAGGCATTGAAGT p53 exons 5-6 TGCAGGAGGTGCTTACGCATGT CCTTAACCCCTCCTCCCAGAGAC p53 exons 7-9 ACAGGTCTCCCCAAGGCGCACT TTGAGGCATCACTGCCCCCTGAT p53 exon 10 GTCAGCTGTATAGGTACTTGAAGTGCAG TGGCAGCTGAGCTAGACCTCG p53 exon 11 CCTTAGGCCCTTCAAAGCATTGGTCA GTGCTTCTGACGCACACCTATTGCAAG and Bcl-XL) and signalling pathways (NF-κB and Akt) itumab + anti-Fcγ at the indicated concentrations for 24 h. are believed to confer resistance; however, little is known Drozitumab (a kind gift from Dr Avi Ashkenazi, Genentech concerning the influence of proteins which sensitise tumour Inc., South San Francisco, CA, USA), was cross-linked with cells to drozitumab therapy, apart from DR5 itself. The protein anti-human IgG Fcγ antibody (Jackson ImmunoResearch and mRNA expression levels of DR5 and DR4 in sarcoma cell Laboratories, Inc., West Grove, PA, USA) as previously lines have been extensively documented in literature. Notably, described (28). For synergy experiments, cells were pre-treated resistance to TRAIL-mediated apoptosis is not associated with Nutlin-3a (Cayman Biochemicals, Ann Arbor, MI, USA) with differential expression of TRAIL-receptors between for 24 h prior to the addition of drozitumab + anti-Fcγ. Cells sensitive and resistant sarcoma cell lines (24,25). As DR5 has were harvested and processed as previously described (27). been shown to be a transcriptional target of p53 (26), this study The viability of harvested cells was determined using 7-amino- assessed the role of p53 in mediating sensitivity to drozitumab actinomycin-D staining and processed on a FACSCalibur flow in sarcoma cell lines and human sarcoma patient material. cytometer (Becton-Dickinson Immunocytometry Systems, As expected, knockdown of p53 ablated drozitumab-induced Franklin Lakes, NJ, USA). apoptosis in vitro. Furthermore, pre-activation of the p53 pathway through Nutlin-3a (p53-MDM2 antagonist) enhanced RNA interference. Cell lines with silenced expression of p53 the cytotoxic effects of drozitumab both in vitro and ex vivo. were generated using the pGIPZ lentiviral shRNAmir system Our study provides the first pre-clinical evidence that pre- (Open Biosystems) as previously described (29). Briefly, activation of the p53 pathway in conjunction with drozitumab HEK-293T cells were seeded at 50% confluency and trans- will potentially provide an effective therapeutic means to fected with either a non-silencing scramble control (RHS4346) maximise the apoptotic response from both the extrinsic and or shRNA directed against human p53 (V2LHS217) using intrinsic pathway for the treatment of sarcomas. Trans-Lentiviral packaging mix according to the manufac- turer's protocol (Thermo Fisher Scientific, Waltham, MA, Materials and methods USA). Forty-eight hours post-transfection, growth medium containing lentivirus particles was filtered and added to Cell culture. Osteosarcoma (Saos-2, U20S) and Ewing's recipient TC252 cells seeded at 50% confluency. Polyclonal sarcoma (SK-ES1, RD-ES) cell lines were purchased from populations of transduced cells were generated through subse- American Type Tissue Culture (ATCC, Manassas, VA, USA). quent puromycin selection Additional Ewing's
Load more

Recommended publications
  • Predictive QSAR Tools to Aid in Early Process Development of Monoclonal Antibodies
    Predictive QSAR tools to aid in early process development of monoclonal antibodies John Micael Andreas Karlberg Published work submitted to Newcastle University for the degree of Doctor of Philosophy in the School of Engineering November 2019 Abstract Monoclonal antibodies (mAbs) have become one of the fastest growing markets for diagnostic and therapeutic treatments over the last 30 years with a global sales revenue around $89 billion reported in 2017. A popular framework widely used in pharmaceutical industries for designing manufacturing processes for mAbs is Quality by Design (QbD) due to providing a structured and systematic approach in investigation and screening process parameters that might influence the product quality. However, due to the large number of product quality attributes (CQAs) and process parameters that exist in an mAb process platform, extensive investigation is needed to characterise their impact on the product quality which makes the process development costly and time consuming. There is thus an urgent need for methods and tools that can be used for early risk-based selection of critical product properties and process factors to reduce the number of potential factors that have to be investigated, thereby aiding in speeding up the process development and reduce costs. In this study, a framework for predictive model development based on Quantitative Structure- Activity Relationship (QSAR) modelling was developed to link structural features and properties of mAbs to Hydrophobic Interaction Chromatography (HIC) retention times and expressed mAb yield from HEK cells. Model development was based on a structured approach for incremental model refinement and evaluation that aided in increasing model performance until becoming acceptable in accordance to the OECD guidelines for QSAR models.
    [Show full text]
  • Activating Death Receptor DR5 As a Therapeutic Strategy for Rhabdomyosarcoma
    International Scholarly Research Network ISRN Oncology Volume 2012, Article ID 395952, 10 pages doi:10.5402/2012/395952 Review Article Activating Death Receptor DR5 as a Therapeutic Strategy for Rhabdomyosarcoma Zhigang Kang,1, 2 Shi-Yong Sun,3 and Liang Cao1 1 Genetics Branch, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892, USA 2 Laboratory of Proteomics and Analytical Technologies, SAIC-Frederick, Inc., NCI Frederick, Frederick, MD 21702, USA 3 Department of Hematology and Medical Oncology, Winship Cancer Institute, Emory University School of Medicine, Atlanta, GA 30322, USA Correspondence should be addressed to Liang Cao, [email protected] Received 4 January 2012; Accepted 24 January 2012 Academic Editors: E. Boven and S. Mandruzzato Copyright © 2012 Zhigang Kang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children. It is believed to arise from skeletal muscle progenitors, preserving the expression of genes critical for embryonic myogenic development such as MYOD1 and myogenin. RMS is classified as embryonal, which is more common in younger children, or alveolar, which is more prevalent in elder children and adults. Despite aggressive management including surgery, radiation, and chemotherapy, the outcome for children with metastatic RMS is dismal, and the prognosis has remained unchanged for decades. Apoptosis is a highly regulated process critical for embryonic development and tissue and organ homeostasis. Like other types of cancers, RMS develops by evading intrinsic apoptosis via mutations in the p53 tumor suppressor gene.
    [Show full text]
  • Tanibirumab (CUI C3490677) Add to Cart
    5/17/2018 NCI Metathesaurus Contains Exact Match Begins With Name Code Property Relationship Source ALL Advanced Search NCIm Version: 201706 Version 2.8 (using LexEVS 6.5) Home | NCIt Hierarchy | Sources | Help Suggest changes to this concept Tanibirumab (CUI C3490677) Add to Cart Table of Contents Terms & Properties Synonym Details Relationships By Source Terms & Properties Concept Unique Identifier (CUI): C3490677 NCI Thesaurus Code: C102877 (see NCI Thesaurus info) Semantic Type: Immunologic Factor Semantic Type: Amino Acid, Peptide, or Protein Semantic Type: Pharmacologic Substance NCIt Definition: A fully human monoclonal antibody targeting the vascular endothelial growth factor receptor 2 (VEGFR2), with potential antiangiogenic activity. Upon administration, tanibirumab specifically binds to VEGFR2, thereby preventing the binding of its ligand VEGF. This may result in the inhibition of tumor angiogenesis and a decrease in tumor nutrient supply. VEGFR2 is a pro-angiogenic growth factor receptor tyrosine kinase expressed by endothelial cells, while VEGF is overexpressed in many tumors and is correlated to tumor progression. PDQ Definition: A fully human monoclonal antibody targeting the vascular endothelial growth factor receptor 2 (VEGFR2), with potential antiangiogenic activity. Upon administration, tanibirumab specifically binds to VEGFR2, thereby preventing the binding of its ligand VEGF. This may result in the inhibition of tumor angiogenesis and a decrease in tumor nutrient supply. VEGFR2 is a pro-angiogenic growth factor receptor
    [Show full text]
  • Pancreatic Cancer Stem Cells in Patient Pancreatic Xenografts Are Sensitive to Drozitumab, an Agonistic Antibody Against DR5 Jason W.-L
    Eng et al. Journal for ImmunoTherapy of Cancer (2016) 4:33 J Immunother Cancer: first published as 10.1186/s40425-016-0136-y on 21 June 2016. Downloaded from DOI 10.1186/s40425-016-0136-y RESEARCHARTICLE Open Access Pancreatic cancer stem cells in patient pancreatic xenografts are sensitive to drozitumab, an agonistic antibody against DR5 Jason W.-L. Eng1†, Thomas A. Mace1,2†, Rohit Sharma3,4, Danielle Y. F. Twum1, Peng Peng1, John F. Gibbs3,5, Rosemarie Pitoniak1, Chelsey B. Reed1, Scott I. Abrams1, Elizabeth A. Repasky1 and Bonnie L. Hylander1* Abstract Background: Therapeutic resistance and tumor recurrence are two major hurdles in the treatment of pancreatic ductal adenocarcinoma. Recent findings suggest that both of these attributes are associated with a small subset of pancreatic tumor initiating cancer stem cells (CSCs). Here, we demonstrate that drozitumab, a human agonistic monoclonal antibody which binds the death receptor DR5, selectively eliminates CSCs, resulting in tumor growth inhibition and even regression of pancreatic tumors. Methods: To examine the efficacy of drozitumab against pancreatic CSCs, we treated patient-derived pancreatic tumor xenografts (PDX) in immunocompromised SCID mice and evaluated tumor control. To assess apoptosis following drozitumab treatment, we identified the CSCs as CD24+, CD44+, and EpCAM+ by FACS analysis, and measured in vivo and in vitro levels of cleaved caspase-3. Lastly, in vitro evaluation of DR5 re-expression was performed using isolated patient pancreatic cancer xenograft cells along with the cell line, Panc-1. After treatment with drozitumab, the remaining DR5- cells were assessed by FACS analysis for DR5 expression at the cell surface at 8, 24 and 48 h post-treatment.
    [Show full text]
  • Looking for Therapeutic Antibodies in Next Generation Sequencing Repositories
    bioRxiv preprint doi: https://doi.org/10.1101/572958; this version posted March 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Title: Looking for Therapeutic Antibodies in Next Generation Sequencing Repositories. Authors: Konrad Krawczyk1*, Matthew Raybould2, Aleksandr Kovaltsuk2, Charlotte M. Deane2 1 NaturalAntibody, Hamburg, Germany 2 Oxford University Department of Statistics, Oxford, UK *Correspondence to [email protected] Abstract: Recently it has become possible to query the great diversity of natural antibody repertoires using Next Generation Sequencing (NGS). These methods are capable of producing millions of sequences in a single experiment. Here we compare Clinical Stage Therapeutic antibodies to the ~1b sequences from 60 independent sequencing studies in the Observed Antibody Space Database. Of the 242 post Phase I antibodies, we find 16 with sequence identity matches of 95% or better for both heavy and light chains. There are also 54 perfect matches to therapeutic CDR-H3 regions in the NGS outputs, suggesting a nontrivial amount of convergence between naturally observed sequences and those developed artificially. This has potential implications for both the discovery of antibody therapeutics and the legal protection of commercial antibodies. Introduction Antibodies are proteins in jawed vertebrates that recognize noxious molecules (antigens) for elimination. An organism expresses millions of diverse antibodies to increase the chances that some of them will be able to bind the foreign antigen, initiating the adaptive immune response.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2017/0172932 A1 Peyman (43) Pub
    US 20170172932A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0172932 A1 Peyman (43) Pub. Date: Jun. 22, 2017 (54) EARLY CANCER DETECTION AND A 6LX 39/395 (2006.01) ENHANCED IMMUNOTHERAPY A61R 4I/00 (2006.01) (52) U.S. Cl. (71) Applicant: Gholam A. Peyman, Sun City, AZ CPC .......... A61K 9/50 (2013.01); A61K 39/39558 (US) (2013.01); A61K 4I/0052 (2013.01); A61 K 48/00 (2013.01); A61K 35/17 (2013.01); A61 K (72) Inventor: sham A. Peyman, Sun City, AZ 35/15 (2013.01); A61K 2035/124 (2013.01) (21) Appl. No.: 15/143,981 (57) ABSTRACT (22) Filed: May 2, 2016 A method of therapy for a tumor or other pathology by administering a combination of thermotherapy and immu Related U.S. Application Data notherapy optionally combined with gene delivery. The combination therapy beneficially treats the tumor and pre (63) Continuation-in-part of application No. 14/976,321, vents tumor recurrence, either locally or at a different site, by filed on Dec. 21, 2015. boosting the patient’s immune response both at the time or original therapy and/or for later therapy. With respect to Publication Classification gene delivery, the inventive method may be used in cancer (51) Int. Cl. therapy, but is not limited to such use; it will be appreciated A 6LX 9/50 (2006.01) that the inventive method may be used for gene delivery in A6 IK 35/5 (2006.01) general. The controlled and precise application of thermal A6 IK 4.8/00 (2006.01) energy enhances gene transfer to any cell, whether the cell A 6LX 35/7 (2006.01) is a neoplastic cell, a pre-neoplastic cell, or a normal cell.
    [Show full text]
  • Monoclonal Antibody-Based Therapy As a New Treatment Strategy in Multiple Myeloma
    Leukemia (2012) 26, 199–213 & 2012 Macmillan Publishers Limited All rights reserved 0887-6924/12 www.nature.com/leu REVIEW Monoclonal antibody-based therapy as a new treatment strategy in multiple myeloma NWCJ van de Donk1, S Kamps1, T Mutis2 and HM Lokhorst1 1Department of Hematology, University Medical Center Utrecht, Utrecht, The Netherlands and 2Department of Clinical Chemistry and Hematology, University Medical Center Utrecht, Utrecht, The Netherlands The introduction of autologous stem cell transplantation the myeloma patients achieved a partial response (PR) or stable combined with the introduction of immunomodulatory drugs disease following rituximab therapy. All these patients expressed (IMiDs) and proteasome inhibitors has significantly improved CD20 on their myeloma cells.2 However, as only B15–20% of survival of multiple myeloma patients. However, ultimately the majority of patients will develop refractory disease, indicating all myeloma patients express CD20 on their bone marrow the need for new treatment modalities. In preclinical and clinical plasma cells, new targets for immunotherapy need to be studies, promising results have been obtained with several identified. The search for other targets has led to the develop- monoclonal antibodies (mAbs) targeting the myeloma tumor ment of mAbs targeting growth factor receptors or adhesion cell or the bone marrow microenvironment. The mechanisms molecules on myeloma cells. Other newly developed mAbs underlying the therapeutic efficacy of these mAbs include are directed against cellular or non-cellular components of the direct induction of tumor cell apoptosis via inhibition or activation of target molecules, complement-dependent cyto- bone marrow microenvironment, resulting in the neutraliza- toxicity and antibody-dependent cell-mediated cytotoxicity tion of growth factors, inhibition of angiogenesis, modulation (ADCC).
    [Show full text]
  • NSCLC Therapeutics in Asia-Pacific Markets to 2019 Personalized Therapies Focus on Untapped Segment of Squamous Cell Carcinoma to Expand Treatment Pool
    NSCLC Therapeutics in Asia-Pacific Markets to 2019 Personalized Therapies Focus on Untapped Segment of Squamous Cell Carcinoma to Expand Treatment Pool GBI Research Report Guidance GBI Research Report Guidance Chapter two provides an overview of the disease, its symptoms, etiology, pathophysiology, diagnosis, classification, epidemiology, prognosis, staging and treatment options. Chapter three provides a detailed profiling and comparative heat map analysis in terms of safety and efficacy for currently marketed products in the NSCLC market. Chapter four presents a detailed pipeline analysis for the disease, including individual product profiles, a comparative efficacy and safety profile heat map analysis of the most promising pipeline products as well as analyses on the distribution of molecule types across the NSCLC developmental pipeline, the molecular targets of pipeline mAbs and the developmental program types. In addition, detailed analyses of the clinical trial failure rates, the clinical trial durations by phase and clinical trial sizes, by participant numbers. Chapter five provides market forecasts for countries across the globe, with special attention given to the APAC countries: India, Australia, China and Japan. The multiple scenario forecasts take into account a range of factors that are likely to vary and provide a clear perspective on the level of the potential degree of variance in the market sizes. Chapter six covers the major deals that have taken place in the disease market in recent years. Coverage includes co-development deals and licensing agreements, which are segmented on the basis of geography and total value. A concomitant analysis of the licensing deal values for products by molecule types and molecular targets is also provided.
    [Show full text]
  • WO 2016/176089 Al 3 November 2016 (03.11.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/176089 Al 3 November 2016 (03.11.2016) P O P C T (51) International Patent Classification: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, A01N 43/00 (2006.01) A61K 31/33 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, PCT/US2016/028383 MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (22) International Filing Date: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 20 April 2016 (20.04.2016) SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, 62/154,426 29 April 2015 (29.04.2015) US TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (71) Applicant: KARDIATONOS, INC. [US/US]; 4909 DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, Lapeer Road, Metamora, Michigan 48455 (US).
    [Show full text]
  • New Strategies in Ewing Sarcoma: Lost in Translation?
    Published OnlineFirst April 22, 2014; DOI: 10.1158/1078-0432.CCR-13-0633 Clinical Cancer CCR New Strategies Research New Strategies in Ewing Sarcoma: Lost in Translation? Fernanda I. Arnaldez and Lee J. Helman Abstract Ewing sarcoma is the second most common pediatric malignant bone tumor. Aggressive multimodality therapy has led to an improvement in outcomes, particularly in patients with localized disease. However, therapy-related toxicities are not trivial, and the prognosis for patients with relapsed and/or metastatic disease continues to be poor. In this article, we outline some of the promising therapies that have the potential to change the Ewing sarcoma therapeutic paradigm in the not-too-distant future: insulin-like growth factor receptor inhibitors, targeting of the fusion protein, epigenetic manipulation, PARP inhibitors, and immunotherapy. Clin Cancer Res; 20(12); 1–7. Ó2014 AACR. Background other fusions have been described (10, 11). This fusion gives Ewing sarcoma is the second most common pediatric origin to a chimeric transcription factor that is responsible malignant bone tumor, and it can also present as a soft- for the Ewing sarcoma oncogenic program. This aberrant tissue malignancy. Approximately 225 new cases are diag- factor modifies the transcription machinery, activating or nosed each year in the United States in patients between the quite often repressing transcription of target genes (12, 13). ages of 1 and 20 years (1). The presence of macrometastatic Although the cell of origin has been much debated, growing disease continues to be the single most significant predictor evidence suggests that Ewing sarcoma could possibly orig- of poor clinical outcome (2): Patients with localized disease inate in mesenchymal stem cells (14).
    [Show full text]
  • (INN) for Biological and Biotechnological Substances
    INN Working Document 05.179 Update 2013 International Nonproprietary Names (INN) for biological and biotechnological substances (a review) INN Working Document 05.179 Distr.: GENERAL ENGLISH ONLY 2013 International Nonproprietary Names (INN) for biological and biotechnological substances (a review) International Nonproprietary Names (INN) Programme Technologies Standards and Norms (TSN) Regulation of Medicines and other Health Technologies (RHT) Essential Medicines and Health Products (EMP) International Nonproprietary Names (INN) for biological and biotechnological substances (a review) © World Health Organization 2013 All rights reserved. Publications of the World Health Organization are available on the WHO web site (www.who.int ) or can be purchased from WHO Press, World Health Organization, 20 Avenue Appia, 1211 Geneva 27, Switzerland (tel.: +41 22 791 3264; fax: +41 22 791 4857; e-mail: [email protected] ). Requests for permission to reproduce or translate WHO publications – whether for sale or for non-commercial distribution – should be addressed to WHO Press through the WHO web site (http://www.who.int/about/licensing/copyright_form/en/index.html ). The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by the World Health Organization in preference to others of a similar nature that are not mentioned.
    [Show full text]
  • Ep 3321281 A1
    (19) TZZ¥¥ _ __T (11) EP 3 321 281 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 16.05.2018 Bulletin 2018/20 C07K 14/79 (2006.01) A61K 38/40 (2006.01) A61K 38/00 (2006.01) A61K 38/17 (2006.01) (2006.01) (2006.01) (21) Application number: 17192980.5 A61K 39/395 A61K 39/44 C07K 16/18 (2006.01) (22) Date of filing: 03.08.2012 (84) Designated Contracting States: • TIAN, Mei Mei AL AT BE BG CH CY CZ DE DK EE ES FI FR GB Coquitlam, BC V3J 7E6 (CA) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO • VITALIS, Timothy PL PT RO RS SE SI SK SM TR Vancouver, BC V6Z 2N1 (CA) (30) Priority: 05.08.2011 US 201161515792 P (74) Representative: Gowshall, Jonathan Vallance Forresters IP LLP (62) Document number(s) of the earlier application(s) in Skygarden accordance with Art. 76 EPC: Erika-Mann-Strasse 11 12746240.6 / 2 739 649 80636 München (DE) (71) Applicant: biOasis Technologies Inc Remarks: Richmond BC V6X 2W8 (CA) •This application was filed on 25.09.2017 as a divisional application to the application mentioned (72) Inventors: under INID code 62. • JEFFERIES, Wilfred •Claims filed after the date of receipt of the divisional South Surrey, BC V4A 2V5 (CA) application (Rule 68(4) EPC). (54) P97 FRAGMENTS WITH TRANSFER ACTIVITY (57) The present invention is related to fragments of duction of the melanotransferrin fragment conjugated to human melanotransferrin (p97). In particular, this inven- a therapeutic or diagnostic agent to a subject.
    [Show full text]