PUBLISHED VERSION Pishas, K.I., Neuhaus, S.J., Clayer, M.T., Adwal, A., Brown, M.P., Evdokiou, A., Callen, D.F., Neilsen, P.M. Pre-activation of the p53 pathway through Nutlin-3a sensitises sarcomas to drozitumab therapy Oncology Reports, 2013; 30(1):471-477 DOI: 10.3892/or.2013.2454 PERMISSIONS http://www.spandidos-publications.com/pages/info_for_authors 10. Author self-archiving Authors are encouraged to submit the final publisher’s version PDF of their manuscript to their institution’s repository 6 months following publication, as well as to their funding body’s archive. A link to the published version on the Spandidos Publications website must be included with full citation details and acknowledgement of the journal as the original source. Authors that have purchased open access can add the final publisher's PDF to their institutional repository and funding body's archive immediately. 16th April 2015 http://hdl.handle.net/2440/80828 ONCOLOGY REPORTS 30: 471-477, 2013 Pre-activation of the p53 pathway through Nutlin-3a sensitises sarcomas to drozitumab therapy KATHLEEN I. PISHAS1,2, SUSAN J. NEUHAUS1,3, MARK T. CLAYER4, ALAKNANDA ADWAL1, MICHAEL P. BROWN1,5, ANDREAS EVDOKIOU1,6, DAVID F. CALLEN1 and PAUL M. NEILSEN1,2 1Centre for Personalised Cancer Medicine, The University of Adelaide; 2Sarcoma Research Group, Discipline of Medicine, The University of Adelaide; 3 Department of Surgery, The University of Adelaide, Royal Adelaide Hospital; 4Department of Orthopaedics and Trauma, Royal Adelaide Hospital; 5Cancer Clinical Trials Unit, Royal Adelaide Hospital; 6Discipline of Surgery, The University of Adelaide, Basil Hetzel Institute, Adelaide, South Australia, Australia Received February 7, 2013; Accepted March 20, 2013 DOI: 10.3892/or.2013.2454 Abstract. The present study evaluated the efficacy of droz- Activation of the extrinsic pathway of apoptosis through itumab, a human monoclonal agonistic antibody directed the use of recombinant ligand and agonistic monoclonal anti- against death receptor 5 (DR5), as a new therapeutic avenue bodies directed against TRAIL receptors DR4 (TRAIL-R1) for the targeted treatment of bone and soft-tissue sarcomas. and/or DR5 (TRAIL-R2) has been explored as a promising new The antitumour activity of drozitumab as a monotherapy or targeted therapy for numerous types of malignancies. Based in combination with Nutlin-3a was evaluated in a panel of on their selective ability to induce apoptosis in a variety of sarcoma cell lines in vitro and human sarcoma patient samples human cancer cell lines and xenografts while sparing normal ex vivo. Knockdown experiments were used to investigate the cells (1), several agents are currently undergoing phase I and central role of p53 as a regulator of drozitumab cytotoxicity. II clinical testing both as single agents and in combination Pre-activation of the p53 pathway through Nutlin-3a upregu- with traditional chemotherapies. These include monoclonal lated DR5, subsequently sensitising sarcoma cell lines and agonistic antibodies which specifically target either DR5, human sarcoma specimens to the pro-apoptotic effects of drozitumab (Genetech) (2), lexatumumab (Human Genome drozitumab. Silencing of p53 strongly decreased DR5 mRNA Sciences) (3-6), conatumumab (Amgen) (7-10), tigatuzumab expression resulting in abrogation of drozitumab-induced (humanized IgG1 antibody; Daiichi-Sankyo) and LBY135 apoptosis. Our study provides the first pre-clinical evaluation [chimeric (mouse/human) IgG1 antibody; Novartis] (11) or of combination therapy using p53-activating agents with droz- DR4, mapatumumab (Human Genome Sciences) (12-17) or itumab to further sensitise sarcomas to the cytotoxic effects of both cognate receptors as well as three decoy receptors of DR5 antibody therapy. recombinant human TRAIL (rhApo2L/TRAIL) (dulanermin, Amgen/Genentech) (18). Introduction Results from early trials have established that DR4 and DR5 agonistic antibodies can be considered safe and are well Sarcomas represent a diverse group of heterogeneous mesen- tolerated with responses not limited to histological subtype. chymal neoplasms that affect ~200,000 individuals worldwide However, the clinical efficacy of these agonistic antibodies as each year. There has been limited improvement in overall monotherapeutic agents has proven to be quite poor, with only 5-year survival rates for sarcoma patients over the past 30 a few patients showing partial or complete responses (19). Out years, particularly for patients with metastatic disease. As such, of the 41 evaluable patients who participated in dose escala- the use of molecular-targeted therapies has emerged as a prom- tion phase I clinically testing of drozitumab, partial responses ising new therapeutic approach for the treatment of sarcomas. were reported in only 3 patients (chondrosarcoma, colorectal cancer and ovarian cancer) (2). These findings reflect cell culture studies which indicate that only a small subset of sarcoma cell lines are highly sensitive to DR5 agonistic anti- Correspondence to: Dr Paul M. Neilsen, Sarcoma Research Group bodies (20-23). and Centre for Personalised Cancer Medicine, Level 3 Hanson The poor clinical efficacy of drozitumab as a monotherapy Institute, The University of Adelaide, Frome Road, Adelaide 5000, warrants further investigation into combinational therapeutic South Australia, Australia approaches involving drozitumab with other systemic thera- E-mail: [email protected] pies to synergistically drive tumour regression. Furthermore, additional mechanistic studies are required to completely Key words: Nutlin-3a, drozitumab, TP53, sarcoma delineate the fundamental regulators of drozitumab. A broad spectrum of apoptosis regulatory molecules (FLIP, XIAP 472 PISHAS et al: Nutlin-3a SENSITISES SARCOMAS TO DROZITUMAB THERAPY Table I. Primer sequences utilised in this study. Primer sequence 5'→3' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Forward Reverse PPIG (housekeeping) CAGATGCAGCTAGCAAACCGTTTG CTCTTCAGTAGCACTTTCGGAATCAGAGG DR5 (TRAIL-R2) CGCTGCACCAGGTGTGATT GTGCCTTCTTCGCACTGACA p21 (CDKN1A) TGGACCTGGAGACTCTCAGGGTCG TTAGGGCTTCCTCTTGGAGAAGATC PUMA (BBC3) ACGACCTCAACGCACAGTACG TCCCATGATGAGATTGTACAGGAC p53 exons 2-4 GTGTCTCATGCTGGATCCCCACT GGATACGGCCAGGCATTGAAGT p53 exons 5-6 TGCAGGAGGTGCTTACGCATGT CCTTAACCCCTCCTCCCAGAGAC p53 exons 7-9 ACAGGTCTCCCCAAGGCGCACT TTGAGGCATCACTGCCCCCTGAT p53 exon 10 GTCAGCTGTATAGGTACTTGAAGTGCAG TGGCAGCTGAGCTAGACCTCG p53 exon 11 CCTTAGGCCCTTCAAAGCATTGGTCA GTGCTTCTGACGCACACCTATTGCAAG and Bcl-XL) and signalling pathways (NF-κB and Akt) itumab + anti-Fcγ at the indicated concentrations for 24 h. are believed to confer resistance; however, little is known Drozitumab (a kind gift from Dr Avi Ashkenazi, Genentech concerning the influence of proteins which sensitise tumour Inc., South San Francisco, CA, USA), was cross-linked with cells to drozitumab therapy, apart from DR5 itself. The protein anti-human IgG Fcγ antibody (Jackson ImmunoResearch and mRNA expression levels of DR5 and DR4 in sarcoma cell Laboratories, Inc., West Grove, PA, USA) as previously lines have been extensively documented in literature. Notably, described (28). For synergy experiments, cells were pre-treated resistance to TRAIL-mediated apoptosis is not associated with Nutlin-3a (Cayman Biochemicals, Ann Arbor, MI, USA) with differential expression of TRAIL-receptors between for 24 h prior to the addition of drozitumab + anti-Fcγ. Cells sensitive and resistant sarcoma cell lines (24,25). As DR5 has were harvested and processed as previously described (27). been shown to be a transcriptional target of p53 (26), this study The viability of harvested cells was determined using 7-amino- assessed the role of p53 in mediating sensitivity to drozitumab actinomycin-D staining and processed on a FACSCalibur flow in sarcoma cell lines and human sarcoma patient material. cytometer (Becton-Dickinson Immunocytometry Systems, As expected, knockdown of p53 ablated drozitumab-induced Franklin Lakes, NJ, USA). apoptosis in vitro. Furthermore, pre-activation of the p53 pathway through Nutlin-3a (p53-MDM2 antagonist) enhanced RNA interference. Cell lines with silenced expression of p53 the cytotoxic effects of drozitumab both in vitro and ex vivo. were generated using the pGIPZ lentiviral shRNAmir system Our study provides the first pre-clinical evidence that pre- (Open Biosystems) as previously described (29). Briefly, activation of the p53 pathway in conjunction with drozitumab HEK-293T cells were seeded at 50% confluency and trans- will potentially provide an effective therapeutic means to fected with either a non-silencing scramble control (RHS4346) maximise the apoptotic response from both the extrinsic and or shRNA directed against human p53 (V2LHS217) using intrinsic pathway for the treatment of sarcomas. Trans-Lentiviral packaging mix according to the manufac- turer's protocol (Thermo Fisher Scientific, Waltham, MA, Materials and methods USA). Forty-eight hours post-transfection, growth medium containing lentivirus particles was filtered and added to Cell culture. Osteosarcoma (Saos-2, U20S) and Ewing's recipient TC252 cells seeded at 50% confluency. Polyclonal sarcoma (SK-ES1, RD-ES) cell lines were purchased from populations of transduced cells were generated through subse- American Type Tissue Culture (ATCC, Manassas, VA, USA). quent puromycin selection Additional Ewing's