Taxonomic Diversity of Some Rusts and Smuts of Khyber Pakhtunkhwa and Adjacent Hills of Pakistan.Pdf

Taxonomic Diversity of Some Rusts and Smuts of Khyber Pakhtunkhwa and Adjacent Hills of Pakistan

A dissertation submitted to the University of the Punjab in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

IN BOTANY

BY AAMNA ISHAQ

DEPARTMENT OF BOTANY UNIVERSITY OF THE PUNJAB LAHORE, PAKISTAN February, 2017

Taxonomic Diversity of Some Rusts and Smuts of Khyber Pakhtunkhwa and Adjacent Hills of Pakistan

A dissertation submitted to the University of the Punjab in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Botany

AAMNA ISHAQ

Supervisors Prof. Dr. Abdul Nasir Khalid Dr. Najam-ul-Sehar Afshan

DEPARTMENT OF BOATNY UNIVERSITY OF THE PUNJAB LAHORE-PAKISTAN

Dedicated to My loving Parents and My Sisters Without whom none of my success would be possible

APPROVAL CERTIFICATE

I certify that the research work described in this thesis submitted by Aamna Ishaq d/o Muhammad Ishaq Malik has been carried out under my direct supervision. I have personally gone through all the data reported in the manuscript and certify their authenticity. I also certify that the thesis has been prepared according to the prescribed format. I recommend it to be processed for evaluation by the external examiner for the award PhD degree in Botany.

Prof. Dr. Abdul Nasir Khalid Department of Botany University of the Punjab, Lahore, Pakistan.

ACKNOWLEDGEMENTS

First of all, I would like to thank almighty Allah Subhanahu Wa Ta'ala for giving me strength to start and successfully complete this work. I would like to pay my heartiest gratitude to my respected teacher and PhD supervisor, Dr. Abdul Nasir Khalid for his continuous advices, guidance, kindness, support, and patience throughout the duration of my research work.

Thanks are also due to my co-supervisor Dr. Najam-ul-Sehar Afshan (Assistant Professor, Center for Undergraduate Studies, PU, Lahore) for her supervision, skills, scholarly guidance and inspiring advices throughout the progress of my research work.

Thanks are also due to Dr. Abdul Rehman Khan Niazi (Associate Professor, Department of Botany, PU, Lahore) for his moral support, kindness and especially for his assistance in field tours.

I am thankful to Prof. Dr. Firdaus-e-Bareen, chairperson, Prof. Dr. Muhammad Saleem and Prof. Dr. Khan Rass Masood, Ex-Chairmen Department of Botany, University of the Punjab, Lahore for providing me conducive environment and facilities for carrying out this research project.

I am indebted to Higher Education Commission of Pakistan (HEC) for funding this research project and awarding me the scholarships under indigenous 5000 fellowships (Batch VI) and IRSIP (International Research Support Initiative Program).

I am thankful to my foreign supervisor, Prof. Dr. Catherine Aime, Director, Botany and Plant Pathology, Purdue University USA for allowing me to work in her Lab under her guidance, valuable suggestions and giving me access to Arthur Fungarium (PUR) and Kriebel Herbarium (PUL) specimens and literature for improvement of my work and publications. My sincere thanks to Dr. Mehardad Abbasi (Acting Curator, Arthur Herbarium) for his valueable suggestions in identifitacions and Mr. John F. Klimek (Herbarium Manager) for his help in Phylogenetic part of my research. I want to thank my foreign lab fellows Ms. Rachel

i A. Koch and Mr. Teeratas Kijpornyongpan (PhD Scholars, Purdue University, USA) for their continuous help in completion of my work during my stay in Purdue University, USA.

I am thankful to Director, Department of Physics, University of Peshawar, Peshawar, Pakistan for facilitating the Scanning Electron Microscopy (SEM). I would like to acknowledge staff of Soil survey of Punjab, Lahore and Pakistan Meteorological Department (PMD) for giving me necessary data and information of the study area needed for the research work. Special thanks to Ms. Sana Ishaq (GIS Specialist, Urban Unit, Lahore) for generous help in mapping and distribution analysis of data.

I wish to thank Dr. Kálman Vánky (Honorary Member of Hungarian Academy of Science), Prof. Dr. Cvetomir M. Denchev (Bulgarian Academy of Sciences, Bulgaria), Prof. Dr. Reinhard Burndt (Department of Biology, ETH, Zurich) for verification of some of the samples and reviewing the manuscripts.

I highly acknowledge my dearest friends, Dr. Nousheen Yousaf (Lecturer, Government College University, Lahore), Dr. Sana Jabeen (Lecturer, University of Education, Faisalabad) and Ms. Nusrat Majeed for always being there for me with their great support and cheerful company. I want to thank my seniors in research Laboratory, Dr. Muhammad Hanif (GCU, Lahore), Dr. Samina Sarwar (LCWU, Lahore), Dr. Tayyaba Ashraf (Govt. college for women, Sheikhupura), Dr. Abdul Razzaq (UVAS, Lahore), Dr. Sobia Razzaq (LCWU, Lahore) and Dr. Syeda Bint-e- Zahra (Govt. college for woment, Salamat Pura, Lahore) for always acknowledging my efforts.

I also acknowledge all my friends and lab fellows especially Dr. Malka Saba (Gujrat University), Ms. Arooj Naseer (Center for Undergraduate Studies, PU, Lahore), Ms. Hira Bashir, Ms. Munazza Kiran, Ms. Tayyeba Qasim, MS. Memoona Khan (Govt. Post graduate college for women, Muzang, Lahore), Ms. Annum Razzaq, Ms. KhushBakht and Mr. Muhammad Usman for their support and help in finishing of this project and cheerful company throughout the session.

ii My sincere thanks to my research collaborators Dr. Muhammad Fiaz (Assistant Professor, Hazara University, Mansehra) and Mr. Sadiqullah (Hazara University, Mansehra) for sharing some of their specimens generously. I am thankful to Dr. Ishtiaq Ahmad (Govt. College, Matta, Swat) and Dr. Shah Hussain (Hazara University, Mansehra) for arranging wonderful field trips in different regions of Pakistan. My special thanks to Mr. Akbar Shah (Lab assistant) for his help both in field and in laboratory.

This piece of research would have been impossible without the prayers and support of my sweet parents. I am thankful to my sisters, Saira, Hina, Tibra and Sakeena for their moral support and love.

Aamna Ishaq

iii Table of Contents

Page No. Acknowledgment ...... i List of Tables ...... iv List of Figures ...... vii Abstract ...... xii CHAPTER 1 Introduction ...... 1 CHAPTER 2 Literature Review ...... 5 Aims and Objectives of Study ...... 11 CHAPTER 3 Materials and Methods ...... 12 3.1. Description of sampling site ...... 12 3.2. Sample collection ...... 12 3.3. Preservation of samples ...... 12 3.4. Identification of host plants ...... 12 3.5. Microscopic analysis ...... 20 3.6. Identification of Fungi ...... 20 3.7. Molecular Characterization ...... 21 3.7.1. Genomic DNA Extraction...... 21 3.7.2. Polymerase Chain Reaction (PCR) ...... 21 3.7.3. Analyses of Molecular Data ...... 22 3.8. Biodiversity Analysis ...... 23 3.8.1. Species Richness (S) ...... 23 3.8.2. Margalef diversity index (D) ...... 23 3.8.3. Shannon Index (H) ...... 24

3.8.4. Shannon‟s Equitability (EH ) ...... 24 3.5.5. Simpson Index (D) ...... 25 3.8.5. Simpson‟s Reciprocal Index (1/D)...... 25 3.9. Dendrogram cluster analysis ...... 25

iv 3.10. Distribution Mapping and Predictive Modeling ...... 26 CHAPTER 4 Results ...... 27 4.1. Taxonomy ...... 28 4.2. Biodiversity Analysis ...... 212 4.2.1. Diversity of fungal taxa ...... 212 4.2.2. Shannon and Simpson Indices ...... 212 4.2.3. Species Richness (S) ...... 212 4.3. Dendrogram cluster analysis ...... 219 4.4. Distribution Mapping and Predictive Modeling ...... 219 CHAPTER 5 Discussion...... 227 References ...... 257 Annexure I Annexure II Annexure III

v List of Tables

TITLE Page No. Table 1 Description of sampling sites...... 13 Table 2 Bioclimatic predictor variables used for assessing fungal habitat ...... 26 Table 3 Spore morphology for Phragmidium species...... 63 Table 4 Rust fungi species matrix analysis of using different diversity and species richness indices...... 214 Table 5 Smut fungi species matrix analysis of using different diversity and species richness indices...... 215 Table 6 Clustal groups formed in dendrogram of the sampling sites on the basis of climatic factors...... 222 Table 7 Clustal groups formed in dendrogram of the sampling sites on the basis of diversity of rust and smut fungi...... 222

vi List of Figures

TITLE Page No. Figure 1 Map of Khyber Pakhtunkhwa (KP) and adjacent hilly areas showing sampling sites...... 14 Figure 2 Photographs of Abbottabad District, Khyber Pakhtunkhwa, Pakistan...... 15 Figure 3 Photographs of Bagh Distrcit, Azad Jammu and kashmir, Pakistan...... 16 Figure 4 Photographs of Kalash valley, Chitral Distrcit, Khyber Pakhtunkhwa, Pakistan ...... 17 Figure 5 Photographs of Torghar District, Khyber Pakhtunkhwa, Pakistan. ...17 Figure 6 Photographs of Skardu Distrcit, Gilgit-Baltistan, Pakistan...... 18 Figure 7 Photographs of sampling site Swat District, Khyber Pakhtunkhwa, Pakistan ...... 19 Figure 8 Morphology of Aecidium quintum ...... 29 Figure 9 Morphology of Aecidium viburni...... 31 Figure 10 Lucida drawings of Aecidium viburni...... 32 Figure 11 Molecular Phylogenetic analysis of Aecidium quintum by Maximum Likelihood method based on LSU sequence...... 34 Figure 12 Morphology of Cerotelium fici ...... 36 Figure 13 Scanning Electron Microphotographs of Cerotelium fici ...... 37 Figure 14 Molecular Phylogenetic analysis of Cerotelium based on LSU sequence by Maximum Likelihood method...... 39 Figure 15 Morphology of Coleosporium tussilaginis ...... 41 Figure 16 Morphology of Macruropyxis sp...... 43 Figure 17 Lucida drawings of Macruropyxis sp...... 44 Figure 18 Molecular Phylogenetic analysis based on LSU sequences of Macruropyxis by Maximum Likelihood method...... 46 Figure 19 Morphology of Melampsora dimorphospora ...... 48 Figure 20 Scanning Electron Microphotograhs of Melampsora dimorphospora ...... 49 Figure 21 Scanning Electron Microphotograhs Melampsora euphorbiae ...... 51 Figure 22 Scanning Electron Microphotograhs Melampsora yoshinagae...... 53 Figure 23 Molecular Phylogenetic analysis of Melampsora based on LSU sequences by Maximum Likelihood method ...... 55 Figure 24 Morphology of Miyagia pseudosphaeria ...... 57 Figure 25 Morphology of Phakopsora ziziphi-vulgaris ...... 59

vii Figure 26 Morphology of Phragmidium pakistanica ...... 61 Figure 27 Scanning Electron Microphotograhs Phragmidium pakistanica ...... 62 Figure 28 Morphology of Phragmidium rosae-pimpinellifoliae ...... 65 Figure 29 Scanning Electron Microphotographs of Phragmidium rosae- pimpinellifoliae ...... 66 Figure 30 Morphology of Phragmidium shogranense ...... 68 Figure 31 Lucida drawing of teliospores of Phragmidium shogranense ...... 69 Figure 32 Molecular phylogenetic analysis of genus Phragmidium by Maximum Likelihood method ...... 71 Figure 33 Morphology of Pileolaria pistaceae ...... 73 Figure 34 Scanning Electron Microphotographs of Pileolaria pistaciae showing verrucose surface ornamentation of teliospores ...... 74 Figure 35 Lucida drawings of Pileolaria pistaciae...... 75 Figure 36 Molecular phylogenetic analysis of Pileolaria pistaciae using Maximum Likelihood method ...... 77 Figure 37 Morphology of Puccinia brachypodii ...... 78 Figure 38 Morphology of Puccinia brachypodii var. brachypodii ...... 79 Figure 39 Morphology of Puccinia calcitrapae...... 81 Figure 40 Morphology of Puccinia carthami...... 83 Figure 41 Scanning Electron Microphotographs Puccinia carthami...... 84 Figure 42 Morphology of Puccinia c.f prenanthis var. himalensis ...... 86 Figure 43 Morphology of Puccinia c.f phaeopoda ...... 88 Figure 44 Morphology of Puccinia c.f phaeopoda ...... 89 Figure 45 Morphology of Puccinia cnici ...... 91 Figure 46 Morphology of Puccinia coronata var. avenae ...... 93 Figure 47 Morphology of Puccinia deosaiensis...... 95 Figure 48 Morphology of Puccinia graminis...... 97 Figure 49 Lucida drawings of Puccinia graminis ...... 98 Figure 50 Morphology of Puccinia heraclei...... 100 Figure 51 Morphology of Puccinia iridis...... 102 Figure 52 Morphology of Puccinia menthae ...... 104 Figure 53 Scanning Electron Microphotographs of Puccinia menthae...... 105 Figure 54 Morphology of Puccinia nakanishikii ...... 107 Figure 55 Morphology of Puccinia nepalensis ...... 109 Figure 56 Scanning Electron Microphotographs of Puccinia nepalensis ...... 110 Figure 57 Morphology of Puccinia polygoni-alpini ...... 112 Figure 58 Morphology of Puccinia polygoni-amphibii...... 114

viii Figure 59 Morphology of Puccinia poarum Nielsen ...... 116 Figure 60 Morphology of Puccinia polliniicola ...... 118 Figure 61 Morphology of Puccinia shikotsuensis...... 120 Figure 62 Morphology of Puccinia sorghi ...... 122 Figure 63 Morphology of Puccinia tanaceti ...... 124 Figure 64 Morphology of Puccinia hieracii ...... 126 Figure 65 Scanning Electron Microphotographs of Puccinia taraxaci ...... 127 Figure 66 Morphology of Puccinia tricholepidis ...... 129 Figure 67 Morphology of Puccinia ustalis ...... 131 Figure 68 Morphology of Puccinia versicolor ...... 133 Figure 69 Morphology of Puccinia violae ...... 135 Figure 70 Morphology of Puccinia wattiana ...... 137 Figure 71 Molecular Phylogenetic analysis of genus Puccinia based on LSU sequences by Maximum Likelihood method...... 139 Figure 72 Morphology of Pucciniastrum guttatum...... 141 Figure 73 Molecular phylogenetic analysis of Pucciniastrum guttatum by Maximum Likelihood method ...... 143 Figure 74 Morphology of Sphaerophragmium sp...... 145 Figure 75 Scanning Electron Microphotographs of Sphaerophragmium sp...... 146 Figure 76 Molecular phylogenetic analysis of Sphaerophragmium sp. based on LSU sequences of by Maximum Liklihood Method (AM21 is the studied taxon)...... 148 Figure 77 Morphology of Tranzschelia discolor ...... 150 Figure 78 Scanning Electron Microphotographs of Tranzschelia discolor ...... 151 Figure 79 Morphology of Tranzschelia discolor ...... 152 Figure 80 Molecular Phylogenetic analysis of Tranzschelia discolors by Maximum Likelihood method...... 154 E Figure 81 Morphology of Uredo otostegiae ...... 156 Figure 82 Morphology of Uromyces ambiens...... 158 Figure 83 Lucida drawings of Uromyces ambiens...... 159 Figure 84 Morphology of Uromyces capitatus ...... 161 Figure 85 Scanning Electron Microphotographs of Uromyces capitatus...... 162 Figure 86 Morphology of Uromyces dactylidis ...... 164 Figure 87 Morphology of Uromyces heliotropii ...... 166 Figure 88 Scanning Electron Microphotographs of Uromyces heliotropii...... 167 Figure 89 Morphology of Uromyces lespedezae-sericeae...... 169

ix Figure 90 Morphology of Uromyces polygoni-avicularis ...... 171 Figure 91 Morphology of Uromyces polygoni-avicularis ...... 172 Figure 92 Morphology of Uromyces setariae–italicae ...... 174 Figure 93 Molecular Phylogenetic analysis Uromyces (Link) based on LSU sequences of by Maximum Likelihood method...... 176 Figure 94 Morphology of Bauhinus tenuisporus ...... 178 Figure 95 Morphology of Microbotryum nepalense ...... 180 Figure 96 Molecular Phylogenetic analysis of Microbotryum by Maximum Likelihood method...... 182 Figure 97 Morphology of Sporisorium cruentum ...... 184 Figure 98 Morphology of Sporisorium moniliferum ...... 186 Figure 99 Morphology of Sporisorium pulverulentum ...... 188 Figure 100 Morphology of Sporisorium reilianum ...... 190 Figure 101 Scanning Electron Microphotographs of Sporisorium reilianum ...... 191 Figure 102 Molecular Phylogenetic analysis by Maximum Likelihood method of Genus Sporisorium...... 193 Figure 103 Morphology of Urocystis narcissi ...... 195 Figure 104 Scanning Electron Microphotographs of Urocystis narcissi ...... 196 Figure 105 Molecular Phylogenetic analysis of Urocystis based on LSU sequences of by Maximum Likelihood method...... 198 Figure 106 Scanning Electron Microphotographs of Ustilago idonea...... 200 Figure 107 Morphology of Ustilago maydis ...... 202 Figure 108 Scanning Electron Microphotographs of teliospores of Ustilago maydis...... 203 Figure 109 Morphology of Ustilago nunavutica ...... 205 Figure 110 Morphology of Ustilago sp...... 207 Figure 111 Morphology of Ustilago tritici ...... 209 Figure 112 Molecular Phylogenetic analysis based on ITS and LSU regions of nrDNA sequences by Maximum Likelihood method of Genus Ustilago...... 211 Figure 113 Diversity of rust taxa in all sampling sites...... 216 Figure 114 Diversity of smut taxa in all sampling sites...... 216 Figure 115 Diversity of rust taxa on host plant families...... 217 Figure 116 Diversity (%age) of smut taxa on host plant families...... 217 Figure 117 Comparative status of rust fungi of sampling sites with world after this research...... 218

x Figure 118 Comparative status of smust fungi of sampling sites with world after this research...... 218 Figure 119 Dendrogram depicting the results of a complete linkage hierarchical clustering of the sampling sites on the basis of climatic factors using Euclidean distance measure ...... 221 Figure 120 Dendrogram depicting the results of a coplete linkage hierarchical clustering of the sampling sites on he basis of rust and smut fungi diversity using Sorensen distance measure ...... 221 Figure 121 A dot map showing the locations where the presence of rust taxa has been documented...... 223 Figure 122 A dot map showing the locations where the presence of rust taxa has been documented...... 224 Figure 123 Modelled diversity map with potential distributions of Asian Pistachio rust...... 225 Figure 124 Modelled diversity map with potential distributions of Box wood rust...... 226

xi Abstract

In current research project, taxonomic diversity of two different pathogenic groups of Basidiomycota viz. rust and smut fungi is studied in Khyber Pakhtunkhwa (KP) and adjacent hilly areas of Pakistan. A survey to ten (10) different sampling sites of selected regions was made for three consecutive years. A total of sixty four (64) taxa are identified using both morphological and molecular techniques. This is first time to use molecular markers for taxonomic purpose for selected pathogenic fungi in Pakistan. Among these sixty four (64) taxa, fifty two (52) are rust fungi belonging to fifteen (15) genera of Pucciniales while remaining twelve (12) are smuts of five (05) genera belonging to Urosystales and Ustilaginales. One taxon of rust fungi i.e. Phragmidium pakistanica seems new to science while fifteen (15) taxa including three genera (03) and thirteen (13) species viz. Aecidium viburni, Coleosporium tussilaginis, Macruropyxis sp., Melamspora dimorphospora, Ph. rosae- pimpinellifoliae, Pileolaria pistaciae, Puccinia phaeopoda, P. cnici, P. heraclei, P. polygoni-alpini, P. pollinicola, P. shikotsuensis, Pucciniastrum guttatum, Spherophragmium sp., Uromyces ambiens and three (03) species of smut fungi viz. Sporisorium pulvirulentum, Urocystis narcissi and Ustilago nunavutica are new records for Pakistan. Three (03) rust taxa are reported for the first time from Province KP. In addition to these, six (06) plants are reported as a new host record for the respective fungus. Twenty four (24) rusts and five smuts described in this study have already been reported from Pakistan but here, these are recorded from new localities. This work is first attempt to explore the selected regions of Pakistan thoroughly with respect to rust and smuts. Diversity analysis revealed that members of the Poaceae are most susceptible plants to these pathogens. Similarly distribution analysis via mapping techniques revealed that maximum diversity of rusts is found in Abbottabad district and of smut fungi in Shangla district. Predictive distribution modeling is also performed of selected pathogens to visualize the potential range of disease spread within the country.

This work will help in future to set a trend of molecular markers usage in Pakistan for these two groups of fungal pathogens. This data will also help in future taxonomic and phylogenetic studies for comparisons and in up-gradation of checklists of fungal flora of Pakistan. This will help in selection of potential biocontrol agent against various weeds of economically important crops of this agricultural land.

xii

Introduction

Khyber Pakhtunkhwa (KP) formerly known as the “North-West Frontier Province (NWFP)” is smallest province of Pakistan. It is located in the north-west of the country. It covers latitude 34° N and longitude 71.32° E at about 347 m above sea level. This province is located at the junction where the slopes of the Hindu Kush Mountains on the Iranian plateau and the Eurasian land plate are located (Shad et al., 2011). It borders Afghanistan to the north-west, Azad Kashmir to the east, Gilgit and Baltistan (Northern areas of Pakistan) to the north-east, the Federally Administered Tribal Areas (FATA) to the west and south, Baluchistan to the south, Punjab and the Islamabad Capital Territory to the south-east. It is only about 74,500 square kilometers in area. It has diverse climatic conditions as in the mountainous north, summers are temperate and winters intensely cold. Topography of this province varies from dry rocky areas in the south to forests and green plains in the north (Marwat et al., 2010). KP is adjunct to Northern areas (Hilly areas) of Pakistan that lies between 35°–37 °N and 72°–75°E, officially named as Federally Administrated Northern Areas (FANA). It spreads over 72496 square kilometers lying under great mountain ranges of Himalayas, Karakoram, Hindukush, Hindu Raj, Pamir and Nanga Parbat (Afshan et al., 2009; Israr et al., 2009). FANA (Axis of Asia) constitutes six important districts mainly named as, Astor, Diamer, Ghanche, Ghzer, Gilgit and Skardu. It borders with China and Chitral at west, Kalam, Kohistan and Kaghan Valleys to south, Ladakh and Kashmir to the east (Official Newsletter of the WANA Seed Network, 2003).

Khyber Pakhtunkhwa and these adjacent hilly areas are endowed with a rich and varied flora ranges from permanent snow line, alpine meadows, sub mountain scrubs and coniferous forests with large biodiversity. Vegetation of Abies pindrow Royle, Acacia modesta Wall., Acer L., Cedrus deodara Loudon, Picea smithiana Boiss., Pinus wallichiana A.B.Jacks, Populus L., Quercus L., Taxus L., and shrubs like Berberis L., Daphne L., Dodonaea viscose Royen ex Blume, Lonicera L., Monotheca buxifolia Falc., Rosa spp. and Viburnum L. are dominant. Degraded scrub vegetation is typically of Reptonia buxifolia A.DC., Olea cuspidata Wall. ex G.Don, Pistacia integerrima J.L.Stewart and (Griff.) Aitch. and Bromus spp. (Fazal et al., 2010; Bahri et al., 2011). These floristically rich areas are affected by many biotic and

1 abiotic stresses including bacterial, viral and fungal diseases among which members of Pucciniales formerly known as Uredinales (rust fungi) and smut fungi are prominent one (Asad et al., 2007).

Rust fungi belonging to order Pucciniales (Basidiomycota, Pucciniomycotina) represent the largest group of fungal plant pathogens. These are obligate, biotrophic parasites having very narrow and specific host range. They require two unrelated hosts to complete their life cycle. In addition, their life cycle is very complex and interesting, consisting of up to five distinctive spore stages named as Pycniospores (0), aeciospores (I), urediniospores (II), teliospores (III) and basidiospores (IV). Some rust fungi have all of these stages (macrocyclic rust taxa) but others lack uredinial stage (demicyclic rust taxa) or both aecial and uredinial stages (microcyclic rust taxa). All these types of life cycles may lack pycnia stage (Cummins and Hiratsuka, 2003).

Rust fungi are of great economic importance due to their potential to cause severe damage to agricultural crops including cereals. Rust scenario in Pakistan revealed that pathogens exhibit their severity in cereal crops especially wheat when these develop in an epidemic form. This disease has previously appeared in epidemics for several times in Pakistan on wheat as in 1947-48, 1953-54, 1958-59 and 1977-78. Hussain et al. (2004) reported 10.1% yield loss valuing US$ 86 million during 1977- 78. Similarly, a loss of Rs. 2 billion was estimated during 1997-98 due to rust attack on wheat. According to estimation, out of 8.303 million hectares of wheat production area in Pakistan, about 70% is prone to stripe rust (Afzal et al., 2008). Thus rust fungi because of having such great impact on cereal crops which are pillar for economy of Pakistan got special interest in research here.

More than 8000 species of rust fungi belonging to 100-125 genera and 14 families are accepted currently which is one-third of all described basidiomycetes (Webster and Weber, 2007; Kirk et al., 2001, 2008). As far as Pakistan is concerned, uptil now only 22 genera and approximately 400 species of rust fungi on 350 host plants are known. Among reported species, about one hundred and eighty (180) species of rust fungi have been reported from Khyber Pakhtunkhwa (KP) and seventy (70) from adjacent hilly (northern) areas of Pakistan (Ahmad et al., 1997; Afshan et al., 2007, 2008a, b, c, d; Afshan and Khalid, 2008; Iqbal et al., 2008; Afshan and Khalid, 2009; Khalid and Afshan, 2009; Afshan et al., 2010; Khalid et al., 2010;

2 Afshan et al., 2011; Ishaq et al., 2011; Afshan et al., 2012a, b, c; Fiaz, 2013; Ishaq et al., 2013; Saba and Khalid, 2013; Usman et al., 2016a, b).

Smut fungi is monophyletic group of fungi They are mostly Ustilaginomycetes of the class Teliomycetae, subphylum Basidiomycota. The smuts are grouped with the other basidiomycetes because of their commonalities concerning sexual reproduction. Hypha-producing smuts are united by their lifestyle as ecologically obligate plant pathogens, often with an additional free-living saprotrophic phase (Bauer et al., 1997, 2001; Begerow et al., 1997; Kirk et al., 2001; 2008). They can be distinguished from the rust fungi by the presence of black dusty masses of teliospores resembling soot. They attack all parts of plants including inflorescence, stem, leaves and even roots. These are biotrophic pathogens with shorter or longer saprobic phases (Kendrick, 2000). Smut fungi live on higher plants, especially on herbs and among these mainly on grasses belonging to Poaceae and Cyperaceae. They form sori with usually powdery dark masses of spores which are dispersed by the wind. In humid environment, the spores germinate with basidia and basidiospores. Basidiospores can bud forming a yeast-stage. Yeast cells conjugate and the resulting dikaryotic hyphae are able to infect susceptible host plants (Piepenbring, 2002).

There are to date, 1640 true species of smut fungi that are classified into 2 phyla, 2 subphyla, 4 classes, 8 orders, 24 families and 90 genera. In Pakistan, up till now, about one hundred and fifteen (115) species of smut fungi have been reported, among which only twenty eight (28) species are recorded from KP with eight (08) species from adjacent hilly areas of Pakistan (Ahmad et al., 1997; Denchev et al., 2012, 2013). This number is far less than expected indicating need of more critical and precise exploration in selected areas especially of KP.

Economically smuts are very important causing millions of dollars‟ worth of damage to important food crops as well as ornamentals. Many of the most widely distributed smut diseases cause serious problems on cereal crops that feed much of the world‟s population (Alexopoulos et al., 1996). Major disease problems in the main crops of Pakistan are loose smuts in wheat, Whip smut in sugarcane, grain and long smut in Sorghum, green ear and smut in millets. Among theses, loose smut of wheat (Ustilagotritici C. Bauhin) and flag smut of wheat (Urocystis tritici Körn.) are widely prevalent in all the four provinces of Pakistan; partial bunt or karnal bunt in the

3 central, northern Punjab and KP whereas complete bunt or stinking smut (Tilletia laevis J.G. Kühn) is confined in the uplands of Balochistan and hilly areas of Punjab and KP (Khan, 1992). In wheat, losses due to bunt and loose smut were reported to be Rs.14.4 and 26 million, respectively in 1971(Official Newsletter of the WANA Seed Network, 2003). Similarly, Whip smut (Ustilago scitaminea Syd.) is the major disease of sugarcane in Pakistan and can cause severe losses in sugarcane yield and production and reduce cane quality. Grain smut (Moesziomyces bullatus (J. Schröt.) Vánky = Tolyposporium penicillariae Bref.) is the most important disease of millet (Bajra) in Pakistan because of its considerable losses to overall production (Jiskani, 2001). Some of these diseases may cause as much as 70 % losses in the affected fields whereas the overall losses appear to range between 1-3 % (Khan and Kamal, 1968).

Knowledge of rust and smut fungi is very important not only because of their great influence on cereal crops of Pakistan but also because of their usage as an agent of biological control. These can also be used to control weeds due to their specific features. The characteristics that make rusts particularly useful as classical biocontrol agents are their high virulence, efficient, short- and long-distance dispersal (via dry, airborne spores), and high host-specificity (Barton, 2004). Many rust fungi are being used as a biological control agent.PucciniachondrillinaBubakhas been used to controlChondrilla juncea L. (rushskeleton weed) in wheat fields of Australia similarly Phragmidiumviolaceum(Schultz) G. Winterhas been utilized to controlRubus sp. (blackberry) which is a common weed in pastures of Chile (Kendrick, 2000).

In Pakistan, rust and smut pathogens on economically important crops have got special interest in research. The number of species of these fungi recorded from this area is expected to increase in future by extensive exploration. Hopefully, this taxonomic knowledge of rust fungi will directly or indirectly be useful in biological control against certain noxious weeds of Pakistan in near future. Without reliable taxonomy based on morphological and molecular data, the distribution, biogeography and ecology of rusts and smuts in natural habitats cannot be fully understood. So this work will create a better access to biodiversity information on rust fungi of selected areas, an increased understanding of their taxonomy and an opportunity therefore, to develop robust ecological research and conservation strategies.

Literature Review

Rust fungi being obligate parasites and having complex life cycle, it is difficult to obtain pure cultures of these and to study them. Thus spore morphology and host occurrence is an important tool in identification and taxonomy of rust fungi. Identification of rust fungi is based mostly on teliospore morphology (Cummins and Hiratsuka, 2003). At the same time, it has been demonstrated that the morphology of life stages other than teliospore also have significant characters for taxonomical and phylogenetical studies (Maier et al., 2003). It includes aecia morphology (Sato and Sato, 1985), urediniospore germ pore arrangement and spore shape (Hiratsuka and Cummins, 1963), uredinia morphology (Kenney, 1970) and morphology of pycnia (spermogonia) (Hiratsuka and Cummins, 1963). Similarly soral characteristics including spore ball, spore and sterile cells morphology was considered important tool in taxonomic studies of smuts (Vanky, 2007).

Due to the complications with taxonomy of these fungi based on morphology (Long, 1914; Maier et al., 2007), the use of molecular sequence data, combined with morphology has become a powerful tool for the study at the species level (Aime, 2006; Begerow et al., 2006; Maier et al., 2007; Van der Merwe et al., 2007). First attempt to study this complicated group of fungi was made using the 5.8S rRNA by Gottschalk and Blanz (1984). Later, phylogenetic studies of the Internal Transcribed Spacer (ITS) region of the nuclear ribosomal genes were successfully applied to gain insight into closely related species of Puccinia Pers., Uromyces (Link) Unger (Zambino and Szabo, 1993; Kropp et al., 1997; Roy et al., 1998; Pfunder et al., 2001), and into the genus Cronartium (Vogler and Bruns, 1998). An 18S rDNA study has also been done on fern rusts and allies (Sjamsuridzals et al., 1999).

Maier et al. (2003) analyzed sequence of large subunit (LSU) rDNA to resolve suprageneric relationship of the rust fungi. In 2004, Wingfield et al. analyzed the sequence data from small subunit (SSU) rRNA to infer phylogenetic relationships in Pucciniales.

Liang et al. (2006) studied the taxonomic diversity of Pucciniastrum G.H. Otth in Japan. In this work forty nine (49) specimens comprising fourteen (14)

5 morphologically similar species were analyzed based on sequence data of LSU, 5.8S and ITS regions.

Dixon et al., (2010) resolved the phylogenetic positions of Puccinia spp. infecting sugarcane collected from sixty four (64) different locations in twenty three (23) countries using both light microscopy and nuclear ribosomal DNA sequences including 5.8S rDNA, ITS2 and LSU regions. Studies confirmed the separation of poaceous rust from rust species infecting Cyperaceae and Juncaceae. This study further led to making predictions regarding potential rust pathogen host.

Zuluaga et al., (2011) phylogenetically analyzed rusts from Colombian Andean Region using 28S (LSU) rDNA sequences to support taxonomic validity of families Pucciniaceae, Phakopsoraceae, Phragmidiaceae, Pileolariacacea, Mikronegeriaceae, Coleosporiaceae and Cronartiaceae.

In 2011, Kyiashchenko identified four different species on Berberis spp. from different parts of Sweden using spore measurements, aecia description as well as DNA sequence analysis using ITS region, EF1-α and β-tubulin partial genes.

Yun et al. (2011) revised the rust genus Frommeëlla Cummins & Y. Hirats using both spore morphology and phylogenetic analysis of LSU mainly and in some cases ITS2 of rDNA of about 37 samples of Rosaceae. Studies suggested that Frommeëlla was derived from within a clad representing Phragmidium Link. Thus taxon should be considered as a later generic synonym of Phragmidium.

Toome and Aime (2015) reassess the rust fungi on weeping willows (Salix babylonica L.) in America. For this study about eleven (11) different collections were analyzed using a combination of morphology, ITS and LSU regions of rDNA and host data including previously published inoculation studies, new and previously published sequence data to determine that they are undescribed rust fungi. Melampsora ferrinii Toome & Aime was found as a new taxon. From this work it was appeared that species collected and studied for last many years but was misidentified because of overlapping range of urediniospores measurements between studied taxon and previously reported rusts on same host. Thus importance of combining morphology,

6 host data and phylogenetic data was clearly emphasized to study taxonomist diversity of any region.

As far as Smut fungi are concerned these pathogens exhibit great variety from taxonomic point of view. Soral characteristics such as peridium, columella, sterile cells and teliospores morphology are taken in to account. These characters are highly dependent on morpho-anatomical features of host plants. Hence host identification is also very important for correct identification. With recent revolution in DNA related studies use of molecular tools has also been become an essential part for smut taxonomy. Begerow et al. (1997) studied the phylogenetic relationships among smut fungi and their relatives using LSU region of rDNA of forty three (43) different species. The results were correlated with classification system proposed by Bauer et al. (1997). Groups of Ustilaginomycetes reported by Bauer et al. (based on morphology of basidia) were well evidenced in phylogenetic hypothesis resulting from this study.

Almaraz et al. (2002) studied the phylogenetic relationships among smut fungi parasitizing dicots based on sequence data of ITS region of rDNA. During this research the evolutionary relationships of three (03) genera viz. Microbotryum Lév., Sphacelotheca de Bary and Ustilago (Pers.) Roussel were tried to resolve.

Stoll et al. (2005) did a comprehensive study on molecular phylogeny of Sporisorium, Ustilago and their related taxa using combined analysis of ITS and LSU region sequences. In this study the phylogenetic relationships of about ninety eight (98) taxa were successfully resolved.

In 2013, Piepenbring with his co-workers recorded two species of smut fungi from Panama. The study was based on morphological characters of sori, and teliospores along with sequence data of 28S region of rDNA. In this study the concept of genus Tolyposporium Woronin was also discussed in detail.

Escudero (2015) investigated the phylogenetic congruence of parasitic smut fungi and their host plants. For analysis LSU sequence data of thirty one (31) smuts as used to infer the phylogenetic history of parasites and their hosts. in addition to cophylogenetic reconstruction , codiversity events were also inferred.

7 In Pakistan, rust and smut pathogens on economically important crops have got special interest in research. Dr. Sultan Ahmad (1910-1983) has been the pioneer mycologist of Pakistan who worked on taxonomy of fungi of Pakistan and published more than 170 papers including monographs such as of Uredinales of West Pakistan (Ahmad, 1956a) with 185 species, Ustilaginales of West Pakistan (Ahmad, 1956b) with 86 species and Fungi of Pakistan (Ahmad et al., 1997) with 290 species. Among these, only thirty three (33) taxa of smut fungi and one hundred and sixty (160) taxa of rust fungi have been reported from Khyber Pakhtunkhwa (KP) and adjacent hilly areas of Pakistan.

Japanese scientists during the Cryptogamic expedition of Pakistan have made a lot of contribution to our fungal flora. More than 178 species of rust fungi and 20 species of smut fungi were reported by these scientists from different parts of the country that included many new records as well as new species (Izumi et al., 1992; Ono, 1992; Ono and Kakishima, 1992, 1993; Kakishima et al., 1993a, b; Kaneko, 1993; Ono and Izumi, 1995).

Major contribution in taxonomy of rust fungi after Sultan Ahmad, in Pakistan, has been made by Khalid and Iqbal (1995; 1996a, b; 1997), Khalid et al. (1993a, b; 2010) and Afshan (2009).

Masood et al. (1995) added six taxa of graminicolous rust fungi from Pakistan as new records. Khalid and Iqbal (1995) added Aecidium gjaerumii Khalid and Iqbal on Phagnalon nevium Edgw. to rust flora of Pakistan. Khalid and Iqbal (1996a, b) described and illustrated seven taxa of the rust fungi as new records and Phakospora anaphalidis-adnatae Khalid and Iqbal and Puccinia deosaiensis Khalid and Iqbal as new species from Pakistan (Khalid and Iqbal, 1997).

Sultan (2005) described and illustrated 36 taxa of rust fungi from Northern areas of Pakistan including two new anamorphs and some new records for Pakistan.

Afshan et al. (2007, 2008a, b, c, d) reported eleven (11) taxa of rust fungi as new records of rust fungi along with six (06) new host plants and spermogonial stages of two (02) and aecial stage for one (01) rust species from KP.

8 Iqbal et al. (2008) added two (02) new records and one (01) new host for rust fungi of KP. Similarly, one (01) new species, Puccinia khanspurica Khalid and Afshan, four (04) new records and one (01) new host for rust fungi have been reported by Afshan and Khalid (2009) and Khalid and Afshan(2009).

Afshan et al. (2010) reported three (03) new species viz., Puccinia dichanthii Afshan and Khalid on Dichanthium annulatum (Forssk.) Stapf, P. leersiae Khalid and Afshan on Leersia oryzoides Michx. And P. sporoboli-coromandeliani Afshan, Khalid and Niazi on Sporobolus coromandelianus Link from different areas of KP, Pakistan.

Saba et al. (2012) proposed Hyalopsora nodispora Saba & Berndt as the new name for Uredo capilli-veneris Jørst. & S.H. Iqbal from Himalayan moist temperate forest of KP, Pakistan.

As compared to rust fungi very little work has been done related to taxonomy of smut fungi. Sultan et al. (2007) added Bauhinus piperi (G. P. Clinton) Denchev. to the smut flora of Pakistan. Later on, V'anky et al. (2007) described Thekophora pakistanica V'ankey, Iqbal and Khalid as new species of smut fungi from Pakistan.

In 2012, Denchev et al. reported a new species of smut fungi viz. Sporisorium pakistanense Denchev, T. Denchev & Fiaz along with two new records for Pakistan including Bauhinustenui sporus (Cif.) Denchev and R.T. Moore and Sporisorium dinteri (Syd. & P. Syd.)Vánky.

Fiaz et al. (2013) reported Sporisorium linderi (Zundel) Vánky as a new record for Asia from this province along with Digitaria ciliaris Vanderyst as a new host for smut fungi in Pakistan.

So, up till now, approximately two hundred and forty (240) taxa of rust fungi and thirty six (36) taxa of smut fungi have been reported from different areas of KP and hilly areas (northern areas) of Pakistan (Ahmad et al., 1997; Afshan, 2009; Denchev et al., 2012; Fiaz et al., 2013; Saba and Khalid, 2013).

These figures reflect that there have been inadequate surveys in this province and in adjacent hilly areas as regard the prevalent climatic conditions and floristic

9 composition of this area. So there is strong need to explore this floristically rich province along with its adjacent northern areas to present a complete picture of Rusts and Smuts.

Literature shows that all the taxonomic research previously done on these pathogens was totally based on disease pattern, morphology of spores and sporangium and host identification. Modern innovations regarding DNA analysis, sequence data base, evolutionary aspects and phylogenetic affinities have never been used in Pakistan for identification of Rust and Smut fungi. So this work is the first attempt to use latest techniques along with traditional methods to produce more authentic picture of diversity of selected pathogens in Pakistan.

The number of species of these fungi recorded from this area is expected to increase in future by extensive exploration. Hopefully, this taxonomic knowledge of rust fungi will directly or indirectly be useful in biological control against certain noxious weeds of Pakistan in near future. Without reliable taxonomy based on morphological and molecular data, the distribution, biogeography and ecology of rusts and smuts in natural habitats cannot be fully understood. So this work will create a better access to biodiversity information on rust fungi of selected areas, an increased understanding of their taxonomy and an opportunity therefore, to develop robust ecological research and conservation strategies.

Ultimate goal is to make the results of this taxonomic research available as a tool, thereby activating further projects which explore and explain the importance of rusts and smuts as a regulatory feature in natural plant communities and ecosystems.

Aims and Objectives of Study

 The main objective of this work is to explore and document the diversity of the rust and smut fungi of selected region.  This is the first attempt to use molecular markers for taxonomic study of rust and smut fungi in Pakistan and this project will be helpful in establishment of molecular database of selected plant pathogens of Pakistan.  This study will provide a thorough picture of rust and smut fungi and their distribution pattern in Khyber Pakhtunkhwa (KP) and Northern areas (hilly areas) of Pakistan.  Another objective of this work is to upgrade the existing information regarding selected pathogenic fungi (rust and smut) of this province with special reference to Pakistan through taxonomic consideration.  As rust fungi are host specific and have very narrow host ranges so these can be used to control certain noxious weeds. This knowledge will be helpful to select potential rust fungi that could be utilized as biological control agents against certain noxious weeds of economically important crops (grasses and sedges) in future.  The study is also aimed to strengthen the Department of Botany, University of the Punjab, Lahore through providing preserved and identified fungal specimens. Moreover this research work will provide a baseline for further research projects related to exploration and documentation of fungi of Pakistan.

Materials and Methods

3.1. Description of sampling site

The selected sampling sites were visited thrice (July to November) from 2011 to 2015. The sampling sites which were hypothesized to support rich diversity of these pathogenic fungi were selected. The sites lie in Khyber Pakhtunkhwa and adjacent northern hills of Pakistan from enriched coniferous forests to grass lands of Deosai Plains (Figure 1). Major sampling sites included Abbottabad district (Ayubia National Park, Galliyat, Khanspur, Thandiani), Chitral district (Kalash Valley), Mansehra District (Hazara University, Kaghan valley, Sharan Valley), Battgram district (Battgram), Swat district (Kalam, Madyan, Malam Jabba, Mankial, Mashkoon, Ushu Valley), Shangla district, Torghar District (Kala Dhaka), Upper Dir (Kumrat Valley, Shringal) of Khyber PakhtunKhwa, Bagh district (Bagh, Dher Kot, Neela Kot) of Azad Kashmir and Skardu District of Gilgit-Baltistan adjacent to KP in North East (Figures 2-7). Description of sampling sites has been given in Table 1.

3.2. Sample collection

Infected plants were collected and photographed. It was tried to collect healthy plants along with their inflorescence or fruit for accurate and precise identification of the host plants.

3.3. Preservation of samples

The collected samples were pressed and dried individually among blotting papers, properly labeled (locality and date of collection). These samples were brought back in laboratory for further analysis.

3.4. Identification of host plants

Host plants were identified in comparison with plants already present in the LAH herbarium, Department of Botany, University of the Punjab, Lahore, Pakistan. The plants along with their inflorescence and infected leaves were photographed.

Table 1: Description of sampling sites.

Sampling Site Description Abbottabad Bagh Battagram Chitral Northern Mansehra Shangla Swat Torghar Upper Dir Areas Temperature 10 oC 21 oC 22 oC 15 oC 13 oC 19 oC 15 oC 15 oC 14 oC 17 oC *Climate (Mean annual) Rainfall 1200 <1500 <1100 <800 <250 700-1000 1400 897 980 1500 (mm) Humidity 57% 65% 56% 63% 60 % 72 % 66% 85% 60 % 87%

Soil Silt loam to Clay Loam loam to Yellow Silty Loamy, Loam to sandy loam to shallow silty clays in to loam alluvial loess to Loam to shallow Clay Loam loam to alluvial slightly valleys alluvial Clay alluvial gravely Loam loams/silt loams

**Edaphic PH < 7 5-7 5.5-7 6 5-7 6.5-8 6.1-8 6-7 6.1-7.3 Factor Organic 3-4 0.5-2.5 0.8 0.9-1.5 11-25 10 0.9 0.8 0.7-0.9 0.7 Matter (%) *Geography Altitude 3000-4000 1500-2500 450-3000 1200-3300 4100 2000-3000 1300-3000 >3000 450-3000 2000 (meters) Sub-tropical Himalayan Montane Dry Alpine Sub- subtropical moist sub-tropical Pine Forest Moist temperate temperate Pasture tropical pine forests temperate to alpine Forest Type Temperate forests Oak and Pine forest and the sub- and sub regions Forests Deodar alpine alpine having dry forests Forests and (Champion et coniferous al., 1965; moist Sheikh, temperate 1993) forest types

Source: *Pakistan Meteorological Department, Lahore, **Soil Survey of the Punjab, Lahore

Figure 1: Map of Khyber Pakhtunkhwa (KP) and adjacent hilly areas showing sampling sites. 14

Figure 2: Photographs of Abbottabad District, Khyber Pakhtunkhwa, Pakistan.

Figure 3: Photographs of Bagh District, Azad Jammu and kashmir, Pakistan.

Figure 4: Photographs of Kalash valley, Chitral Distrcit, Khyber Pakhtunkhwa, Pakistan

Figure 5: Photographs of Torghar District, Khyber Pakhtunkhwa, Pakistan.

Figure 6: Photographs of Skardu Distrcit, Gilgit-Baltistan, Pakistan.

Figure 7: Photographs of sampling site Swat District, Khyber Pakhtunkhwa, Pakistan

3.5. Microscopic analysis

Infected portions were observed under stereomicroscope at the magnification of 25-50X. Slides of infected plants were prepared using lactophenol to prepare semi- permanent slides by cementing cover slips with nail lacquer (Dade and Gunnell, 1969). Slides were studied under microscope (Nikon YS 100).Sections and spores were microphotographed. Illustrations of spores were made and spore dimensions were taken by an Ocular micrometer (Zeiss Eyepiece Screw Micrometer). Spore dimensions which were taken in to account include: sorus length and width; spore length, width, wall thickness, apical thickness, pedicel length, width; paraphyses length and width if present.

Surface features of spores (size, shape and surface ornamentation) were observed using Scanning Microscopic Microscope (JSM5910, JEOL, Japan) in Centralized Resource Laboratory (CLR), Department of Physics, University of Peshawar, Pakistan.

3.6. Identification of Fungi

The Rust and Smut fungi were identified using the following manuals;

 British rust fungi (Wilson and Henderson, 1966).  European smut fungi (Vanky, 1994).  Fungi of Pakistan (Ahmad et al., 1997).  Illustrated genera of rust fungi (Cummins and Hiratsuka, 2003).  Manual of rust in United States and Canada (Arthur, 1934).  Smut fungi of the Indian subcontinent (Vanky, 2007).  The rust flora of Japan (Hisratsuka et al., 1992).  The rust fungi of cereals, grasses and bamboos (Cummins, 1971).  Uredinales of West Pakistan (Ahmad, 1956a).

All the specimens were codeposited in both LAH Herbarium, Department of Botany, University of the Punjab, Lahore, Pakistan and Arthur and Kriebel Herbarium, Purdue University, Indiana, USA.

3.7. Molecular Characterization:

3.7.1. Genomic DNA Extraction

Sori were excised from the dried host material, placed in 2 ml Bead Solution tubes of the UltraClean Plant DNA Isolation Kit, and extracted per the manufacturer‟s instructions (MoBio Laboratories, Solana Beach, CA, USA).

3.7.1. Polymerase Chain Reaction (PCR)

Polymerase chain reaction (PCR) was performed to amplify Internal Transcribed Spacers (ITS1 and ITS2) in addition to 5.8S region and Larger Sub Unit (LSU) of nrDNA gene using different primer pairs (Annexure I). For Rust fungi amplification was performed in 25-μl reaction volumes with 12.5μl Apex Taq RED Master Mix (Genesee Scientific), 1.25μl each 10μM primers (upstream and downstream), and 10μl diluted (10- to 100 fold) DNA template. For Rusts approximately 1400bp of a region of the ribosomal repeat spanning the 5.8S subunit, the internal transcribed spacer region 2 (ITS-2), and the large subunit (28S) was amplified with rust-specific primer Rust2inv, based on the reverse complement of LR6 (Aime, 2006) and amplification was achieved with an initial denaturation step of 7 min at 94°C; 45 cycles of 30 s at 94°C, 1 min at 57°C, and 1.5 min at 72°C, and a final extension of 7 min at 72°C. Products of PCR were cleaned using ExoSAP (Affymetrix Inc.) Treatment was carried out at 37°C followed by an incubation period of 15 min then at 80°C for 15 min to completely inactivate both enzymes. Once these contaminants are removed, Nested PCR was carried out using Rust28SF (Forward primer) and LR5 (Reverse primer) with an initial denaturation step of 2 min at 94°C; 44 cycles of 30 s at 94°C, 1 min at 57°C, and 1.5 min at 72°C, and a final extension of 7 min at 72°C.

For smuts ITS1F (forward primer) and ITS4 (reverse primer) primers were used. Amplification of ITS region with an initial denaturation step of 5 min at 94°C; 34 cycles of 30 s at 94°C, 45 s at 50°C, and 45 s at 72°C, and a final extension of 7 min at 72°C while LSU region was amplified using LROR, based on the reverse complement of LR6 & LSU4B with an initial denaturation step of 5 min at 94°C; 35

cycles of 30 s at 94°C, 45 s at 50°C, and 1 min at 72°C and a final extension of 7 min at 72°C (Annexure I).

PCR products were separated by electrophoresis on 1% Agarose gel, run at 110 Volt for 50-60 min and stained with GelRed. The PCR products were visualized through Gel Documentation System using default settings. Sequencing of the amplified fragments was performed by Beckman Coulter, Inc. with the same primer sets as used for amplification. Amplification reactions of the ITS and LSU gene regions resulted in fragments of ~750 bp and ~900 bp in length respectively.

3.7.2. Analyses of Molecular Data

3.7.2.1. Editing of sequences and BLAST analysis

After getting the results of sequencing, sequences were edited and assembled in Sequencher v.5.2.3. (Gene Codes, Ann Arbor, MI, USA). BioEdit (Hall, 1999) was also used for editing the sequences manually (www.mbio.ncsu.edu/bioedit/bioedit.htm). Consensus sequences were compared to other sequences in the NCBI database (http://www.ncbi.nlm.nih.gov/) with a BLASTn analysis to determine the percent shared sequence identity with other sequenced fungi.

3.7.2.2. Phylogenetic analyses

Phylogenetic trees were constructed for each genus during this study. Sampling of taxa for phylogenetic analyses was based upon retrieving closely related sequences from Genbank after BLAST search. Sequences from already published data were tried to include in each alignment to bring the accuracy. At least one out group sequence was selected for each tree.

Multiple alignments were performed using MUSCLE alignment software (Edgar, 2004) and in MAFFT version 7. Phylogenetic trees were constructed using two different methods. In first method alignments were constructed in Phylogenetic analyses were performed within the CIPRES portal (Miller et al., 2010). Maximum likelihood (ML) analyses of independent gene trees was conducted with RAxML specifying a general time-reversible model on XSEDE with default parameters and

1000 bootstrap iterations. Phylogenetic tree was visualized in FigTree and edited using Inkscape.

Secondly, phylogenetic analyses were performed with the Maximum Likelihood algorithm and Jukes & Cantor (1969) model of sequences evolution using Model testing feature of MEGA5 software (Tamura et al., 2013). Bootstrap consensus tree inferred from 1000 replicates is presented here to describe the phylogeny of taxa and corresponding bootstrap values >50 % are cited in the tree. Then phylogenetic analysis was carried out to find out their phylogenetic nature and appropriate position on molecular basis.

3.8. Biodiversity Analysis:

Biodiversity statistics and indices based on biotic data were computed using different formulae.

3.8.1. Species Richness (S):

The total number of different organisms present in any sample. It does not take into account the proportion and distribution of each species within the community. “Menhinick's index” is the measure of species richness.

Menhinick's index=D=

Where,

S= Number of different species represented in sample

N= Total number of individual organisms in sample

3.8.2. Margalef diversity index (D):

The Margalef diversity index can easily be calculated by given formulae

Margalef diversity index=d = (S - 1) / ln N

Where,

S= Number of species

N= Total number of individuals in the sample.

3.8.3. Shannon Index (H):

The Shannon index is an information statistic index, which means it assumes all species are represented in a sample and they are randomly sampled.

Shannon index= H=-

In the shannon index,

Pi= The proportion (n/N) of individuals of one particular species found (n)

divided by total number of individuals found (N)

ln= Natural log

∑= The sum of the calculations

s= number of species.

The shannon diversity index is affected by both the number of species and their equitability, or evenness. A greater the number of species and a more even distribution of species both result in an increase in Shannon‟s diversity. Using ln the value of H ranges from 0-5, given a large sample size. A value near 4.6 would indicate that the number of individuals is evenly distributed between all the species (Magurran, 2004).

3.8.4. Shannon’s Equitability (EH ):

It measures the evenness of a community and can be easily calculated by dividing the value of H with Hmax, which equals to lnS (S=number of species encountered). Its value ranges between 0 and 1, with being complete evenness. “H” will always be less than Hmax.

Shannon‟s Equitability=EH=H/Hmax=H/lnS

Shannon‟s evenness is derived from Shannon‟s diversity index. Evenness is a measure of how similar the abundances of different species are. When there are similar proportions of all species, evenness approaches a value of 1.0. Ehen the abundances are very dissimilar, then the value for evenness decreases (Magurran, 2004).

3.8.5. Simpson Index (D):

The Simpson index is a dominance index because it gives more weight to common or dominant species. A few rare species which are represented by a low number will not affect the Simpson diversity.

Simpson Index=

Where,

N=the total number of organisms of all the species

n= the total number of organisms of a particular species

The value of “D” ranges from 0 to 1. With this index, 0 represents infinite diversity (all taxa are equally present) and 1 represents no diversity meaning single taxon dominates the community completely (Magurran, 2004). This does not seem intuitive or logical, or so sometimes derivatives of the index are used, such as the inverse (1/D) or the difference from 1(1-D)

3.8.6. Simpson’s Reciprocal Index (1/D):

The value of this index starts with 1 as the lowest possible figure. This figure would represent a community containing only one species. The higher the value, the greater will be the diversity. The maximum value is the number of species in sample.

3.9. Dendrogram cluster analysis:

To analyse the clustering of sampling sites based on climatic factors including mean annual temperature, mean annual rainfall, humidity and wind velocity, Community Analysis Program (CAP) 4.0 was used. Objective was to compare the all sampling sites ecologically to infer similarities and dissimilarities among them. Same analysis was performed between fungal taxa collected during this project and sampling sites . The purpose was to see the effect of climatic facors of diversity and distribution of rust and smut fungi. This clustering analysis was performed using complete linkages among Agglomerative method with Eudidear distance measures.

3.10. Distribution Mapping and Predictive Modeling:

The GIS tool set was used for diversity analysis and for disease prediction model of selected pathogens. Overlay analysis was performed on multiple data layers of last ten (10) years meteorological data. Bioclimatic variables were selected from the list described by WorldClime (2011). Weighted overlay analysis was also performed by assigning suitability rate to three (03) main bioclimatic variables viz. temperature, humidity and precipitation along with position of host trees (Table 2). Selection of bioclimatic variables was purely based on study of life cycle of pathogen and abiotic and biotic factors affecting its life from previously published literature. The result of analysis was displayed in the form of maps generated in ArcGIS version 10 (ArcMap) licensed by ESRI 2011 in map development.

Table 2: Bioclimatic predictor variables used for assessing fungal habitat. (Source: WorldClim 2011)

No Bioclimatic Variable Description 1 BIO1 Annual Mean Temperature

2 BIO5 Max temperature of warmest month

3 BIO6 Min temperature of coldest month

4 BIO7 Temperature annual range (BIO5- BIO6)

5 BIO12 Annual precipitation 6 ---- Humidity 7 ---- Host distribution

Results

In current research project, sixty four (64) taxa are identified using both morphological and molecular techniques. Among these, fifty two (52) are rusts taxa while remaining twelve (12) are smuts. A total of 110 sequences were generated of Internal Trinscribed Spacers (ITS1, 5.8S, ITS2) and large subunit (LSU). Morphological descriptions, microphotographs, Lucida drawings and phylogenetic trees of all taxa are described here.

4.1. Taxonomy:

Aecidium quintum Syd. & P. Syd., Annls mycol. 15(1/2): 144 (1917)

(Figure 8 )

Spermogonia, uredinia and telia not found. Aecia abaxial, densely arranged, white, hypertrophied, irregular. Aeciospores ovoid to ellipsoid, hyaline to subhyaline, verrucose, 15–23 × 17–25 μm, wall densely verrucose, 1–1.5 μm thick with up to 7 μm thick apex. Peridial cells hyaline, angular to rectangular, 16–23 × 24–33 μm, wall verrucose, 1–2 μm.

Material Examined: On leaves of Elaeagnus umbellata Thunb. (Elaeagnaceae), with I stage, Pakistan, Khyber Pakhtunkhwa, Torghar District, Kala Dhaka, at 2438 m a. s. l., October, 2014, A. Ishaq, KD5-AM33 (LAHAM20901).

Additional material examined: On leaves of Elaeagnus umbellata (Elaeagnaceae), with I stage, Pakistan, Azad Jammu & Kashmir, District Bagh, 1,676 m a.s.l., July, 2015, BG10-AM47, A. Ishaq (LAHAM20001).

Comments: It has previously been reported on Elaeagnus umbellata Thunb. from Oghi forest of District Mansehra (Fiaz, 2013). It is a new record for Torghar District and Azad Jammu and Kashmir.

B B

C D E

F G

Figure 8: Morphology of Aecidium quintum (KD5-AM33) A. Infected host plant Elaeagnus umbellata B. Peridial cells C–E. Microphotographs of aeciospores F. Lucida drawings of peridial cells G. Lucida drawings of aeciospore. Scale bar A= 1cm, B= 10 μm, C= 6 μm, D & E= 5 μm, F= 11 μm, G= 5.5 μm.

Aecidium viburni Henn. & Shirai, in Hennings, Bot. Jb. 28(3): 265 (1900)

(Figures 9, 10)

Spermogonia adaxial, group 1, type 1, yellowish brown, 86–113 μm in diameter. Aecia adaxial, densely gregarious, brown to dark brown lesions, irregular. Aeciospores globose, subglobose or ellipsoid, hyaline to subhyaline, 18–23 × 20–25 μm, wall densely verrucose, 2.5–3.55 μm thick. Peridial cells hyaline, angular to nearly rhomboid, 16–23 × 21–25 μm, wall verrucose, up to 2 μm thick.

Material Examined: On leaves of Viburnum grandiflorum Wall. ex DC. (Caprifoliaceae), with 0 + I stages, Pakistan, Khyber Pakhtunkhwa, Abbottabad District , Khanspur, at 2250 m a. s. l., July 2015, A. Ishaq, KP-50 (LAH Herbarium No. AM20002).

Comment: It is a new record for Pakistan.

A C

D E

F G

Figure 9: Morphology of Aecidium viburni (KP-50) A−B. Infected host plant Viburnum grandiflorum C. Cup-like aecium on host plant D. Spermogonium E. Aecium with chains of aeciospores F. Peridial cells G. Aeciospores. Scale bar A & C= 1cm, D= 16 μm, E= 10 μm, F= 14 μm, G= 7 μm.

Figure 10: Aecidium viburni (KP-50) A. Peridial cells B. Aeciospores. Scale bar A= 7 μm, B= 4.5 μm.

Phylogenetic Analysis of genus Aecidium Pers.

During this study, one sequence of LSU region of one taxon belonging to anamorphic genus Aecidium Pers. ex Pers. collected from Torghar District was successfully generated. Only Aecidial stage has been found on infected leaves from which it was found difficult to identify the pathogen. For fungal genome DNA analysis the data set was used published by Aime (2006). The evolutionary history was inferred by using the Maximum Likelihood method. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 41 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 433 positions in the final dataset. In final tree query sequence was found clustered with Melampsoridium betulinum (Pers.) Kleb. (KF031548). From which it seems that holomorph of A. quantum might belongs to Melamsporidium Kleb. or its allies (Figure 11).

Figure 11: Molecular Phylogenetic analysis of Aecidium quintum by Maximum Likelihood method based on LSU sequence.

Cerotelium fici (Castagne) Arthur, Bull. Torrey bot. Club 44: 509 (1917)

(Figures 12, 13)

Spermogonia, aecia and telia not found. Uredinia hypophyllous, small, brown, scattered, covered by epidermis. Urediniospores broadly ellipsoid, hyaline to golden, 22–28 × 28–36 µm; wall yellowish brown, echinulate, 1.5−2 µm thick; germ pores up to 2, equatorial or tending to be equatorial.

Material examined: On Ficus sp. (Moraceae), with II stage, Pakistan, KhyberPakhtunkhwa, District Battagram, at 1038 m a.s.l., October, 2014, B8-AM5. A. Ishaq (LAHAM20019).

Additional material examined: On Ficus sp. (Moraceae), with II stage, Pakistan, KhyberPakhtunkhwa, District Mansehra, Hazara University, at 1088 m a.s.l., November, 2014, H-2. A. Ishaq (LAH AM20003); Abbottabad District , Thandiani, at 2750 m a.s.l., November, 2014, T-5. A. Ishaq (LAH AM20004); District Tor Garh, Kala Dhaka, at 2438 m a.s.l., October, 2014, A. Ishaq (LAH AM20005).

Comments: C. fici is first time characterised phylogenetically from Pakistan.

Figure 12: Morphology of Cerotelium fici (B8−AM5) A−B. Infected host plant Ficus sp. B. Rounded to irregular sori C. Urediniospores showing echinulate surface ornamentation. Scale bar for A= 2cm, B= 1 cm, C= 11 μm.

Figure 13: Scanning Electron Microphotographs of Cerotelium fici (H-2) A−B. urediniospores showing echinulate surface ornamentation.

Phylogenetic analysis of genus Cerotelium Arthur:

In the present study one Large Subunit (LSU) on nrDNA of (one) 01 species was successfully amplified and generated. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from GenBank. The evolutionary history was inferred by using the Maximum Likelihood method. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions containing gaps and missing data were eliminated.

Analysis involved 24 nucleotide sequences having 23 in group and 1 outgroup sequence. Out of these 23 in group sequences, two clades i.e., Clade I and clade II were constructed. Clade I consists of two subclades. In first subclade sequences of genera Batistopsora Dianese, R.B. Medeiros & L.T.P. Santos, Cerotelium Arthur and Phakopsora Dietel belonging to Phakosporaceae were clustered together while in second subclade genus Tranzschelia Arthur belonging to Uropyxidaceae lies. In clade II sequences of Puccinia Pers. were included. Eucronartium G.F. Atk. has been selected as an outgroup based on previously published data. There were a total of 548 positions in the final dataset (Figure 14).

Figure 14: Molecular Phylogenetic analysis of Cerotelium based on LSU sequence by Maximum Likelihood method.

Coleosporium tussilaginis (Pers.) Lév., in Orbigny, Dict. Univ. Hist. Nat.

12: 786 (1849) (Figure 15)

Spermogonia, aecia and telia not found. Uredinia abaxial, yellow, rounded, scattered, naked. Urediniospores golden to pale orange when fresh become hyaline after drying, 18–24 × 22–26 µm; wall 1.5–2 µm thick, Coarsely verrucose, germ pores highly obscure.

Material examined: On Inula sp. (Asteraceae), with II stage, Pakistan, Khyber PakhtunKhwa (KP), Abbottabad District , Thandiani, at 2,700 m a. s. l., September, 2014. T-23. A. Ishaq. (LAH Herbarium No. LAHAM20006).

Comments: It is a new record for Pakistan as well as first report of any fungal pathogen on Inula sp from this region.

A C

D E F

Figure 15: Morphology of Coleosporium tussilaginis (T-23) A−C. Infected host plant Inula sp. D−F. Microphotographs of urediniospores G. Lucida drawings of urediniospores with verrucose surface ornamentation. Scale bar A= 1.5 cm, B= 0.5 cm, D= 4.5 μm, E & F= 5 μm, G= 5 μm.

Macruropyxis sp. (Figures 16, 17)

Sori on leaves abaxial, brown, circular, scattered, on branches orange-brown, elongated. Aecia abaxial, ovate to broadly ellipsoid, hyaline, with yellow aeciospores. Aeciospores globose to subglobose, verrucose, hyaline with yellowish tinge, 22–26 × 27–33 μm; wall 2–3 μm thick; upto 2 equatorial germ pores. Peridial cells hyaline, angular to rectangular, verrucose, 20–30 × 27–37 (–45) μm, wall densely verrucose, 2.5–6.5 μm thick.

Material Examined: On leaves of Jasminum humile Gueldenst. (Oleaceae), with I stage, Pakistan, Khyber Pakhtunkhwa, Abbottabad District , Khanspur, at 2250 m a. s. l., 20th July, 2015, AM43, A. Ishaq (LAH20902).

Comments:

This is a new genus for Pakistan.

Figure 16: Morphology of Macruropyxis sp. (AM45) A−B. Infected host plant Jasminum humile C−D. Aecium showing aeciospores with peridial cells E. Peridial cells F. Aeciospore. Scale bar A= 2 cm, B−C= 4 mm, D= 5 μm, E= 16 μm, F= 10 μm.

Figure 17: Lucida drawings of Macruropyxis sp. A. aeciospores B. Peridial cells. Scale bar A= 6 μm, B=7 μm.

Phylogenetic Analysis of genus Macruropyxis Azbukina:

In the present study one Large Subunit (LSU) on nrDNA of 1 species of genus Macruropyxis was successfully generated. Sampling of taxa for phylogenetic analysis was based on retrieving not only closely related sequences from GenBank but sequence dataset of Maier et al. (2003) was used to see the generic association of studied taxon. The evolutionary history was inferred by using the Maximum Likelihood method based. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Maximum Composite Likelihood (MCL) approach was used to construct tree. All positions containing gaps and missing data were eliminated. There were a total of 428 positions in the final dataset. The analysis involved 46 nucleotide sequences (Figure 18).

Figure 18: Molecular Phylogenetic analysis based on LSU sequences of Macruropyxis by Maximum Likelihood method.

Melampsora dimorphospora S. Kaneko & Hirats. f., in Hiratsuka & Kaneko, Rep. Tottori Mycol. Inst. 20: 6 (1982) (Figures 19, 20)

Spermogonia, aecia and telia not found. Uredinia Abaxial, scattered, rounded, brownish yellow in dry state. Urediniospores of two types: (1) borne singly on pedicels, subglobose, golden brown, 18–23 × 18–27 µm, wall up to 2.5 µm thick, echinulate, germ pores obscure, (2) subglobose to broadly ellipsoida, catenulate in short chains, (22–) 27–33 × 28–36 µm; wall dark brown, verrucose, 2.5–3.5 µm thick, germ pores up to 2, tending to be equatorial. Paraphyses numerous, intermixed, capitate to clavate, 20–26 × 30–47 µm, wall up to 4 µm thick.

Material Examined: On Salix alba L. (Salicaceae) with II stage, Pakistan, Khyber Pakhtunkhwa (KP), Ushu valley, 4th September, 2012. U–1 (LAHAM20006).

Comment: It is a new record for Pakistan.

B C

A D E

F G

Figure 19: Morphology of Melampsora dimorphospora (U1) A. Infected host plant Salix alba B–C. Urediniospores showing verrucose surface ornamentation D. Urediniospore showing echinulate surface ornamentation E–G. Capitate paraphyses. Scale bar for A= 1 cm, B & C= 5 μm, D= 8 μm, E= 13 μm, F= 4 mm, G= 8 μm.

B C

Figure 20: Scanning Electron Microphotographs of Melampsora dimorphospora (U1) A. Urediniospores showing echinulate surface ornamentation B. Urediniospore with densely verrucose surface ornamentation C. Capitate paraphyses.

Melampsora euphorbiae (Ficinus & C. Schub.) Castagne, Observ. Uréd. 2: 18 (1843) (Figure 21)

Spermogonia and aecia not found. Uredinia brown and scattered. Urediniospores globose to subglobose, golden brown, 20–24 × 22–25 µm; wall hyaline, 2–5 µm thick, echinulate; up to 5 germ pores, scattered. Paraphyses capitate, having cap of 16–23 μm diameter; pedicel 35–45 μm long. Telia subcuticular, subepidermal, amphigenous, black. Teliospores cylinderic, apex not thickened, yellowish brown, 10–14 × 20–45 µm.

Material examined: On Euphorbia helioscopia L. (Euphorbiaceae), with II stage, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM13. A. Ishaq. (LAH Herbarium No. 1210).

Comment: It is first time reported from Deosai plains, Norther areas of Pakistan

A C D

Figure 21: Morphology of Melampsora euphorbiae (AM13) A−B. Infected host plant Euphorbia helioscopia L. C−D. Urediniospores E. Telium. Scale bar A & B= 1 cm, C= 8 μm, D= 6 μm, E= 7 mm.

Melampsora yoshinagae Henn. [as 'yoshinagai'], Hedwigia 42(Beibl.): (108) (1903) (Figure 22)

Spermogonia, aecia and uredinia not found. Telia hypophyllous, scattered, deep brown or cinnamon brown as protruding swollen upon leaf surface, 14−45 × 55−189 µm. Teliospores sub-epidermal, golden to cinnamon-brown, rectangular to ellipsoidal or oblong; 8−14 × 26−46 µm, walls deep brown, smooth, 1.5−2 µm thick on sides, not thickened at apex.

Material examined: On Wikstroemia canescens Meisn. (Thymelaeaceae), with III stage, Pakistan, KhyberPakhtunkhwa, District Upper Dir, Kumrat Valley, at 2284 m a.s.l., November, 2015, KV1-AM45. A.N. Khalid (LAHAM20007).

Additional material examined: On Wikstroemia canescens (Thymelaeaceae), with III stages, Pakistan, KhyberPakhtunkhwa, District Shangla, at 2200 m a.s.l., November, 2014, A.R. Niazi NSA-01. (LAHAM20008).

Comments: Melampsora yoshinagae is first time characterised phylogenetically. It is a new record for District Shangla and District Upper Dir.

Figure 22: Morphology of Melampsora yoshinagae (KV1-AM45) A−B. Infected host plant Wikstroemia canescens C. Cross section of telium. Scale bar A & B= 1 cm, C= 11 mm.

Phylogenetic analysis of genus Melampsora Castagne:

In the present phylogenetic analysis 2 sequences of LSU-nrDNA region were produced from two different collections of Melampsora yoshinagae Henn. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from GenBank. The analysis involved 38 nucleotide sequences. Out of these, 37 sequences were in group sequences belonging to genus Melampsora Castagne while 1 sequence of Endoraecium acacia Hodges & D.E. Gardner (DQ323916) was selected as out group by reviewing the previous literature (Figure 23).

Initial tree(s) for the heuristic search were obtained by applying the Neighbor- Joining method to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The evolutionary history was inferred by using the Maximum Likelihood method. The percentage of trees in which the associated taxa clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions containing gaps and missing data were eliminated. There were a total of 542 positions in the final dataset.

Figure 23: Molecular Phylogenetic analysis of Melampsora based on LSU sequences by Maximum Likelihood method.

Miyagia pseudosphaeria (Mont.) Jørst., Nytt Mag. Bot. 9: 78 (1962) [1961]

(Figure 24)

Spermogonia, aecia and telia not found. Uredinia amphigenous, small, irregular. Urediniospores globose to subglobose, hyaline to light brown, 13–19 × 17– 23 µm; wall 1.2–2 µm, verrucose; germpores obscure.

Material examined: On Sonchus sp. (Asteraceae), with II stage, Pakistan, Khyber PakhtunKhwa, Abbottabad District, Thandiani, at 2750 m a. s. l., November, 2014. T- 2. A. R. Niazi (LAHAM20197).

Additional material examined: Swat District, Kalam, at 2,000 m a. s. l.; Mankial Top at 3816 m a. s. l., August, 2014. K-2, A. Ishaq (LAH Herbarium No. LAHAM20009); Swat District, Kalam, at 2,000 m a. s. l., September, 2013. K-2, A. Ishaq (LAHAM20010); Azad Jammu & Kashmir, Bagh District, 1,676 m a.s.l., July, 2015, BG–8, A. Ishaq (LAHAM20011).

Comments: Presence of this pathogenic fungus from Azad Jummu and Kashmir is reported here first time.

A C

D E

Figure 24: Morphology of Miyagia pseudosphaeria (T-2) A−C. Infected leaves of Sonchus sp. D–E. Urediniospores. Scale bar A−C= 1cm, D= 3.5 μm, E= 5 μm.

Phakopsora ziziphi-vulgaris Dietel, Annls mycol. 8(3): 469 (1910)

(Figure 25)

Spermogonia, aecia and telia not found. Uredinia abaxial, scattered, brown. Urediniospores ellipsoid to ovate, hyaline to yellowish, 15–19 × 21–31 μm; wall 1.5– 2 μm thick, echinulate, up to 3 germ pores. Paraphyses few, hyaline, capitate, cap up to 6 μm wide with short pedicels.

Material Examined: On leaves of Zizyphus jujuba Mill. (Rhamnaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Swat District, Kalam, at 2000 m a. s. l., August, 2014. K-8, A. Ishaq (LAHAM20013).

Additional material examined: On leaves of Z. jujuba with II stage, Pakistan, Khyber PakhtunKhwa, District Tor Garh, Kala Dhaka, at 2438 m a.s.l., October, 2014, KD41, A. Ishaq (LAHAM20014).

Comments: It is a new report for Khyber PakhtunKhwa.

B C

D E

A F G

Figure 25: Morphology of Phakopsora ziziphi-vulgaris (K8) A. Infected host plant, Zizyphus jujuba B–E. Microphotographs of urediniospores germ pores (shown with arrow). Scale bar A= 1cm, B–D= 5.5 μm, E= 5 μm, F–G= 6 μm.

Phragmidium pakistanica nom. prov. (Figure 26–27)

Etymology: On the basis of country name “Pakistan”

Spermogonia and aecia not found. Uredinia black, hypophyllous, naked. Urediniospores hyaline, 20–22 × 19–23 µm; wall 2–2.8 µm thick, verrucose; germ pores up to 2, equatorial. Telia hypophyllous, scattered, minute, naked. Teliospores oblong to cylindrical, dark brown, 2–9 celled (5–9 celled are common), 32–35 × 103– 117 µm; wall 2–2.5 µm thick, verrucose; 10–15 µm thick at apex, 3 germ pores in each cell, pedicel persistent, 15–20 µm thick, up to 99 µm long.

Material examined: On Rubus fruticosus Roth (Rosaceae), with II+III stages, Pakistan, Khyber Pakhtunkhwa (KP), District Mansehra, Hazara University, at 1,088 m a. s. l., October 15, 2014, A. R. Niazi, H1 (Holotype) (LAHAM20015); November 8, 2014, A. Ishaq, H7 (LAHAM20016); District Tor Garh, at 2438 m a. s. l., October 25, 2014, A. Ishaq, KD1 (LAHAM20017).

Comment: It seems previously undescribed.

Figure 26: Phragmidium pakistanica (H1) A–C. Infected host plant Rubus fruticosus D–E. Teliospores. Scale bar A–C= 1cm, D= 39 μm, E= 31 μm.

Figure 27: Scanning Electron Microphotographs of Phragmidium pakistanica (H1). Teliospores showing verrucose surface ornamentation.

Table 3: Spore morphology for Phragmidium species with size range similar to Ph. pakistanica or having 99% similarity in initial Blast from NCBI (National Center for Biotechnology Information). Measurements were obtained from original descriptions.

Phragmidium Uredinia Urediniospores/wall Telia Teliospores species size/ornamentation septation/size/ wall/ (µm) Apical thickness /Pedicel (µm) Ph. pakistanica Hypophyllous 20–22 × 19–23/2– Hypophyllous 2–9 celled/ 32–35 × (H1, H7, KD1) 2.8/echinulate 103–117/2–2.5/10– 15/up to 99 Ph. rubi-idaei Hypophyllous 15–18 × 18–23 /up to Hypophyllous 6–10 celled/ 26–30 × 1.5/echinulate 80–120/6–7/3–13/up (DC.) P. Karst. to 165 Ph. rubi-odorati Hypophyllous 15–18 × 18– Hypophyllous 7–10 celled/ 29–34 × 23/1/echinulate 80–110/5–7/7–17/up Dietel to 110 Ph. rubi-japonici Hypophyllous 12–18 × 15–24 /0.8–1.5 Hypophyllous 4–10 celled/ 24–36 × /echinulate 66–135/2.5–3.5/up Kasai to 21/up to 435 Ph. rubi-oldhami Hypophyllous 12–20 × 14–25/1.5– Hypophyllous 2–7 celled/ 24–32 × 2/echinulate 32–108/2–4/1– Togashi & Y. 12.5/up to 145 Maki Ph. occidentale Hypophyllous 15–19 × 19–25/1– Hypophyllous 6–9 celled/ 29–34 × 1.5/echinulate 80–110/5–7/7–17/up Arthur to 110 Ph. sanguisorbae Hypophyllous 16–20 × 17–24/1– Hypophyllous 2–5 celled/ 20–26 × 1.5/echinulate 40–70/2–2.5/10– (DC.) J. Schröt. 15/up to 25 Ph. barnardii Hypophyllous 17–18 × 23–25/2– Hypophyllous 6–9 celled/ 23–27 × 2.5/echinulate 60–115/2–2.5/10– Plowr. & G. 18/up to 140 Winter Ph. violaceum Hypophyllous 18–25 × 19–30/3– Hypophyllous 1–5 celled/ 25–36 × 4.5/echinulate 70–100/6–8/10– (Schultz) G. 15/up to 119 Winter Ph. potentillae Hypophyllous 15–25 × 17–27/1.2– Hypophyllous 2–7 celled/ 22–30 × 2/echinulate 48–90/3–4/ up (Pers.) P. Karst. to10/up to 240

Phragmidium rosae-pimpinellifoliae Dietel, Hedwigia 44: 339 (1905)

(Figure 28–29)

Spermogonia, aecia and uredinia not found. Telia hypophyllous, scattered, minute, rarely naked. Teliospores oblong to cylindrical, dark brown, 5–8 celled, 28– 37 × (53–) 72–87 (–116) µm; wall verrucose, 2–3.5 µm thick, 8–20 µm thick at apex, one germ pore in each cell, pedicel persistent, 8–16 µm thick above, 18–30 µm thick below, up to 133 µm long..

Material examined: On Rosa webbiana Wall. (Rosaceae), with III stages, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM15. A. Ishaq. (LAH Herbarium No. 1207).

Comments: It is a new record for Pakistan.

Figure 28: Morphology of Phragmidium rosae-pimpinellifoliae (AM15) A. Infected host plant Rosa webbiana B–C. Microphotographs of teliospores D. Lucida drawings of teliospores showing verrucose surface ornamentation. Scale bar A= 1cm, B= 11 μm, C= 17 μm, D= 15 μm.

Figure 29: Scanning Electron Microphotographs of Phragmidium rosae- pimpinellifoliae (AM15). Teliospores showing verrucose surface ornamentation

Phragmidium shogranense Petr., Sydowia 8(1-6): 162 (1954)

(Figure 30–31)

Spermogonia and aecia not found. Telia black, hypophyllous, scattered, powdery. Teliospores oblong to cylindrical, dark brown, 3–5 celled, 22–31 × 43–81 µm; wall smooth, 3–4.5 µm thick, 4–9 µm thick at apex, one germ pore in each cell, pedicel persistent, bulbous from the base, 9–15 µm thick, up to 90 µm long.

Material examined: On Rubus fruticosus Roth (Rosaceae), with II+III stages, Pakistan, Khyber Pakhtunkhwa (KP), Abbottabad District , Thandiani, at 2750 m a. s. l., November‟8, 2014, A. Ishaq, T-18 (LAHAM20018)

Comment: This is the first molecular evidence of Ph. shogranense

Figure 30: Morphology of Phragmidium shogranense (T-18) A. Infected host plant Rubus fruticosus B. Sori under stereomicroscope C. Microphotographs of teliospores. . Scale bar A= 2 cm, B= 1 cm, C–D= 12 μm.

Figure 31: Lucida drawing of teliospores of Phragmidium shogranense (AM15). Scale bar= 6 μm.

Phylogenetic Analysis of genus Phragmidium Link:

In present investigation, out of three (03) Phragmidium spp. collected, 28S region of nrDNA of two (02) species was successfully amplified and four (04) sequences were generated. This included three (03) sequences of Ph. pakistanica and one (01) of Ph. shogranense.

Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from the GenBank. The evolutionary history was inferred by using the Maximum Likelihood method. The analysis involved thirty two (32) nucleotide sequences in group and two (02) out group sequences. There were a total of 451 positions in the final dataset. In this analysis, two (02) clades were constructed i.e Clade I and Clade II. Clade I consist of further two (02) subclades. Studied taxa fall in clade II.

Herpobasidium filicinum (Rostr.) Lind. has been selected as an out group based on previously published data (Figure 31).

Figure 32: Molecular phylogenetic tree of genus Phragmidium by Maximum Likelihood method. Analysis is based on LSU sequences of genus Phragmidium. Numbers on branches represent bootstrap values.

Pileolaria pistaciae (DC.) Castagne, Observ. Uréd. 1: 22 (1842)

(Figure 33-35)

Leaves were found to have small orange-red to black, angular spots. On microscopic analysis, spermogonia, aecia and uredinia not found. Telia amphigenous, dark brown to black, erumpent, irregular to rounded. Teliospores 1-celled, borne singly on pedicels, globose to broadly ellipsoid, reticulately verrucose, 29–34 x 23–32 µm; wall chocolate brown in color, 5–7 µm thick; pedicel hyaline, up to 110 µm long

Material examined: On Pistacia chinensis. (Anacardaceae), with III stages, Pakistan, KhyberPakhtunkhwa, Abbottabad District, Thandiani, at 2750 m a.s.l October, 2014, T-17. A. Ishaq (PURN11945; LAHAM100052).

Comments: This is the first report of genus Pileolaria & Pistachio rust for Pakistan.

Figure 33: Morphology of Pileolaria pistaceae (T17-AM8) A. Infected host plant Pistacia chinensis. B. Rounded to irregular sori C–D. Teliospores showing verrucose surface ornamentation and long hyaline pedicel (Arrow showing small apical opening). Scale bar A= 2 cm, B= 1 cm, C–D= 12 μm.

Figure 34: Scanning Electron Microphotographs of Pileolaria pistaciae showing verrucose surface ornamentation of teliospores

Figure 35: Lucida drawings of Pileolaria pistaciae, showing verrucose surface ornamentation of teliospores. Scale bar= 8μm.

Phylogenetic analysis of genus Pileolaria Castagne

In the present phylogenetic analysis one (01) sequence of LSU-nrDNA region was produced from rust fungi attacking Pistacia sp. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from GenBank. It was observed during analysis that there is scarcity of sequence data of Pileolaria sp. in GenBank. The analysis involved 9 nucleotide sequences making two (02) clades. In Clade I four (04) sequences clustered together in two (02) sister clads belonging to genus Pileolaria while Clade II clustered remaining five (05) sequence of Uromycladium which is the genus belonging to same family (Pileolariaceae).

The percentage of trees in which the associated taxa clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions containing gaps and missing data were eliminated.

Figure 36: Molecular phylogenetic analysis of Pileolaria pistaciae by Maximum Likelihood method. Analysis is based on sequence of LSU, showing the position of Pileolaria pistaciae. Numbers on branches represent bootstrap values.

Puccinia brachypodii var. brachypodii G.H. Otth, Mitt. naturf. Ges. Bern 469-496: 81 (1861) (Figure 37–38)

Spermogonia, aecia and telia not found. Uredinia adaxial, brown, elongated. Urediniospores globose to subglobose, brown, 18–23 × 22–26 µm, wall 1.5–2.5 µm thick at sides, echinulate, germ pores up to 2, mostly obscure; paraphyses capitate, hyaline, 40–51 µm long , cap up to 20 µm wide.

Material examined: On Poa annua Steud. (Poaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Abbottabad District, Thandiani, at 2750 m a. s. l., November, 2014, A. N. Khalid, T-20 (LAHAM20019).

Comments: Poa annua is a new host record for this rust fungus in Pakistan.

77 (a)

A C D

E F G

Figure 37: Morphology of Puccinia brachypodii (T-20) A–B: Infected host plant, Poa annua. C–D: Capitate paraphyses E–G: Urediniospores. Scale bar A= 2.5 cm, B= 3 mm, C–D= 5 μm, E–F= 5.7 μm, G= 8.5 μm.

Figure 38: Scanning Electron Microphotographs of Puccinia brachypodii var. brachypodii (T-20). Scanning Electron Microphotographs (SEM) of urediniospores attacking Poa annua.

Puccinia calcitrapae DC., in Lamarck & de Candolle, Fl. franç., Edn 3 (Paris) 2: 221 (1805) (Figure 39)

Spermogonia, aecia and telia not found. Uredinia hypophyllus, naked, brown. Urediniospores globose to subglobose, brown, 22–32 × 30–39 (–46) µm; wall light in color, up to 3µm thick, echinulate, germ pores 2, near equator.

Material examined: On Carduus L. (Asteraceae), with II stage, Pakistan, Khyber PakhtunKhwa, Upper Dir District, Sheringal, 1820 m a. s. l., August, 2014, SL-1, A. Ishaq (LAHAM20903).

Comments: It is first report of any rust fungus from Upper Dir, KP, Pakistan.

B C D

E F

Figure 39: Morphology of Puccinia calcitrapae (SL-1) A. Infected host plant, Carduus B–D. Microphotographs of urediniospores E–F. Scanning Electron Microphotographs of urediniospores showing echinulate surface ornamentation. Scale bar A= 1 cm, B & C= 8 μm, D= 12 μm.

Puccinia carthami Corda, Icon. fung. (Prague) 4: 15 (1840) (Figure 40–41)

Spermogonia and aecia not found. Uredinia amphigenous, scattered, brown. Urediniospores globose to broadly obovoid, 23–29 × 26–32 μm; wall 1.5–2 μm thick, echinulate, germ pore up to 4. Telia black, amphigenous. Teliospores, ellipsoid, dark brown, (23–) 27–36 × (31–) 36–46 μm, wall chocolate brown, 3–5 μm thick, verrucose; apex 4–7 μm thick; pedicel hyaline, 4–7 μm thick, up to 100 μm long.

Material examined: On Centaurea iberica Trev. (Asteraceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Swat District, Kalam, at 2000 m a. s. l., August, 2013. K3, A. Ishaq (LAHAM20020); with III stage, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM12. A. Ishaq (LAHAM20021).

Comments: It is a new record for Deosai Plains.

A C D

E F G

Figure 40: Morphology of Puccinia carthami (K3 & AM12) A–B. Infected host plant, Centaurea sp. showing sorus C–D. Microphotographs of urediniospores. E–G. Teliospores. Scale bar for A= 2 cm, B= 0.3 mm, C& D= 7 μm, E= 11 μm, F & G= 8 μm.

Figure 41: Scanning Electron Microphotographs of Puccinia carthami (AM12) A-B. Scanning Electron Microphotographs of teliospores showing verrucose surface ornamentation.

Puccinia c.f prenanthis var. himalensis Barclay, Scientific Mem. by Med. Officers of Army of India 6: 65 (1891) (Figure 42)

Spermogonia, aecia and telia not found. Uredinia amphigenous, small, irregular, brown. Urediniospores globose to subglobose, hyaline to light brown, 17–25 × 24–30 µm; wall 1.2–2.0 µm, echinulate; germ pores covered by flat papillae.

Material examined: On Lactuca L. (Asteraceae), with II stage, Paskistan, Azad Jammu & Kashmir, Bagh District, 1,676 m a.s.l., July, 2015, BG41-AM55, A. Ishaq (LAHAM20022)

Comments: It is first time described using molecular marker. Sequence produced during this study will be an addition to GenBank. Bagh is a new locality for this rust fungus in Pakistan.

A B

C D

Figure 42: Morphology of Puccinia c.f prenanthis var. himalensis (BG41-AM55) A–B. Infected host plant, Lactuca C–D. Microphotographs of urediniospores E. Lucida drawing of urediniospores. Scale bar for A= 2 cm, B= 1 cm, C= 9 μm, D= 6 μm, F= 5.5 μm.

Puccinia c.f phaeopoda Syd., Annls mycol. 29(3/4): 155 (1931)

(Figure 43–44)

Spermogonia and aecia not found. Uredinia amphigenous, small, elongated. Urediniospores globose to subglobose, light brown, 20–25 × 22.5–30 µm; wall 1–2 (– 5) µm thick, echinulate; germpores 1–2, equatorial or tending to be equatorial. Telia amhigenous, exposed, dark brown sori, linnear, naked. Teliospores 2–celled, light brown; mostly diorchidoid, (14–)20–25 × 21–37 µm; wall 1.2–2.5 µm (–5.4) µm thick, seems reticulate or rugose; pedicel hyaline 5–6 µm, up to 40 µm long.

Material examined: On Microstegium ciliatum A.Camus (Poaceae), with II + III stages, Pakistan, Khyber PakhtunKhwa (KP), Abbottabad District, Thandiani, at 2,700 m a. s. l., September, 2014. AM7-T4. A. Ishaq. (LAHAM20023).

Comments: It seems new record for Pakistan.

A B

C D E

F G

Figure 43: Morphology of Puccinia c.f phaeopoda (AM7-T4) A. Infected host plant, Microstegium ciliatum B Urediniospores showing echinulate surface ornamentation C. 1-celled teliospore D-G. 2-celled teliospores. Scale bar for A= 1cm, B & C= 8 μm, D= 7.5 μm, E & F= 10 μm, G= 9 μm.

Figure 44: Lucida drawings of Puccinia c.f phaeopoda (AM7-T4) A. Urediniospores showing echinulate surface ornamentation B. teliospores. Scale bar for A= 8 μm, B= 6.5 μm.

Puccinia cnici H. Mart., Prodr. Fl. Mosq., Edn 2: 227 (1817) (Figure 45)

Spermogonia, aecia and telia not found. Uredinia hypophyllus, naked, brown. Urediniospores globose to subglobose, pale brown, 22–26 × 25–30 µm; wall light in color, 1.5–2.5 µm thick, echinulate, germ pores obscure.

Material examined: On Cnicus sp. (Asteraceae), with II stage, Pakistan, Khyber PakhtunKhwa, Swat District, Miandam, 1800 m a. s. l., August, 2012, MM55, A. Ishaq (LAHAM20024).

Comments: It is a new record for Pakistan.

Figure 45: Morphology of Puccinia cnici (MM55) A. Infected host plant, Cnicus sp. B–C. Urediniospores. Scale bar for A= 1cm, B= 7 μm, C= 9.5 μm.

Puccinia coronata var. avenae W.P. Fraser & Ledingham, Sci. Agric. 13: 315 (1933) (Figure 46)

Spermogonia and aecia not found. Uredinia abaxial, brown, linear. Urediniospores globose to subglobose, hyaline, few, 18–21 × 22–27 um; wall echinulate, up to 3.5 um thick; germ pores obscure. Telia abaxial, dark brown, scattered, elongated. Teliospores broadly clavate, hyaline to golden, brown at apex, 17–23(–41) × 30–53 um thick apically excluding digitations, 2–6 digits, pedicel fragile.

Material Examined: On Digitaria sp. (Poaceae) with II + III stages, Pakistan, Khyber Pakhtunkhwa (KP), Shangla District, 2nd September, 2012, A. Ishaq, S5 (LAHAM20025)

Comments: Digitaria sp. is found as a new host for P. coronata var. avenae from Pakistan.

C A

D E

Figure 46: Morphology of Puccinia coronata var. avenae (S5) A−B. Infected host plant, Digitaria sp. C. Scanning Electron Microphotographs of a urediniospore showing echinulate surface ornamentation D–E. Teliospores with digitation. Scale bar for A & B= 1cm, C= 2 μm, D= 5 μm, E= 6 μm.

Puccinia deosaiensis Khalid & S.H. Iqbal, Can. J. Bot. 75(5): 864 (1997

(Figure 47)

Spermogonia and aecia not found. Uredinia hypophyllus, dark brown. Urediniospores globose to subglobose, brown, 19–25 × 21–26 µm; wall hyaline, 2– 2.5 µm thick, densely verrucose; 1 germpore in each spore, equatorial. Telia hypophyllous, black. Teliospore brown, fusiform, 19–26 × 35–42 µm; wall verrucose, 2–3 µm thick, 3–3.5 µm thick apically, pedicel persistent, up to 50 µm long.

Material examined: On Epipactis sp. (Orchidaceae), with II + III stage, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM17. A. Ishaq. (LAH Herbarium No. 1209).

Comments: It is second report of P. deosaiensis on Epipactis sp. from Deosai plains.

Figure 47: Morphology of Puccinia deosaiensis (AM17) A–B. Infected host plant, Epipectis sp. C & F. Urediniospore D–E, G. Teliospores showing verrucose ornamentation. Scale Bar for A= 1.4 cm, B= 1.3 cm, C= 6 μm, D= 10.4 μm, E= 14 μm, F= 14 μm, G= 11μm.

Puccinia graminis Pers., Neues Mag. Bot. 1: 119 (1794) (Figure 48–49)

Spermogonia, uredinia and telia not found. Aecia abaxial, brown, cupulate, in circle forming small groups. Aeciospores globose to more or less oblong, verrucose, hyaline, 16–20 × 17–22 μm; wall 1–1.5 μm thick; up to 2 equatorial germ pores. Peridial cells hyaline, angular to rectangular, 20–29 × 27–32 μm, wall verrucose, 2.5– 6.5 μm thick.

Material Examined: On leaves of Berberis sp. (Berberidaceae), with I stage, Pakistan, Khyber Pakhtunkhwa, Swat District, Shawar, at 1650 m a. s. l., August, 2015. SV1-AM91. A. N. Khalid (LAHAM20026).

Comments: This is first report of aecial stage of this pathogen from Swat District. This is the first time reported using molecular tools from Pakistan.

A C

D E

Figure 47: Morphology of Puccinia graminis (SV1-AM91) A–B. Infected host plant Berberis sp. C. Sori having cupulate aecia D. Peridial cells E. Aeciospore. Scale Bar for A= 1cm, B= 0.5 cm, C= 1 mm, D= 12 μm, E= 5μm.

Figure 49: Lucida drawings of Puccinia graminis (SV1-AM91) A. Peridial cells E. Aeciospore. Scale Bar for A= 9μm, B= 3μm.

Puccinia heraclei Grev., Scott. crypt. fl. (Edinburgh) 1: pl. 42 (1823)

(Figure 50)

Spermogonia and aecia not found. Uredinia amphigenous, scattered, minute. Urediniospores globose to subglobose, hyaline to light brown, (21–) 24–33 × (24–) 31–34 (–39) µm; wall hyaline, (2.1–) 2.8–4 (–4.4) µm thick, echinulate; germpores 1– 2, tending to be equatorial. Telia small, scattered, pulverulent. Teliospores 1–2 celled, 1–celled spores globose to subglobose, hyaline, 23–30 × 27–36 µm; wall 2.8–4.2 µm thick, 3–5 (–7) µm thick at apex, pedicel up to 12 µm long. 2–celled spores ovate, hyaline to light brown, 23–28× 32–44 (–47) µm; wall 3–5 µm thick, reticulate, 3–5 µm thick at apex, pedicel broken mostly, up to 7 µm long.

Material examined: On Heracleum sp. (Apiaceae), with II + III stages, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM9. A. Ishaq. (LAH Herbarium No. 1204).

Comments: It is a new record for Pakistan.

Figure 50: Morphology of Puccinia heraclei (AM9) A–C. Infected host plant, Heracleum sp. D–F. Urediniospores. E, G–H. 1-2 celled teliospores. Scale Bar for A= 1 cm, B= 2.5 cm, C= 2 cm, D= 12.5 μm, E= 11 μm, F=19 μm, G=15.5 μm, H= 14 μm.

100

Puccinia iridis Wallr., in Rabenhorst, Deutschl. Krypt.-Fl. (Leipzig) 1: 23 (1844) (Figure 51)

Spermogonia, aecia and telia not found. Uredinia amphigenous, in groups, rounded or elongated, minute, reddish brown. Urediniospores globose to ovoid, brown,19–24 × 26–31 µm; wall 2–3 µm thick, echinulate; 2–4germ pores, near equator.

Material examined: On Iris sp. (Iridaceae), with II stages, Pakistan, Khyber PakhtunKhwa, District Tor Garh, Kala Dhaka, at 2438 m a.s.l., October, 2014, KD23- AM41, A. Ishaq (LAHAM20027).

Comments: It is a new record for Province Khyber Pakhtunkhwa as well as it is first time studied phylognetically in Pakistan.

101

C D E

Figure 51: Morphology of Puccinia iridis (KD23-AM41) A. Infected host plant, Iris sp. B–E. Microphotographs of urediniospores showing echinulate surface ornamentation. Scale Bar for A= 1cm, B= 4μm, C= 5.5μm, D–E= 7μm.

102

Puccinia menthae Pers., Syn. meth. fung. (Göttingen) 1: 227 (1801)

(Figure 52–53)

Spermogonia and aecia not found. Uredinia light brown, abaxial, naked, irregular, scatterd. Urediniospores hyaline, subglobose to obovate, 16–22 × (18–)22– 30 µm; wall echinulate, 1.5–2.5 µm thick, germ pores up to 3, near equator. Telia brown to black. Teliospores subglobose to obovate, rounded at both ends, with a hyaline papilla, slightly constricted at septum, 21–25 × 24–30 µm; wall 11.5–2 µm thick, verruculose; pedicel short, mostly broken.

Material examined: On Mentha sp. ((Lamiaceae), with II + III stages, Pakistan, Khyber PakhtunKhwa, Chitral District, Kalash valley, at 1,128 m a. s. l., 24th August, 2014. KL-2. A. Ishaq. (LAHAM20028)

Additional material examined: On Mentha sp. (Lamiaceae), with II stage, Pakistan, KhyberPakhtunkhwa, Battagram District, at 1,038 m a.s.l., October, 2014, A. Ishaq, B4-AM6 (LAHAM20029); Battagram District, at 1,038 m a.s.l., October, 2014, A. Ishaq, B4-AM6 (LAHAM20030); Swat District, at Miandam, at 1800 m a. s. l., August, 2012, A. Ishaq, MM-4 (LAHAM20031); On Nepeta L. (Lamiaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Battagram District District, at 1,038 m a.s.l., October, 2014, A. Ishaq, B3-AM17 (LAHAM20032); Mansehra District, at 2,600 m a.s.l., October, 2014, A. Ishaq, NB2-AM70 (LAHAM20033); On Origanum. (Lamiaceae), with II stage, Pakistan, Azad Jammu & Kashmir, Bagh District, 1,676 m a.s.l., July, 2015, BG17-AM51, A. Ishaq (LAHAM20034); Khyber PakhutunKhwa, Tor Ghar District, Kala Dhaka, at 2438 m a. s. l., October, 2014, A. N. Khalid, KD40- AM78 (LAHAM20035);

Comment:

It is first time reported from Battagram District and Tor Ghar District of Province Khyber Pakhtunkhwa and Bagh District of Azad Jummu and Kashmir. Moreover it is first time described phylogenetically from Pakistan.

103

A B D

E F F G

Figure 52: Morphology of Puccinia menthae (T-19) A. Infected host plant, Nepeta (B3-AM17) B–C. Infected host plant Mentha (B4-AM6) D–E. Urediniospores F–G. Teliospores. Scale bar A & B= 1cm, C= 1mm, D= 7 μm, E= 14.5 μm, F= 8.5 μm, G= 10 μm.

104

Figure 53: Scanning Electron Microphotographs of Puccinia menthae Pers. (KL-2) A. Urediniospore B. Teliospore.

105

Puccinia nakanishikii Dietel, Bot. Jb. 34: 585 (1905) (Figure 54)

Spermogonia and aecia not found. Uredinia amphigenous, cinnamon-brown, small, elongated. Urediniospores globose to subglobose, light brown to dark brown, 19–31 × 25–36 µm; wall 1.5–2.5 µm thick, echinulate; germpores 4, equatorial or tending to be equatorial. Paraphyses yellowish to golden, capitate or clavate-capitate, up to 18µm thick apically, up to 65 µm long pedicel. Telia amhigenous, dark brown sori, elongated. Teliospores golden brown to chest-nut brown, (17–)24–31 × 38–47 µm; wall up to 2.5 µm thick, smooth, up to 6 µm thick apically; pedicel hyaline 8–10 µm thick, up to 70 µm long.

Material examined: On Sorghum sp. (Poaceae), with II + III stages, Pakistan, Khyber PakhtunKhwa (KP), Torgarh District, Kala Dhaka, at 2438 m a.s.l., October, 2014, KD15, A. N. Khalid (LAHAM20036).

Comments: It is a new record for District Tor Garh.

106

A B

C D E

F G H

Figure 54: Morphology of Puccinia nakanishikii (KD15) A. Infected host plant, Sorghum sp. B. Paraphyses C–E. Microphotographs of urediniospores F–H. Microphotographs of teliospores. Scale bar A= 1cm, B= 10 μm, C & D= 6 μm, E= 7 μm, F= 10 μm, G & H= 7 μm.

107

Puccinia nepalensis Barclay & Dietel, in Dietel, Hedwigia 29: 265 (1890)

(Figure 55–56)

Spermogonia and aecia not found. Uredinia brown, abaxial, naked. Urediniospores golden, globose to subglobose, 17–24 × 21–29 µm; wall 1.5–2.8 µm thick, germ pores up to 2, near to equator. Telia dark brown, abaxial, scattered, minute, naked. Teliospores ellipsoid, rounded at both ends, reddish brown, 21–24 × 20–26 µm; wall 1.5–2 µm thick, smooth; pedicel hyaline, short.

Material examined: On Rumex nepalensis Spreng (Polygonaceae)., with II+III stages, Pakistan, Khyber Pakhtunkhwa (KP), Swat District, Kalam at 2,000 m a. s. l., September, 2013, K22, A. Ishaq (LAHAM20037).

Additional material examined: On R. nepalensis, with II+III stages, Pakistan, Khyber Pakhtunkhwa (KP), Swat District, Miandam at1,800 m a. s. l., September, 2013, MM9, A. Ishaq (LAHAM20038)

Comment: Here it will help in up-gradation of previous description of taxon.

108

A C D

E F G

Figure 55: Morphology of Puccinia nepalensis (K-22) A–B. Infected host plant, Rumex nepalensis C–D Urediniospores showing echinulate surface ornamentation E– G teliospore with hyaline apical papillae. Scale bar A= 1.5 cm, B= 1cm, C= 6.5 μm, D= 7 μm, E–G= 3.5 μm.

109

Figure 56: Scanning Electron Microphotographs of Puccinia nepalensis (K-22) A– B. Urediniospores showing echinulate surface ornamentation.

110

Puccinia polygoni-alpini Cruchet & Mayor, in Cruchet, Bull. Herb. Boissier, 2 sér. 8: 245 (1908) (Figure 57)

Spermogonia, aecia and uredinia not found. Telia dark brown, abaxial, scattered. Teliospores 1–2 celled, 1-celled spores globose to subglobose, brown, 17– 20 × 19–24 µm; wall darker in color, 2.5–3.7 µm thick, verrucose, pedicel fragile. 2– celled spores dark brown, 17–24 × 20–30 µm; wall minutely verrucose, 2–3 µm thick, 2–4 µm thick at apex, one germ pore in each cell, pedicel broken.

Material examined: On Polygonum sp. (Polygonaceae), with III stages, Pakistan, Northern Areas, Deosai Plains, at 4,114 m a. s. l., September, 2011. AM14. A. Ishaq. (LAH Herbarium No. 1206).

Comments: It is a new record for Pakistan.

111

Figure 57: Morphology of Puccinia polygoni-alpini (AM14) A–B. Infected host plant, Polygonum sp. C. SEM photographs of teliospores showing verrucose surface ornamentation D. Lucida drawings of Teliospores. Scale bar A & B= 1cm, D= 5.5 μm.

112

Puccinia polygoni-amphibii Pers., Syn. meth. fung. (Göttingen) 1: 227 (1801) (Figure 58)

Spermogonia, aecia and telia not found. Uredinia amphigenous, brown, naked. Urediniospores globose to subglobose, hyaline to light brown, 18–23 × 20–24.5 µm; wall verrucose, 1.6–2.5 µm thick, germ pores 2, equatorial or tending to be equatorial.

Material Examined: On Polygonum sp. (Polygonaceae), with II stage, Pakistan, Khyber Pakhtunkhwa (KP), Kalam, at 2,000 m a. s. l., September, 2013. K-1. A. Ishaq (LAH Herbarium No. AM1254).

Comments: In present study, it is re-described and its description is up-graded.

113

A B

Figure 58: Morphology of Puccinia polygoni-amphibii (K-1) A. Infected host plant, Polygonum plebeium B–D. Microphotographs of urediniospores E. Scanning Electron Microphotographs of urediniospores. Scale bar A= 0.6 cm, B–D= 5 μm.

114

Puccinia poarum Nielsen, Bot. Tidsskr. 3(2): 34 (1877) (Figure 59)

Spermogonia and aecia not found. Uredinia adaxial, brown, scattered. Urediniospores globose to subglobose, hyaline to golden brown, 16–23 × 17–24 µm; wall echinulated, 1.5–2.5 µm thick, germ pores obscure. Telia abaxial, dark brown, scattered. Teliospores 1–2 celled. 1–celled teliospores clavate, light brown, 18–21 × 27–30 µm; wall 1.8–2.1 µm thick, apex 2.4–3.3 µm thick, pedicel broken. 2–celled teliospores broadly ellipsoid, upper cell light brown, lower cell golden brown, 21–25 × 35–40 (–48) µm; wall 1.6–2.4 µm thick, 2.6–4.2 µm thick apically; pedicel fragile, mostly broken, up to 7 µm long.

Material Examined: On Agrostis sp. (Poaceae) with II + III stages, Pakistan, Khyber Pakhtunkhwa, Swat District, Ushu valley, 4th September, 2014, A. Ishaq, U–7, (LAHAM20039).

Comments: It is a new record for Swat District.

115

A C

D E

Figure 59: Morphology of Puccinia poarum (U-7) A. Infected host plant, Agrostis sp. B–C. Urediniospores D–E. Teliospores. Scale bar A= 1 cm, B= 5 μm, C= 6.5 μm, D= 9 μm, E= 6 μm.

116

Puccinia polliniicola Syd., Annls mycol. 29(3/4): 156 (1931) (Figure 60)

Spermogonia, aecia and telia not found. Uredinia dark brown, abaxial scattered. Urediniospores light brown to dark brown; 15–21 × 23–29 µm; wall darker in color, 1.5–2.5 µm thick, echinulate, germ pores 2, equatorial; pedicel hyaline, up to 30 µm long.

Material Examined: On Microstegium nudum A. Camus (Poaceae), with III stage, Pakistan, Khyber Pakhtunkhwa, District Tor Garh, Kala Dhaka, at 2438 m a.s.l., October, 2014, KD9-AM10, A. Ishaq (LAHAM20040).

Additional material examined: On M. nudum, with III stage, Pakistan, Khyber Pakhtunkhwa, Battagram District, at 1038 m a. s. l., October, 2014, B7-AM4, A. Ishaq (LAHAM20041).

Comment: P. polliniicola is a new record for Pakistan and M. nudum is a new host for this pathogen in Pakistan.

117

A C D

Figure 60: Morphology of Puccinia polliniicola (B7-AM4) A–C. Infected host plant, Microstegium nudum D–E. Microphotographs of urediniospores. Scale bar A & B= 1 cm, C= 1 mm, D= 6 μm, E= 10 μm.

118

Puccinia shikotsuensis S. Ito, Trans. Sapporo nat. Hist. Soc. 17: 168 (1943)

(Figure 61)

Spermogonia and aecia not found. Uredinia hypophyllous, small, rounded, 0.2–0.8 mm. Urediniospores globose, light brown, 20–29 × 27–35 µm; wall 2.8–3 (– 5) µm, echinulate; germpores 1–2, apical to subapical. Telia amhigenous, exposed, dark brown sori, scattered, naked. Teliospores 2–celled, uppercell darker brown, lower cell golden brown; broadly ellipsoid, slightly oblique at apex, 20–27 × (28-)31– 39(–44) µm; wall 3–4.2 µm (–5.4) µm thick, verrucose; 3.5–7 µm thick at apex, pedicel mostly broken; hyaline up to 17 µm long; wall 2.6–3.5 µm thick.

Material examined: On Polygonum sp. (Polygonaceae), with II + III stages, Pakistan, Northern Areas, Deosai Plains, at 4,114 m a. s. l., September, 2011. AM4. A. Ishaq. (LAH Herbarium No. 1201).

Comments: It is a new record for Pakistan.

119

D E

Figure 61: Morphology of Puccinia shikotsuensis (AM4) A-B. Infected host plant, Polygonum sp. C. Scanning Electron Microphotographs of Urediniospore showing echinulate surface ornamentation and verrucosely ornamentated teliospore D. Lucida drawing of urediniospores E. Teliospores. . Scale bar A= 1 cm, B= 2 cm, D= 10 μm, E= 6 μm.

120

Puccinia sorghi Schwein., Trans. Am. phil. Soc., New Series 4(2): 295 (1832) [1834] (Figure 62)

Spermogonia and aecia not found. Uredinia amphigenous, brown, scattered. Urediniospores globose, subglobose to ellipsoidal, pale brown, 21–28 × 29–44 µm; wall 1.5–2.5 µm thick, finely echinulate, germ pores seems 2, supra-equatorial. Telia mostly hypophyllous, black, long, covered by epidermis. Teliospore oblong, ellipsoidal or clavate, chestnut brown, 17–22 × 30–43 µm; wall smooth, up to 4 µm thick, 3–6 µm thick apically, pedicel hyaline, up to 80 µm long.

Material examined: On Zea mays L. (Poaceae), with II + III stage, Pakistan, Khyber Pakhtunkhwa, Swat District, Miandam, at 1800 m a. s. l., August, 2013. MM- 11. A. Ishaq. (LAHAM20042).

Additional material examined: On Z. mays, with II + III stage, Pakistan, Khyber Pakhtunkhwa, Chitral District, Kalash valley, at 1,128 m a. s. l., 24th August, 2014. KL9. A. Ishaq. (LAHAM20904).

Comments: It is first time reported from Kalash Valley.

121

A C D

E F

Figure 62: Morphology of Puccinia sorghi (MM-11). A–B. Infected host plant, Zea mays L. C–D. Urediniospores, red arrow showing germ pore E–F. Teliospores. Scale bar A= 1 cm, B= 1 mm, C–E = 7.5 μm, F= 9 μm.

122

Puccinia tanaceti DC., in Lamarck & de Candolle, Fl. franç., Edn 3 (Paris) 2: 222 (1805) (Figure 63)

Spermogonia and aecia not found. Uredinia brown and scattered. Urediniospores globose to subglobose, golden brown, 18–21 × 22–26 µm; wall hyaline, 2–2.8 µm thick, verrucose; germ pores up to 3, equatorial. Telia blackish brown. Teliospore golden brown to brown, 19–26 × 35–41µm; wall verrucose, 2.4– 3.3 µm thick, 3–5 µm thick apically, pedicel mostly broken, up to 25 µm long.

Material examined: On Artemisia sp. (Asteraceae), with II + III stages, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM16. A. Ishaq. (LAHAM20043).

Comment: It is a new report of P. tanaceti from Deosai plains, Northern areas of Pakistan.

123

A C D

E F

Figure 63: Morphology of Puccinia tanaceti (AM16) A–B. Infected host plant, Artemisia sp. C–D. Microphotographs of urediniospores E–F. Scanning electron Microscopy (SEM) of teliospores showing verrucose surface ornamentation. Scale bar A & B= 1 cm, C= 4.5 μm, D= 9 μm.

124

Puccinia hieracii sensu auct. NZ; fide NZfungi (2008)

SYNONYM: Puccinia taraxaci Plowr., Monograph Brit. Ured.: 186 (1889)

(Figure 64–65)

Spermogonia, aecia and telia not found. Uredinia amphigenous, small, irregular, brown. Urediniospores globose to subglobose, hyaline to light brown, 15–25 × 17–27 µm; wall 1.2–2.5 µm, echinulate, germ pores 2, near equator.

Material examined: On Taraxacum officinale Linn. (Asteraceae), with II stage, Pakistan, Khyber PakhtunKhwa, Swat District, Kalam, at 2,001 m a. s. l., August, 2012. K-2. A. Ishaq. (LAHAM20345).

Additional material examined: On T. officinale Linn. (Asteraceae), with II stage, Pakistan, Khyber PakhtunKhwa, Chitral District, Kalash valley, at 1,128 m a. s. l., 24th August, 2014. KL-1. A. Ishaq. (LAHAM20044); Swat District, Mankial Top, at 3816 m a. s. l., August, 2013. ML-3. A. Ishaq. (LAHAM20045).

Comments: It is new record for Chitral District.

125

A C

Figure 64: Morphology of Puccinia taraxaci (K-2). A–B Infected leaves of Taraxacum officinale C–D Urediniospores showing echinulate surface ornamentation. Scale bar A & B= 1 cm, C= 4 μm, D = 5 μm.

126

Figure 65: Scanning Electron Microphotographs of Puccinia taraxaci (KL-1). A–B Urediniospores showing echinulate surface ornamentation.

127

Puccinia tricholepidis Syd., Annls mycol. 36(5/6): 438 (1938)

(Figure 66)

Spermogonia, aecia and uredinia not found. Telia hypophyllous, blackish brown. Teliospores clavate, golden brown to dark brown, 22–29 × 30–40 μm, apex 3–6 μm thick; wall chocolate brown, 3–5.5 μm thick, slightly verrucose; pedicel hyaline, deciduous, up to 15 μm long.

Material examined: On Tricholepis sp. (Asteraceae), with III stage, Pakistan, Northern Areas, Deosai Plain, at 4,114 m a. s. l., September, 2011. AM8. A. Ishaq. (LAHAM20046).

Comments: It is a new record for Deosai plains.

128

Figure 66: Morphology of Puccinia tricholepidis (AM8) A–B. Infected host plant, Tricholepis sp. C–D. Microphotographs of Teliospores. E. Lucida drawings of Teliospre. F-G. SEM photograph of teliospores. Scale Bar for A= 0.75 cm, B= 0.8 cm, C= 12.3 μm, D= 9.2 μm, E= 14 μm

129

Puccinia ustalis Berk., Hooker's J. Bot. Kew Gard. Misc. 6: 207 (1854)

(Figure 67)

Spermogonia, aecia and uredinia not found. Telia blackish brown, abaxial, naked, clustered together in large compact groups. Teliospores hyaline to subhyaline, oblong, linear to clavate or cylinderic, 15–20 × 43–57 µm; wall smooth, 1–1.5 µm thick, apex brown in color, up to 6 µm thick; pedicel hyaline, very short.

Material examined: On Aquilegia L. (Ranunculaceae), with III stage, Pakistan, Khyber Pakhtunkhwa, Swat District, Miandam, 1800 m a. s. l., August, 2013, MM8, A. Ishaq (LAHAM20047).

Comment: Aquilegia sp. is a new host for this rust fungus in Pakistan.

130

A B

C D E

F G H

Figure 67: Morphology of Puccinia ustalis (MM8) A–B. Infected host plant, Aquilegia C–H. Microphotographs of teliospores. Scale bar A= 1 cm, B= 1 mm, C– E= 5.5 μm, F = 10 μm, C & H= 7 μm.

131

Puccinia versicolor Dietel & Holw., in Holway, Bot. Gaz. 24: 28 (1897)

(Figure 68)

Spermogonia, aecia and telia not found. Uredinia abaxial, small, irregular, brown. Urediniospores globose to subglobose, hyaline to light brown, 17–23 × 22–28 µm; wall 1.5–2.5 µm, echinulate, germ pores obscure mostly.

Material examined: On Themeda anathera (Nees ex Steud.) Hack. (Poaceae), with II stage, Pakistan, Khyber PakhtunKhwa, Abbottabad District, Thandiani, at 2750 m a.s.l., November, 2014, T1. A. Ishaq (LAHAM20049).

Comments: It is a new record for Distrcit Abbottabad.

132

B C

A D E

Figure 68: Morphology of Puccinia versicolor (T1) A–B. Infected host plant Themeda anathera C–E. Microphotographs of urediniospores showing echinulate surface ornamentation. Scale bar for A & B= 1 cm, C= 10 μm, D= 11 μm, E= 8 μm.

133

Puccinia violae (Schumach.) DC., in de Candolle & Lamarck, Fl. franç., Edn 3 (Paris) 5/6: 62 (1815) (Figure 69)

Spermogonia, aecia and telia not found. Uredinia abaxial, brown, circinate, naked. Urediniospores globose, subglobose to obovoid or ellipsoid, pale brown to cinnamon brown, 18–23 × 21–26 µm, wall 1.5–2 µm thick, echinulate, germ pores up to 2, supra-equatorial to equatorial.

Material examined: On Viola caespitosa D. Don. (Violaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Swat District, Mankial Top at 3816 m a. s. l., August, 2014, A. Ishaq, MS4 (LAHAM20050).

Comments: It is first time reported from Mankial, KP, Pakistan.

134

A C D

E F

G H

Figure 69: Morphology of Puccinia violae (MS4) A–C. Infected host plant Viola caespitosa with circinate uredinia D–F. Microphotographs of urediniospores G–H. Scanning Electron Microphotographs of urediniospores. Scale bar for A= 1 cm, B & C= 1 mm, D–F= 7 μm.

135

Puccinia wattiana Barclay, J. Asiat. Soc. Bengal, Pt. 2, Nat. Sci. 54: 109

(1890) (Figure 70)

Spermogonia, aecia and uredinia not found. Telia black, amphigenous, naked, rounded and clustered together in circles. Teliospores yellowish brown to brown, ellipsoid to elongated ellipsoid, 20–28 × 34–53 µm; wall smooth, 2–4 µm thick, up to 7 µm thick apically; pedicel hyaline, up to 50 µm long.

Material examined: On Clematis amplexicaulis Edgew. (Ranunculaceae), with III stage, Pakistan, Khyber Pakhtunkhwa, Abbottabad District, Thandiani, at 2750 m a. s. l., November, 2014, A. R. Niazi, T-16 (LAHAM20051).

Additional material examined: On Clematis sp. (Ranunculaceae), with III stage, Pakistan, Azad Jammu & Kashmir, Bagh District, 1,676 m a.s.l., July, 2015, BG–20, A. Ishaq (LAHAM20052); Khyber PakhtunKhwa, Swat District, Miandam, 1800 m a. s. l., August, 2012, MM-47, A. Ishaq (LAHAM20053).

Comment: It is a new record for Abbottabad District of Khyber Pakhtunkhwa and Bagh District of Azad Jammu and Kashmir.

136

B C D

Figure 70: Morphology of Puccinia wattiana (T-16) A–B. Infected host plant, Clematis amplexicaulis B–D. Teliospore. Scale bar for A= 1 cm, B=7.5 μm, C=10 μm, D= 12.5 μm.

137

Phylogenetic Analysis of genus Puccinia Pers.

In present research, twenty seven (27) taxa of Puccinia were collected and identified among which 28S region of nrDNA of eight (08) species were successfully amplified and thirteen (13) sequences were generated. This included five (05) sequences of P. menthae Pers., two (02) of P. polliniicola Syd. and one (01) of P. c.f. phaeopoda Syd., P. graminis Pers., P. iridis Wallr., P. prenanthis var. himalensis Barclay, P. polygoni-amphibii Pers. and P. wattiana Barclay each. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from the GenBank. Tree was constructed using Maximum Likelihood method (ML). The analysis involved thirty five (35) nucleotide. In this analysis, two (02) clades were constructed i.e Clade I and Clade II. Clad I clustered the all sequences attacking the Poaceous hosts including all nine (09) sequences generated during this study. Clad II clustered the taxa attacking host plants belonging to families other than grasses including Asteracea, Lamiaceae, Polygonaceae and Ranunculaceae. Kuehneola uredines (Link) Arthur of Phragmidiaceae was selected as an out group (Figure 71).

138

Figure 71: Molecular Phylogenetic analysis of genus Puccinia based on LSU sequences by Maximum Likelihood method.

139

Pucciniastrum guttatum (J. Schröt.) Hyl., Jørst. & Nannf., Op. bot. 1: 81

(1953) (Figure72) Spermogonium, aecium and telium not found. Uredinia hypophyllous, small, rounded, brown, scattered. Urediniospores globose to subglobose, light brown to hyaline, 14–18 × 16–23 μm; wall 0.5–1.5 μm thick, echinulate, germ pore obscure.

Material examined: On Galium sp. (Rubiaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Battagram District, at 1,038 m a. s. l., October, 2014. B5-AM2. A. Ishaq. (PUR N11943).

Comments: This is the first report of P. guttatum for Pakistan (Ishaq et al., 2017)

140

Figure 72: Morphology of Pucciniastrum guttatum (B-5-AM2) A. Infected host plant Galium sp. B. Small rounded sori C–D. Urediniospores showing echinulate surface ornamentation. Scale bar for A= 1 cm, B=11 μm, C=5.7 μm.

141

Phylogenetic Analysis of Pucciniastrum G.H. Otth:

During this study, LSU region of one species of Pucciniastrum was successfully amplified and generated. From fungal genomic DNA fragments approximately 840bp, in BLAST search on the NCBI database our sequence shows the maximum similarity (99%) with other published Thekopsora guttata sequences from NewZeland (KJ16345) which is now named as P. guttatum with 100% query cover and 0.0 E value. The evolutionary history was inferred by using the Maximum Likelihood method based on the Jukes-Cantor model. There were a total of 483 positions in the final dataset.

Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from Genbank. Analysis involved thirty four (34) nucleotide sequences including thirty two (32) in group and two (02) out group sequences. Out of these thirty two (32) in group sequences, two clades i.e., Clade I and clade II were constructed. Studied taxon falls in clad II making subclad with T. minima (Arthur) P. Syd. & Syd. with 84% bootstrap value. Naohidemyces vaccinii (Jørst.) S. Sato, Katsuya & Y. Hirats. has been selected as an out group based on previously published data (Figure 73).

142

Figure 73: Molecular phylogenetic analysis of Pucciniastrum guttatum by Maximum Likelihood method based on sequence of LSU, showing the position of Pucciniastrum guttatum. Numbers on branches represent bootstrap values.

143

Sphaerophragmium sp. (Figure 74–75)

Spermogonium, aecium and telium not found. Uredinia hypophyllous, minute, brown, scattered. Urediniospores ellipsode, light brown to hyaline, 8–11 × 16–23 μm; wall 1–1.8 μm thick, minutely echinulate, germ pore 2, supra-equatorial. Peripheral paraphysis

Material examined: On Dalbergia sissoo Roxb. (Fabaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Abbottabad District, at 1,038 m a. s. l., October, 2014. T22- AM 21, A. Ishaq (LAHAM20054).

Comment: This is the first molecular evidence of a rust on D. sissoo from Pakistan. More exploration for telial stage and more sequences are required for authentic identification at species level.

144

Figure 74: Morphology of Sphaerophragmium sp. A-B. Infected leaf of Dalbergia sissoo C-F. Microphotographs of Urediniospores and paraphysis. Scale bar for A= 1.6 cm, B= 1 mm, C=3.3 μm, D= 10 μm, E=4 μm, F= 6.5 μm.

145

Figure 75: Scanning Electron Microphotographs of urediniospores infecting Sphaerophragmium sp.

146

Phylogenetic Analysis of genus Sphaerophragmium Magnus:

During this study, one sequence of LSU region of one species belonging to genus Sphaerophragmium Magnus collected from Thandiani forests of Abbottabad District was successfully generated.

From fungal genomic DNA fragments in BLAST search on the NCBI database our sequence shows the maximum similarity (93%) with published Sphaerophragmium sp. sequence reported from Australia (KJ862350) with 100% query cover. The evolutionary history was inferred by using the Maximum Likelihood method. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from Genbank and dataset of Aime (2006) was followed. Analysis involved forty four (44) nucleotide sequences belonging to almost all reported genera of rust fungi to determine the correct genus of pathogen. Studied taxon falls in clade Spheropphragmium sp. with other only deposited sequence of this genus (KJ862350) with 96% bootstrap value indicating dire need of more collections for more authentic identification of taxon up to species level (Figure 76).

147

Figure 76: Molecular phylogenetic analysis of Sphaerophragmium sp. based on LSU sequences of by Maximum Liklihood Method (AM21 is the studied taxon).

148

Tranzschelia discolor (Fuckel) Tranzschel & M.A. Litv., J. Bot., Paris 24(3): 248 (1939) (Figure 77–79)

Spermogonia, aecia and telia not found. Uredinia on lower surface of leaves, on yellowish or brownish angular spots, scattered. Urediniospores pale brown, obovoid to oval or elongated oval, 16–18 × (19–)25–30 µm, wall 1.7–2.3 µm thick at sides, echinulate, apex acute, (3.3–)6.6–8.6 µm, germ pores 3–4, equatorial; paraphyses present, pale to yellowish brown, capitate, thick-walled at apex, thinner below.

Material examined: On Prunus persica Stokes (Rosaceae), with II stage, Pakistan, Azad Jammu and Kashmir (AJK), Bagh District, at 1,676 m a.s.l., July, 2015, BG–2, BG–23. A. Ishaq (LAHAM20055).

Comments: Tranzschelia discolor is first time characterised phylogenetically from Pakistan. It is a new record for Azad Jammu and Kashmir (AJK).

149

Figure 77: Morphology of Tranzschelia discolor A–B. Infected host plant Prunus persica C–F. Urediniospores showing echinulate ornamentation G–H. Capitate paraphyses. Scale bar for A= 1cm, B= 1mm, C= 11 μm, D=8 μm, E= 7 μm, F & H=6 μm, G= 3.5 μm.

150

Figure 78: Scanning Electron Microphotographs of Tranzschelia discolor (BG-23). Urediniospores showing echinulate ornamentation.

151

Figure 79: Lucida drawings of Tranzschelia discolor A. Urediniospores showing echinulate ornamentation B. Capitate paraphyses. Scale bar for A= 6 μm, B=3.4 μm.

152

Phylogenetic Analysis of genus Tranzschelia Arthur:

During this study, two sequences of LSU region of one species belonging to genus Tranzschelia collected from Bagh District of Azad Jammu and Kashmir were successfully generated.

From fungal genomic DNA fragments in BLAST search on the NCBI database our sequence shows the maximum similarity (100%) with other published T. discolor sequence reported from Oman (DQ995341) and with unpublished T. pruni- spinosae (Pers.) Dietel (DQ363329) with 100% query cover. The evolutionary history was inferred by using the Maximum Likelihood method. Alignment has 453 distinct alignment patters. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from Genbank. Analysis involved twenty three (23) nucleotide sequences including twenty two (22) in group and one (01) out group sequences. Out of these twenty three (23) in group sequences three clades i.e., Clade Pucciniaceae, clade Uropyxidaceae and clade Phakopsoraceae were constructed. Studied taxon falls in clade Uropyxidaceae aligned with other sequences of T. discolor with 100% bootstrap value. Eucronartium muscicola (Pers.) Fitzp has been selected as an out group based on previously published data (Figure 80).

153

Figure 80: Molecular phylogenetic analysis of Tranzschelia discolors by Maximum Likelihood method. Analysis is based on sequence of LSU. Numbers on branches represent bootstrap values.

154

Uredo otostegiae S. Ahmad, Biologia, Lahore 2(1): 92 (1956) (Figure 81)

Spermogonia, aecia and telia not found. Uredinia amphigenous, small, dark brown, scattered, covered by epidermis. Urediniospores globose, golden brown, 21– 28 × 28–32 µm, wall 1.5−2.5 µm thick, echinulate, germ pores up to 2, near equator.

Material examined: On Otostegia limbata (Benth.) Boiss. (Lamiaceae), with II stage, Pakistan, KhyberPakhtunkhwa, Abbottabad District, Thandiani, at 2750 m a.s.l., November, 2014, T-12. A. Ishaq (LAHAM20056).

Comments: It is a new record for Abbottabad District.

155

A C

D E

Figure 81: Morphology of Uredo otostegiae (T-12) A-B: Infected leaves of Otostegia E limbata D–E: Urediniospores. Scale bar for A= 1.3 cm, B= 0.4 mm, C= 7.5 μm, D=7 μm, E= 6 μm.

156

Uromyces ambiens Cooke, Grevillea 3: 75 (1874) (Figure 82–83)

Aecia and Uredinia not found. Spermogonia subepidermal, group 1, type 1, golden brown to hyaline, 175 × 137 µm. Telia abaxial, raised, developing as circular black boundaries around central yellow spots, scattered, naked, chestnut brown, 2–3 ×4–5 mm. Teliospores dimorphic: ovate teliospores yellow, elongated, 1-celled, 29– 40 × 48–60(–79) µm, walls smooth, yellow; globose to subglobose teliospores brown, 29–47 × 39–48 µm, walls smooth and dark brown, 2.8–5 µm thick at sides, up to 3.5 μm thick apically, germ pore one, subapical to apical; pedicel hyaline, 6.5– 9 × 160–205(–285) µm.

Material examined: On Buxus wallichiana Baill. (Buxaceae), with 0, III stages, Pakistan, Khyber Pakhtunkhwa (KP), Shangla District Yukhtange, at 2200 m a.s.l., 2nd September, 2013, A.N. Khalid AM-S1 (LAH AM20914); 4th November 2013, Sadiqullah RS 36A (LAH 20913A); 1st January, 2014, Sadiqullah RS 36B (LAH 20913B).

Comments: It is a new record for Pakistan.

157

Figure 82: Morphology of Uromyces ambiens A–B: Leaves of Buxus wallichiana showing raised spermogonial and telial sori. C. Inflorescence of Buxus wallichiana. D. Telial sori under stereomicroscope. E. Longitudinal section of spermogonium. F– H. Dimorphic teliospores. Scale bar = 10 μm.

158

Figure 83: Uromyces ambiens Lucida drawings of dimorphic teliospores showing long pedicels. Scale bar = 14 μm.

159

Uromyces capitatus Syd. & P. Syd., Öst. bot. Z. 52(5): 182 (1902)

(Figure 84–85)

Spermogonia and aecia not found. Uredinia orangish brown, amphigenous. Urediniospores globoase to subglobose, light brown, golden to hyaline, 19–24 × 21– 26 µm; wall echinulate, 1.8–2.6 µm thick; up to 2 germ pores, equatorial or tending to be equatorial. Telia black, amphigenous, naked. Teliospores dark brown with blackish brown thick walls, rounded, one-celled, 21–26 × (14–) 16–23 µm; wall densely verrucose, 1–3(–4) µm thick, up to 4 µm thick apically; pedicel hyaline, 4.5–6.3 µm thick, up to 35 µm long.

Material examined: Desmodium elegans DC. (Fabaceae), with II+ III stages, Pakistan, Khyber Pakhtunkhwa (KP), Distrcict Swat, Kalam, at 2,000 m a. s. l., September, 2013. K-6. A. Ishaq. (LAHAM20056);

Material examined: D. elegans, with II+ III stages, Pakistan, Khyber Pakhtunkhwa (KP), Abbottabad District, Thandiani, at 2750 m a. s. l., November, 2014, A. R. Niazi, T-20 (LAHAM20057)

Comment: This is the first report of U. capitatus from Abbottabad District.

160

Figure 84: Morphology of Uromyces capitatus (T-20) A–B. Infected host plant, Desmodium elegans C. Urediniospores D. Teliospore. Scale bar for A= 1.5 cm, B= 0.6 cm, C= 19 μm, D=6 μm.

161

Figure 85: Scanning Electron Microphotographs of Uromyces capitatus A. Urediniospores showing echinulate surface ornamentation B. Teliospores with reticulate surface ornamentation.

162

Uromyces dactylidis G.H. Otth, Mitt. naturf. Ges. Bern 469-496: 85 (1861)

(Figure 86)

Spermogonia, aecia and telia not found. Uredinia adaxial, brown, irregular. Urediniospores globose to subglobose, hyaline, 16–20 × 18–22 µm; wall echinulated, 1–1.5 µm thick, germ pores up to 2, equatorial or tending to be equatorial.

Material Examined: On Poa pratensis L. (Poaceae) with II stage, Pakistan, Khyber Pakhtunkhwa (KP), Ushu valley, 4th September, 2012. U–4 (LAHAM20058).

Comment: It is a new record for Pakistan from Ushu Valley.

163

B C

A D

Figure 86: Morphology of Uromyces dactylidis (U4). A. Infected host plant, Poa pratensis B–C. Microphotographs of urediniospores D. Lucida drawings of urediniospores. Scale bar for A= 1 cm, B &C=5 μm, D=3.6 μm.

164

Uromyces heliotropii Sred., in Issatschenko, Parasit. Pilze de Gour. Clerson: 229 (1896) (Figure 87–88)

Spermogonia and aecia not found. Uredinia amphigenous, small, elongated, Urediniospores globose to subglobose, light brown,19–24 × 22–31 µm; wall 1.5–2.5 µm thick, echinulate; germpores 1–2, near equator. Telia amhigenous, exposed, dark brown. Teliospores light brown; 20–24 × 23–26 µm; wall up to 2.5 µm thick, smooth; pedicel hyaline, mostly broken, up to 40 µm long.

Material examined: On Heliotropium supinum L. (Boraginaceae), with II + III stages, Pakistan, Gilgit-Baltistan, District Hunza, at 2200 m a. s. l., September, 2011. AM11. A. Ishaq. (LAHAM20059).

Comments: It is second report of this fungus from Gilgit, Pakistan.

165

A C

D E F

Figure 87: Morphology of Uromyces heliotropii (AM11) A−B. Infected host plant Heliotropium supinum C. Urediniospores D−F. Teliospores. Scale bar for A= 1 cm, B= 0.6 cm, C & D= 5.5 μm, E=3.5 μm, F=6 μm.

166

Figure 88: Scanning Electron Microphotographs of Uromyces heliotropii (AM11) A−B. Urediniospores showing echinulate surface ornamentation.

167

Uromyces lespedezae-sericeae S. Ahmad, Biologia, Lahore 2: 86 (1956)

(Figure 89)

Spermogonia, aecia and uredinia not found. Telia black, amphigenous, naked. Teliospores light brown with golden apex, one-celled, 21–22 × 23–26 µm; wall 1.5– 2.3 µm thick, 4-7 µm thick apically; pedicel hyaline, 5.5–7.5 µm thick, up to 35 µm long.

Material Examined: On Lespedeza Michx. (Papilionaceae), with III stage, Pakistan, Khyber Pakhtunkhwa, Hazara University at 2,000 m a. s. l., September, 2014. H1-AM20. A. Ishaq. (LAHAM20060).

Material Examined: On Lespedeza Michx. (Papilionaceae), with III stage, Pakistan, Khyber Pakhtunkhwa, Tor Ghar District, Kala Dhaka, at 2438 m a. s. l., November, 2014, A. R. Niazi, KD17-AM38 (LAHAM20061).

Comment: It is a new record for both Mansehra District and Torghar District.

168

A C D

Figure 89: Morphology of Uromyces lespedezae-sericeae (H1-AM20) A–B. Infected host plant, Lespesdiza sp., C–D. Teliospores E. Lucida drawings of Teliospores. Scale bar for A= 1 cm, B= 1mm, C= 7 μm, D=9.5 μm, E=6 μm.

169

Uromyces polygoni-avicularis (Pers.) G.H. Otth, Mitt. naturf. Ges. Bern 531-552: 87 (1864) [1863] (Figure 90–91)

Spermogonia and aecia not found. Uredinia abaxial, brown, scattered, pulverulent. Urediniospores globose to subglobose, golden light brown, 17–22 × 22– 28 µm; wall echinulate with blunt ends or verruculose, 1.8–2.8 µm thick, germ pores up to 2 equatorial or tending to be equatorial, pedicel hyaline up to 12 µm long. Telia amphigenous, small, roundish, scattered, 1–2 mm. Teliospores single celled, ovoid, brown, 19–24 × 23–29 μm, apex rounded up to 9 μm thick; wall dark brown to chocolate brown, smooth, 2.6–4 μm thick ; pedicel hyaline, 6–11 μm wide, up to 59 μm long.

Material Examined: On Polygonum aviculare L. (Polygonaceae), with II stage, Pakistan, Khyber Pakhtunkhwa (KP), Kalam, at 2,000 m a. s. l., September, 2013. AM97-K5. A. Ishaq. (LAHAM20062).

Material Examined: On P. plebeium R.Br. (Polygonaceae), with III stage, Pakistan, Northern Areas, Deosai Plains, at 4,114 m a. s. l., September, 2011. AM7. A. N. Khalid (LAHAM20063).

Comment: It is a new record for Deosai plains and P. plebeium is a new host for this rust fungus.

170

B C

D A

Figure 90: Morphology of Uromyces polygoni-avicularis (AM97-K5) A. Infected host plant, Polygonum aviculare B–C. Microphotographs of urediniospores D–E. Scanning Electron Microphotographs of urediniospores showing echinulate surface ornamentation. Scale bar for A= 1 cm, B= 1mm, C= 7 μm, D=9.5 μm, E=6 μm.

171

B C

A D E

Figure 91: Morphology of Uromyces polygoni-avicularis (AM7) A–C. Infected host plant, Polygonum plebejum D–E. Teliospores F. Lucida drawings of Teliospores. Scale bar for A= 1 cm, B= 1mm, C= 7 μm, D=9.5 μm, E=6 μm.

172

Uromyces setariae–italicae Yoshino, Bot. Mag., Tokyo 20: 247 (1906)

(Figure 92)

Spermogonia, aecia & telia not found. Uredinia amphigenous, brown. Urediniospores globose to sub globose, 23–31 × 28–34 μm; wall 1.5–2 μm thick, echinulate; germ pores 3, equatorial.

Material examined: On Setaria sp. (Poaceae), with II stage, Pakistan, Khyber Pakhtunkhwa, Torghar District, Kala Daka, at 2438 m a. s. l., November, 2014, A. N. Khalid, KD19-AM82 (LAHAM20064).

Comment: It is a new record for Province Khyber Pakhtunkhwa (KP).

173

A C

Figure 92: Morphology of Uromyces setariae–italicae (KD19-AM82) A. Infected host plant, Setaria sp. B–C. Urediniospores D. Lucida drawings of urediniospores. Scale bar for A= 1.5 cm, B= 5 μm, C= 7.5 μm, D=6 μm.

174

Phylogenetic Analysis of genus Uromyces (Link) Unger:

In present research, out of seven (07) Uromyces spp. collected, 28S region of nrDNA of three (03) species were successfully amplified and five (05) sequences were generated. These included three (03) sequences of U. lespedezae-sericeae S. Ahmad and one (01) of U. polygoni-avicularis (Pers.) G.H. Otth and U. setariae- italicae Yoshino each. Sampling of taxa for phylogenetic analysis was based on retrieving closely related sequences from the GenBank. Tree was constructed using Maximum Likelihood method (ML). The analysis involved twenty five (25) nucleotide. In this analysis, two (02) clades were constructed i.e Clade I and Clade II. Clade I clustered all the sequences attacking the fabaceous hosts including all three sequences generated during this study of U. lespedezae-sericeae. Clade II clustered the taxa attacking host plants belonging to families other than legumes including U. polygon-avicularis and U. setariae-italicae (Figure 93).

175

Figure 93: Molecular Phylogenetic analysis Uromyces (Link) based on LSU sequences of by Maximum Likelihood method.

176

Bauhinus tenuisporus (Cif.) Denchev & R.T. Moore, in Denchev, Moore &

Shin, Mycol. Balcanica 3(1): 74 (2006) (Figure 94)

Sori in flowers, systemic infection with black powdery mass. Spores globose, subglobose or broadly ellipsoidal, 8–11 × 10–13 μm, wall up to 1.5 μm thick; reticulate.

Material examined: On Persicaria maculosa Gray (Polygonaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , at 1100 m a. s. l., October, 2014. AM84. A. N. Khalid (LAHAM20065).

Comments: It is previously undescribed from Shangla District .

177

Figure 94: Morphology of Bauhinus tenuisporus (AM84) A–B. Infected host plant Persicaria maculosa C. Spores. Scale bar A−B= 1cm, C= 7.5μm.

178

Microbotryum nepalense (Liro) Vánky, Mycotaxon 67: 47 (1998)

(Figure 95)

Sori in ovaries and stalk of inflorescence, covered by off white to brown peridium. Spores brown, globose to subglobose, 9–14 × 10–14 μm; wall up to 1.2 μm thick, reticulate Peridial cells hyaline to subhyaline, globose to subglobose, 4–8 × 5– 13 μm.

Material Examined: On Persicaria nepalensis (Meisn.) H. Gross (Polygonaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 1100 m a.s.l, October 2014, A. N. Khalid, AM85 (LAHAM20066).

Comments: It is first time described phylogenetically.

179

Figure 95: Morphology of Microbotryum nepalense (AM85) A. Infected host plant Persicaria nepalensis B–C. Microphotographs of teliospores D–E. Scanning Electron Microphotographs of teliospores. Scale bar A= 1cm, B= 4μm, C= 6μm.

180

Phylogenetic analysis of genus Microbotryum Lév.

To study the evolutionary relationship of Microbotryum nepalense (Liro) Vánky within genus a phylogenetic tree was constructed of LSU region of nrDNA using the Maximum Likelihood method. All the available data of Microbotryum was extracted from GenBank and only eleven (11) sequences of seven (07) species were found available. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved eighteen (12) nucleotide sequences including three (03) outgroup sequences. All positions containing gaps and missing data were eliminated. There were a total of 706 positions in the final dataset. Query sequence was found making a separate branch within in-group sequences (Figure 96).

181

Figure 96. Molecular Phylogenetic analysis of LSU region of nrDNA of Microbotryum nepalensis by Maximum Likelihood method.

182

Sporisorium cruentum (J.G. Kühn) Vánky, Symb. bot. upsal. 24(no. 2): 115

(1985) (Figure 97)

Sori in all florets of stunted panicle, covered by a delicate peridium, dark brown powdery spore mass, intermixed with sterile cells and columella. Columella composed of host tissues diffuse by hyphae producing spores and sterile cells. Mature spores single or in loose groups. Spores globose to ovoid, 6–9 × 7–10 µm, olivaceous brown, sparsely verruculose to echinulate. Sterile cells 8-14 µm long, hyaline or pale yellow, smooth.

Material examined: On Sorghum bicolor (L.) Moench (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , at 1300 m a. s. l., October, 2014, AM105. A. N. Khalid (LAHAM20067).

Comments: It is first time identified phylogenetically from Pakistan.

183

Figure 97: Morphology of Sporisorium cruentum (AM105) A. Infected host plant Sorghum bicolor B–C. Microphotographs of Spores D–E. Scanning Electron Microphotographs of spores with sparsely verrucose to echinulate surface ornamentation. Scale bar A= 1cm, B= 28μm, C= 3.4μm.

184

Sporisorium moniliferum (Ellis & Everh.) L. Guo, Mycosystema 3: 82 (1990) (Figure 98)

Sori in ovaries, usually all ovaries are infected in a plant, cylindrical, 3–4 mm long, mostely hidden by enveloping leaf sheath. Spore balls of variable shape and size, up to 80 um long, dark brown. Spores light brown to dark olivaceous brown, globose, subglobose or irregular 9–11 × 10–13 µm, wall up to 1 µm, densely echinulate. Sterile cells abundant, mostly in irregular groups, in chains or spreading singly among the spores, equal to or smaller than the spores, hyaline, smooth.

Material examined: On Heteropogon contortus (L.) P.Beauv. ex Roem. & Schult. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , at 1100 m a. s. l., August, 2015. AM104. A. N. Khalid. (LAHAM20068).

Comments: It is first time described phylogenetically from Pakistan. It is undescribed from Shangla District previously.

185

D E

Figure 98: Morphology of Sporisorium moniliferum (AM104) A. Infected host plant Heteropogon contortus B–C. Microphotograph of teliospores D. Lucida drawing of infected host plant (arrow showing sori). E. Lucida drawing of teliospores. Scale bar A & D= 1cm, B= 7.5 μm, C= 5μm, E= 4 μm.

186

Sporisorium pulverulentum (Cooke & Massee) Vánky, Symb. bot. upsal.

24(no. 2): 120 (1985) (Figure 99)

Sori in spikelets of inflorescence, sometimes hidden by the floral envelopes. Spore mass blackish-brown, powdery. Spores globose to subglobose or obovoid, brown, 9–12 × 11–14 µm; wall 0.8–1.2 µm thick, densely echinulate. Sterile cells not seen.

Material Examined On Dichanthium sp. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 2750 m a.s.l, September, 2015, A. N. Khalid, AM58 (LAHAM20069).

Comments: It is a new record for Pakistan and Dichanthium sp. seems new host for this fungus.

187

Figure 99: Morphology of Sporisorium pulverulentum (AM58) A. Infected host plant Dichanthium sp. B–D. Teleospores. Scale bar for A= 1 cm, B & E= 4 μm, C= 6μm.

188

Sporisorium reilianum (J.G. Kühn) Langdon & Full., Mycotaxon 6(3): 452 (1978) (Figure 100–101)

Sori infected whole inflorescence, cylindrical, first covered by an orangish white to grayish brown peridium, which ruptures irregularly to expose the blakish brown, spore balls together with long threads of the host spikelets. Spore balls irregular in size and shape and composed of loosely connected spores. Spores brown, globose to ovoid or slightly irregular, 9–12 × 10–13 µm, wall up to 1 µm thick, finely and densely echinulate, sterile cells 9–14 µm long, mostly in irregular compact groups.

Material Examined: On Sorghum halepense (L.) Pers. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 1600 m a.s.l, September, 2014, A.N. Khalid, AM101 (LAHAM20070).

Comments: It is a new record for Shangla District.

189

Figure 100: Morphology of Sporisorium reilianum (AM101) A–C. Infected host plant Sorghum halepense D. Spores showing echinulate surface ornamentation in LM. Scale bar for A–C= 1 cm, D= 5.5 μm.

190

Figure 101: Morphology of Sporisorium reilianum (AM101) A–D. Scanning Electron Microphotographs of teliospores E. Lucida drawings of Spores showing echinulate surface ornamentation. Scale bar for E=4.5 µm.

191

Phylogenetic analysis of genus Sporisorium Ehrenb. ex Link

To study the evolutionary relationship within genus Sporisorium a combined phylogenetic tree was constructed of both ITS and LSU region of nrDNA using the Maximum Likelihood method. Dataset of Stoll et al. (2005) is used to construct the tree. There were a total of 529 positions in the final dataset. The analysis involved 30 nucleotide sequences. The analysis involved thirty (30) nucleotide sequences. Two (02) clades were constructed i.e Clade I and Clade II. Clade I consist of further two (02) subclades. There were a total of 451 positions in the final dataset (Figure 101).

192

Figure 102: Molecular Phylogenetic analysis of ITS and LSU region of nrDNA by Maximum Likelihood method of Genus Sporisorium.

193

Urocystis narcissi (Gonz. Frag.) Vánky, Mycotaxon 48: 41 (1993)

(Figure 103–104)

Sori in leaves and scales, yellowish-silver or yellowish-brown or black pustules containing black powdery mass. Spore balls globose to subglobose or ellipsoid, 25–44 × 31–54 µm, composed of 1–3(–4) spores, completely surrounded by sterile cells. Spores globose to subglobose, ovate or ellipsoidal, 12–21× 13–24 µm, dark brown, wall smooth, sterile cells variable in shape and size, subglobose to elongated, 4–14 µm long, wall 0.6–1.5 µm, yellowish brown to hyaline, smooth.

Material Examined: On Narcissus tazetta L. (Amaryllidaceae), Pakistan, Khyber Pakhtunkhwa, Swat District , 1000 m a.s.l, February 2015, A. N. Khalid, no S-10 (HUP: 315).

Additional material examined: On N. tazetta, Pakistan, Khyber Pakhtunkhwa, Shangla District , 1100 m a.s.l., March 2015, A. N. Khalid, S-11 (HUP: 316).

Comments: Urocystis narcissi, reported here from Pakistan is a new record for Asia.

194

A C

Figure 103: Morphology of Urocystis narcissi (S-10) A–B. infected host plant Narcissus tazetta C–D Spore balls Scale bars: A & B = 51µm; C & D=10 µm; E=11µm; F=8µm

195

Figure 104: Scanning Electron Microphotographs of Urocystis narcissi (S-10).

196

Phylogenetic analysis of genus Urocystis Rabenh.

To study the evolutionary relationship of Urocystis narcissi (Gonz. Frag.) Vánky within genus a combined phylogenetic tree was constructed of both ITS and LSU region of nrDNA using the Maximum Likelihood method. All the available data of Urocystis was extracted from GenBank and only nine (09) sequences of four (04) species were found available. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved twelve (12) nucleotide sequences including two (02) out-group sequences. All positions containing gaps and missing data were eliminated. There were a total of 514 positions in the final dataset. Query sequence was found making a separate branch within in-group sequences (Figure 105).

197

Figure 105: Molecular Phylogenetic analysis of Urocystis based on LSU sequences of by Maximum Likelihood method.

198

Ustilago idonea Syd., Annls mycol. 37(4/5): 442 (1939) (Figure 106)

Sori in spikelets of inflorescence. Spore mass blackish-brown, powdery. Spores globose to subglobose, brown, 7–9 × 7–11 µm; wall 0.8–1.2 µm thick, moderately echinulate-verrucose. Sterile cells not seen.

Material Examined On Elucine sp. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Swat District , 3000 m a.s.l, September, 2015, S. Hussain, ST-2 (LAHAM20071).

Comments: It is a new report for Swat District .

199

Figure 106: Morphology of Ustilago idonea (SH-1). Scanning Electron Microphotographs of teliospores showing echinulated-verrucose surface ornamentation. Scale bar for A= 1 cm, B= 4.5 μm, C= 8μm, E= 3.8μm.

200

Ustilago maydis (DC.) Corda, Icon. fung. (Prague) 5: 3 (1842)

(Figure 107–108)

Sori in stem, leaves or whole inflorescence, as irregular galls, first covered by a grayish smooth membrane. Spores olive-brown, globose to subglobose or ovoid, sometimes slightly irregular, 8–12 × 7–13 µm, wall up to 0.8 µm thick, finely echinulate.

Material Examined: On Zea mays L. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 1300 m a.s.l, August, 2014, Sadiqullah, AM86 (LAHAM20072).

Additional material examined: On Zea mays, Pakistan, Khyber Pakhtunkhwa, Chitral District , Kalash valley, at 1,128 m a. s. l., 24th August, 2014. KL-10. A. Ishaq. (LAHAM20073).

Comments: It is a new record for Chitral District and Shangla. It is first time phylogenetically described from Pakistan using molecular markers.

201

Figure 107: Morphology of Ustilago maydis (AM86 & KL-10) A–C. Infected host plant Zea mays D. Spores with echinulate surface ornamentation. Scale bar for A–C= 1 cm, D= 8μm.

202

Figure 108: Scanning Electron Microphotographs of teliospores of Ustilago maydis.

203

Ustilago nunavutica Savchenko, Carris, Castl., V.P. Heluta, Wasser & Nevo,

Persoonia 33: 179 (2014) (Figure 109)

Sori in inflorescence and stem as short streaks, infection systemic, dark brown to smoky black, powdery, Spores globose, subglobose or ovoid, rarely elongated, 5– 10 × 6–13 µm, olivaceous-brown, echinulate to verruculose or warty, wall 0.5–0.8 µm thick.

Material Examined: On Dactylis glomerata L. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 1250 m a.s.l, September, 2015, A. N. Khalid, AM87 (LAHAM20074).

Additional material examined: On Digitaria violascens Link (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 1250 m a.s.l, August, 2014, A. N. Khalid, AM107 (LAHAM20075).

Comments: It is a new report for Pakistan. Moreover Dactylis glomerata and

Digitaria violascens are new host record for this fungus.

204

Figure 109: Morphology of Ustilago nunavutica Savchenko (AM107) A–B. infected host plant Dactylis glomerata C–D. Microphotographs of Spore. E–F. SEM photographs of teliospores. Scale bar for A & B= 1 cm, C= 6μm, D= 4.7μm.

205

Ustilago sp. (Figure 110)

Sori in parts of the inflorescence, black to smoky brown dusty mass of spores, at first infected inflorescence hidden by enveloping leaf sheaths, become visible later on. Spores globose, subglobose, or ovoid, 8–11 × 10–14 µm, light brown to dark chestnut brown, densely echinulate.

Material Examined: On Digitaria sanguinalis (L.) Scop. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Shangla District , 1300 m a.s.l, October, 2014, A. N. Khalid, AM100 (LAHAM20076).

Additional material examined: On Dactylis glomerata L., Pakistan, Khyber Pakhtunkhwa, Shangla District , 1300 m a.s.l, October, 2014, A. N. Khalid, AM88 (LAHAM20077).

Comments: To identify the taxon on species level more study in needed.

206

Figure 110: Morphology of Ustilago sp. (AM88 & AM100) A. Infected host plant Digitaria sanguinalis B–E. Microphotographs of spores F. SEM photograph of spore showing echinulate surface ornamentation G. Lucida drawings of spores. Scale bar for A= 1 cm, B= 3μm, C= 4.8 μm, D= 4μm, E= 7μm, G= 6 μm.

207

Ustilago tritici (Pers.) Rostr., Overs. K. Danske Vidensk. Selsk. Forh. Medlemmers Arbeider: 15, 1890 (Figure 111)

Sori in spikelets, dark brown to smoky black, usually all the floral parts are destroyed and only the naked rachis is left behind. Spores globose, subglobose or ovoid, rarely elongated, 5–10 × 6–13 µm, olivaceous-brown, almost smooth to minutely echinulate, wall 0.5–0.8 µm thick.

Material Examined: On Triticum aestivum L. (Poaceae), Pakistan, Khyber Pakhtunkhwa, Swat District , Miandam, 1800 m a.s.l, August, 2014, A. Ishaq, AM109 (LAHAM20079).

Additional material examined: On T. aestivum, Pakistan, Khyber Pakhtunkhwa, Shangla District , 1250 m a.s.l, September, 2015, A. N. Khalid, AM99 (LAHAM20080).

Comments: It is first time described from Shangla District taxonomically and is first molecular evidence of this fungus from Pakistan.

208

Figure 111: Morphology of Ustilago tritici (AM99) A. Infected host plant Triticum aestivum B–F. Microphotograph of teliospores. Scale bar for A= 1 cm, B= 23μm, C= 5 μm, D= 4μm, E= 7μm, G= 6 μm.

209

Phylogenetic analysis of Ustilago (Pers.) Roussel:

To analyze the evolutionary relationships of Ustilago and for correct identification of studied taxa a combined tree of both ITS/LSU regions of nrDNA is constructed. Accession numbers of all the sequences used in phylogenetic tree are given in Annexure III. The maximum related data is extracted from GenBank. The evolutionary history was inferred by using the Maximum Likelihood method. The analysis involved 36 nucleotide sequences which grouped in two (02) clades. Clade I is substituting further two (02) sub clades. All positions containing gaps and missing data were eliminated. There were a total of 548 positions in the final dataset (Figure 112).

210

Figure 112: Molecular Phylogenetic analysis based on ITS and LSU regions of nrDNA sequences by Maximum Likelihood method of Genus Ustilago.

211

4.2. Biodiversity Analysis:

In present study a total of sixty four (64) taxa were described including fifty two (52) of rusts and twelve (12) smuts from 10 different sampling sites using morphological and molecular methods. To infer the generic diversity among all these studied sites different parameters and indices were used.

4.2.1. Diversity of fungal taxa:

Diversity analysis was performed with respect to sampling site and host plant family. Maximum generic diversity was found in Abbottabad District while minimum in Districts Upper Dir and Chitral (Figure 113). Similarly members of Asteracea were found having maximum diversity of rust fungi comparable to other twenty four (24) families (Figure 114).

4.2.2. Shannon and Simpson Indices:

Diversity of Rust and smut fungi collected from ten (10) deifferent sampling sites of Khyber Pakhtunkhwa and adjacent hilly areas was calculated by using Shannon and Simpson diversity indices. Among rusts highest value of both Simpson and Shannon indices was observed in Abbottabad District (0.88, 2.15 respectively) while lowest value of in Distrcit Battagram and Upper Dir (0.33, 0.49 respectively). It shows the Abbottabad as most diverse while Battagram District and Upper Dir as least diverse sampling site for rust fungi. AS far as smut fungi is concerned diversity of smuts is comparatively very low. Smut fungi are found only in three (03) sampling sites i.e., Chitral, Shangla and Swat. Among these highest value of both Simpson and Shannon indices was observed in Shangla District (1.25, 0.94 respectively). It shows the Abbottabad as most diverse while Battagram District and Upper Dir as least diverse sampling site for rust fungi while Shangla is the richest sampling site for smuts (Table 4 & 5).

4.2.3. Species Richness (S):

Species richness of rust and smut from selected sampling sites was calculated using Margalef‟s and Menhinick's indices (Tables 4 & 5). Maximum species richness

212

was observed in Torghar District (3.26, 1.60 respectively) while Shangla District was found having least species richness (0.58, 0.55 respectively). For smut fungi maximum species richness was found in Shangla (1.14, 2.46 respectively).

213

Table 4: Rust fungi species matrix analysis of using different diversity and species richness indices.

Sr. Sampling Site Simpson Simpson Simpson’s Shannon Shannon’s Menhinick's Margalef No. Index Diversity Reciprocal Index Equitability index diversity (D) Index Index (1/D) (H) (EH) (D) index (d) (1-D) 1 Abbottabad 0.12 0.88 8.33 2.15 0.89 1.18 2.6

2 Bagh 0.37 0.62 2.65 1.12 0.81 0.8 1.4

3 Battagram 0.67 0.33 1.48 0.49 0.71 0.71 1.2

4 Chitral & Upper 0.67 0.33 1.48 0.49 0.71 0.70 1.0 Dir 5 Mansehra 0.20 0.80 5.00 1.36 0.98 0.63 0.8

6 Shangla 0.31 0.69 3.22 1.08 0.99 0.55 0.58

7 Swat 0.44 0.55 2.25 1.15 0.97 1.48 1.48

8 Torghar 0.23 0.76 4.32 1.60 0.89 1.60 3.26

9 Adjacent Northern 0.48 0.51 2.04 1.00 0.72 1.05 2.0 Areas

214

Table 5: Smut fungi species matrix analysis of using different diversity and species richness indices.

2 Bagh 0.00 0.00 0.00 0.00 0.00 0.00 0.00

3 Battagram 0.00 0.00 0.00 0.00 0.00 0.00 0.00

4 Chitral & Upper 1.00 0.00 1.00 0.00 0.00 0.31 0.00 Dir 5 Mansehra 0.00 0.00 0.00 0.00 0.00 0.00 0.00

6 Shangla 0.05 0.94 1.05 1.25 0.78 1.14 2.46

7 Swat 0.35 0.64 2.80 1.03 0.94 0.63 0.8

8 Torghar 0.00 0.00 0.00 0.00 0.00 0.00 0.00

9 Adjacent Northern 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Areas

215

25 Uromyces Uredo 20 Tranzschelia

Sphaerophragmium 15 Pucciniastrum Puccinia

10 Pileolaria No. of taxa taxa of No. Phragmidium 5 Phakopsora Miyagiya Melampsora 0 Macruropyxis Coleosporium Cerotellium Aecidium Sampling Sites

Figure 113: Diversity of rust taxa in all sampling sites.

8 Ustilago 6 Urocystis

4 Sporisorium

No. of taxa reported taxa of No. Microbotryum 2 Bauhinus 0

Sampling sites

Figure 114: Diversity of smut taxa in all sampling sites.

216

12 Uromyces 10

Uredo 8 Tranzschelia Sphaerophragmium 6 Pucciniastrum No. of Taxaof No. 4 Puccinia 2 Pileolaria Phragmidium 0 Phakopsora Miyagiya

Melampsora

Poaceae

Apiaceae

Iridaceae

Oleaceae

Rosaceae

Fabaceae

Buxaceae

Violaceae

Moraceae

Salicaceae

Rubiaceae Lamiaceae

Asteraceae Macruropyxis

Thylelaceae

Eleagnaceae

Orchidaceae

Rhamnaceae

Boraginaceae

Polygonaceae

Papilionaceae

Anacardaceae Caprifoliaceae

Berberidaceae Coleosporium

Euphorbiaceae Ranunculaceae Host Plant Families Cerotellium Aecidium

Figure 115: Diversity of rust taxa on host plant families.

120

100

80 Ustilago

60 Urocystis

%age axa of %age Sporisorium 40 Microbotryum 20

Bauhinus 0 Amaryllidaceae Poaceae Polygonaceae

Host Plant Families

Figure 116: Diversity (%age) of smut taxa on host plant families.

217

Current status 197

KP 180

Pakistan 400

World 8000

0 2000 4000 6000 8000 10000 Number of rust species

Figure 117: Comparative status of rust fungi of sampling sites with world after this research.

Current status 31

KP 28

Pakistan 115

World 1650

0 500 1000 1500 2000 Number of smut species

Figure 118: Comparative status of smust fungi of sampling sites with world after this research.

218

4.3. Dendrogram cluster analysis:

In current study, Dendrogram cluster analysis is performed to see the similarities and dissimilarities of selected sampling sites. Climatic factors including mean annual rainfall, mean annual temperature, humidity and wind velocity are taken under consideration. It this analysis of sampling sites there is formation of two large clades which are entitled as group 1 (Table 6). Abootabad and Battagram are found climatically similar to on another. Similarly there is resemblance between Chitral and Mansejra, Swat and Torghar. While Bagh is found clustering with Shangla and somehow related to Upper Dir also but with prominent dissimilarities. Norther areas (Some parts of Gilgit-Baltistan) are found making a totally separate clade which reflects the geographical and climatic isolation of this part from other sampling sites of Khyber Pakhtunkhwa (Figure 119).

Similarly same analysis is performed between sampling sites and rust and smut taxa studied during this research project (Figure 120). In this dendrogram there is formation of three cluster groups which are further sub divided based on similarities and dissimilarities (Table 7). In dendrogram Abbottabad, Mansehra and Torghar are found having somehow similar diversity of rust and smut fungi. While Bagh, Battagram and Chitral are linked to one another. Diversity of these pathogens in Norther areas is at the quite same level as of Upper Dir. There is great similarity found in Shangla and Swat. Interestinh thing to note is that this diversity dendrogram is somehow not similar to the above described above (Figure 119) which indicates that diversity of rust and smut fungi in more not primarily dependent on climatic factors. Habit of these pathogenic fungi of being host dependent is authenticated the results of these dendrogram cluster analysis.

4.4. Distribution mapping and predictive modeling:

To observe the distribution pattern of rust and smut fungi studied in present research in Khyber pakhtunkhwa and adjacent hilly areas, dot distribution maps are constructed. Map shows the maximum spread of rust fungi in Abbottabad District , Mansehra and Swat with maximum diversity (Figures 121). While maximum distribution of smut fungi was observed in Shangla District (Figures 122).

219

Moreover, to overcome shortcomings of less exploration in this region of Asia in past and uneven distribution of species records, single species are modelled for potential ranges, species richness and distribution of selected taxa. Selection of taxa for predictive modeling is based on economic and ecological importance of host plants for country. In this research sixteen (16) taxa were found new for Pakistan including one (01) taxon new to science. Similarly there are many new host records and new observations from respective localities. Two (02) rust fungi including Pileolaria pistaciae and Uromyces ambiens are selected on the basis of economic and ecological importance of host plants.

Pileolaria pistaciae causative agent of Asian Pistachio rust is first time reported on Pistacia chinensis ssp. Integerrima from two different localities of Pakistan viz. Distrcit Shangla and Thandiani. In Pakistan Pistacia spp. are considered economically very important not only because of their nutritional value but also due to their usage in dye industry, fodder, fuel, furniture and wood carving, ornamental and pharmaceutical industry (Bibi et al., 2015; Sheikh, 1993). So P. pistaciae was selected for this analysis. Analysis was performed using selected climatic variables and habitat of host tree. The predicted area of distribution for this disease indicated by the model covered the dry deciduous forest of Jehlum to coniferous forests of Gilgit- Baltistan (Figure 123).

Uromyces ambiens causative agent of rust on Box wood trees (Buxus wallichiana) is a rare taxon found in forests of Shangla Districts. Box wood tree is economically an important tree because of its wood which is used for making fine wood articles, carving and packing cases and for fuel purpose. Its expected distribution is predicted here (Figure 124).

220

Figure 119: Dendrogram depicting the results of a complete linkage hierarchical clustering of the sampling sites on the basis of climatic factors using Euclidean distance measure.

Figure 120: Dendrogram depicting the results of a complete linkage hierarchical clustering of the sampling sites on the basis of rust and smut fungi diversity using Sorensen distance measure.

221

Table 6: Clustal groups formed in dendrogram of the sampling sites on the basis of climatic factors.

Cluster Group Label Samples Sites 1 5 Mansehra Torghar 2 7 Shangla Swat 3 6 Northern Areas Upper Dir 4 1 Abbottabad Mansehra Torghar 5 3 Battagram Chitral 6 6 Northern Areas Upper Dir Shangla Swat 7 2 Bagh Battagram Chitral 8 1 Abbottabad Mansehra Torghar Bagh Battagram Chitral 9 1 Abbottabad Mansehra Torghar Bagh Battagram Chitral Northern Areas Upper Dir Shangla Swat 10 0 Table 7: Clustal groups formed in dendrogram of the sampling sites on the basis of diversity of rust and smut fungi.

Cluster Group Label Samples Sites 1 4 Chitral Mansehra 2 8 Swat Torghar 3 2 Bagh Shangla 4 1 Abbottabad Battagram 5 4 Chitral Mansehra Swat Torghar 6 2 Bagh Shangla Upper Dir 7 1 Abbottabad Battagram Chitral Mansehra Swat Torghar 8 1 Abbottabad Battagram Chitral Mansehra Swat Torghar Bagh Shangla Upper Dir 9 1 Abbottabad Battagram Chitral Mansehra Swat Torghar Bagh Shangla Upper Dir Northern Areas 10 0

222

Figure 121: A dot map showing the locations where the presence of rust taxa has been documented. 223

Figure 122: A dot map showing the locations where the presence of smut taxa has been documented. 224

Figure 123: Modelled diversity map with potential distributions of Asian Pistachio rust A. Current status B. Predictive distribution.

225

Figure 124: Modelled diversity map with potential distributions of Box wood rust A. Current status B. Predictive distribution.

226

Discussion:

Aecidium Pers. is an anamorphic genus of Pucciniales which is characterized by the presence of cup-shaped sorus with well-developed peridium and verrucose aeciospores. Genus is represented by fourteen (14) taxa in Pakistan (Ahmad et al., 1997; Sultan et al., 2008). During present investigation, two rust fungi were identified. One was found attacking leaves of Elaeagnus umbellata Thunb. from two different sampling sites viz. Bagh District and Torghar District. Morphological characterization revealed that it as an anamorphic taxon Aecidium quintum Syd. & P. Syd. Sequence of 28S region of nrDNA was generated successsfully which did not show more than 97% similarity with any previously deposited sequence in GenBank during initial Blast. Being an anamorphic genus it was found difficult to select sequences for phylogenetic analysis hence dataset of Aime (2006) was used to see the most probable holomorph for the studied taxon. In phylogenetic tree query sequence was found making clade with Melampsoridium betulinum (Pers.) Kleb. (KF031548) having 70% bootstrap value. Aecial stage of M. betulinum is still unknown so it is not possible to compare both taxa morphologically. It seems that holomorph of A. quantum might belong to Melamsporidium Kleb. or its allies. But for authentic confirmation more collections and sequences are required or one must have to wait to find sexual stages of this rust.

Aecidium viburni Henn. & Shirai infecting leaves of Viburnum grandiflorum Wall. ex DC. has been collected from Himalyan moist temperate forests of Khanspur, Abbottabad District . Taxon was characterized here morpho-anatomically. Spermogonial and aecial stages were found. Morphology of sporangium and spore dimensions were taken into account for identification. This pathogen has previously been reported on Viburnum betulifolium Batalin, V. dilatatum Thunb., V. erosum Thunb., V. erubescens var. limitaneum W.W.Sm., V. formosanum P.S.Hsu, V. lobophyllum Graebn., V. opulus L., V. plicatum A.Gray, V. pubinerve Blume ex Miq. and V. sargentii Koehne from China, Japan and Korea (Cao et al., 2000; Cho and Shin, 2004; Kobayashi, 2007). It is first time reported from Pakistan. Moreover, Viburnum L. is a new host record for any rust fungi in Pakistan.

227

Genus Cerotellium belonging to Phakopsoraceae composed of twenty (20) species inhabiting on various host families in warmer regions of world. Genus is characterised by presence of paraphysis along urediniospores and formation of teliospores successively from basal sporogenous cells. During this research project, one species of the genus Cerotellium was collected from four different sampling sites viz. Abbottabad, Battagram, Mansehra and Torgarh on same host plant i.e., Ficus sp. Sample collected from Battagram District (B-5) was identified on the basis of both spore morphology and molecular method. 28S region of nrDNA was successfully amplified and showed 99% similarity with Cerotelium fici (Castagne) Arthur during BLAST. Furthermore in phylogenetic tree, the taxon was found clustering with C. fici (KP753385) collected from Africa. Molecular evidence was further complimented with spore morphology and disease pattern.. Remaining specimens collected from other sampling sites were only morphologically characterized.

Previously the taxon has been reported on Ficus palmata Forssk., F. carica L. and F. religiosa Decne. ex Miq. from Azad Jammu & Kashmir, Changa Manga, Karachi, Lahore, Rawalpindi, Sangla Hill and Tandojam by Ahmad (1956a, b), Hasnain et al. (1959), Ghaffar & Kafi (1968), Khan & Kamal (1968), Kaneko (1993) and Saba et al. (2013). All these reports are based only on morphological bases. No evidence of molecular characterisation has previously been reported from Pakistan. This is the first phylogenetic report of genus Cerotellium from Pakistan.

Coleosporium Lev., a small genus of Coleosporiaceae, is characterized by the presence of subepidermal spermogonia and aecia with conspicuous peridium, catenulate aeciospores, Caeomoa-type bright orange uredinia with echinulate, verrucose or sometimes reticulated urediniospores and sessile 1-celled teliospores. It has many species distributed worldwide, some of which are doubtfully distinct morphologically. Most of species are heteroecious, macrocyclic with spermogonia and aecia on Pinaceae while uredinia and telia mostly occur on Asteraceae (Cummins and Hiratsuka, 2003). In Pakistan, this genus is represented by four (04) species i.e. Coleosporium clematidis Barclay, C. datiscae Tranzschel, C. lycopi Syd. & P. Syd., C. pseudocampanulae S. Kaneko, Kakish. & Y. Ono (Ahmad et al., 1997). In present investigation one taxon, Coleosporium tussilaginis (Pers.) Lév., on Inula sp. has been identified on the basis of disease pattern and spore dimension. Studied taxon was

228

differentiated from other taxa of Coleosporium reported on same host on the basis of spore size. It is a new record for Pakistan. Previously it has been reported on Inula aschersoniana Janka, I. ensifolia L., I. germanica L., I. graveolens (L.) Desf., I. helenium L., I. heterolepis Boiss., I. hirta L., I. methanaea Hausskn., I. parnassica Boiss. & Heldr., I. salicina Pall., Inula sophiae Beauverd, Inula viscosa (L.) Aiton and Tussilago farfara L. from Balearic Islands, Bulgaria, Canary Islands, Greece, Poland, Russia, Turkey and Ukraine (Farr and Rossman, 2017; Tunali et al., 2005).

Macruropyxis Azbukina is a monotypic, microcyclic genus resambling Dipyxis Cummins & J.W. Baxter in significant features. Genus is characterized by presence of 2-celled teliospores having bilaminated walls, 3-4 germ pores in each cell appears as sieve. Previously type species, Macruropyxis fraxini (Kom.) Azbukina, has been reported as Puccinia fraxini Kom. and Uropyxis fraxini (Kom.) Magnus, on Fraxinus sieboldiana Blume (Oleaceae). In present study plants of Jasminum humile were found infected with aecidial stage of an unknown rust fungus. From morphological characterization it seems comparable with aecidial stages of previously reported rusts on same host including Aecidium jasminicola Henn., A. longaense Henn., A. tylophorae Cooke, Chaconia butleri (Syd. & P. Syd.) Mains, Gymnosporangium sp., Hemileia jasmine C.S. Krishnam. & Rangaswami, H. wakefieldii Ritschel, Puccinia abyssinica (Henn.) P. Syd. & Syd., P. chrysopogoni Barclay, P. exhauriens Thüm. P. jasmini DC., P. jasmini-humilis Jørst., P. jasminicola T.S. Ramakr. & K. Ramakr. and P. ugandana Cummins (Farr and Rossman, 2016). The fungus was found having similar infection pattern apparently like rounded sori on abaxial side of leaf with Aecidium jasminicola on Jasminum sp. but it can be separated from A. jasminicola by dimensions of aeciospores. Studied taxon has larger aeciospores (22–26 × 27–33 μm vs 15–18 × 18–24 μm). Here molecular characterization of studied taxon reveals something different. In phylogenetic tree studied taxon made clade with unpublished Macruropyxis sp. (JX036028). But aecia and uredinia of genus are unknown previously, so it is difficult to identify this pathogen at specific level. Therefore present study reveals that the fungus on Jasminum is anamorphic stage of Macruropyxis sp. For identification of pathogen at specific level more sampling and data is required which is not yet available on any database.

229

Melampsoraceae is a monophyletic family of having mainly heteroecious rusts producing aecia, generally on needles of conifers while telia on members of Euphorbiaceae and Salicaceae mainly (Cummins and Hiratsuka, 2003). Melampsora Castagne is proposed as primitive rust by Durrieu (1980) which was supported with 28S sequence data (Maier et al., 2003). Genus is characterized by presence of 1-celled sessile teliospores. No comprehensive monograph of this genus is available to show exact number of species under this genus. From Pakistan ten (10) species of this genus are reported i.e. Melampsora capraearum Thum., M. ciliata Barclay, M. epitea Thüm., M. euphorbiae (Ficinus & C. Schub.) Castagne, M. laricis-populina Kleb., M. lini (Ehrenb.) Thüm., M. populnea (Pers.) P. Karst., M. populina subsp. populina (Jacq.) Lév., M. salicis-albae Kleb. and M. yoshinagae Henn. However all these records are based on morphological characters (Ahmad et al., 1997). Usually morphological characteristics and identification of host is considered as main determinants to identify the Pucciniales, however this approach is not optimal for Melampsora spp. as all species of this genus are morphologically distinct (Cummins and Hiratsuka, 2003). Moreover, identifications based on host plant data also cannot be considered reliable for most of the taxa of this genus, as a single host can be infected by different species of Melampsora spp. while a single Melampsora species can infect several species of host plants on one genus (Toome and Aime, 2015).

In current project, three species belonging to this genus have been identified using both morphological and molecular tools. M. dimorphospora S. Kaneko & Hirats. f. was found infecting leaves of Salix alba, from Ushu valley of Swat District . Taxon was characterized by the presence of dimorphic urediniospores i.e. echinulated, pedicellated urediniospores which are characteristically different from other catenulated, verrucose urediniospores. This feature makes this taxon distinguishable from other taxa reported on same host viz. Melampsora abieti-capraearum Tubeuf, M. allii-salicis-albae Kleb., M. alpina Juel, M. americana Arthur, M. amygdalinae Kleb., M. bigelowii Thüm., M. epitea Thüm., M. farinosa (Pers.) J. Schröt., M. humboldtiana Speg., M. iranica Damadi, M.H. Pei, J.A. Sm. & M. Abbasi, M. laricis- pentandrae Kleb., M. salicina Desm. and M. salicis-albae Kleb. It has previously been found on Salix koriyanag Kimura (Koriyananagai) from Japan (Hiratsuka et al., 1992). It is a new record for Pakistan.

230

Another taxon, M. euphorbiae has been collected from Deosai plain and identified on the basis of disease pattern and spore morphology. This rust fungus has previously been reported on Euphorbia hypericifolia L. from Gilgit, Karachi and Muzaffarabad (Ahmad et al., 1997), on leaves of E. helioscopia L., E. dracunculoides Lam. and E. cornigera Boiss from Charsada, Chillianwala, Faisalabad, Kaghan valley, Lahore, Murree, Nathiagali, Peshawar, Quetta, Swat and Wazirabad (Malik and Khan, 1944; Ahmad, 1956a, b; Malik et al., 1968; Malik and Virk, 1968; Khan and Kamal, 1968; Ahmad and Arshad, 1972). It is a new record for Deosai plains.

During this project two sequences of Genus Melampsora were produced infecting Wikstroemia canescens Meisn. of Thymelaeaceae from two different sampling sites. During BLAST both sequences did not match with any previously sequenced species. However these two sequences bear a distinct status but with 79% bootstrap support. These two sequences form a sister clade with M. ferrinii Toome & Aime. Based on spore morphology and host range the studied taxon was found close to Melampsora yoshinagae Henn. It was originally described by Arthur as Pucciniastrum wikstroemiae Arthur and has since been considered endemic to Hawai„i (Stevens, 1925). The rust was renamed as Uredo wikstroemiae (Arthur) Hirats. f. in Hiratsuka's monograph of the Pucciniastraceae in 1958 because only the uredinial state has been found at that time. The rust had been collected very rarely since the time of its description. Later on, it was found on Wickstroemia oahuensis Rock and W. uva-ursi A. Gray (Gardner, 1994; Gardner and Hodges, 1989). Further studies revealed the presence of prominent capitate paraphyses, apparently not observed previously, that led to the reclassification of the rust fungus as a member of the genus Melampsora. The rust was referred to M. yoshinagae, a species known on other Melampsora hosts in Japan, Taiwan, India, and the Philippines (Gardner, 1988).

In Pakistan, M. yoshinagae is previously reported on Wikstroemia canescens Maxim. from Dunga gali and Kaghan by Ono (1992), Okane et al. (1992) and Kakishima et al. (1993a,b). In present study, the description of the species is updated and now, it is re-described on the same host from new locality i.e. Kumrat Valley (Chitral District), Khyber PakhtunKhwa, Pakistan.

Miyagia Miyabe ex Syd. & P. Syd. is a small genus of Pucciniaceae found attacking mainly members of Asteraceae. It is often confused with Puccinia Pers.

231

because of the presence of almost similar echinulate urediniospores and 2-celled teliospores sometimes. Presences of peridiate uredinia and telia with palisade like paraphyses are the characteristic features separating the both genera from one another (Cummins and Hiratsuka, 2003). In present study, Miyagia pseudosphaeria (Mont.) Jørst. has been collected from two different sampling sites (Abbottabad District and Bagh District) infecting leaves of Sonchus sp. Taxon was characterized on morphological basis. It has previously been reported on Sonchus arvensis L. as Puccinia sonchi from Hazara, Murree, Quetta, Shangla and Upper Topa (Iqbal and Khalid, 1996; Usman et al., 2016a). It is found as a new report for Azad Jammu and Kashmir.

Phakopsora Dietel, is a small genus of Phakosporaceae. This genus is characterized by the presence of one-celled teliospores which are arranged irregularly in telia (Cummins and Hiratsuka, 2003). In present study, uredinial stage of one taxon belonging to this genus was found infecting leaves of Zizyphus jujuba Mill. which a common plant in Pakistan with great economic importance. Spore morphology and host identification here lead to its identification as Phakopsora ziziphi-vulgaris Dietel. It has previously been reported on leaves of Zizyphus jujuba Mill. from Changa Manga, Chillianwala and Lahore (Sydow and Ahmad, 1939; Malik and Khan, 1944; Ahmad, 1956a, b; Hasnain et al., 1959; Kaneko, 1993). It is a new report for Khyber PakhtunKhwa.

Phragmidium Link, characterized by presence of distinctive one to several celled teliospores having smooth or more often verrucose surface ornamentation is type genus of Phragmidiaceae. About 60-65 species of this genus have been reported till date. All known species are autoecious and mostly macrocyclic but few demicyclic and microcyclic species are also reported. All species are found infecting mostly or perhaps only Rosaceae predominately Rosa L., Rubus L. and Potentilla L. The genus mainly inhabits the northern hemisphere (Cummins and Hiratsuka, 2003).

From Pakistan previously sixteen (16) species of Phragmidium have been reported. In the present study, three (03) species of this genus were described using both morphological and molecular tools. These are P. pakistanica nom. prov., Ph. rosae-pimpinellifoliae Dietel and Ph. shogranense Petr.

232

One taxon parasitizing Rubus fruticosus Roth is found in three different collections from two different locations viz. Hazara University, District Mansehra (H1 & H7) and Kala Dhaka, Battagram District (KD1) of Khyber PakhtunKhwa. Species was characterized by presence of 2-9 celled teliospores with long pedicle, having 3 germ pores per cell and hygroscopic pedicels. LSU sequences of rust on these plants were successfully obtained. In BLAST analysis, sequences shared 99% sequence identity with numerous sequences of Phragmidium in GenBank, including P. sanguisorbae (DC.) J. Schröt. (JF907674) of Germany, P. barnardii Plowr. & G. Winter (KT199402) of Australia, P. violaceum (Schultz) G. Winter (EF672358) of USA, P. rubi-idaei (DC.) P. Karst. (AF426215) of Europe, P. potentillae (Pers.) P. Karst. (KT199403) of Australia with 100% query coverage and in phylogenetic tree taxon clade separately. Total length of compared sequence data was up to 872 bp. Morphological characteristics of this taxon were found overlapping with above mentioned previously reported Phragmidium species on Rubus L. (Table 2). P. rubi- ideai was found closer to this taxon morphologically but in phylogenetic tree its placement confirms the non-conspecificity between both species. On the basis of all these facts taxon is identified as previously undescribed and named on the basis of type locality as P. pakistanica nom. prov.

Phragmidium rosae-pimpinellifoliae (AM15), collected on Rosa webbiana Wall., from Deosai Plains is described here only on morphological basis. It has previously been reported on leaves of Rosa sp. from Rawalpindi as Phragmidium disciflorum (Tode.) J. F. James (Ahmad, 1956a, b).

Phragmidium shogranense (T18) was found infecting Rubus fruitocosus Weihe & Nees in Thandiani forests of Abbottabad District . This species is indigenous to Pakistan and has previously been reported from Kaghan Valley and Swat (Ahmad, 1956a, b). This study is the first molecular evidence of P. shogranense.

The genus Pileolaria Castagne belongs to Pileolariaceae comprising about 20 to 25 species, most of which are macrocyclic and autoecious. This genus has been found parasitizing economically important species of Anacardaceae especially Rhus L. and Pistacia L. Pileolaria terebinthi (DC.) Castagne and P. pistaciae F.L. Tai & C.T. Wei are found to be parasitic on Pistacia spp. causing severe economic losses in various countries of Africa, Asia and Europe (Cummins & Hiratsuka, 2003; Aime,

233

2006). Taxon is characterized by presence of Ridged or beaded in longitudinal or spiral patterned urediniospores, unicellular, discoid verrucose or reticulately verrucose, long pedicellated teliospores (Cummins & Hiratsuka, 2003). The stages of the life cycle have not been reported in detail. The disease can cause blossom blight, defoliation, branch deformity and die-back of affected plants (De Candolle, 1815). During this infection, round or irregularly shaped red-brown pustules develop on leaves, flowers, pedicels and/or fruits; leaves drop from tree prematurely and fruit become misshapen; leaves redden in late summer.

During a field survey to the forests of Ghari Habib near Thandiani, Abbottabad District, Pileolaria sp. has been found infecting leaves of wild Pistacia plants. Molecular characterization of LSU region of nrDNA was amplified. During BLAST amplified sequence of taxon did not match any previously sequenced species. However it makes clade with unpublished Pileolaria terebinthi sequence collected from Spain with 100% bootstrap value. But study of spore morphology and geographical distribution showed that studied taxon was found closer to P. pistaciae. Teliospores of present taxon were found darker in color with very long pedicels which were different from P. terebinthi, which are shortly pedicellated, light colored teliospores. Spore dimensions and disease pattern also indicated the presence of P. pistaciae on infected leaves.

Pileolaria pistaciae is commonly named as Asian rust as it has only been reported from Asian countries i.e. China, India, Japan, Philippines and Taiwan previously. This is the first report of any fungal disease on Pistachio for Pakistan but also of genus Pileolaria from this part of world (Yun, 2016).

Puccinia is the largest genus of Pucciniales having about 3000 to 4000 species. It may parasitize most groups of vascular plants mainly Asteraceae, Cyperaceae, Poaceaea, Polygonaceae and Liliaceae in all land areas except polar regions. Genus is characterized by the presence of typically 2-celled teliospores, but it can be 1-celled or 3-celled in some species, borne singly on pedicels, spore walls having varying degree of pigmentation and one germ pore in each cell (Cummins & Hiratsuka, 2003).

234

In present investigation, twenty seven (27) taxa belonging to Puccinia spp. were collected on twenty nine (29) different host plants. Among these six (06) taxa are new records for Pakistan, one (01) taxon is found new to province Khyber PakhtunKhwa, four (04) taxa are reported on new host plants while fifteen (15) taxa were previously reported from the country but here these are reported from new localities.

During a survey to forests of Thandiani, Abbottabad, rust infected leaves of a grass Microstegium ciliatum A.Camus were collected. Fungus was described morphologically and one sequence of 28S region of nrDNA was also generated. In initial Blast it does not show similarity more than (94%) with any other sequence in GenBank. For phylogenetic tree construction sequences were retrieved from initial Blast results and previous literature. In phylogenetic tree, studied taxon clustered with Puccinia physalides (DQ354522) and Puccinia sparganioidis Ellis & Barthol. (GU327649) which have been found on Physalis spp. respectively with 89% bootstrap value. Spore morphology was taken into consideration. Teliospores of studied pathogen have characteristically right angled pedicels to spore which also make it different from previously reported species on same host. Studied taxon has been found different from previously reported taxa on same host. It was found resambling with P. aestivalis but absence of characteristic paraphysis makes both taxa different. Similarly, P. polliniicola has teliospores with characteristic apical thickeness which was not found in studied taxon. Morphologically it was found closer to P. phaeopoda Syd. but type specimen of this rust is no longer available in Arthur Herbarium so more authentic confirmation was not possible. Hence taxon is named as P. c.f. phaeopoda that has not been reported previously from Pakistan so it seems new record for the country.

Puccinia cnici H. Mart. is found on leaves of Cnicus sp. from Swat and identified on the basis of spore morphology. It has previously been reported on leaves of Cnicus lanceolatus Willd. from Russia (Cummins, 1978; Hylander, 1953). It is a new record for Pakistan.

Puccinia heraclei Grev. is found on on Heracleum sp. and is identified on the basis of spore morphology. It is characterized by the presence of amphigenous uredinia with echinulated urediniospores having 2 germ pores and 1–2 celled slightly

235

reticulated teliospores. It is first time reported from Pakistan and has previously been reported on Heracleum sphondylium Bourg. ex Reut. in Britain (Wilson and Henderson, 1966).

Two different taxa of Polygonum L. are collected in current research project from two sampling sites viz. Deosai plains and Swat. First one, collected from Deosai plains is found infected with telial stage. Presence of 1–2 celled teliospores with verrucose surface ornamentation make it identical to previously known Puccinia polygoni-alpini Cruchet & Mayor on same host. Spore dimensions also supported the identification. It has previously been reported on leaves of Polygonum phytolaccaefolium Meisn. Alpine Knotwood from Central California, Europe and Eastern Asia. It is distributed in United States (California, Idaho, Oregon), Europe and Eastern Asia, on Aconogonum sp., Polygonum phytolaccaefolium Meisn and P. alpinum Schur. (Arthur, 1934). It is a new record for Pakistan.

Second sample is found infected with urediniospores, which makes it difficult to identify the pathogen. However amplification of 28S region of nrDNA makes it easy to identify the rust fungus correctly. In phylogenetic tree, studied taxon is clustered with Puccinia polygoni-amphibii Pers. (DQ917702) with well supported bootstrap value. Morphology of urediniospores supports the result and pathogen was given same name. P. polygoni-amphibii has been reported on Polygonum pterocarpum Wall., from Swat and Kalam (Ahmad, 1956a). It is first time described phylogenetically from Pakistan.

Infected leaves of Microstegium nudum A. Camus are collected from two sampling sites including Torghar District and Battagram District in current investigation. In first look, spores present on infected leaves seem one-celled teliospores of Uromyces, but on critical examination and from some experts review, it is realized that these are urediniopsores with equatorial germ pores and echinulate surface ornamentation. For further confirmation “key to species of Puccinia” (Cummins, 1971) was followed and rust fungus was identified as P. polliniicola Syd. which is a common species on Microstegium spp. and a new record for Pakistan. It has previously been reported on Arthraxon lanceolatus Hochst., Isachne sp., Microstegium biaristatum (Steud.) Keng, M. ciliatum A.Camus, M. gratum A.Camus, M. vagans (Nees ex Steud.) Hand.-Mazz., M. vimineum (Trin.) A.Camus, M.

236

vimineum (Trin.) A.Camus f. polystachyum (Franch. & Sav.) Koyama and Pollinia viminea Merr. M. nudum is a new host for this pathogen in Pakistan. nrDNA LSU is successfully amplified for both collections and are found clustering together in phylogenetic tree with 99% bootstrap value and making sister clade with P. nakanishikii Dietel as previously there was no sequence of P. pollinicola is available in GenBank so this will be an addition to future researches.

Puccinia shikotsuensis S. Ito was found on leaves of Polygonum sp. from Deoasai plains. Fungus was identified morpho-anatomically. It can be distinguished from other species on same host by the presence of larger teliospores with uniformly and minutely verrucose surface ornamentation. It has previously been reported on Polygonum weyrichii Fr. Schm. in Japan (Hiratsuka et al., 1992). It is a new record for Pakistan.

Puccinia brachypodii G.H. Otth is the oldest valid name for a complex of rust fungi found to produce aecia on Berberis sp. and characterized by clavate or clavate- capitate uredial paraphyses with walls that are thick throughout, and echinulate urediospores having numerous obscure germ pores. Many species have been identified within the complex but the morphological variability is almost continuous. Consequently, lots of varieties have been added in this complex which does not eliminate the difficulties but does put the magnitude of the differences in truer perspective. But still in some databases all these varieties are considered as synonym of P. brachypodii including P. brachypodii var. arrhenatheri (Kleb.) Cummins & H.C. Greene, P. brachypodii G.H. var. brachypodii, P. brachypodii var. major Cummins & H.C. Greene and P. brachypodii var. poae-nemoralis (G.H. Otth) Cummins & H.C. Greene (http://www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=249291). Here following the Cummins (1971), studied taxon is treated as a variety instead of synonym and identified as Puccinia brachypodii var. brachypodii G.H. Otth. It has previously been reported as P. baryi (Berk. & Broome) G. Winter on Brachypodium sp. and Poa attenuata Trin. from Changla gali, Nathia gali, Shogran, and Sharan (Ahmad, 1969; Kakishima et al., 1993b). Poa annua Steud. is a new host record for this rust fungus in Pakistan and it is an addition to rust flora of Thandiani forest.

237

During a visit to Shaheed Benazir Bhutto University, Sheringal campus, Upper Dir District , a rust fungus on Carduus L. was found. Based on host specificity and spore morphology fungus was identified as Puccinia calcitrapae DC. It is autoecious and occurs on various species of Asteraceae. It is characterized by uredinoid aecidia accompanied by spermogonia, urediniospores with thin, echinulate walls with up to 3 equatorial germ pores and thin-walled, rounded, more or less verruculose teliospores without apical thickening (Wilson and Henderson, 1966). It has previously been named as Puccinia carduorum Jacky, P. centaureae DC. and P. cirsii Lasch attacking various taxa of Asteraceae (http://www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=153090). It has previously been reported from Pakistan variously on leaves of Centaurea calcitrapa Linn. from Dargai, Peshawar Rawalpindi and Swat, on Cnicus argyracanthus C.B.Clarke and Cnicus wallichii Hook.f. as P. cirsii Lasch from Swat, Changla gali, Kaghan valley and Shogran; as P. carduorum Jacky on Carduus nutans Linn. from Kaghan Valley, Batakundi, Shogran and Swat (Ahmad et al., 1997). It is first report of any rust fungus from Upper Dir.

Puccinia carthami Corda is found infectiong Centaurea sp. from Deosai plains and Kalam (Swat). Fungus was identified morpho-anatomically. It is found confusing with closely related Puccinia spp. that infects members of the Cardueae including Puccinia calcitrapae DC., P. cnici-oleracei and P. dioicae but presence of echinulated urediniospores with 4 germ pores and verrucose teliospores with long pedicels (up to 100 μm) make studied taxon closer to P. carthami. It has previously been reported on leaves of Carthamus oxyacantha M. B. and C. tinctorius L. from Faisalabad, Chillianwala, Dargai, Lahore, Mingora, Sangla Hills (Ahmad, 1956a, b; Khan and Kamal, 1968); as P. calcitrapae var. centaureae on Centaurea bruguieriana (DC.) Bornm. Ex Rech. f., C. candolleana Jacky on Carduus edelbergii Rech. f. from Kaghan Valley and Swat by Ahmad (1956a, b); as P. cirsii DC. on Cirsium argyracanthum DC., C. wallichiana DC. and Cnicus sp. from Swat, Changla gali, Kaghan valley by Ahmad (1956a, b), Ono (1992) and Kakishima et al. (1993a, b) and on Centaurea calcitrapa from Fairy meadows (Afshan, 2009).

During field tour to forests of Bagh District, rust infected leaves of Lactuca L. commonly called “Lettuce” are collected. Fungus is studied morphologically and

238

spore dimensions are recorded. DNA sequence of LSU region is generated during current study. Initial Blast results show maximum similarity (97%) with Puccinia caricis Rebent. (KM110789), currently named as P. dioicae Magnus., which is found to infect Cyperaceous hosts. Studied taxon made clade with P. lapsanae Fuckel (HQ412649), a rust fungus found mostly on Lapsana L. of Asteraceae with 67% bootstrap value in phylogenetic tree. Spore dimensions and presence of 2 minutley echinulated flat papilae covering germ pores, which is a distinctive feature of some Puccinia species attacking Lactuca and allied genera make both taxa different. For more confirmation data was reviewed by Prof. Dr. Reinhard Berndt (ETH, Switzerland) who reviewed the descrtiption stating “It may be difficult or impossible to determine the rust fungus alone with urediniospores. I suggest that you visit the collection site again later in season to obtain teliospores. I assume that you should be able to determine the fungus by uredinio- and teliospore characters if the identity of the host plant is certain and after having studied all spore characters carefully” so tentatively on the basis of present urediniospore characters studied taxon is named on the basis of its closely matching Puccinia prenanthis var. himalensis Barclay. Previously no sequence of this taxon is available in GenBank so after more confirmation of the pathogen this molecular data will be helpful for future researcher. P. prenanthis var. himalensis has previously been reported on Lactuca brunoniana Clarke from Kaghan Valley, Shogran and Changla gali (Ahmad et al., 1997).

Puccinia coronata var. avenae W.P. Fraser & Ledingham is identified on Digitaria Haller from Shangla District. Fungus is identified on the basis of its characteristic teliospores with 2–6 digits on apex. It is a variation of crown rust fungus which infects oat plants mainly. Almost every growing region of oat has been affected by this pathogen at one point or another. In Pakistan, it has been found on Agrostis pilosula Trin., Festuca sp., Lolium persicum Boiss. & Hohen. and Rhamnus spp. (Ahmad et al., 1997). But in past this fungus has never been reported on Digitaria sp., so it is a new host record from Pakistan.

Puccinia deosaiensis Khalid & S.H. Iqbal is indigenous to Deosai Plains, Pakistan. It has previously been collected on leaves of Epipactis helleborine (L.) Grantz (Khalid and Iqbal, 1997). This taxon is characterized by specific verrucose

239

urediniospores and teliospores. Here it is second time reported from same locality on same host plant.

During field survey to forest of Shawar, Swat District, leaves of Berberis are found infected with aecial stage of a rust fungus. Spore morphology directs it to aecial stage of P. graminis Pers. For more confirmation, 28S region of nrDNA was amplified and sequenced. In phylogenetic tree, sequences are retrieved from GenBank. Studied taxon makes clade with P. graminis (AF522177 and KM249852) with 84% bootstrap value in phylogenetic tree which confirms its identity. Aecial stage of P. graminis has previously been reported on Berberis vulgaris Aitch. from Fairy meadows and Naltar (Sultan, 2005; Afshan, 2009). This is the first report of aecial stage of this pathogen from Swat District and here it is first time reported using molecular tools from Pakistan.

T'he rust of Iris, Puccinia iridis Wallr., a widely distributed rust in Asia, Europe, Japan and North America is collected in present investigation. The rust pathogen is morphologically similar to the descriptions of Hiratsuka et al. (1992). The genomic DNA was extracted from urediniospores, and the rDNA-LSU region was amplified and sequenced. Sequence shows 99% similarity with P. iridis (KM249853). In phylogenetic tree, both sequences clustered together with 99% bootstrap value. It has previously been reported on Iris germanica Linn. from Lahore (Ahmad, 1956a). It is a new record for Province Khyber Pakhtunkhwa and is first time studied phylognetically in Pakistan.

During field surveys of six (06) different sampling sites, leaves of three plants of Lamiaceae viz. Mentha sp., Origanum sp. and Nepeta L. are found infected. From spore morphology, fungus on all these plants is found similar. LSU region of nrDNA is successfully amplified and four sequences are generated. All these sequences clustered with P. menthae Pers. (accession numbers KJ16344, KU296890, DQ917712, DQ354513) with 91% bootstrap value in phylogenetic tree. Spore morphology also supported the identity. This commonly found rust with relatively broad host range has previously been reported on Mentha sylvestris L. from Quetta, Chillianwala, Mingora, Poonch, Kaghan valley, Naran, Murree hill and Peshawer; on Origanum vulgare L. from Kaghan valley, Naran, Sharan and Changa gali; on Calamintha umbrosa Rchb. and C. clinopodium Benth. from Kaghan. Batakundi,

240

Changla Gali, Swat, Kalam and Naran; on Nepeta sp. from Kaghan valley, Swat, KP, on Mentha longifolia L. from Azad Jammu & Kashmir, Neelam valley, Sharda, Pakistan (Afshan, 2009; Ahmad et al., 1997; Usman et al., 2016a). Here it is first time being reported from Battagram District and Torghar District of Province Khyber Pakhtunkhwa and Bagh District of Azad Jummu and Kashmir. Moreover it is first time described phylogenetically from Pakistan.

Puccinia nakanishikii Dietel is collected from Torghar District on leaves of Sorghum sp. and was identified morphologically. The studied taxon was found similar to P. khanspurica Khalid & Afshan due to the presence of few similar characters including the presence of clavate to capitate paraphyses and smooth teliospores. But it was separated on the basis of only 2-celled teliospores with thinner apices and echinulate urediniospores while P. khanspurica is characterized by the presence of 2– 4-celled teliospores with thicker apices and finely verrucose or striolate verrucose urediniospores. On the basis of spore dimensions, and morphology made the studied taxon was identified as P. nakanishikii Dietel. It has previously been found infecting Sorghum halepense Pers. from Malakand, Pakistan (Hussain et al., 2015). It is a new record for Torgarh District.

During exploration of rust and smut fungi from forests of Swat Rumex nepalensis Spreng. was found infected. Presence of reddish brown, ellipsoid teliospores with rounded ends, hyaline apical papilla, smooth wall and short pedicels make it evidently as Puccinia nepalensis Barclay & Dietel. It has previously been reported on Rumex nepalensis Spreng. from Changla gali, Fairy meadows, Hazara, Kaghan Valley, Murree, Muzaffarabad, Naran and Swat (Ahmad et al., 1997; Afshan et al., 2009). Its description is here being upgraded.

Puccinia poarum Nielsen has been found infecting Agrostis sp. from Ushu valley. It was found difficult to identify it as spore morphology of previously described taxa on same host plant, are almost similar with small variations in spore dimensions. However, presence of one-celled teliospores and pale uredinia and urediniospores, absence of uredinial paraphyses and scarcity of telial paraphyses helped in its identification. Puccinia poarum has been previously reported on Agrostis sp. & Poa annua L. from Kaghan valley, Azad Jammu & Kashmir, Lahore and Fairy

241

meadows (Kakishima et al., 1993a, b; Ahmad, 1956a, b; Afshan, 2009). It is a new record for Swat District .

Puccinia sorghi Schwein. is collected from Chitral District and Swat District on leaves of Zea mays L. Rust was identified on the basis of spore morphology. Taxon was characterized by echinulated urediniospores having two supra-equatorial germ pores and smooth walled teliospore with thick apex. It has been found worldwide where maize is grown. In Pakistan, it has been reported previously on leaves of Zea mays L. as P. maydis Bérenger from Faisalabad, Kaghan, Lahore and Swat (Ahmad, 1956a, b), Karachi and Tandojam (Ghaffar and Kafi, 1968), Matiltan (Ono and Kakishima, 1992), Balakot, Naran, Shogran and Sharan (Ono, 1992; Kakishima et al., 1993b). It is a new record for Chitral District .

Leaves of Artemisia sp. were collected from Deosai plains infected with rust fungi. From morphology of uredinal and telial stages, fungus was identified as Puccinia tanaceti DC. Taxon has variously been identified as P. artemisiae Fuckel and P. artemisiella P. Syd. & Syd. but was united as P. tanaceti due to the lack of sufficient morphological data. It is a common rust throughout the world. It has previously been reported in Pakistan on leaves and stem of Artemisia vestita Wall. and Chrysanthemum griffthii Clarke from Chitral (Ahmad 1956a, b, Gjaerum and Iqbal, 1969). Here it is first time reported from Deosai Plains.

Puccinia hieracii sensu auct. (synonym=Puccinia taraxaci Plowr.), is found on Taraxacum officinale Linn. from three sampling sites viz. Kalam and Miandam in Swat District and Kalash Valley of Chitral District. Fungus is found confusing with Puccinia variabilis Grev. mainly in the absence of the aecidium. But, in addition to that, the urediniospores of P. taraxaci were found far more abundant and the sori are seen mainly on adaxial surface of leaves while the urediniospores of P. variabilis are scanty and are usually intermixed in the teleuto-sori. It has previously been reported from Batakundi, Kaghan valley and Kalam (Ahmad, 1956a, b). It is found as a new record for Chitral District .

During field exploration to District Astore, leaves of Tricholepis sp. is found infected with clavate teliospores with slightly verrucose surface ornamentation and hyaline, deciduous pedicels. Spore morphology is compared with other rust taxa

242

reported on same host in literature and identified as Puccinia tricholepidis Syd. It is an indigenous taxon to India and Pakistan. In Pakistan, it has been reported on leaves of Tricholepis stewartei C.B.Clarke ex Hook.f. from Changla gali and Dunga gali (Ahmad, 1956a, b), on T. nigrscense Edgew from Skardu (Gjaerum and Iqbal, 1969). It is a new record for Deosai plains.

Puccinia ustalis Berk. is found on leaves of Aquilegia L. from forests of Swat. Fungus was identified on the basis of host specificity, spore dimensions and morphology. The compact large sori make the species prominent among other taxa reported on same host. It is found comparable with P. recondita but according to Tranzschel‟s law, it is considered as a short cycle derivative of P. recondita (Yun, 1991). It is a microcyclic rust mostly found on Anemone L., Aquilegia spp., Clematis L., Pulsatilla Mill., Ranunculus L., Thalictrum Tourn. ex L. and Trautvetteria Fisch. & C.A.Mey. It has previously been reported in Pakistan on Anemone obtusiloba D. Don, Ranunculus diffusus DC. and Ranunculus hirtellus Royle from Changla Gali, Dunga Gali, Kaghan Valley, Mansehra and Nathia Gali (Ahmad 1956a,b; Fiaz et al., 2015; Okane et al. 1992; Ono 1992). Aquilegia L. is a new host for this rust fungus in Pakistan.

Puccinia versicolor Dietel & Holw. has been identified on Themeda anathera (Nees ex Steud.) Hack. from Thandiani forests. It was identified on the basis of spore morphology. It has previously been reported from Neelam Valley, Azad Jammu and Kashmir. P. versicolor has been reported on Heteropogon contortus (Linn.) Beauv. ex Roem. and Schult. from Choa Saidan Shah by Ahmad (1956a, b; 1976). Telial stage of P. versicolor was reported on T. anathera from Sharan (Saba and Khalid, 2013). It is first time reported from the forest of Thandiani, District Abboattabad.

In current research, during survey to Swat valley leaves of Viola caespitosa D. Don. are collected from Mankial. On the basis of circinate uredinia and spore morphology pathogen is identified as Puccinia violae (Schumach.) DC. It has previously been reported on leaves of Viola canescens Wall. ex Roxb.,V. biflora L., V. beteonicifolia sm. subsp. napaulensis (Ging.) Becker (=V. caespitosa D. Don.), V. indica W. Beck, V. rupestris F. W. Schmidt and V. serpens Wall. ex Roxb. from Kalam, Hazara, Kaghan Valley and Fairy meadows (Afshan, 2009; Ahamd, 1956a, b;

243

Jorstad and Iqbal, 1967; Kakishima et al., 1993; Ono and Kakishima, 1992; Ono, 1992).

Puccinia wattiana Barclay, a common rust of Clematis L. is collected during field survey to three sampling sites including Bagh, Swat and Thandiani. The telial stage of fungus is found with brown teliospores with smooth, thick wall. LSU region of nrDNA of one sample collected from Bagh is amplified successfully. In initial Blast search query sequence showed maximum similarity of 96% with Puccinia sp. (accession No. KC433394). In phylogenetic tree taxa is found making clade separately with 69% bootstrap value, which can be because of scarcity of available sequence data of P. wattiana and its allied species in GenBank. It has previously been reported on Clematis grata Wall. from Miana, Margzar (Swat) and Murree (Ahmad, 1956a, b); on C. barballata Edgew. from Kawai of Kaghan Valley (Kakishima et al. 1993a; Ono, 1992) and from Leepa Valley, Azad Jammu and Kashmir (Saba et al., 2013). Here it is first time reported from Abbottabad and Bagh.

The genus Pucciniastrum G.H. Otth belonging to Pucciniasteraceae was first time established by Otth in 1861 based upon its type species Pucciniastrum epilobii Oth on Epilobium angustifolium L., thereafter many new species were added in said genus and about 30 species have been reported till now (Hiratsuka, 1958; Cummins and Hiratsuka, 2003). Out of these only four (04) species have yet been reported from Pakistan (Ahmad et al., 1997). This genus was most often confused with Thekopsora Magnus and Calyptospora J.G.Kuhn in past but was separated by Hiratsuka (1958) when he revised the taxonomy of this family based on position of telia in plant tissue. Pucciniastrum is characterized by ostiolar peridial cells in uredinia, subepidermal telia and teliospores in a cluster of 2-4 cells without pedicels (Sato et al. 1993).

In present studies, one species of Pucciniastrum is collected from Battagram District of KhyberPakhtunkhwa Province. Identification is based on both morphological and molecular methods. During BLAST, sequence shows maximum similarity of 99% with Thekopsora guttata (J. Schröt.) Hyl., Jørst. & Nannf. (KJ16345) reported from New Zealand. In phylogenetic tree, P. guttatum falls in clade with T. guttta with 84% bootstrap value. The species make clade with T. minima (Arthur) P. Syd. & Syd. Maximum available data of genus Pucciniastrum is tried to incorporate in the tree to understand the evolutionary relations within genus. Six (06)

244

species including P. actinidiae Hirats. f., P. kusanoi Dietel, P. miyabeanum Hirats., P. styracinum Hirats., P. tiliae Miyabe and P. yoshinagai Hirats. f. constitute a single cluster together in analysis based on 28S region. In addition they have identical nucleotide sequences. Although molecular data from wider regions of species can provide a better understanding of evolutionary trends among these taxa.

Based on urediniospore morphology, DNA amplification, and sequence analysis, the causal agent of the rust observed was confirmed to be P. guttatum. P. guttatum is a common species belonging to the genus which was previously named as Caeoma galii Link., Melampsora galii G. Winter., M. guttata J. Schröt., Thekopsora galii (G. Winter) De Toni and T. guttata even much of the literature about it still refers to it as T. guttata. The majority of P. guttatum hosts reside in the subfamily Rubioideae of the Rubiaceae. This fungus has been observed previously on Cruciata glabra (L.) Opiz in Poland, on Gallium spp. in Asia (Iran, Japan, Russia), Europe (Belgium, Bulgaria, Canada, Denmark, Finland, Germany, Norway, Sweden, Ukraine), United Kingdom, United States (Arizona, California, Colorado, Idaho, New York, Oregon, Pennsylvania, Utah, Washington, Wisconsin) and Madeira Islands (http://nt.ars-grin.gov/fungaldatabases/fungushost/fungushost.cfm). In Pakistan Puccinia ambigua (Alb. & Schwein.) Lagerh., P. difformis Kunze and P. punctata Link has been found on same host previously but no Pucciniastrum sp. has been recorded till to date (Ahmad et al., 1997). P. guttatum is a new record for Pakistan (Ishaq et al., 2017).

Sphaerophragmium Magnus is a genus belonging to family Raveneliaceae. Genus is characterized by presence of peripheral paraphysis along with echinulate urediniospores and 4-celled teliospores with truncated spines like projections. There are sixteen (16) species of this genus attacking mainly Fabaceae and sometimes Annonaceae. Distribution of Sphaerophragmium spp. is cosmopolitan from warm to tropical areas (Cummins & Hiratsuka, 2003). In present investigation, one taxon of Sphaerophragmium on Dalbergia sissoo is collected from Thandiani forests of KP. Previously urediniospores of this rust fungus have variously been reported on same host and identified as Uredo dalbergiae Henn. In present studies its 28S region is amplified for the first time. In phylogenetic tree, this anamorphic fungus is forming clade with Sphaerophragmium sp. (KJ862350) collected from Australia with 96%

245

bootstrap value. The position in phylogenetic tree indicates that the studied taxon must belongs to genus Sphaerophragmium. Previously six (06) species belonging to same genus has been reported attacking same host including S. dalbergiae Dietel, S. fimbriatum Mains, S. gabonensis J.M. Yen, S. guineense Vienn.-Bourg., S. longicorne Eboh and S. ornatum Lohsomb. Kakish. & Y. Ono mainly from Africa and South America (Farr and Rossman, 2016). Based on urediniospore dimensions and morphology all these taxa were found distinct from studied taxon. It is difficult to identify the taxon up to species level on the basis of only one collection and uredinial stage solely, so more sampling is needed in future for authentic identification of this taxon.

The genus Tranzschelia Arthur belonging to Uropyxidaceae was initially included in Puccinia Pers. In 1906 Arthur separated the genus mainly on the account of teliospores characteristics (Hisratsuka et al., 1992). Only fifteen (15) species are known and mostly parasitize members of Ranunculaceae and Prunus spp. of Rosaceae. This genus is characterized by the presence of urediniospores which borne singly on pedicels, echinulate with equatorial germ pores and teliospores which are borne single but adheres basally in groups (Cummins and Hiratsuka, 2003). Using morphological characteristics species can be separated only on the basis of teliospores as urediniospore morphology of all Tranzschelia species is virtually same.

In present study, two plants of Prunus persica (L.) Batsch, commonly named as Peach, are found infected with rust fungi from Bagh District of Azad Jammu and Kashmir. Leaves are found infected with urediniospores of Tranzschelia sp. So in the absence of telial stage it is found difficult to identify the pathogen. For species delimitation along with the urediniospore morphology, molecular method was also used. LSU region of nrDNA was amplified and two sequences were generated successfully. During BLAST, sequences showed maximum similarity of 100% with T. discolor sequence reported from Oman (DQ995341), central Europe (AF426223), Iran (DQ354542) and with T. pruni-spinosae (Pers.) Dietel (DQ363329) with 100% query cover. In phylogenetic tree, maximum available data of genus Tranzschelia was tried to incorporate to understand the evolutionary relations within genus. In phylogenetic tree the fungus was identified as T. discolor. Spore morphology also supported the results. T. discolor has previously been named as Aecidium punctatum

246

Pers., A. quadrifidum DC., Caeoma punctatum (Pers.) Link, C. quadrifidum (DC.) Link, Puccinia discolor Fuckel, P. pruni-spinosae f. discolor (Fuckel) J.C. Fisch. and T. pruni-spinosae var. discolor (Fuckel) Dunegan. The majority of hosts reside in the genus Prunus L. of Rosaceae (http://nt.ars- grin.gov/fungaldatabases/fungushost/fungushost.cfm). This fungus has previously been described on P. persica from Tandojam on morphological basis only (Khan and Kamal, 1968). This fungus is first time phylogenetically described from Pakistan and this is the first ever report of T. discolors from Azad Jammu and Kashmir.

During visit to Thandiani forests, leaves of Otostegia limabata (Benth.) Boiss. is found infected with urediniospores. Disease pattern, host specificity and spore dimensions help here for identification of fungus that is Uredo otostegiae S. Ahmad, an indigineous rust fungi to Pakistan. It is characterized by the presence of echinulated urediniospores having 2 equatorial germ pores. It has previosuly been reported on Otostegia limabata (Benth.) Boiss from Balakot and Poonch (Ahmad, 1956a; Malik and Virk, 1968), Katas and Salt range (Khalid et al., 1993a), and Gandian, District Mansehra (Fiaz, 2013).

Uromyces (Link) Unger, the second largest genus of Pucciniales next to Puccinia Pers. parasitizes economically important plants throughout the world. This genus is characterized by the presence of subepidermal spermogonia and aecia, singly borne urediniospores on pedicels with various germ pores and one-celled, pigmented, teliospores having single germ pore. Genus comprises about 600 species distributed worldwide (Cummins and Hiratsuka, 2003).

In present research work, seven (07) species of genus Uromyces on six (06) different host plants from seven (07) different sampling sites have been identified using both morphological and molecular tools. Uromyces ambiens Cooke was identified based on morphological characterization and in light of comments of expert reviewers. Presence of subepidermal spermogonia type I of group I and dimorphic teliospores with very long pedicels (up to 85 µm) make it distinct from previously reported Puccinia buxi Sowerby on Buxus spp. U. ambiens is a rare taxon as it has previously been reported from Himalayan range of India and Pakistan (Spaulding,

247

1961). This is second report of this taxon from Pakistan and is an addition to fungal flora of Shangla District (Sadiqullah et al., 2014).

Another rust fungus infecting Desmodium elegans Schltdl. is collected during field surveys of forests in Kalam (Swat District) and Thandiani (Abbottabad District). Using disease pattern and spore morphology fungus was identified as U. capitatus Syd. & P. Syd. Presence of verrucose, rounded teliospores with pale papillae makes present taxon distinct from previously reported taxa on same host. Previously reported species belonging to Uromyces are: U. hedysari-paniculati (Schwein.) Farl., U. orbicularis Dietel, U. antiguanus Cummins, U. castaneus P. Syd. & Syd., U. desmodii Cooke, U. desmodiicola Jørst., U. desmodiicola var. desmodii R.T. Almeida, U. desmodiicola var. desmodiicola Jørst., U. huallangensis Henn., U. mexicanus Dietel & Holw., U. tenuistipes Dietel & Holw., U. unioniensis Viégas and U. vignae Barclay (Farr and Rossman, 2016). U. capitatus has variously been reported on leaves of Desmodium tiliaefolium G.Don from Saiden Shah, Salt Range, Sharan and Swat (Ahmad, 1956a, b; Khalid et al., 1993a) and on D. elegans from Leepa Valley, Azad Jammu and Kashmir (Saba et al., 2011). This is the first report of U. capitatus from Abbottabad District.

Uromyces dactylidis G.H. Otth was found infecting leaves of Poa pratensis L. in forests of Ushu valley. Taxon was identified through morphological characterization. This rust has previously been reported from Europe (Bulgaria, Cyprus, Denmark, Finland, Greece, Norway, Scotland, Sweden, Turkey, United Kingdom), USA (Indiana, Michigan, North and South Dakota, Oregon, Utah) and USSR (Farr and Rossman, 2016).

Uromyces heliotropium Sred. on leaves of Heliotropium supinum L., is characterized in present research morpho-anatomically. Host identification and spore dimensions help here to identify the pathogen. It has previously been reported on Heliotropium eichwaldii Steud., H. ellipticum Ledeb., H. europaeum L. and H. lasiocarpum Fischer & C. A. Meyer from Australia, Bulgaria, Cyprus, Greece, Pakistan, Turkey, Ukraine and Uzbekistan (Farr and Rossman, 2017).

In present study, infected leaves of Lespedeza sp. were collected from two different sampling sites of Khyber Pakhtunkhwa. Three sequences were generated

248

during this research work which did not show more than 97% similarity with any previously deposited sequence of Uromyces spp. in GenBank during initial Blast. In phylogenetic tree all sequences clustered together with 99% bootstrap value. As there was no sequence data available for rust fungi attacking the Lespedeza spp., so disease pattern, spore dimensions and other morphological features were used to identify the pathogen at specific level. Fungus was identified as U. lespedezae-sericeae S. Ahmad which seems endemic to Pakistan as it had only been reported from this region (Ahmad, 1956a, b).

Another taxon belonging to same genus, Uromyces polygoni-avicularis (Pers.) G.H. Otth has also been collected attacking leaves of Polygonum aviculare Bert. ex Meisn., and P. plebeium R.Br. from District Astore of Gilgit-Baltistan and Swat District . The fungus was identified using both morphological and molecular tools. It is characterized by the presence of verruculose urediniospores and smooth walled, deep red brown teliospores with hyaline pedicels. It is distributed in United States, Europe (Finland, Germany, Great Britain, Iceland, Ireland, Norway, Spain, Sweden), Asia (China, India, Iraq, Japan, Pakistan), Australia, New Zealand and Africa (Egypt), on Polygonum aviculare Bert. ex Meisn., P. buxiforme Small , P. glaucum Nutt., P. ramosissimum Michx., P. sawatchense Small, P. spergulariaeforme Meisn., Rumex sp. (Arthur, 1934; Wilson and Handerson, 1966; Hiratsuka et al., 1992). In Pakistan it has previously been reported on leaves of Polygonum aviculare L., P. paronychioides C. A. Meyer ex Hohn., and P. viviparum L. from Sharan, Quetta, Hazara, Madian, Gabral and Kaghan (Malik and Khan, 1944; Ahmad, 1956a, b; Ahmad, 1969; Malik et al., 1968; Malik and Virk, 1968; Ono and Kakishima, 1992; Ono, 1992). It is new record for District Skardu.

Rust fungi attacking leaves of Setaria sp. are collected from forest of Kala Dhaka, Torghar District . Only uredinial stage was found on the infected leaves which makes it difficult to identify pathogen on the basis of spore morphology. Its LSU region is amplified and sequence is generated which shows 99% similarity in inital BLAST with U. setaria-italiceae (HQ412654) with with 100% query coverage. This similarity is confirmed in phylogenetic tree where both taxa clustered together with 100% bootstrap value. U. setariae–italicae has previously been reported on Brachiaria reptans (L.) C. A. Gardner & C. E. Hubb., Setaria geniculata

249

Sieber ex Kunth, S. glauca (L.) P. Beauv., S. lutescens (Stuntz ) F. T. Hubb. and S. verticillata (L.) P. Beauv. from various localities of Province Punjab and Sindh including Ladhar, Tandojam, Malir, Islamabad and Taxila (Ahmad, 1956a, b; Ghaffar and Kafi, 1968; Hasnain et al., 1959; Khan and Kamal, 1968, Ahmad, 1976; Kakishima et al., 1993a). Presence of this pathogen in Province KP is reported here first time.

In present investigation, twelve (12) species of smut fungi belonging to five (05) genera on twelve (12) different host plants have been identified using both morphological and molecular tools.

Among these, Bauhinus tenuisporus (Cif.) Denchev & R.T. Moore has been identified infecting Persicaria maculosa Gray (AM84). It is identified using morphological tool. It has variously been named as Microbotryum tenuisporum (Cif.) Vánky and previously been reported from District Mansehra (Denchev et al., 2012). It is a new record for Shangla District.

Microbotryum nepalense (Liro) Vánky is identified in current study attacking Persicaria nepalensis (Meisn.) H. Gross (AM85) from Shangla. It has previously been reported as Bauhinus nepalensis (Liro) Denchev, Melanopsichium nepalense (Liro) Zundel and Ustilago nepalensis Liro. In Pakistan, it has been found on Persicaria nepalensis (Meisn.) H. Gross and P. alata (Hanilt. ex D. Don) Nakai from Batakundi, Kaghan valley, Muzaffarabad, Nathiagali and Sharan (Ahmad et al., 1997). Here it is first time described phylogenetically.

Sporisorium Ehrenb. ex Link is an unnatural genus of Ustilaginales attacking mainly poaceous hosts. It is characterized by the presence of exclusively in florets and rarely on distal leaves and clums usually covered by peridium. Spores are confined in loose groups or spore balls which may become detached on maturity. During field surveys to forests of Shangla and Swat, four (04) different smut fungi belonging to Sporisorium on five (05) different host plants are collected including S. cruentum (J.G. Kühn) Vánky, S. moniliferum (Ellis & Everh.) L. Guo, S. pulverulentum (Cooke & Massee) Vánky and S. reilianum (J.G. Kühn) Langdon & Full.

250

Infloresence of Sorghum bicolor (L.) Moench is found prone with smut. Fungus is identified as S. cruentum (J.G. Kühn) Vánky using molecular and morphological tools. Both ITS and LSU regions of nrDNA are amplified and a combine tree of both regions was constructed (Figure 102). Query sequence clustered with S. cruentum (AY740156, AF453939) reported from USA. Both sequences cluster together with 86% bootstrap value. It is characterized by the presence of thinner soral peridium with medium sized spores and larger sterile cells. It is often confused with S. sorghi due to the presence of similar spores and disease pattern but both taxa can be distinguished due to the absence of congestions of the panicle in later one. In Pakistan, it has previously been reported on Sorghum helepense (Johnson grass) (L.) Pers. and S. vulgare Pers. from D. G. Khan, Gujranwala, Islamabad, Lahore, Mansehra, Sheikhupra, Sialkot and Taxila (Ahmad et al., 1997; Fiaz, 2013). In current project, it is identified first time using molecular markers in Pakistan.

Sporisorium moniliferum (AM104) has been identified on Heteropogon contortus (L.) P.Beauv. ex Roem. Its ITS and LSU sequences are generated and phylogenetic tree is constructed. Query sequence is found clustering with previously deposited sequence of same taxon deposited from Indonesia (AY344984, AF453940) with morphological descriptions also supporting the result. It is named as Ustilago monilifera Ellis & Everh. It has previously been reported on Heteropogon spp. from Arizona, China, Ethiopia, India, Indonesia, Mexico, Papua New Guinea, Zambia and Zimbabwe. S. moniliferum is one of four species of Sporisorium on Heteropogon contortus in Australia. It is very common in northern Queensland (Cash, 1954; Gandhe, 2011; Shivas et al., 2001; Stoll, 2005; Vankey, 2000; Vanky and Vanky, 2002; Zhuang, 2001). In Pakistan, it has been reported on H. contortus from Abbottabad, Madian (Swat), Mansehra and Taxila (Ahmad, 1956 b, c; Fiaz, 2013; Kakishima and Ono, 1993). It is first time described phylogenetically from Pakistan and is undescribed from Shangla District previously.

In phylogenetic analysis two sequences of ITS and LSU regions on nrDNA are generated (AM58 and AM103) for another Sporisorium sp. Both sequences clustered with S. pulverulentum with 100% bootstrap value. Spore morphology also supports the results of molecular analysis. S. pulverulentum has previously been reported on

251

Saccharum strictum and S. ravennae from Europe and South Asia. Dichanthium sp. seems new host for this fungus in Pakistan.

Sporisorium reilianum (J.G. Kühn) Langdon & Full. has been found on Sorghum halepense (AM101) during current investigation. It is identified using both morphological and molecular markers. It is characterized by the presence of infection on whole inflorescence forming long stout collumellae. It has variously been named as Sphacelotheca reiliana (J.G. Kühn) G.P. Clinton. It is a widely spread pathogen in Maize and Sorghum crops after Ustilago maydis. It has been reported on S. vulgare. and Zea mays L. from Faisalabad, Jehlum, Kalash valley, Lahore, Murree, Quetta and Swat (Ahmad et al., 1997; Fiaz, 2013). It is first time described phylogenetically from Pakistan and a new record for Shangla District.

Urocystis Rabenh. is a natural genus comprising about one hundred and forty (140) species with wide host range. Delimitation within this genus is always found difficult due to insufficient morphological features of spore balls and spores. However all morphological features together with the host plants is used as basic criteria for this delimitation (Vanky, 2007). With the advancement in modern DNA analysis techniques it has become relatively easy to identify and classify the taxa more precisely.

One taxon belonging to Urocystis was found infecting leaves of Narcissus pallidulus Graells from two different sampling sites viz. Shangla District and Swat. Fungus was characterized by having spore balls composed of 1–3(–4) spores, completely surrounded by sterile cells. Individual spores were found smooth walled. Its large sized spore balls and usteliospores make it different from other Urocystis species on hosts of same genus. Host identification, morphological characterization and expert reviews help in identification of pathogen as Urocystis narcissi (Gonz. Frag.) Vánky. For additional support both ITS and LSU region of nrDNA were amplified and successfully sequenced. A multigene phylogenetic tree was constructed but lack of sufficient data of studied genus in GenBank makes it difficult to use certain molecular markers as identifying tool. However tree has been constructed here which will be helpful for future studies (Figure 105).

252

Previously U. narcissi has been reported on Narcissus pallidulus Graells as U. colchici f. narcissi Gonz. Frag. (Fragoso, 1914) and as Tuburcinia narcissi (Gonz. Frag.) Cif (Ciferri, 1938) from Spain (Vánky, 2011). Later on it was revised by Vánky (1993) as U. narcissi. The description of smut fungus on N. tazetta from Swat, Pakistan resembles with description given by Vanky (2011) with some minor difference in spore size for being larger. Studied taxon has been identified as U. narcissi with little differences in spore size while, N. tazetta is a new host record for this fungus in Pakistan.

Ustilago (Pers.) Roussel is a genus of Ustilaginales infecting members of Poaceae predominantly. It is represented by about three hundred (300) species and characterized by the presence of agglutinated, olive-brown single, medium sized spores having verruculose, echinulate or irregularly verrucose-reticulate surface ornamentation.

Five (05) taxa of genus Ustilago have been identified on six (06) different host plants of Poaceae in present investigation. All these taxa are identified on the basis of both morphological and molecular tools except Ustilago idonea Syd.

Ustilago idonea was found infecting inflorescence of Elucine sp. (ST-2) from Swat. During morphological study, SEM analysis revealed that studied taxon has characteristic ornamentation of spores, with a regularly echinulated spore wall and the presence of verruculae within inter-spaces. Two species of Ustilago are nown from inflorescence of host plants (Elucine sp.) belonging to Caryophyllaceae, namely U. eleusines Kulk. and U. idonea Syd. Amongst these, U. eleusines has superficially similar spores, but the characteristic verruculose surface between short echines of studied taxon is not typically present in U. eleusines. Spore dimensions and surface ornamentation is found similar to U. idonea. It has previously been reported attacking Dactyloctenium scindicum Boiss. from Sheikhupura and Sangla Hills (Ahmad, 1956a,b).

During exploration of Kalash Valley, of Chitral Distrcit (KL-10) and Shangla District (AM86), fruit and inflorescence of Corn (Zea mays L.) are found infected with smut. Fungus is identified on morphological as well as molecular basis as Ustilago maydis (DC.) Corda. It has variously been reported on Z. mays from Azad

253

Jammu & Kashmir, Dir, Kaghan valley, Murree, Quetta and Swat (Ahmad, 1956a, b). It is first time described phylogenetically from Pakistan and a new record for Chitral and Shangla.

During exploration in forests of Shangla two different grasses i.e., Dactylis glomerata L. (AM88) commonly called Cat grass and Digitaria violascens (AM87) are found prone to smut fungi. Infection on both plants is morphologically analyzed and it is revealed that pathogen is quite comparable with previously known taxa on same hosts i.e. Ustilago striiformis on same host plants. For more confirmation both ITS and LSU regions are amplified and a combined phylogenetic tree is constructed including all initial Blast sequences and data set of Stoll et al. (2005) is also followed. In final tree both query sequences make clade with Ustilago nunavutica Savchenko with 81% bootstrap value, which has previously been reported from Northern part of Canada on Puccinellia angustata (R. Br.) E.L. Rand and Redfield and sister clade with U. striiformis with 86% boostrap value. Morphological data also supports this result. It is a new record for Pakistan while D. glomerata and D. violascens are new host records for this smut fungus.

In present research work, smut infected plants of Digitaria sanguinalis (L.) Scop. was collected. In light microscopy it seems Ustilago syntherismae (Schwein.) Peck based on spore appearance and dimensions but in phylogenetic tree both taxa become separated. Fungus is compared with previously known all taxa on same host plants but it seems difficult to identify it at species level due to its placement in phylogenetic tree. For species level identification, there is need to have more collection and DNA sequences of all previously reported taxa on same host.

A smut fungus infecting plants of Triticum aestivum L. (AM99, AM110) is collected from two different sampling sites viz. Swat and Shangla. Fungus is identified using both morphological and molecular tools. In phylogenetic tree both sequences are found clustering together with previously reported Ustilago tritici (Pers.) Rostr. with 100 % bootstrap value. Morphological characterization also supports the result. It has previously been reported from Mansehara, Khyber Pakhtunkhwa, Pakistan (Fiaz, 2013). It is first time described here with molecular evidence from Shangla District.

254

The diversity of rusts and smuts is determined with reference to samling site as well as host plant families. The Maximum diversity of the rust fungi is observed in Abbottabad District, part of Himalayan moist temperate forests, which are in the list of top twenty five (25) hot spots of biodiversity of flora and fauna (Myers et al., 2000). As rust fungi is host dependent primarily so there are chances to have more diversity of pathogens on these plants comparatively. Minimum rust diversity is found in Chitral and Upper Dir which mainly resides dry temperate forests with less ground flora (Table 4). So there is less variety of host plants which is one of the major causes of less diversity of rust fungi in these sampling sites. Similarly maximum species richness was observed in Torghar district that is due to less variety of host plants and no human interference in most parts of the district as this area is sparsely populated.

All sampling sites are observed for three (03) years but smut fungi was found in only three sampling sites including Chitral, Shangla and Swat which is might be due to differences in climatic factors. Maximum diversity of smuts is recorded in Shangla District which comprises large sub-tropical or sub-alpine forests (Table 5). Climatic factors of this sampling site greatly support the growth of grasses which are major hosts of smut fungi. To observe the distribution pattern of rust and smut fungi in selected sampling sites dot distribution maps are constructed. Map shows the maximum spread of rust fungi in Abbottabad District, Mansehra and Swat (Figures 120), while maximum distribution of smut fungi was observed in Shangla District (Figures 121).

To determine the potential range of selected taxa single species predictive modeling is done. For this purpose, Asian Pistachio rust and Box wood rust are selected purely on the basis of economic importance of selection of taxa for predictive modeling is based on economic and ecological importance of host plants for country. In current study, Pileolaria pistaciae causative agent of Pistachio rust is reported from Abbottabad and Shangla districts. In GIS-based modeling it is predicted that disease can spread from dry deciduous forest of Jehlum to Rawalpindi, Islamabad, Swat to whole area of Gilgit-Baltistan where host trees are found. It means more than 50% Pistachio tree population in under the threat of this disease throughout the country (Figure 122).

255

Causative agent of Box wood rust fungus is collected from Shangla District and using GIS-based model spread of disease is predicted Rawalpindi, Murree and Swat which is about 40% of the host tree population (Figure 123).

These results indicate that the forest of selected sampling sites have a great potential of fungal diversity. A thorough exploration of each site is further needed to explore more diversity. The pathogens identified in this study can be used as a biological control agent against weeds in economically important plantation. This is first attempt to use molecular markers for taxonomic study of rust and smuts in Pakistan. The data generated in this study can be used for comparisons in future. The predictive modeling performed on selected pathogens can further be applied on large scale to determine the exact status of these fungal pathogens which are great threat to not only economically and ecologically important plants but also for the sustainability of forest ecosystem of Khyber Pakhtunkhwa and adjacent hills.

256

References

Afshan, N. S. (2009). A contribution to the rust flora of AJ & K (Azad Jammu & Kashmir) and adjacent Northern areas of Pakistan, Ph.D. thesis, Department of Botany, University of the Punjab, Lahore, Pakistan.

Afshan, N. S., & Khalid, A. N. (2008). New rust fungi on noxious weeds from Pakistan. Pak. J. Phytopathol., 20 (1), 82–87.

Afshan, N. S., & Khalid, A. N. (2009). New records of Puccinia and Pucciniastrum from Pakistan. Mycotaxon, 108, 137–146.

Afshan, N. S., Berndt, R., Khalid, A. N., & Niazi, A. R. (2008a). New graminicolous rust fungi from Pakistan. Mycotaxon, 104, 123–130.

Afshan, N. S., Khalid, A. N., & Javed, H. (2008b). Further additions to the rust flora of Pakistan. Pak. J. Bot., 40, 1285–1289.

Afshan, N. S., Khalid, A. N., & Niazi, A. R. (2008c). New records of graminicolous Rust Fungi from Pakistan. Pak. J. Bot., 40, 1279–1283.

Afshan, N. S., Khalid, A. N., & Niazi, A. R. (2008d). New records and distribution of rust fungi from Pakistan. Mycotaxon, 105, 257–267.

Afshan, N. S., Khalid, A. N., & Niazi, A. R. (2012a). Three new Caeomo species on Rosa spp. from Pakistan. Mycotaxon, 120, 239–246.

Afshan, N. S., Khalid, A. N., & Niazi, A. R. (2012b). New records of Puccinia species on Poaceae from Fairy Meadows, Pakistan. Mycotaxon, 120, 407–413.

Afshan, N. S., Khalid, A. N., & Niazi, A. R. (2012c). Some new rust fungi (Uredinales) from Fairy Meadows, Northern Areas, Pakistan. J. Yeast Fungal Res., 3(5), 65–73.

Afshan, N. S., Khalid, A. N., Iqbal, S. H., Niazi, A. R., & Sultan, A. (2009). Puccinia subepidermalis sp. nov. and new records of rust fungi from Fairy Meadows, Northern Pakistan. Mycotaxon, 110, 173–182.

Afshan, N. S., Khalid, A. N., Niazi, A. R., & Iqbal, S. H. (2011). New records of Uredinales from Fairy Meadows, Pakistan. Mycotaxon, 115, 203–213.

257

Afshan, N. S., Niazi, A. R., & Khalid, A. N. (2010). Three new species of rust fungi from Pakistan. Mycol. Progress, 9, 485–490.

Afshan, N.S., Khalid, A.N., Abbasi, M., & Niazi, A. R. (2007). New records of rust fungi for Pakistan. Mycotaxon, 101, 233–237.

Afzal, S. N., Haque, M. I., Ahmedani, M. S., Rauf, A., Munir, M., Firdous, S. S., Rattu, A. R., & Ahmad, I. (2008). Impact of stripe rust on kernel weight of wheat varieties sow in rain fed areas of Pakistan. Pak. J. Bot., 40(2), 923–929.

Ahmad, S. (1956a). Uredinales of Pakistan. Biologia, 2, 29–101.

Ahmad, S. (1956b). Ustilaginales of West Pakistan. Mycol. Pap., 64, 1–17.

Ahmad, S. (1969). Fungi of Pakistan. Biol. Soc. Pak, Lahore, Mon. 5. Supp. 1, 110

Ahmad, S. (1976). Contribution to the fungi of Pakistan. XVII. Sultania, 2, 17–21.

Ahmad, S., & Arshad, M. (1972). Contributions to the fungi of Pakistan. XV. Biologia, 18, 113–119.

Ahmad, S., Iqbal, S. H., & Khalid, A. N. (1997). Fungi of Pakistan. Sultan Ahmad Mycological society of Pakistan, Department of Botany, University of the Punjab, Lahore, Pakistan, pp1–248.

Aime, M. C. (2006). Toward resolving family-level relationships in rust fungi (Uredinales). Mycoscience, 47, 112–122.

Alexopoulos, C. J., Mims, C. W., & Blackwell, M. (1996). Introductory Mycology. John Wiley & Sons, New York, pp. 609–655.

Almaraz, T., Roux, C., Maumont, S., & Durrieu, G. (2002). Phylogenetic relationships among smut fungi parasitizing dicotyledons based on ITS sequence analysis. Mycol. Res., 106 (5), 541–548.

Arthur, J. C. (1934). Manual of the rusts in United States and Canada, Purdue Research Foundation, Lafayette, Indiana, pp1–438.

Asad, S., Iftikhar, S., Munir, A., Ahmad, I., & Ayub, N. (2007). Pathogenic diversity in Bipolaris sorokiniana isolates collected from different wheat growing areas of the Punjab and NWFP of Pakistan. Pak. J. Bot., 39 (6), 2225–2231.

258

Bahri, B., Shah, S., Hussain, S., Leconte, M., Enjalbert, J., & Pope, C. D. V. (2011). Genetic diversity of the wheat yellow rust population in Pakistan and its relationship with host resistance. Plant Pathology, 60, 649–660.

Barton, J. (2004). How good are we at predicting the ﬁeld host-range of fungal pathogens used for classical biological control of weeds. Biol. Control, 31, 99–122.

Bauer, R., Begerow, D., Oberwinkler, F., Piepenbring M., & Berbee M. L. (2001). Ustilaginomycetes, In McLaughlin, D., McLaughlin, E., & Lemke (eds.). Mycota VII. Systematics and Evolution. Springer, Berlin, p. 57–83.

Bauer, R., Oberwinkler, F., & Vanky, K. (1997). Ultrastructural markers and systematics in smut fungi and allied taxa. Can. J. Bot., 75, 1273–1314.

Begerow, D., Bauer, R., & Oberwinkler, F. (1997). Phylogenetic studies on the nuclear large subunit ribosomal DNA of smut fungi and related taxa. Can. J. Bot., 75, 2045–2056.

Begerow, D., Stoll, M., & Bauer, R. (2006). A phylogenetic hypothesis of Ustilaginomycotina based on multiple gene analyses and morphological data. Mycologia, 98 (6), 906–916.

Bibi, Y., Zia, M., & Qayyum, A. (2015). An overview of Pistacia integerrima a medicinal plant species: Ethnobotany, biological activities and phytochemistry. Pak. J. Pharm. Sci., 28 (3), 1009–1013.

Cao, Z.-m. Li, Z.Q., & Zhuang, J.-Y. (2000). Uredinales from the Qinling Mountains. II. Mycosystema, 19, 312–316.

Cash, E.K. (1954). A record of the fungi named by J.B. Ellis (Part 3). U.S.D.A. Special Publ., 2, 347–518.

Champion, H.G., Seth, S. K., & Khattak. G. M. (1965). Forest Types of Pakistan. Pakistan Forest Institute, Peshawar.

Cho, W. D., & Shin, H. D. (2004). List of plant diseases in Korea. Fourth edition. Korean Society of Plant Pathology, pp. 1–779.

Ciferri, R. (1938). Ustilaginales. In flora italica Cryptogama, Pars I. Fungi, Fasc.17, p. 101.

259

Cummins, G. B. (1971). The rust fungi of cereals, grasses and bamboos. Springer– Verlag, New York.

Cummins, G. B., & Hiratsuka, Y. (2003). Illustrated genera of rust fungi. Third ed. American phytopathological Society. APS press, St. Paul, MN, 1–210.

Cummins, G.B. (1978). Rust Fungi on legumes and composites in North America. University of Arizona Press, pp. 1–424.

Dade, H. A., & Gunnell, J. (1969). Class work with fungi. Common wealth Mycological Institute Kew, Surrey, England.

De Candolle, A. P. (1815). Uredo terebinthi DC. Flora francaise, Paris, France 6,71

Denchev, C. M. (1995). Bulgarian Uredinales. Mycotaxon, 55, 405–465.

Denchev, C. M., Fiaz, M., Denchev, T. T., Ahmad, H., & Khalid, A. N. (2012). Additions to the smut fungi of Pakistan 1. Mycotaxon, 121, 165–170.

Denchev, C. M., Fiaz, M., Denchev, T. T., Ahmad, H., & Khalid, A. N. (2013). Additions to the smut fungi of Pakistan 2. Mycotaxon, 123, 255–260.

Dixon, L. J., Castlebury, L. A., Aime, M. C., Glynn, N. C., & Comstock, J. C. (2010). Phylogenetic relationships of sugarcane rust fungi. Mycol Progress, 9(4), 459– 468.

Durrieu, G. (1980). Phylogeny of Uredinales on Pinaceae. Rep Tottori Mycol Inst., 18, 283–290.

Escudero, M. (2015). Phylogenetic congruence of parasitic smut fungi (Anthracoidea, Anthracoideaceae) and their host plants (Carex, Cyperaceae), Cospeciation or host-shift speciation? Am. J. Bot., 102 (7), 1108–14.

Farr, D.F., & Rossman, A.Y. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved December 25, 2016, from http://nt.ars-grin.gov/fungaldatabases/

Farr, D.F., & Rossman, A.Y. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved January 23, 2017, from http://nt.ars-grin.gov/fungaldatabases/

260

Fazal, H., Nisar, A., Rashid, A., & Farooq, S. (2010). A checklist of Phanerogamic flora of Haripur Hazara, Khyber Pakhtunkhwa, Pakistan, Pak. J. Bot. 42 (3), 1511–1522.

Fiaz, M. (2013). Species diversity of basidiomycetes of District Mansehra, Ph.D. thesis, Department of Botany, Hazara University,Mansehra,Pakistan.

Fiaz, M., Ahmad, H., Afshan, N. S., & Khalid, A. N. (2015). Some new records of Uredinales from Khyber Pakhtunkhwa, Pakistan. 130, 569–575.

Fiaz, M., Khalid, A. N., & Ahmad, H. (2013). Sporisorium linderi, a new record for Asia. Mycotaxon, 123, 229–231.

Fragoso, R. G. (1914). Nueva contribucion a la flora mycologica de Guadarrama (Teleomycetes, Deuteromycetes). Trab. Mus. Nac. Ci. Nat., Ser. Bot., 7, 20– 22.

French, A. M. (1989). California Plant Disease Host Index. Calif. Dept. Food Agric., Sacramento, pp. 1–394.

Gandhe, R.V. (2011). Ustilaginales of India. Bishen Singh Mahendra Pal Singh, Dehra Dun, India, pp. 1–414.

Gardner, D. E. (1988). Revisions to endemic Hawaiian rusts. Mycologia 80, 747–749.

Gardner, D. E. (1994). The native rust fungi of Hawaii. Canad. J. Bot., 72, 976–989.

Gardner, D. E., & Hodges Jr., C.S. (1989). The rust fungi (Uredinales) of Hawaii. Pacific Sci., 43, 41–55.

Ghaffar, A., & Kafi, A. (1968). Fungi of Karachi. Pak. J. Bot., 4, 195–208.

Gjaerum, H. B., & Iqbal, S. H. (1969). Some rust fungi from West Pakistan. Nytt. Mag. Bot., 16, 221–223.

Gottschalk, M., & Blanz, P. A. (1984). Highly conserved 5S ribosomal RNA sequences in four rust fungi and atypical 5S rRNA secondary structure in Microstroma juglandis. Nucleic Acids Res., 12, 3951–3958.

Hall, T. A. (1999). “BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT”. Nucl. Acids. Symp. Ser., 41, 95–98.

261

Hasnain, S. Z., Khan, A., & Zaidi, A. J. (1959). Rusts and smuts of Karachi. Bot. Deptt. Karachi Univ. Mont. 2, pp. 36.

Hiratsuka, N. (1958). Revision of taxonomy of the Pucciniastreae with Special Reference to Species of the Japanese Archipelago. KASAI Publishing and Printing Co., Tokyo, pp. 1–167.

Hiratsuka, N., Sato, S., Katsuys, K., Kakishima, M., Hiratsuka, Y., Kaneko, S., Ono, Y., Sato, T., Harada, Y., Hiratsuka, T., & Nakayama, K. (1992). The rust flora of Japan. Tsukuba Shuppankai, Tsukuba.

Hiratsuka, Y., & Cummins, G. (1963). Morphology of spermogonia of the rust fungi. Mycologia, 55, 487–507. http://www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=153090 http://www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=249291

Hussain, M., Kirmani, M. A. S., & Ehsan-ul-Haque. (2004). Pathotypes and man guided evolution of Pucciniastriiformis West and sp. tritici in Pakistan. In: Abstracts, Second Regional Yellow Rust Conference for Central & West Asia and North Africa, 22–26 March 2004, Islamabad, Pakistan. p. 21.

Hussain, S., Ahmad, H., Afshan, N.S., & Khalid, A.N. (2015). New reports of rust fungi from Malakand, Khyber Pakhtunkhwa, Pakistan Mycotaxon, 130 (3), 647–651.

Hylander, N., Jorstad, I., & Nannfeldt, J.A. (1953). Enumerato Uredinearum Scandinavicarum. Opera Bot., 1, 1–102.

Iqbal, S. H., & Khalid, A. N. (1996). Material for the fungus flora of Pakistan. II. An updated check list of rust fungi (Uredinales) of Pakistan. Sultania, 1, 39–67.

Iqbal, S. H., Khalid, A. N., Afshan, N. S., & Niazi, A. R. (2008). Rust fungi on Saccharum species of Pakistan. Mycotaxon, 106, 219–226.

Ishaq, A., Afshan, N. S., & Khalid, A. N. (2011). New records of poaceous rusts from Pakistan. Mycotaxon, 118, 237–244.

Ishaq, A., Afshan, N. S., & Khalid, A. N. (2013). New reports of cyperaceous rusts from Pakistan. Mycotaxon, 125, 189–192.

262

Ishaq, A., Afshan, N. S., Niazi, A. R., Aime, M. C., & Khalid, A. N. (2017). First Report of Rust Caused by Pucciniastrum guttatum on Galium sp. from Pakistan. Plant Disease, 101 (1), 245.

Israr, M., Shafi, M. M., Khan, N., Ahmad, N., Baig, S., & Khan, Z. H. (2009). Eco tourism in northern Pakistan and Challenges perspective of stakeholders. Sarhad J. Agric., 25 (1), 113–120.

Izumi, O., Kakishima, M., & Ono, Y. (1992). Uredinales collected in the Murree Hills, Pakistan. In: Cryptogamic flora of Pakistan, 1, 185–196.

Jiskani, M. M. (2001). Diseases of maize, millet and sorghum. Symptoms, perpetuation and control. Industry and Ecology, 34, 8–12.

Jorstad, I. (1962). Distribution of the Uredinales within Norway. Nytt Mag. Bot., 9, 61–134.

Jorstad, I., & Iqbal, S. H. (1967). Uredinales from west Pakistan. Nytt. Mag. Bot., 1, 71–87.

Jukes T. H., & Cantor C.R. (1969). Evolution of protein molecules. In Munro HN, editor, Mammalian Protein Metabolism, pp. 21–132, Academic Press, New York.

Kakishima, M., Okane, I., & Ono, Y. (1993a). Rust fungi (uredinales) of Pakistan collected in 1991. In: Cryptogamic flora of Pakistan, 2, 169–179.

Kakishima, M., Okane, I., & Ono, Y. (1993b). Graminicolous rust fungi (uredinales) from Pakistan In: Cryptogamic flora of Pakistan, 2, 181–186.

Kaneko, S. (1993). Parasitic fungi on woody plants from Pakistan. In: Cryptogamic flora of Pakistan, 2, 149–168.

Kendrick, B. (2000). The Fifth Kingdom. 3rd edition, Focus Publishing, R. Pullins Company. Newburyport MA 01950, USA.

Kenney, M. J. (1970). Comparative mophology of the uredia of the rust fungi. Purdue University, Indiana, pp. 1–152.

Khalid, A. N., & Afshan, N. S. (2009). Addition to the graminicolous rust fungi of Pakistan. Mycotaxon, 108, 175–183.

263

Khalid, A. N., & Iqbal, S. H. (1995). Aecidium gjaerumii nom. prov. on Phagnalon nevium Edgw. from Pakistan. Acta Scientica, 5 (1), 13–16.

Khalid, A. N., & Iqbal, S. H. (1996a). Additions to the rust flora of Pakistan. Pak. J. Bot., 28 (1), 115–117.

Khalid, A. N., & Iqbal, S. H. (1996b). New rusts from Pakistan. Can. J. Bot., 74, 506– 508.

Khalid, A. N., & Iqbal, S. H. (1997). Puccinia deosaiensis nom. prov. on Epipactishelleborine (L.) Grantz. Can. J. Bot., 75, 864–886.

Khalid, A. N., Afshan, N. S., & Elahi, H. (2010). Masseeella flueggeae on Flueggeavirosa, a new record for Pakistan. Mycotaxon, 114, 453–457.

Khalid, A. N., Iqbal, S. H., & Ahmad, F. (1993a). Rust flora of Pakistan. Uredinales collected in Salt Range, Pakistan. Sci. Int. (Lahore), 5(2), 211–214.

Khalid, A. N., Iqbal, S. H., & Ahmad, F. (1993b). Rust flora of Pakistan. II. Genus Phragmidium Link., on Rubus spp. Pakphyton, 5, 133–136.

Khan, S. A., & Kamal, M. (1968). The fungi of South West Pakistan. Pat 1. Pak. J. Sci & Ind. Res., 11, 61–80.

Khan, S. A. J. (1992). Studies on Fungi causing seed-borne diseases of Wheat and Rice and their control. Ph. D. thesis, Department of Botany, University of Karachi, Karachi.

Kirk, P. M., Cannon, P. F., Davil, J. C., & Stalpers, J. A. (2001). Dictionary of the Fungi. 9th ed. CAB International Wallingford, U.K.

Kirk, P. M., Cannon, P. F., Minter, D. W., & Staplers, J. A. (2008). Ainsworth & Bisby’s dictionary of fungi, 10th edn. CABI, Wallingford.

Kobayashi, T. (2007). Index of fungi inhabiting woody plants in Japan. Host, Distribution and Literature. Zenkoku-Noson-Kyoiku Kyokai Publishing Co., Ltd., pp. 1–1227.

Kropp, B. R., Hansen, D. R., Wolf, P. G., Flint, K. M., & Thomson, S. V. (1997). A study on the phylogeny of the Dyer‟s Woad rust fungus and other species of Puccinia from Crucifers. Phytopathology, 87, 565–571.

264

Kuprevich, V., & Transhel, V. (1957). Cryptogamic Plants of the USSR, Vol. IV, Rust Fungi. No. 1, Family Melampsoraceae. Acad. Sci. U.S.S.R., pp. 1–518.

Kyiashchenko, I. (2011). Taxonomic and phylogenetic study of rust fungi forming aecia on Berberis spp. in Sweden. Second cycle, A2E. Uppsala: SLU, Dept. of Forest Mycology and Plant Pathology.

Liang,Y. M., Tian, C. M., & Kakishima, M. (2006). Phylogenetic relationships on 14 morphologically similar species of Pucciniastrum in Japan based on rDNA sequence data. Mycoscience, 47 (3), 137–144

Long, W. H. (1914). Influence of the host on morphological characters of Puccinia ellisiana and Puccinia andropogonis. J. Ag. Res., 2, 303–319.

Magurran, A. E. (2004). Measuring Biological Diversity. Malden, MA: Blackwell Publishing.

Maier, W., Begerow, D., Weib, M., & Oberwinkler, F. (2003). Phylogeny of the rust fungi: an approach using nuclear large subunit ribosomal DNA sequences. Can. J. Bot., 81, 12–23.

Maier, W., Wingfield, B. D., Mennicken, M., Wingfield, M. J. (2007). Polyphyly and two emerging lineages in Puccinia and Uromyces. Mycol. Res., 111, 176–185.

Malik, S. A., & Khan, M. A. (1944). Parasitic fungi of North West Frontier Province. Ind. J. Agri. Sci., 13, 522–527.

Malik, S. A., & Virk (1968). Contribution to the knowledge of parasitic fungi of Quetta–Kalat region. Biologia, 14, 37–46.

Malik, S. A., Javaid, M. T., & Ahmad, M. (1968). New records of graminicolous rust fungi (Uredinales) from Pakistan. Sci. Int. (Lahore), 7(3), 415–416.

Marwat, K. B., Hashim, S., & Ali, H. (2010). Weed management: A case study from North–West Pakistan. Pak. J. Bot., 42, 341–353.

Masood, A., Khalid, A. N., & Iqbal, S. H. (1995). New records of graminicolous Rust Fungi (Uredinales) from Pakistan. Sci. Int. (Lahore) 7(3), 415–416.

Miller, M.A., Pfeiffer, W., & Schwartz, T. (2010). "Creating the CIPRES Science Gateway for inference of large phylogenetic trees" in Proceedings of the

265

Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA. pp. 1 – 8.

Myers, N., Russell, A., Mittermeier, C. Mittermeier, G., Gustavo, A. B., da Fonseca, & Jennifer, K. (2000). Biodiversity hotspots for conservation priorities. Nature, 403, 853–858

Official Newsletter of the WANA Seed Network. (2003). Seed Health Certification in Pakistan. International Center for Agricultural Research in the Dry Areas (ICARDA).

Okane, I., Kakishima, M., & Ono, Y. (1992). Uredinales collected in Murree Hills, Pakistan. In: Cryptogamic flora of Pakistan, Vol. 1, pp. 185–196 (Eds. T. Nakaike and S. Malik). Nat. Sci. Mus., Tokyo.

Ono, Y. (1992). Uredinales collected in Kaghan Valley, Pakistan. In: Cryptogamic flora of Pakistan, 1, 217–240.

Ono, Y., & Izumi, O. (1995). Uredinales collected in Nanga Parbat Area, Pakistan.In: Cryptogamic flora of Pakistan, 3, 61–68.

Ono, Y., & Kakishima, M. (1992). Uredinales collected in swat Valley, Pakistan. In: Cryptogamic flora of Pakistan, 1, 197–216.

Ono, Y., & Kakishima, M. (1993). Smut Fungi (Ustilaginales) Collected in Pakistan. In: Cryptogamic flora of Pakistan, 2, 187–214.

Pfunder, M., Schürch, S., & Roy, B. A. (2001). Sequence variation and geographic distribution of pseudoflower-forming rust fungi (Uromyces pisis. lat.) on Euphorbia cyparissias. Mycol. Res., 105, 57–66.

Piepenbring, M. (2002). Diversity, taxonomy, and ecology of plant parasitic smut fungi in Bolivia. Ecología en Bolivia, 37 (1), 49–58.

Piepenbring, M., Yilmaz, E., & Weisenborn, J. L. F. (2013). Two new records of smut fungi for Panama and new combinations into the genus Tolyposporium. Tropical Plant Pathology, 38 (1), 3–10.

Roy, B. A., Vogler, D. R., Bruns, T. D., & Szaro, T. M. (1998). Cryptic species in the Puccinia monoica complex. Mycologia, 90, 846–853.

266

Saba, M., & Khalid A. N. (2013). Species diversity of genus Puccinia (Basidiomycota, Uredinales) parasitizing poaceous hosts in Pakistan. Int. J. Agric. Biol., 15, 580–584

Saba, M., Khalid, A. N., & Berndt, R. (2012). Hyalopsora nodispora is the new holomorph name for Uredo capilli-veneris (Uredinales, Pucciniastraceae) from Pakistan. Mycol. Progress, 11, 967–969.

Saba, M., Khalid, A.N., & Afshan, N. S. (2011). Species of the genus Uromyces (Basidiomycota: Pucciniales) from Leepa Valley, Azad Jammu and Kashmir (AJ and K), Pakistan. African Journal of Biotechnology, 10 (73), 16480– 16483.

Saba, M., Niazi, A. R., & Khalid, A. N. (2013). New records of Uredinales (Basidiomycota) from Azad Jammu and Kashmir and adjacent Northern Areas of Pakistan. Int. J. Agric. Biol., 15, 878‒884.

Sadiqullah, Ishaq, A., Fiaz, M., Afshan, N. S., & Khalid, A. N. (2014). A new report of Uromyces ambiens on Buxus from Pakistan. Mycotaxon, 129 (2), 429–432.

Sato, S., Katsuya, K., Hiratsuka, Y. (1993). Morphology, taxonomy and nomenclature of Tsuga-Ericaceae rusts. Trans. Mycol. Soc. Jpn., 34, 47–62.

Sato, T., & Sato, S. (1985). Morphology of aecia of the rust fungi. Trans. Br. Mycol. Soc., 85 (2), 223–238.

Shad, A. A., Sha, H. U., Bakht, J., Choudhary, M. I., & Ullah, J. (2011). Nutracutical potential and bioassay of Apiumgraveolens L. grown in Khyber Pakhtunkhwa– Pakistan. J. Med. Plants Res., 5 (20), 5160–5166.

Sheikh, M. I. (1993). Trees of Pakistan, Winrock Institute for Agricultural Development/ GOP-USAID Forestry Planning and Development Project, p. 42. Pictorial Printers (Pvt.), Islamabad, Pakistan.

Shivas, R.G., Vanky, K., Vanky, C., Kula, G.R., & Gavali, V. (2001). An annotated check list of Ustilaginomycetes in Papua New Guinea. Australas. Pl. Pathol., 30, 231–237.

267

Sjamsuridzal, W., Nishida, H., Ogawa, H., Kakishima, M., & Sugiyama, J. (1999). Phylogenetic positions of rust fungi parasitic on ferns: evidence from 18S rDNA sequence analysis. Mycoscience, 40, 21–27.

Spaulding, P. (1961). Foreign Diseases of Forest Trees of the World. U.S.D.A. Agric. Handb., 197, 1–361.

Stevens, F. L. (1925). Hawaiian Fungi. Bernice P. Bishop Mus. Bull., 19, 1–189.

Stoll, M., Begerow, D., & Oberwinkler, F. (2005). Molecular phylogeny of Ustilago, Sporisorium, and related taxa based on combined analyses of rDNA sequences. Mycol. Res., 109, 342–356.

Sultan, M. A. (2005). Taxonomic studies of rust flora of northern areas of Pakistan, Ph.D. thesis, Department of Botany, University of the Punjab, Lahore, Pakistan.

Sultan, M. A., Cvetemore, D., Haq, I. & Khalid, A. N. (2007). A new record of Bauhinus piperi (Microbotryales) from Pakistan. Mycotaxon, 100, 1031–1035.

Sultan, M. A., Haq, I., Khalid, A. N., & Mukhtar, H. (2008). Two new anamorphic rust fungi from northern areas of Pakistan. Mycotaxon, 105, 23–27.

Sydow, H., & Ahmad, S. (1939). Fungi punjabensis. Trans. Br. mycol. Soc., 83 (1), 439–447.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol., 30 (12), 2725–2729.

Toome, M., & Aime, M. C. (2015). Reassessment of rust fungi on weeping willows in the Americas and description of Melampsora ferrinii sp. nov. Plant Pathology 64, 216–224.

Tunali, B., Yildirim, A., Aime, M. C., Hernández, J., & Berner, D. (2005). First Report of the Rust Fungus Coleosporium tussilaginis on Tussilago farfara in Turkey. Plant Disease, 89 (10), 1131.

Usman, M., Ishaq, A., Afshan, N. S., Niazi, A. R., & Khalid, A. N. (2016a). Diversity and distribution of rust fungi causing plant diseases in Swat district, Khyber Pakhtunkhwa. Sci. Int. (Lahore), 28 (4), 3993–4000.

268

Usman, M., Saduqullah, Afshan, N. S., Niazi, A. R., & Khalid, A. N. (2016b). New host records for pathogenic fungi in Pakistan. Sci. Int. (Lahore), 28 (3), 3083– 3087.

Van der Merwe, M., Ericson, L., Walker, J., Thrall, P. H., & Burdon, J. J. (2007). Evolutionary relationshipsamong species of Puccinia and Uromyces (Pucciniaceae, Uredinales) inferred from partial protein coding gene phylogenies. Mycol. Res., 111, 163–175.

Vánky, K. (1994). European smut fungi. Gustav Fischer Verlag, Stuttgart, Jena, New York, pp. 1–554.

Vánky, K. (2000). Taxonomical studies on Ustilaginales. XX. Mycotaxon, 74, 161– 215.

Vánky, K. (2007). Smut fungi of the Indian subcontinent. Polish Academy of sciences, W. Szafer Institute of Botany, p. 4.

Vánky, K. (2011). Smut fungi of the world. APS Press, St. Paul, Minnesota, USA, pp. 1–1458.

Vánky, K., & Vánky, C. (2002). An annotated checklist of Ustilaginomycetes in Malawi, Zambia and Zimbabwe. Lidia, 5, 157–176.

Vanky, K., Iqbal, S. H., & Khalid, A. N. (2007). Thecaphora pakistanica sp. nov. (Ustilaginomycetes) on Androsace (Primulaceae). Mycologia Balcanica, 4, 92–95.

Vogler, D. R., & Bruns, T. D. (1998). Phylogenetic relationships among the pine stem rust fungi (Cronartium and Peridermium spp.). Mycologia, 90, 244–257.

Webster, J., & Weber, R. W. S. (2007). Introduction to Fungi. Cambridge University Press, pp. 487–657.

Wilson, M., & Henderson, D. M. (1966). British rust fungi, Cambridge University Press, Cambridge.

Wingfield, B. D, Ericson, L., Szaro, T., & Burdon, J. J. (2004). Phylogenetic patterns in the Uredinales. Australas Plant Pathol., 33, 327–335.

269

Worldclim. (2011). Bioclimatic layers online (http://www.worldclim.org/current), accessed on: 05/09/2016.

Yohem, K.H., Cummins, G.B., & Gilbertson, R.L. (1985). Revised list and host index of Arizona rust fungi. Mycotaxon, 22, 451–468.

Yun, H. Y., Minnis, A. M., Kim, Y. H., Castlebury, L. A., & Aime, M. C. (2011). The rust genus Frommeëlla revisited: a later synonym of Phragmidium after all. Mycologia, 103 (6), 1451–1463.

Yun, H.Y. Systematic Mycology and Microbiology Laboratory, ARS, USDA. . Invasive Fungi. Asian pistacio rust-Pileolaria pistaciae. Retrieved August 5, 2016, from /sbmlweb/fungi/index.cfm.

Yun, Z. (1991). A taxonomic revision of Chinese species of Puccinia on the plants belonging to Ranales. Mycosystems, 4, 73–86.

Zambino, P. J., & Szabo, L. J. (1993). Phylogenetic relationships of selected cereal and grass rusts based on rDNA sequence analysis. Mycologia, 85, 401–414.

Zhuang, W. Y., Ed. (2001). Higher Fungi of Tropical China. Mycotaxon, Ltd., Ithaca, NY, pp. 1–485.

Zuluaga, C. 1., Buriticá, P., & Marín, M. (2011). Phylogenetic analysis of rust fungi (Uredinales) from the Colombian Andean region using 28S ribosomal DNA sequences. Rev. Biol. Trop., 59 (2), 17–40.

270

Table: Primers used to amplify ITS & LSU regions of rust and smut fungi.

Primer Sequence 5′-3′ Region Amplified Reference Name Rust2Inv GATGAAGAACACAGTGAAA 5.8S subunit, internal Aime, 2006 transcribed spacer region 2 (ITS-2), and the large subunit (28S) ITS1F CTTGGTCATTTAGAGGAAGTAA Internal transcribed Gardes & spacer region 1 (ITS1), Bruns 5.8S subunit and internal (1993) transcribed spacer region 2 (ITS-2) 1TS4 TCCTCCGCTTATTGATATGC Internal transcribed White et al. spacer region 1 (ITS1), (1990) 5.8S subunit and internal transcribed spacer region 2 (ITS-2) LROR GTACCCGCTGAACTTAAGC large subunit (28S) Rehner & Samuels (1994) LR5 ATCCTGAGGGAAACTTC large subunit (28S) Vilgalys & Hester (1990) LR6 CGCCAGTTCTGCTTACC large subunit (28S) Vilgalys & Hester (1990)

Aime, M. C. (2006). Toward resolving family-level relationships in rust fungi (Uredinales). Mycoscience, 47, 112–122. Gardes, M., and Bruns, T. D. (1993). ITS primers with enhanced specificity for basidiomycetes--application to the identification of mycorrhizae and rusts. Mol Ecol; 2(2),113-118. Rehner, S. A., and G. J. Samuels. (1994). Taxonomy and phylogeny of Gliocladium analyzed from nuclear large subunit ribosomal RNA sequences. Mycol. Res., 998, 625-634. Vilgalys, R., and Hester, M. (1990). Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology, 172, 4239-4246. White, T.J., Bruns, T., Lee, S., Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications. Academic Press, New York, USA: 315–322.

Table: Sequence data used to construct the phylogenetic trees of smuts.

Sr. Species Host Origin GenBank Source no. accession no.

1. Sporisorium aegypticum Schismus arabicus Iran I: AY344970 Ust. Exs. 756 L: AY740129 (M)

2. S. andropogonis Bothriochloa Ecuador I: AY740042 56588 (M) saccharoides (as L: AY740095 Andropogon saccharoides)

3. S. andropogonis- Capillipedium Australia I: AY740047 56595 (M) micranthi (as spicigerum L: AY740100 Sporisorium capillipedii)

4. S. arthraxonis Arthraxon lanceolatus China I: AY740046 56592 (M) L: AY740099

5. S. cruentum Sorghum halepense USA I: AY344974 Ust. Exs. 687 Pers. L: AF453939 (M)

6. S. dimeriae- Dimeria ornithopoda India I: AY344977 Ust. Exs. 848 ornithopodae L: AY740132 (M)

7. S. fastigiatum Andropogon angustatus Nicaragua I: AY344978 MP 1976 L: AY740133 (USJ)

8. S. foveolati Eremopogon foveolatus Canary I: AY740050 MP 2365 Islands L: AY740103 (TUB)

9. S. lacrymae-jobi Coix lacryma-jobi India I: AY740052 56611 (M) L: AY740105

10. S. lepturi Hemarthrina uncinata Australia I: AY344981 Ust. Exs. 966 L: AY740135 (M)

11. S. manilense (as Sacciolepis indica India I: AY740059 Ust. Exs. 854 Sporisorium L: AY740112 (M) sacciolepidis)

12. S. modestum Enneapogon avenaceus Australia I: AY740054 56617 (M) L: AY740107

13. S. monakai Isachne globosa India AY740161 56618 (M)

14. S. moniliferum Heteropogon contortus Indonesia I: AY344984 Ust. Exs. 851 L: AF453940 (M)

15. S. ophiuri Rottboellia Unknown I: AY740019 HB20 cochinchinensis L: AJ236136

16. S. paspali-notati Paspalum notatum Cuba I: AY344982 MP 2101

L: AF453944 (HAJB)

17. S. pseudechinolaenae Pseudechinolaena Indonesia I: AY344989 Ust. Exs. 853 polystachya L: AY740139 (M)

18. S. puellare Hyparrhenia hirta Canary I: AY740058 MP 2372 Islands L: AY740111 (TUB)

19. S. pulverulentum Saccharum strictum Yugoslavia AY740162 56627 (M)

20. S. reilianum Sorghum halepense Greece AY740163 Ust. Exs. 527 (M)

21. S. sorghi Sorghum bicolor Nicaragua I: AY740021 MP 2036a L: AF009872 (USJ)

22. S. trachypogonicola Trachypogon pulmosus Cuba I: AY344992 MP 2463 L: AY740141 (HAJB)

23. S. trachypogonis- T. pulmosus Venezuela I: AY740060 56635 (M) plumosi L: AY740113

24. Ustilago affinis Stenotaphrum Costa Rica AY344995 56514 (M) secundatum

25. U. austro-africana Enneapogon Zimbabwe I: AY740061 56516 (M) cenchroides L: AY740115

26. U. bouriqueti Stenotaphrum La Reunion AY740167 56517 (M) dimdiantum

27. U. bromina Unknown Israel KF381008 HAI 4721

28. U. bromina Unknown Israel KF381007 ISC 27222

29. U. chloridis Unknown Australia JN872444 Unknown

30. U. crameri Setaria italic India I:AY344999 Ust. Exs. 995 L:AY740143 (M)

31. U. cynodontis Unknown India KP834590 UC3

32. U. cynodontis Cynodon dactylon Mexico AY740168 MP1838 (XAL)

33. U. drakensbergiana Digitaria South AY740169 56523 (M) tricholaenoides Africa

34. U. esculenta Ziana latifolia Taiwan I: AY345002 Ust. Exs. 540 L: AF453937 (M)

35. U. esculentagenes Unknown Japan AB211929 MAFF305619

36. U. lituana Triodia epactia Unknown HQ013119 BRIP 46795

37. U. maydis Cultured on Sweden DQ025484 Unknown Exodasidium

38. U. nunavutica Unknown Israel KF381025 DAOM 91211

39. U. panici-gracilis Paspalidium Unknown HQ170519 BRIP 43942

caespitosum

40. U. shanxiensis Unknown China KY105788 CBS:10075

41. U. shanxiensis Unknown Taiwan FJ515182 strain SN37

42. U. spermophora Eragrostis ferruginea n. a AY740171 F 565/H.U.V. 13634

43. U. striiformis Alopecurus pratenssis Germany AY740172 H.U.V. 18286

44. U. striiformis Unknown Israel KF381024 ISC 13766

45. U. tritici Unknown China JN114419 PDSUT2

46. U. xerochloae Xerochloa imberbis Australia I: AY345012 Ust. Exs. 1000 L: AY740149 (M)