Tesis Doctoral 2014 Filogenia Y Evolución De Las Poblaciones Ambientales Y Clínicas De Pseudomonas Stutzeri Y Otras Especies

TESIS DOCTORAL 2014

FILOGENIA Y EVOLUCIÓN DE LAS POBLACIONES AMBIENTALES Y CLÍNICAS DE PSEUDOMONAS STUTZERI Y OTRAS ESPECIES RELACIONADAS

Claudia A. Scotta Botta

TESIS DOCTORAL 2014

Programa de Doctorado de Microbiología Ambiental y Biotecnología

FILOGENIA Y EVOLUCIÓN DE LAS POBLACIONES AMBIENTALES Y CLÍNICAS DE PSEUDOMONAS STUTZERI Y OTRAS ESPECIES RELACIONADAS

Claudia A. Scotta Botta

Director/a: Jorge Lalucat Jo Director/a: Margarita Gomila Ribas Director/a: Antonio Bennasar Figueras

Doctor/a por la Universitat de les Illes Balears

Index

Index ……………………………………………………………………………..... 5 Acknowledgments ………………………………………………………………... 7 Abstract/Resumen/Resum ……………………………………………………….. 9 Introduction ………………………………………………………………………. 15 I.1. The genus Pseudomonas ………………………………………………….. 17 I.2. The species P. stutzeri ………………………………………………...... 23 I.2.1. Definition of the species …………………………………………… 23 I.2.2. Phenotypic properties ………………………………………………. 23 I.2.3. Genomic characterization and phylogeny ………………………….. 24 I.2.4. Polyphasic identification …………………………………………… 25 I.2.5. Natural transformation ……………………………………………... 26 I.2.6. Pathogenicity and antibiotic resistance …………………………….. 26 I.3. Habitats and ecological relevance ………………………………………… 28 I.3.1. Role of mobile genetic elements …………………………………… 28 I.4. Methods for studying Pseudomonas taxonomy …………………………... 29 I.4.1. Biochemical test-based identification ……………………………… 30 I.4.2. Gas Chromatography of Cellular Fatty Acids ...... 32 I.4.3. Matrix Assisted Laser-Desorption Ionization Time-Of-Flight Mass Spectrometry ...... 32 I.4.4. DNA-DNA hybridization and G+C %mol content ...... 35 I.4.5. Multilocus sequence analysis ...... 35 Objectives …………………………………………………………………………. 37 Chapter 1: Identification and genomovar assignation of clinical strains of Pseudomonas stutzeri .…………………………………………………………….. 41 1.1. Introduction ………………………………………………………………. 43 1.2. Methods …………………………………………………………………... 44 1.3. Results ……………………………………………………………………. 45 1.4. Discussion ………………………………………………………………… 49 1.5. Supplemental material ……………………………………………………. 52 Chapter 2: Whole-cell MALDI-TOF mass spectrometry and multilocus sequence analysis in the discrimination of Pseudomonas stutzeri populations: three novel genomovars ………………………………………………………….. 61 2.1. Introduction ………………………………………………………………. 63 2.2. Methods …………………………………………………………………... 64 2.2.1. Strains studied and growth conditions ……………………………... 64 2.2.2. DNA extraction, PCR and sequencing protocols ………………….. 64 2.2.3. Sequence analysis ………………………………………………….. 66 2.2.4. DNA-DNA Hybridisation …………………………………………. 67 2.2.5. Phenotypic Tests …………………………………………………… 67 2.2.6. WC-MALDI-TOF Mass Spectrometry ……………………………. 67 2.2.7. Nucleotide Sequence Accession Numbers ………………………… 68 2.3. Results ……………………………………………………………………. 68 2.3.1. MLSA ……………………………………………………………… 68 2.3.2. Whole-Cell MALDI-TOF Mass Spectrometry ……………………. 74 2.4. Discussion ………………………………………………………………… 76 2.5. Supplemental material ……………………………………………………. 78 Chapter 3: Concordance between whole-cell matrix-assisted laser- desorption/ ionization time-of-flight mass spectrometry and multilocus sequence analysis approaches in species discrimination within the genus Pseudomonas ……………………………………………………………………… 99

Index

3.1. Introduction ………………………………………………………………. 101 3.2. Methods …………………………………………………………………... 103 3.2.1. Bacterial strains and culture conditions ……………………………. 103 3.2.2. Sequencing conditions and sequence analysis …………………….. 103 3.2.3. WC-MALDI-TOF mass spectrometry …………………………….. 104 3.3. Results ……………………………………………………………………. 106 3.3.1. Multilocus sequence analysis ……………………………………… 106 3.3.2. WC-MALDI-TOF MS analysis ……………………………………. 107 3.3.3. Resolution at the group and subgroup level within the genus Pseudomonas ……………………………………………………………... 111 3.3.4. Resolution at the genus and species levels ………………………… 113 3.4. Discussion ………………………………………………………………… 114 3.5. Supplemental material ……………………………………………………. 116 Chapter 4: Environmental microbiota represents a natural reservoir for dissemination of clinically relevant metallo--lactamases …………………….. 117 4.1. Introduction ………………………………………………………………. 119 4.2. Methods and Results ……………………………………………………… 119 Chapter 5: Taxonomic characterisation of ceftazidime-resistant Brevundimonas isolates and description of Brevundimonas faecalis sp. nov. … 127 5.1. Introduction ………………………………………………………………. 129 5.2. Methods and Results ……………………………………………………… 130 5.3. Description of Brevundimonas faecalis sp. nov. …………………………. 136 5.4. Supplemental material ……………………………………………………. 137 Conclusions ……………………………………………………………………….. 149 References ………………………………………………………………………… 153

Acknowledgments

Agradecimientos

Quisiera agradecer en general a todas las personas que han estado presentes durante en esta etapa de mi vida.

Quiero agradecer por orden histórico al Dr. Rafael Bosch por sus valiosas clases que fueron mi primer “enganche” a la Microbiología, el me transmitió su pasión por allá en el 2004 cuando cursaba Métodos y Técnicas de Microbiología y me dio la oportunidad de colaborar en algunos proyectos con Celia.

A Jorge Lalucat por ser mi director de tesis y encontrar un momento para mí incluso siendo decano de la Universidad. Gracias por aportar siempre una solución a cualquier problema que se me presentaba, por respetar mis decisiones y mi manera de trabajar y sobre todo por enseñarme a ser autónoma. Siento una profunda admiración por ti porque logras guiarnos a todos y sacar lo mejor de cada uno para alcanzar un proyecto común. Gracias también por tu aliento y paciencia en estos últimos años alejada del laboratorio.

A Elena por las charlas y discusiones que empezaban con genomovares y terminaban en recetas de empanadas e historias de hijos y madres. Tengo el recuerdo de tu despacho lleno de papeles entre los cuales siempre encontrabas “esa” lista de gliceroles o “ese” artículo que estaba necesitando… Gracias.

Gracias a Toni Bennasar por enseñarme el lado más moderno de la microbiología, buscando nuevos experimentos y técnicas por aplicar, por insistirme en leer mucho y tenerme paciencias en mis comienzos.

Gracias a los demás profesores del laboratorio por las enseñanzas no solo teóricas sino del trabajo diario en el laboratorio. Gracias Balbi por obligarme a usar la bata e inculcarme buenos hábitos de trabajo y por organizar tan enriquecedores seminarios.

Y bueno, les llega el turno a los compañeros del laboratorio. Qué les puedo decir que no sepan ya. Qué los adoro! Qué buen equipo humano tenemos en el labo! Siempre nos ayudamos y apoyamos entre todos. Gracias por ser no solo compañeros de laboratorio sino amigos. Fue una suerte poder trabajar con todos ustedes. Con Cris y más tarde con Claudia P. siempre liadas con los muestreos… colapsando la cabina; con Magda y David peleándonos por los turnos de PCR, que risas siempre en el labo cuando hacíamos PCRs con Mariana y cantábamos las cantidades de primers como si fuera el sorteo de navidad… Tengo infinitos recuerdos y experiencias inolvidables con todos (no me olvido de Joseph, Mariuchi, Joaneta, Sebas, Lady, Arantxa, Toni B., Zoyla, Celia, Laura, Mariette, Pau, Farith, Mohamed, etc). Gracias a todos.

Muchas gracias a Sebastián Albertí, Antonio Oliver, Carlos Juan y Antonio Ramirez por su colaboración en el estudio de aguas fecales de Son Llàtzer.

Acknowledgments

Muchas gracias Francisca Barceló y Jesús Prades por abrirme las puertas de la investigación en UIB y enseñarme lo que es la tenacidad y constancia.

Gracias a Aina y Andreu en la recepción del edificio aportando una sonrisa cada mañana al llegar, a las chicas de limpieza y los mozos que nos ayudaron siempre a que todo funcione bien en el laboratorio.

Muchas gracias a toda mi familia y amigos por su apoyo, por entender mis tantas ausencias.

Dejo para lo último y no por eso menos importante a mi querida amiga y directora Margarit. No me alcanzan las palabras para agradecerte todo los que me has dado en estos años a nivel profesional y personal. Esta tesis no hubiera sido posible sin tu ayuda, has estado en cada detalle, con la ayuda precisa y más. El tiempo que me has dedicado no tiene precio…has sido mi cable a tierra estos últimos años de maternidad y esta tesis te la dedico a ti.

Gracias por aportarme tantas cosas buenas y sobre todo por aguantarme!

Quiero agradecer a la Conselleria d’Economia, Hisenda i Innovacio del Govern de les Illes Balears por brindarme la oportunidad de realizar esta Tesis con una beca predoctoral para la formación de personal investigador (FPI2007) y a la Dirección general de Investigación por el proyecto CGL2006-09719/BOS en el cual se ha enmarcado esta tesis.

Abstract

Abstract: “Phylogeny and Evolution of Environmental and Clinical Populations of Pseudomonas stutzeri and related species”.

Pseudomonas stutzeri is a widely distributed species with very high genetic diversity and metabolic capacities, occupying many diverse ecological niches. In the first chapter, the identification of Pseudomonas stutzeri clinical isolates through conventional phenotypic methods was compared with identification through partial rpoD gene sequencing. We observed that commercial phenotypic systems easily confuse P. stutzeri with other Pseudomonas species. We also demonstrated that most of the clinical strains of P. stutzeri herein studied (79%) belonged to genomovar 1 of the species. We propose the use of partial rpoD gene sequence analysis as a complementary molecular tool for the precise routine identification and genomovar assignation of P. stutzeri clinical isolates, as well as for typing and epidemiological studies. In the second chapter, a collection of 229 P. stutzeri strains isolated from different habitats and geographical locations has been characterized phylogenetically, by MLSA, and phenotypically by WC-MALDI-TOF MS. Both methods showed coherence in strain grouping; 226 strains were allocated in the 18 genomovars known presently. The remaining three strains are proposed as references for three novel genomovars in the species. The correlation and usefulness of sequence-based phylogenetic analysis and whole-cell MALDI-TOF mass spectrometry, which are essential for studies in microbial ecology, is discussed for the differentiation of P. stutzeri populations.

Multilocus sequence analysis (MLSA) is one of the most accepted methods for the phylogenetic assignation of Pseudomonas strains to their corresponding species. Updated databases are essential for correct bacterial identification and the number of Pseudomonas species is increasing continuously. Novel species have been described since the publication of the last comprehensive MLSA phylogenetic study based on the sequences of the 16S rDNA, gyrB, rpoB and rpoD genes. Therefore, in the third chapter an update of the sequence database is presented, together with the analysis of the phylogeny of the genus Pseudomonas. Whole-cell matrix-assisted laser- desorption/ionization time-of-flight (WC-MALDI-TOF) mass spectrometry (MS) analysis has been applied very recently to the identification of bacteria and is considered a fast and reliable method. A total of 133 type strains of the recognized species and subspecies in the genus Pseudomonas, together with other representative strains, were analyzed using this new technique, and the congruence between the WC-MALDI-TOF MS and MLSA techniques was assessed for the discrimination and correct species identification of the strains. The utility of both methods in the identification of environmental and clinical strains is discussed.

Chapter four describes how Pseudomonas and related species can act as environmental reservoir for antibiotic resistance genes. A total of 10 metallo--lactamase-producing isolates of six different species, including Brevundimonas diminuta (n=3), Rhizobium radiobacter (n=2), Pseudomonas monteilii (n= 1), Pseudomonas aeruginosa (n =2),

Abstract

Ochrobactrum anthropi (n = 1), and Enterobacter ludwigii (n = 1), were detected in the sewage water from Son Llàtzer Hospital in Mallorca, Spain. The presence of blaVIM-13 associated with a Tn1721-class 1 integron structure was detected in all but one of the isolates (E. ludwigii, which produced VIM-2), and in two of them (R. radiobacter), this structure was located on a plasmid, suggesting that environmental bacteria represent a reservoir for the dissemination of clinically relevant metallo--lactamase genes.

Chapter five describes the taxonomic characterization of the Brevundimonas isolates (formerly Pseudomonas) described in chapter four. Three ceftazidime-resistant strains isolated from the sewage water of a municipal hospital in Palma de Mallorca, Spain, were analysed phenotypically and genotypically to clarify their taxonomic positions. Sequence determinations and phylogenetic analyses of the 16S rRNA genes indicated that strains CS20.3T, CS39 and CS41 were affiliated with the species of the alphaproteobacterial genus Brevundimonas, most closely related to B. bullata, B. diminuta, B. naejangsanensis and B. terrae. Additional sequences analyses of the ITS1 region of the rRNA operon and the genes for the housekeeping enzymes DNA gyrase β- subunit and RNA polymerase β-subunit, genomic DNA-DNA hybridisation similarities, cell fatty acid profiles and physiological and biochemical characterizations supported the recognition of CS20.3T (CCUG 58127T = CECT 7729T) as a distinct and novel species, for which the name Brevundimonas faecalis sp. nov. is proposed. Strains CS39 and CS41 were ascribed to the species B. diminuta.

Resumen

Resumen: “Filogenia y evolución de las poblaciones ambientales y clínicas de Pseudomonas stutzeri y otras especies relacionadas”.

Pseudomonas stutzeri es una especie que ocupa diversos nichos ecológicos y destaca por su gran diversidad genética y capacidades metabólicas. En el primer capítulo, se compara la utilización de métodos fenotípicos convencionales con el análisis de la secuencia parcial del gen rpoD para la identificación de aislamientos clínicos de Pseudomonas stutzeri. Observamos que los sistemas fenotípicos comerciales confunden fácilmente a P. stutzeri con otras especies de Pseudomonas. Comprobamos además, que la mayoría de las cepas clínicas de P. stutzeri de este estudio (79%) pertenecían a la genomovar 1 de la especie. Se propone el uso del análisis de la secuencia parcial del gen rpoD como una herramienta molecular precisa para la identificación rutinaria y la asignación a genomovar de los aislamientos clínicos de P. stutzeri, En el segundo capítulo, una colección de 229 cepas de P. stutzeri aisladas de diferentes hábitats y localizaciones geográficas se caracterizaron filogenéticamente, mediante el análisis de de secuencias multilocus, y fenotípicamente por espectrometría de masas a partir de colonias (Whole-cell Matrix-assisted Laser-Desorption/Ionization Time-of-Flight Mass Spectrometry, WC-MALDI-TOF MS). La agrupación de las cepas fue congruente en ambos métodos; 226 cepas fueron asignadas a las 18 genomovares conocidas actualmente. Las tres cepas restantes se proponen como cepas de referencia para tres nuevas genomovares de la especie. En este capítulo se analiza la correlación y la utilidad del análisis filogenético basado en el análisis de secuencias multilocus y de la espectrometría de masas (WC-MALDI-TOF MS), para el estudio de poblaciones de P. stutzeri.

El análisis de secuencias multilocus (MLSA) es uno de los métodos más aceptados para la asignación filogenética de cepas de Pseudomonas a sus correspondientes especies. Dado que el número de especies de Pseudomonas está aumentando continuamente, es esencial mantener las bases de datos de secuencias actualizadas, para asegurar así una correcta identificación bacteriana. Desde la publicación del último estudio filogenético integral basado en las secuencias de los genes 16S rDNA, gyrB, rpoB y rpoD se han descrito nuevas especies. Por lo tanto, en el tercer capítulo se presenta una actualización de la base de datos de secuencias, junto con el análisis de la filogenia del género Pseudomonas. La espectrometría de masas (WC-MALDI-TOF) se ha aplicado recientemente a la identificación de bacterias y se considera un método rápido y fiable. Un total de 133 cepas tipo de las especies y subespecies reconocidas del género Pseudomonas, junto con otras representantes, se analizaron mediante esta nueva técnica. Luego, se evaluó la congruencia entre las técnicas MLSA y WC-MALDI-TOF MS para una discriminación e identificación correcta de las especies del género. Se discute la utilidad de ambos métodos en la identificación de cepas ambientales y clínicas.

El capítulo cuatro describe cómo Pseudomonas y otras especies relacionadas pueden actuar como reservorio ambiental de genes de resistencia a antibióticos. Se investigó

Resumen una salida de aguas residuales del Hospital Son Llàtzer (Mallorca, España) y se encontraron un total de 10 aislamientos productores de metalo-β-lactamasa pertenecientes a seis especies diferentes, incluyendo Brevundimonas diminuta (n = 3), Rhizobium radiobacter (n = 2), Pseudomonas monteilii (n = 1), Pseudomonas aeruginosa (n = 2), Ochrobactrum anthropi (n = 1), y Enterobacter ludwigii (n = 1). Se detectó la presencia de un integrón de clase 1 asociado al trasposon Tn1721 que contiene el gen de resistencia blaVIM-13 en todos menos uno de los aislamientos (E. ludwigii, que produjo blaVIM-2), y en dos de ellos (R. radiobacter), esta estructura estaba ubicada en un plásmido, lo que sugiere que las bacterias ambientales representan un reservorio para la difusión de genes metalo-β-lactamasa clínicamente relevantes.

El capítulo cinco describe la caracterización taxonómica de los aislamientos de Brevundimonas (anteriormente Pseudomonas) descritos en el capítulo cuatro. Tres cepas resistentes a ceftazidima aisladas de las aguas residuales del Hospital Son Llatzer de Palma de Mallorca, España, se analizaron fenotípica y genotípicamente para aclarar sus posiciones taxonómicas. El análisis filogenético del gen 16S rRNA indicaba que los aislamientos CS20.3T, CS39 y CS41 estaban afiliados al género Brevundimonas en la clase Alphaproteobacteria, más estrechamente relacionados con B. bullata, B. diminuta, B. naejangsanensis y B. terrae. El análisis de las secuencias del ITS1 del operón rRNA y los genes para los enzimas ADN girasa subunidad β (gyrB) y ARN polimerasa subunidad β (rpoB), la hibridación ADN-ADN, los perfiles de ácidos grasos celulares y la caracterización fisiológica y bioquímica, justifican el reconocimiento del aislamiento CS20.3T (CCUG 58127T = CECT 7729T) como una especie distinta y nueva, para la cual se propone el nombre Brevundimonas faecalis. Los aislamientos CS39 y CS41 se adscribieron a la especie B. diminuta.

Resum

Resum: “ Filogènia i evolució de les poblacions ambientals i clíniques de Pseudomonas stutzeri i altres espècies relacionades”.

Pseudomonas stutzeri és una espècie que ocupa diversos nínxols ecològics i destaca per la seva gran diversitat genètica i capacitats metabòliques. En el primer capítol, es compara la utilització de mètodes fenotípics convencionals amb l'anàlisi de la seqüència parcial del gen rpoD per a la identificació d'aïllaments clínics de Pseudomonas stutzeri. Observem que els sistemes fenotípics comercials confonen fàcilment a P. stutzeri amb altres espècies de Pseudomonas. Comprovem a més, que la majoria de les soques clíniques de P. stutzeri d'aquest estudi (79%) pertanyien a la genomovar 1 de l'espècie. Es proposa l'ús de l'anàlisi de la seqüència parcial del gen rpoD com una eina molecular precisa per a la identificació rutinària i l'assignació a genomovar dels aïllaments clínics de P. stutzeri. En el segon capítol, una col·lecció de 229 soques de P. stutzeri aïllades de diferents hàbitats i localitzacions geogràfiques es van caracteritzar filogenèticament, mitjançant l’anàlisi de seqüències multilocus (MLSA), i fenotípicament per espectrometria de masses a partir de colònies (Whole-Cell Matrix-Assisted Laser- Desorption/Ionization Time-Of Flight Mass Spectrometry,WC-MALDI-TOF MS). L'agrupació de les soques va ser congruent en tots dos mètodes; 226 soques van ser assignades a les 18 genomovars conegudes actualment. Les tres soques restants es proposen com a soques de referència per a tres noves genomovars de l'espècie. En aquest capítol s'analitza la correlació i la utilitat de l'anàlisi filogenètica basada en l'anàlisi de seqüències multilocus i de l'espectrometria de masses (WC-MALDI-TOF MS), per a l'estudi de poblacions de P. stutzeri.

L'anàlisi de seqüències multilocus (MLSA) és un dels mètodes més acceptats per a l'assignació filogenètica de soques de Pseudomonas a les seves corresponents espècies. Atès que el nombre d'espècies de Pseudomonas està augmentant contínuament, és essencial mantenir les bases de dades de seqüències actualitzades, per assegurar així una correcta identificació bacteriana. Des de la publicació del darrer estudi filogenètic integral basat en les seqüències dels gens 16S rDNA, gyrB, rpoB i rpoD s'han descrit noves espècies. Per tant, en el tercer capítol es presenta una actualització de la base de dades de seqüències, juntament amb l'anàlisi de la filogènia del gènere Pseudomonas. L'espectrometria de masses (WC-MALDI-TOF) s'ha aplicat recentment a la identificació de bacteris i es considera un mètode ràpid i fiable. Un total de 133 soques tipus de les espècies i subespècies reconegudes del gènere Pseudomonas, juntament amb altres representants, es van analitzar mitjançant aquesta nova tècnica. Després, es va avaluar la congruència entre les tècniques MLSA i WC-MALDI-TOF MS per a una discriminació i identificació correcta de les espècies del gènere. Es discuteix la utilitat de tots dos mètodes en la identificació d’ aïllaments ambientals i clínics.

El capítol quatre descriu com Pseudomonas i altres espècies relacionades poden actuar com reservori ambiental de gens de resistència a antibiòtics. Es va estudiar una sortida d'aigües residuals de l'Hospital Són Llàtzer (Mallorca, Espanya) i es van trobar un total

Resum

de 10 aïllaments productors de metalo--lactamasa pertanyents a sis espècies diferents, incloent Brevundimonas diminuta (n = 3), Rhizobium radiobacter (n = 2), Pseudomonas monteilii (n = 1), Pseudomonas aeruginosa (n = 2), Ochrobactrum anthropi (n = 1), i Enterobacter ludwigii (n = 1). Es va detectar la presència d'un integrón de classe 1 associat al trasposó Tn1721 que conté el gen de resistència bla VIM-13 en tots menys un dels aïllaments (E. ludwigii, que va produir blaVIM-2), i en dos d'ells (R. radiobacter), aquesta estructura estava situada en un plasmidi, la qual cosa suggereix que els bacteris ambientals representen un reservori per a la difusió de gens metalo--lactamasa clínicament rellevants.

El capítol cinc descriu la caracterització taxonòmica dels aïllaments de Brevundimonas (anteriorment Pseudomonas) descrits en el capítol quatre. Tres soques resistents a ceftazidima aïllades de les aigües residuals de l'Hospital Són Llàtzer de Palma de Mallorca, Espanya, es van analitzar fenotípica i genotípicament per aclarir les seves posicions taxonòmiques. L'anàlisi filogenètica del gen 16S rRNA indicava que els aïllaments CS20.3T, CS39 i CS41 estaven afiliats al gènere Brevundimonas dels Alfaproteobacteris, més estretament relacionats amb B. bullata, B. diminuta, B. naejangsanensis i B. terrae. L'anàlisi de les seqüències de l’ITS1 de l'operó rRNA i els gens per als enzims ADN girasasubunitat gyrBi ARN polimerasasubunitat rpoB), la hibridació ADN-ADN, els perfils d'àcids grassos cel·lulars i la caracterització fisiològica i bioquímica, justifiquen el reconeixement de l'aïllament CS20.3T (CCUG 58127T = CECT 7729T) com una espècie diferent, per la qual es proposa el nom Brevundimonas faecalis. Els aïllaments CS39 i CS41 es van adscriure a l'espècie B. diminuta.

Introduction

I.1. The genus Pseudomonas

Pseudomonas and Pseudomonas-like (pseudomonads) comprise a taxon of metabolically versatile organisms capable of utilising wide range of organic and inorganic compounds and therefore of living under diverse environmental conditions (Fig I.1.). Most of the species are saprophytic inhabitants of water and soil related environments and they have interesting biotechnological applications. The antibiotic or siderophore production makes Pseudomonas species useful for biological control of phytopathogens (biocontrol). Many species are endophytes able to promote plant growth inducing systemic resistance in plants, producing phytohormones or mobilizing nutrients through phosphate solubilisation. Some species are used in water and soil bioremediation and in new biotechnological field such as designing of biosensors. A low number of species are pathogenic for plants (Table I.1.) being the species P. syringae the clearest example of diversity with several pathovars affecting different plants. Also, a few species are animal or human pathogens (Table I.2.). Consequently, Pseudomonas is one of the ubiquitous bacterial genera in the world (Peix et al., 2009). Actually, the genus Pseudomonas is the genus of Gram-negative bacteria with the highest number of species (http://www.bacterio.cict.fr and http://www.dsmz.de). Number of species described is growing continuously, with Pseudomonas aestusnigri (Sánchez et al., 2014), Pseudomonas kunmingensis (Xie et al., 2014), Pseudomonas chengduensis (Tao et al., 2014), Pseudomonas helmanticensis (Ramírez et al., 2014), and Pseudomonas salegens (Amoozegar et al., 2014) described in 2014.

Genotypic diversity of Pseudomonas species is being studied in detail after the improvement of sequencing technologies such as pyrosequencing, which has led to the sequencing of the complete genome of an increasing number of strains. The genome of Pseudomonas is a circular chromosome with a size of 4.5-7 Mbp. In Pseudomonas species, mobile genetic elements (MGEs) such as phages, plasmids, transposons and genome islands have been identified in many species (Silby et al., 2011). There is considerable variability in the identity, location and functional gene content, even between strains of a given species.

The species of the genus Pseudomonas are well known for their promiscuity in exchanging genetic material and the question of whether the traits of a given organism are stable and truly characteristic of such organisms becomes relevant taxonomically. Then, the appropriate characteristics with taxonomic values must be selected from the complexity of the cell and used in the most effective way for genus and species differentiation. Criteria that can be used for Pseudomonas species differentiation and identification are among others: genomic ribosomal RNA and alternative housekeeping gene sequences, DNA-DNA similarity, substrate utilization, metabolism of aromatic compounds, organization of pili and flagella, outer membrane proteins, genome structure and organisation, genetics of alginate production and siderophore production (Palleroni and Moore, 2004).

Figure I.1. The functional and environmental range of Pseudomonas spp. The Pseudomonas common ancestor has encountered a wide range of abiotic and biotic environments that has led to the evolution of a multitude of traits and lifestyles with significant overlap among species (Silby et al., 2011).

Introduction

Table I.1. Pseudomonas species pathogenic for plant (Peix et al., 2009).

Species Isolated from NF/F P. aeruginosa Hence green F P. amygdali Prunus dulcis NF P. avellanae Corylus avellana L. F P. asplenii Bird‟s-nest fern Asplenium nidus F P. cannabina Cannabis sativa F P. cichorii Cichorium intybus and C. endivia F P. corrugata Lycopersicon lycopersicon NF P. ficuserectae Ficus erecta NF P. flectens Phaseolus vulgaris NF P. fuscovaginae Diseased leaf sheaths of Oryza sativa in Japan F P. marginalis Marginal lesion on lettuce from Kansas F P. meliae Chinaberry tree (Melia azedarach) F P. mediterranea Tomatoes and peppers NF P. palleroniana Rice plants F P. salomonii Garlic plants F P. tremae Trema orientalis NF P. viridiflava Dwarf or runner bean F P. pseudoalcaligenes Citrus lanatus and Amorphophallus kojanci NF P. savastanoi Olea europaea F P. syringae Lilac (Syringa vulgaris, family Oleaceae) F NF, nonfluorescent. F, Fluorescent.

Table I.2. Human Pseudomonas pathogenic species (Peix et al., 2009).

Species Isolated from Some signs and/or symptoms P. aeruginosa Clinical specimens Blue pus in humans, infections in cystic fibrosis lung disease, wound, burn and urinary tract infections, etc. P. alcaligenes Clinical specimens Endocarditis P. fluorescens Clinical specimens Lung infections, haemolytic activity P. luteola Meat and clinical Bacteraemia, cellulitis, peritonitis, endocarditis, specimens endophtalmitis, septicemia P. mendocina Soil, water and Endocarditis, spondylodiscitis P. monteilii Clinicalclinical specimensspecimens No reported P. mosselii Clinical origin Prosthetic valve endocarditis P. oryzihabitans Japanese rice paddy Catheter-related bacteraemia, septicaemia, ophtalmitis, peritonitis P. otitidis Clinical specimens Associated to acute otitis P. putida Soil, water and Urinary tract infections, septicaemia, septic arthritis clinical specimens wound infections P. stutzeri Soil, water and Bacteraemia, otitis, urinary tract infections, arthritis clinical specimens

Introduction

During many years, the taxonomy of Pseudomonas was based purely on phenotypic characters. The major contribution was made by the detailed study of Stanier et al. (1966). First studies on DNA homologies and genetic comparisons applied to bacterial taxonomy were only possible after the development of a methodology to extract DNA from cells and the discovery of DNA renaturation by Marmur (Marmur, 1961). The presentation, in the first edition of the Bergey‟s Manual of Systematic Bacteriology of the subdivision of the species belonging to the genus based on rRNA similarities was an important contribution that established the basis for modern taxonomy of Pseudomonas. Five distinct “rRNA homology” groups were proposed: • group I: P. aeruginosa, P. fluorescens, P. putida and related species (Pseudomonas sensu stricto; Gammaproteobacteria); • group II: P. cepacia, P. mallei and related species (reclassified as Burkholderia) and P. solanacearum, P. picketti and related species (reclassified as Burkholderia and subsequently as Ralstonia; Betaproteobacteria); • group III: P. testosteroni and related species (reclassified as Comamonas), P. acidovorans and related species (reclassified as Comamonas and subsequently to Delftia), P. facilis and related species (reclassified as Acidovorax), P. palleronii and related species (reclassified as Hydrogenophaga), P. sacharophila and related species (reclassified as Pelomonas); • group IV: P. diminuta and P. vesicularis (reclassified as Brevundimonas; Alphaproteobacteria); • group V: P. maltophilia (reclassified as Xanthomonas and subsequently as Stenotrophomonas; Gammaproteobacteria).

In the 2000, a detailed taxonomic revision of genus Pseudomonas through the analysis of 16S rRNA gene sequences was performed by Anzai et al. (2000). Simultaneously Yamamoto et al. (2000) incorporated the housekeeping genes (ubiquitous protein- coding genes that evolve faster than rDNA) for the phylogenetic description of 32 Pseudomonas taxa. Afterwards, several authors contributed to the phylogenetic study of the genus selecting different housekeeping genes (Hilario et al., 2004, Tayeb et al., 2005).

Recently Mulet et al. (2010) described the phylogenetic status of the genus by means of multi-locus sequence analysis. The analysis of the concatenated partial sequences of 16S rDNA, gyrB, rpoD and rpoB genes allowed the establishment of two main groups: P. fluorescens lineage, containing the P. fluorescens, P. syringae, P. lutea, P. putida, P. anguilliseptica and P. straminea groups (Fig. I.2.); and P. aeruginosa lineage, containing the P. aeruginosa, P.oleovorans and P. stutzeri groups. This work demonstrated that the concatenated analysis of three genes (16S rRNA, gyrB and rpoD) was resolutive enough for the phylogenetic analysis of the genus and that the inclusion of rpoB gene may be necessary only in some few cases.

Introduction

Figure I.2. See below.

Introduction

Figure I.2. Phylogenetic tree based on the multigenic analysis of the concatenated 16S rDNA, gyrB, rpoD and rpoB genes. Distance matrix was calculated by the Jukes-Cantor method. Dendrogram was generated by neighbour-joining. Cellvibrio japonicum Ueda107 was used as outgroup. Bootstrap values of more than 50% (from 1000 replicates) are indicated at the nodes (Mulet et al., 2010).

Among the species Pseudomonas (sensu stricto) the G+C content is 59-68 mol%. While the G+C content among species that have been reclassified within new genera ranges from 65 to 67% for species of the genus Brevundimonas, 64 to 68% for species of the genus Ralstonia, 62 to 70% for species of the genus Acidovorax, to name a few species. Thus, markedly different genomic DNA G+C content reveal phylogenetically different bacterial taxa, similar G+C contents do not necessarily indicate relatedness (Palleroni and Moore, 2004).

Even after many technological advances, the formal definition of the genus Pseudomonas as pointed in the Bergey‟s Manual of Systematic Bacteriology (In Genus I Pseudomonas, Doudoroff and Palleroni, Eds. Buchanan et al., 1974) remains effective: “Straight or slightly curved rods but not helical, 0.5-1.0 m in diameter by 1.5-5.0 m in length. Most of the species do not accumulate granules of poly-- hydroxybutyrate, but accumulation of poly-hydroxyalkanoates of monomer

lengths higher than C4 may occur when growing on alkanes or gluconate. Do not produce prosthecae and are not surrounded by sheaths. No resting stages are known. Gram-negative. Motile by one or several polar flagella, rarely nonmotile. In some species lateral flagella of short wavelength may also be formed. Aerobic, having a strictly respiratory type of metabolism with oxygen as the terminal electron acceptor; in some cases nitrate can be used as an alternate electron acceptor, allowing growth to occur anaerobically. Xhanthomonadins are not produced. Most, if not all, species failed to grow under acid conditions (pH lower than 4.5). Most species do not require organic growth factors. Oxidase positive or negative. Catalase positive. Chemoorganotrophic. Strains of the species include in their composition hydroxylated fatty acids 3-OH 10:0 and 12:0 and 2-OH 12:0,

Introduction

and ubiquinone Q-9. Widely distributed in nature. Some species are pathogenic for humans, animals or plants. The mol% G+C content of the DNA is 58-69. The type species is Pseudomonas aeruginosa (Schroeter 1872) Migula 1900, 884”.

I.2. The species Pseudomonas stutzeri

I.2.1. Definition of the species

Pseudomonas stutzeri is a member of the genus Pseudomonas “sensu stricto”. Belongs to group I of Palleroni‟s DNA-rRNA homology group. Typically, cells are rod shaped, 1 to 3 μm in length, 0.5 μm in width, and have a single polar flagellum. Under certain conditions, one or two lateral flagella with a short wavelength may be produced. Phenotypic traits of the genus include a negative Gram‟s stain; positive catalase and oxidase tests; and a strictly respiratory metabolism. In addition, P. stutzeri strains are defined as denitrifiers. They can grow on starch and maltose, and have a negative reaction in arginine dihydrolase and glycogen hydrolysis tests. They do not produce fluorescent pigments. The G+C content of their genomic DNA lies between 60 and 66 mol%. DNA-DNA hybridizations enable at least 21 genomic groups, called genomovars, to be distinguished. Members of the same genomovar share more than 70% similarity in DNA-DNA hybridizations. Members of different genomovars usually have similarity values below 50% (Lalucat et al., 2006).

I.2.2. Phenotypic properties

Apart from the 1952 study by van Niel and Allen, the only papers containing detailed descriptions of P. stutzeri's phenotypic properties are those by Stanier et al., 1966 and Rosselló-Mora et al., 1994.

Strains of P. stutzeri, like most recognized Pseudomonas spp., can grow in minimal, chemically defined media, with ammonium ions or nitrate and a single organic molecule as the sole carbon and energy source. No additional growth factors are required. Some P. stutzeri strains can grow diazotrophically. This characteristic seems to be rare among the genus Pseudomonas. None of the strains tolerates acidic conditions: they do not grow at pH 4.5. P. stutzeri has a respiratory metabolism, and oxygen is the terminal electron acceptor. However, all strains can use nitrate as an alternative electron acceptor and can carry out oxygen-repressible denitrification. Denitrification may be delayed or may appear only after serial transfers in nitrate media under semiaerobic conditions. Amylolytic activity is one of the phenotypic characteristics of the species. The enzymology of the exo-amylase, which is responsible for the formation of maltotetraose as an end product, has been examined at the molecular level. This enzyme has also been cloned. Obradors and Aguilar (1991) demonstrated that polyethylene glycol was degraded to yield ethylene glycol, a substrate typically used by P. stutzeri strains.

Introduction

The arginine deiminase system (“dihydrolase”) catalyzes the conversion of arginine to citrulline and of citrulline to ornithine. It has been used by taxonomists to differentiate species. All P. stutzeri strains give a negative test result for this reaction. They also fail to use glycogen and do not liquefy gelatin (except genomovar 20 that is gelatinase positive) (Lalucat et al., 2006).

I.2.3. Genomic characterization and phylogeny

The genomovar (gv) concept was originally defined for P. stutzeri as a provisional taxonomic status for genotypically similar strains within a bacterial species. Two strains classified phenotypically as members of the P. stutzeri species were included in the same genomovar when their DNA-DNA similarity values were those generally accepted for members of the same species (more than 70% similarity or less than 5°C difference in thermal denaturation temperature values). This concept has been used taxonomically to group genotypically similar strains in other species, such as Burkholderia cepacia and species in the genera Xanthobacter, Azoarcus, and Shewanella, etc. The concept provides a useful provisional level of classification.

It is commonly accepted that members of the same species should share at least 70 % binding in standardised DNA-DNA hybridisation and/or over 97 % gene-sequence identity for the 16S ribosomal RNA. The strains of P. stutzeri are grouped at least in 21 gv that are numbered from 1 to 22 (the former gv6 was reclassified as a novel species, P. balearica). Members of the same gv have DNA-DNA hybridisation values greater than 70 %. Two strains of different gv show a hybridisation value lower than 65 %. The similarity between gvs is on the same order as the similarity expected between two bacterial species.

Most strains studied so far are included in genomovar 1 (along with the species' type strain). Some genomovars have only one representative strain. These might be considered genomospecies, sensu Brenner et al. (Brenner et al., 2001). As an example, we can consider strain CLN100, of genomovar 10. It is a representative of a new species from a genomic perspective, sharing many substantial phenotypic and phylogenetic characteristics with members of the P. stutzeri phylogenetic branch. Some phenotypic traits can be used to discriminate CLN100 from the P. stutzeri and P. balearica strains described to date (simultaneous degradation of chloro- and methyl-derivatives of naphthalene and absence of ortho cleavage of catechol, etc.). These characteristics could be the basis for describing CLN100 as the type strain of a new species. However, some of these phenotypic traits could be strain specific; therefore, it was preferred not to define a new species until more strains that are genomically and phenotypically similar to strain CLN100 have been described (García-Valdés et al., 2003).

P. xanthomarina is the only described species that is affiliated within the P. stutzeri phylogenetic branch after a multigenic analysis. It shares some basic phenotypic traits with P. stutzeri, and could be considered a gv of P. stutzeri. However, additional

Introduction

biochemical tests (the inability to hydrolyse starch), physiological studies (the ability to grow at 4ºC and in the presence of 8 % NaCl), and chemotaxonomic analyses (fatty acid composition) justified the proposal of a novel species (Romanenko et al., 2005). The phylogenetic analysis of the 16S rDNA genes, as well as three or six housekeeping genes (ITS1, gyrB, rpoB, rpoD, catA, and nosZ) demonstrates a monophyletic origin of all strains that are phenotypically identified as P. stutzeri. The only exception is the Pseudomonas strain OX1 (Cladera et al., 2006b).

When P. stutzeri strains are compared pair-wise, a very good correlation can be detected between the phylogenetic consensus distances of three or six housekeeping genes and the DNA-DNA hybridisations (Mulet et al., 2008). The cut-off point proposed for the gv discrimination corresponds to a similarity value of 95.2 % in the consensus matrix of the partial 16S rDNA, gyrB, and rpoD genes (Fig. I.3.). Recently, Goris et al. (2007) studied the average nucleotide identity (ANI) of common genes in the analysis of complete genomes, and found a similar result: the recommended cut-off value for bacterial species discrimination corresponded to an ANI value of 95±0.5 %. The analysis of only three housekeeping genes seems to sufficiently discriminate for the delineation of gv in P. stutzeri and to differentiate it from the closest-related species.

Figure. I.3. Similarity values in the consensus matrix of the partial 16S rDNA, gyrB, and rpoD genes for P. stutzeri and related species (cortesy of Dr. Mulet)

I.2.4. Polyphasic identification

The basic combination of phenotypic traits that differentiate P. stutzeri from other species in the genus are its wrinkled, yellow-brown colony morphology, its denitrification capability under anaerobic conditions, the use of starch and maltose, and its negative reaction in the arginine dihydrolase test. Other biochemical properties, such as the substrates assimilation tests or the determination of cellular component profiles (whole-cell and outer-membrane proteins, lipopolysaccharides, and fatty acids) are extremely diverse.

The species is well defined phenotypically and chemotaxonomically. However, some of its distinguishing traits are lacking in well-documented strains (starch hydrolysis, arginine dihydrolase activity, and motility, etc.). In addition, many biochemical

Introduction

properties are extremely variable within the species and are not correlated with the genomovar groupings. In P. stutzeri, a polyphasic taxonomic approach is needed for assigning a new strain to the species: the strain has to agree with the basic phenotypic traits of the species, has to be placed in the same branch as P. stutzeri reference strains in the phylogenetic trees of one or more housekeeping genes, and has to show DNA- DNA similarity values of more than 70% with a reference strain of a recognized genomovar.

I.2.5. Natural transformation

Genome analysis and molecular microbial ecology studies have shown that horizontal gene transfer is a relevant force in bacteria for continuous adaptation to environmental changes. Pseudomonas stutzeri can be considered a naturally transformable bacterium, as one-third of its members are naturally transformable. Its transformation capability has been extensively studied during the last two decades. Competence is not constitutive in most naturally transformable bacteria; it depends on physiological state. P. stutzeri competence occurs in broth-grown cultures during the transition from the log phase to the stationary phase. P. stutzeri competence is also developed in media prepared from aqueous extracts of various soils. It is further stimulated under carbon-, nitrogen-, and phosphorous-limited conditions, such as those frequently encountered by bacteria in soil. It has been demonstrated that P. stutzeri can be transformed by mineral-associated DNA in laboratory-designed glass columns, DNA bound in autoclaved marine sediment, and DNA adsorbed in sterilized soil. P. stutzeri can also access and take up DNA bound to soil particles in the presence of indigenous DNases, in competition with native microorganisms.

Transformability is widespread among environmental P. stutzeri strains. However, it has been shown that non-transformability and different levels of transformability are often associated with distinct genomic groups. This suggests that transformation capability may be associated with speciation in the highly diverse species P. stutzeri. In this respect, it has been shown that the presence of DNA restriction-modification systems and mismatch repair mechanisms in P. stutzeri act as barriers to the uptake of foreign DNA. These mechanisms may therefore contribute to further speciation (Lalucat et al., 2006).

I.2.6. Pathogenicity and antibiotic resistance

For a 15-year period after 1956, several reports described the isolation of P. stutzeri from clinical and pathological materials. However, there was no clear association of this species with an infectious process. In fact, 15 of the 17 strains studied in 1966 by Stanier et al., were of clinical origin. In 1973, the first well-documented case of P. stutzeri infection appeared in the literature, it involved a non-union fracture of a tibia. Since then, a few cases of P. stutzeri infection have been reported in association with bacteremia/septicaemia, bone infection, arthritis, endocarditis, eye infection, meningitis, pneumonia and/or empyema, skin infection, urinary tract infection and ventriculitis.

Introduction

Only two of the above cases resulted in death. This reflects P. stutzeri's relatively low degree of virulence. In fact, it is doubtful whether death was due to P. stutzeri infection in these two cases, as both patients had severe malfunctions caused by underlying conditions: chronic renal failure and chronic liver disease. Interestingly, almost all patients with the aforementioned P. stutzeri infections had one or more of the following predisposing risk factors: underlying illness, previous surgery (implying probable nosocomial acquisition), previous trauma or skin infection, and immunocompromise. Only two cases lacked any of these known risk factors: a man with vertebral osteomyelitis and a 4-year-old boy with pneumonia and empyema (Lalucat et al., 2006).

Studies to determine the distribution rates of P. stutzeri in hospitals have also been carried out. Two different studies were undertaken with all of the bacterial isolates obtained in university hospitals during a defined period from samples of wound pus, blood, urine, tracheal aspirates, and sputum. Both studies concluded that 1 to 2% of all the Pseudomonas spp. isolated were P. stutzeri. Similar isolation rates (1.8%) were obtained in a study of Pseudomonas sp. infections in patients with human immunodeficiency virus disease. Interestingly, the highest rate of P. stutzeri isolation was reported by Tan et al. (1997), who showed that 3% of all urine-isolated bacteria were P. stutzeri. Thus, it can be concluded that P. stutzeri is also ubiquitous in hospital environments and that this species could be considered an opportunistic but rare pathogen.

Sensitivity tests for several antibiotics were performed in nearly all of the epidemiological and case reports mentioned above. Nearly all studies involving several antibiotics and bacterial species showed that P. stutzeri was sensitive to many more antibiotics than P. aeruginosa, its most closely related species and a well-known human pathogen. In spite of these results, when bacterial isolates were obtained from immunosuppressed patients (i.e., patients with human immunodeficiency virus disease) no significant differences in antibiotic susceptibility between P. aeruginosa and other Pseudomonas spp., including P. stutzeri, were detected (Manfredi et al., 2000). Immunosuppressed patients are normally hospitalized for long periods. They are generally in contact with more types of antibiotics at higher doses. This extensive use of antibiotics could be responsible for the higher rate of isolation of antibiotic-resistant P. stutzeri strains. Interestingly, with the exception of fluoroquinolones, resistant P. stutzeri strains have been isolated for almost all antibiotic families. This suggests that P. stutzeri has a wide range of antibiotic resistance mechanisms. At least two such antibiotic resistance mechanisms in P. stutzeri have been described: (i) alterations in outer membrane proteins and lipopolysaccharide profiles and (ii) the presence of β- lactamases that hydrolyze natural and semisynthetic penicillins, broad-spectrum “β- lactamase-stable” cephalosporins, and monobactams with similar rates (Lalucat et al., 2006). Although P. stutzeri is a rare cause of clinical infection, it is becoming relevant as a potential reservoir for multidrug resistance. Recently a carbapenem-resistant P. stutzeri strain isolated from a Dutch patient was described (Poirel et al., 2010). This isolate

Introduction

produced a metallo--lactamase (MBL) called DIM-1 that significantly hydrolyzed broad-spectrum cephalosporins and carbapenems. The MBL gene was embedded in a class 1 integron containing two other gene cassettes, encoding resistance to aminoglycosides and desinfectants, located on a 70-kb plasmid (Fig. I.4). P. stutzeri isolates were reported to carry IMP-type metallo--lactamases also in Taiwan and Brazil (Yan et al., 2001, Carvalho-Assef et al., 2010).

Figure. I.4. Schematic map representing the In124 integron structure containing the blaDIM-1 gene, together with its flanking sequences. The 59-be sites are indicated by white circles. The horizontal arrows indicate the transcription orientations. The insertion sequences ISPst10 and ISKpn4 are represented by rectangles.

I.3. Habitats and ecological relevance

The remarkable physiological and biochemical diversity and flexibility of P. stutzeri is shown by its capacity to grow organotrophically through mineralizing or degrading a wide range of organic substrates; its ability to grow anaerobically, using different terminal electron acceptors in a strictly oxidative metabolism; its oxidation of inorganic substrates, as a chemolithotrophic way to gain accessory energy; its resistance to heavy metals; and the variety of nitrogen sources it can use. In addition, a wide range of temperatures supports P. stutzeri growth. This is an important physiological characteristic when the habitats that can be colonized by this species are considered. Phenotypic heterogeneity may be explained by P. stutzeri's huge range of habitats and growth conditions, including the human body. Spiers et al. (2000) classified ecological opportunity and competition as the main ecological causes of diversity. They emphasized that the underlying cause of diversity is genetic and that diversification occurs through mutation and recombination. The natural competence demonstrated by many P. stutzeri strains can help to increase genetic diversity. It provides new genetic combinations for colonizing new habitats or for occupying new ecological niches, even when the population is essentially clonal. It has insertion sequences, and mosaic gene structures have also been reported. There is considerable variation in the length of its genome. All of these factors suggest that different events may contribute to overall species diversity.

I.3.1. Role of mobile genetic elements

Transposons (Tn) are mobile DNA sequence elements that can move from one site to another within the genome. Simple Tn or insertion sequences (IS elements) are found in

Introduction

nearly all bacterial genomes. They have inverted sequences at their ends and code for the enzyme transposase, which mediates the transposition. Composite Tn code for additional genes. For example, in P. stutzeri AN10, IS elements have been found related to the naphthalene catabolic pathway (Bosch et al., 1999, 2000). IS elements might also be involved in the modulation of gene expression, mostly by insertion within a gene that is inactivated. This situation has been demonstrated in the inactivation of the nahH gene, in the naphthalene-degrading strain AN10 by ISPst9, a recently discovered ISL3- like element (Christie-Oleza et al., 2008). The precise excision of ISPst9 restores the gene activity.

Integrons are platforms able to incorporate and excise exogenous gene cassettes by site- specific recombination. They possess a site-specific tyrosine recombinase and an attachment site (attI) into which individual genes are inserted. Integrons have been studied extensively in antibiotic resistant bacterial pathogens. Nevertheless, as they are involved in the capture of metabolic genes, they may also have an important function in the adaptation of bacteria to novel habitats. Holmes et al. (2003) first described integrons in P. stutzeri strains Q and BAM. This group was also the first to experimentally demonstrate that chromosomal integrons can capture gene-cassettes and express the cassette-associated genes.

Figure I.5. Genetic organisation of the sequenced regions of InPstQ (Holmes et al., 2003).

I.4. Methods for studying Pseudomonas taxonomy

Microbial systematics and taxonomy can be said to be made up of three components: (1) characterization; (2) classification; and (3) nomenclature. In turn, microbial systematics provides the basis for identification. Identification of a microbial strain may follow two basic modes of analyses, i.e., characterization of phenotypic traits and characterization of genotypic traits (Welker and Moore, 2011).

Since its discovery the genus Pseudomonas has undergone numerous taxonomic changes not only as far as the number of species included but also as far as the criteria used for their definition and delineation. The exhaustive list of methods used in Pseudomonas reveals the efforts for characterizing the genus (Peix et al., 2009).

The usefulness of chemotaxonomic studies has been proven, such as quinone systems,

Introduction

fatty acid, protein, polar lipid or polyamine profiles, which are commonly applied to the taxonomy of most bacterial groups. All these chemotaxonomic markers have been mainly used to reclassify some Pseudomonas species in other genera. The SDS-PAGE profiles also proved to be useful in different studies to fingerprint Pseudomonas isolates from divergent phylogenetic groups at species level (Vancanneyt et al., 1996).

Modern techniques for analysis of biomolecules are being applied to Pseudomonas taxonomy (Figure I.6). Despite the relevance of these chemotaxonomic approaches together with phenotypic and ecological studies, gene sequencing studies have provided the greatest advances in taxonomy of bacteria, including Pseudomonas.

Figure I.6. An overview of different methods commonly used for microbial typing, with estimates of the levels of expected resolution for each method. The horizontal bars indicate the level of resolution covered by the given methodology. Welker and Moore, 2011.

On the following pages, there is a description of some of the methods used in this work to study the taxonomy of Pseudomonas and related species as well as the genomovar organization of P. stutzeri. In the future, sequencing of complete genomes of Pseudomonas is expected to give light on the understanding of mechanisms of ecological and genetic diversity of this complex genus.

I.4.1. Biochemical test-based identification

Biochemical test-based identification systems are familiar to most microbiologists and require little training to operate. Systems range from strip cards for specific groups of

Introduction

bacteria to large plate arrays that may be automatically scanned for changes due to pH shifts or redox reactions. The cost per sample for identification is considerably less than for DNA sequencing, but higher than for FAME analysis. One problem with most biochemical test systems, however, is that these systems are produced for the clinical market, and as a result, are limited in the number of environmental species they can identify. Besides, some phenotypic features may remain inactive in the metabolism of microorganisms; the tests may reflect only a minimal fraction of the properties encoded in the genome. Despite its limitations, this type of systematic is still used as a starting point for the formal description of a new species (Kunitsky et al., 2005)

Some of the biochemical tests used in this thesis were API 20 NE (bioMérieux), Biolog GN2 (Biolog) and MicroScan W/A (Dade MicroScan inc.). API 20 NE is a standardized system for the identification of non-fastidious, non-enteric Gram-negative rods. The API 20 NE strip consists of 20 microtubes containing dehydrated substrates. The strips combine 8 conventional tests (nitrate reduction, triptophanase, glucose fermentation, arginine dihydrolase, urease, -glucosidase, gelatinase, p-nitrophenyl--galactosidase) and 12 assimilation tests (glucose, arabinose, manose, manitol, N-acety-lglucosamine, maltose, gluconate, capric acid, adipic acid, malic acid, citrate and phenylacetic acid). The conventional tests are inoculated with a saline bacterial suspension, which reconstitutes the media. During incubation, metabolism produces color changes that are either spontaneous or revealed by the addition of reagents. The assimilation tests are inoculated with a minimal medium and the bacteria grow if they are capable of utilizing the corresponding substrate. The Biolog GN2 MicroPlate is a method designed for identification and characterization of aerobic gram-negative bacteria. Biolog‟s MicroPlates uses patented redox chemistry. This chemistry, based on reduction of tetrazolium, responds to the process of metabolism (i.e. respiration) rather than to metabolic by-products (i.e. acid). Biolog GN2 MicroPlate is not dependent upon growth to produce identifications. Biolog‟s redox chemistry makes use of diﬀerent carbon compounds including sugars, carboxylic acids, amino acids and peptides to provide discriminating biochemical characterizations. MicroScan WalkAway-96 instrument is an automated system that includes identification and antimicrobial susceptibility testing panels, interprets biochemical results through the use of a photometric or fluorogenic reader, and generates computerized reports that can be interfaced with hospital mainframe information systems. Conventional panels utilize the photometric reader and provide identification results for gram-negative bacilli based on detection of pH changes, substrate utilization and growth in presence of antimicrobial agents after 16 to 42 h incubation at 35C, with reagents added automatically by the WalkAway instrument. Panels can be removed from the WalkAway instrument and read manually if verification is necessary. Panels for identification of gram-negative bacilli contain 29 modified conventional biochemicals and six antibiotics.

Introduction

I.4.2. Gas Chromatography of Cellular Fatty Acids

The MIDI Sherlock System identifies microorganisms based on gas chromatographic (GC) analysis of extracted microbial fatty acid methyl esters (FAMEs). Microbial fatty acid profiles are unique from one species to another, and this has allowed for the creation of very large microbial libraries. The Sherlock System requires bacteria to be grown in culture. The fatty acids are extracted by a procedure that consists of saponification in dilute sodium hydroxide/methanol solution followed by derivatization with dilute hydrochloric acid/methanol solution to give the respective methyl esters (FAMEs). The FAMEs are then extracted from the aqueous phase by the use of an organic solvent and the resulting extract is analysed by GC (Fig. I.7). The Sherlock system uses an external calibration standard. It is a mixture of the straight chained saturated fatty acids from 9 to 20 carbons in length (9:0 to 20:0) and five hydroxy acids. All compounds are added quantitatively so that the software may evaluate the gas chromatographic performance each time the calibration mixture is analyzed. The technique used by the Sherlock System to present results is based on a Similarity Index (SI). The SI is a numerical value, which expresses how closely the fatty acid composition of an unknown compares with the mean fatty acid composition of the strains used to create the library entry listed as its match (Kunitsky et al., 2005).

Figure I.7. MIDI‟s Fatty Acid-based Microbial Identification System Workflow.

I.4.3. Matrix Assisted Laser-Desorption Ionization Time-Of-Flight Mass Spectrometry

Mass spectrometry (MS) is an analytical technique that produces spectra of the masses of the atoms or molecules comprising a sample of material. Mass spectrometry works by ionizing chemical compounds to generate charged molecules or molecule fragments and measuring their mass-to-charge ratios (m/z). Matrix-assisted laser desorption/ionization (MALDI) is a soft ionization technique used in mass spectrometry, allowing the analysis of biomolecules and large organic molecules which

Introduction

tend to be fragile and fragment when ionized by more conventional ionization methods. Desorption is triggered by a UV laser beam. Matrix material heavily absorbs UV laser light, leading to the ablation of upper layer (~1 μm) of the matrix material. Charged ions of various sizes are generated on the sample slide. A potential difference V0 between the sample slide and ground attracts the ions in direction to the detector. As the potential difference V0 is constant with respect to all ions, ions with smaller m/z value (lighter ions) and more highly charged ions move faster through the drift space until they reach the detector. Consequently, the time of ion flight differs according to the mass-to-charge ratio (m/z) value of the ion (Welker and Moore, 2011).

The procedure of MS-based identification of microorganisms is illustrated schematically in Figure I.8. Generally, microorganisms are analysed from cultures on solid media commonly used in microbiology. Major advantages of Whole Cell-MS are the convenience, ease and speed with which samples are prepared and analysed. This is enabled by the samples being introduced into the mass spectrometer in solid state on a sample support plate, without the necessity for a fractionation process, as in liquid chromatography-mass spectrometry (LC-MS) applications. To obtain mass spectra with the number of well-defined protein peaks in the range of 70-200, it is generally sufficient to place a small amount of fresh cell biomass (105-106 cells) on the sample spot of the target and extract the cells, using a „matrix solution‟. The matrix solution comprises a mixture of solvents, i.e., commonly, combinations of water, ethanol, methanol, acetonitrile and a strong acid, such as trifluoroacetic acid (TFA), in which the matrix compound is dissolved. The solvents of the matrix solution penetrate the cell wall and make intracellular proteins accessible for analysis. When the solvents evaporate from the cell suspension, matrix crystals begin to form, within which the protein molecules and other cellular compounds are embedded, i.e. a process of cocrystallization (Welker and Moore, 2011).

The actual MS measurement is generally performed in an automated mode. The essential information used for microbial identification is contained in a peak list containing m/z values and intensities, i.e., the so-called „mass fingerprint‟ of a sample. This mass fingerprint is then analysed by comparison to a database containing reference mass fingerprints of relevant species. The essential prerequisite for accurate identification of microbial samples, necessarily, is the inclusion of reliable reference data for a comprehensive listing of species in the database (Welker and Moore, 2011).

Introduction

Figure I.8. General scheme of MALDI-TOF MS-based identification of microorganisms, using microbial biomass, generating whole-cell mass spectra to derive a composite strain- specific mass spectrum and comparing the mass spectrum to a reference database (Welker and Moore, 2011).

It is now recognized that a large percentage of the recorded peaks in whole-cell mass spectra, i.e., in the mass range of a typical WC-MS of m/z 2-20 kDa, are comprised of ribosomal proteins, which may explain the marked stability of spectra for given species, even under varying cultivation conditions. Although differing cultivation conditions will result in some degree of variation in the mass spectra for a strain, in general, the peak patterns derived by WC-MS are stable, even when strains are grown on different media or are analysed at different ages of cultivation. However, not all mass peaks are from ribosomal proteins. Besides the ribosomal proteins, other identifiable proteins in a typical WC-MS are mostly “structural” proteins, i.e., those without catalytic function but which are a constitutive part of the cell structure and function, such as ribosome modulation factors, carbon storage regulators, cold-shock proteins, DNA-binding proteins and RNA chaperone (Welker and Moore, 2011).

The fact that, indeed, ribosomal and other cell structure and regulatory („housekeeping‟) proteins represent the predominant number of peaks in the mass spectra of microbial cells has notable consequences:

Introduction

• Mass spectral patterns are stable because conserved ribosomal and other housekeeping proteins are integral, ubiquitous, and abundant components of all living cells; • Mass signals of house-keeping proteins can be analysed as phylogenetic markers, comparable to multi-locus sequence analyses of house-keeping genes; • The more similar the mass spectral patterns are, the closer are the phylogenetic relationships of the microorganisms. There are, thus, excellent precedents for the application of MALDI-TOF MS for taxonomic studies, as well as for routine diagnostics.

Although MALDI TOF MS is a promising method, it has some limitations, namely: analyses of uncultivable microorganisms, analyses of samples of mixed strains and differentiation of very closely related taxa.

I.4.4. DNA-DNA hybridization and G+C %mol content

The first genotypic analysis applied in microbial taxonomy, the nucleotide base ratio of genomic DNA, is measured as the ratio of the amount of guanine and cytosine nucleotides to the total amount of nucleotide bases.

In this study, genomic DNA was isolated by the method of Marmur, which allows obtaining large quantity of highly pure DNA. In order to determine the base compositions of the DNAs, a previously reported reversed-phase high-performance liquid chromatography (HPLC) method was followed, with the modifications reported by Urdiain et al. (2008). Basically, DNA was denatured and hydrolysed. Free nucleotides were dephosphorylated and analysed throw HPLC together with dephosphorylated nucleotides standards.

Genomic DNA-DNA re-association similarities have become the accepted molecular standard by which bacteria are classified at the species level. The exact levels of DNA- DNA similarity that may be used to define strains of a species have been proposed to be 70% similarity. In this study, genomic DNA-DNA relatedness values were calculated, in duplicate, using a non-radioactive method, as described by Ziemke et al. (1998). Reference DNAs were double-labelled with DIG-11-dUTP and Biotin-16dUTP, using a nick-translation kit (Boehringer Mannheim). DNA-DNA hybridisations were performed using the genomic DNAs reference strains as probes against the other strains. Hybridisation experiments were carried out under optimal and stringent temperatures calculated from the melting temperatures based on the G+C mol% content, following the method proposed by Urdiain et al. (2008).

I.4.5. Multilocus sequence analysis

The ribosomal genes have special characteristics that other genes lack. They are present in all organisms having the same essential function for life (protein synthesis) and are present since the beginning of the evolution. 16S rRNA genes are molecules with an

Introduction

evolutionary rate high enough to find variability among different species and with a degree of conservation sufficient to assure that differences corresponded to stable taxonomic categories as genus and species. Even if the 16S rRNA gene is the basis of the current bacterial classification, at present it is known that very closely related species of bacteria cannot be differentiated based on this gene (Peix et al., 2009). Multilocus sequence analysis (MLSA) is based on the combination of multiple molecular markers for the study of phylogenetic relationships. MLSA studies search for a set of genes, which may be informative in all strains of a particular group (genus or family). The idea of selecting a set of genes that allow a classification of all prokaryotes is not practical, since genes that are informative within a family or genus may not be in other groups (Gevers and Coenye, 2007).

In this work, several genes were selected for multigenic phylogenetic analysis of type strains of Pseudomonas and for P. stutzeri genomovars: 16S rDNA and ITS (RNA operon internally transcribed spacer 1), rpoD (RNA polymerase sigma 70 subunit), gyrB (DNA gyrase subunit β) and rpoB (RNA polymerase  subunit). Genes were compared in order to select the most discriminating one, following the method of least square tendency lines comparison (Fig.I.9) (Mulet et al., 2010), and were used in a combined analysis to infer the phylogeny of the genus Pseudomonas or the subspecies organization of P. stutzeri genomovars.

0,60 0,55 rpoD gene 0,50 0,45 0,40 0,35 0,30

0,25 gyrB gene (y = 0.4095x) Phylogenetic distance Phylogenetic 0,20 rpoB gene (y = 0.3123x) 0,15 0,10 16S rRNA gene (y = 0.115x) 0,05 0,00 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,35 0,40 0,45 0,50 0,55 0,60 rpoD phylogenetic distance

Fig. I.9. Least square tendency lines obtained for the comparisons of phylogenetic distances between 107 Pseudomonas type strains. The slope is indicated in each case. The lines have been vertically shifted for the sake of clarity.

Objectives

Pseudomonas is one of the most metabolically versatile genus with impact on biotechnology. Within the genus, Pseudomonas stutzeri species stands as a microorganism of environmental interest for its metabolic capabilities (pollutants degradation, denitrifying potential, nitrogen fixation, sulphur oxidation, etc.), that can occupy very different habitats, including wastewater, drinking, pure and marine waters, as well as clinical environments. It is one of the few microorganisms that have been employed in biodegradation processes through direct introduction into contaminated aquifers.

The overall objective of this thesis is to carry out a comprehensive analysis of the phylogenetic relationships among different populations of P. stutzeri and related species, clarifying their evolutionary strategies and improving the methods used for their study.

The main objectives of this thesis are:

1. Increase and consolidate the collection of Pseudomonas stutzeri strains from diverse environments using specific culture mediums. 2. Perform a molecular, physiological and biochemical characterization of P. stutzeri populations, to understand the microdiversity of phylogenetically close related isolates. 3. Establish a bacterial species criterion in the phylogenetic branch P. stutzeri and related species.

Chapters of this thesis have been written originally in English for their publication on international scientific journals. Thus, each of the chapters is presented in the form of manuscripts of such publications. The name, the co-authors and the journal on which these chapters have been published are listed below:

Chapter 1 Scotta C, Mulet M, Sánchez D, Gomila M, Ramírez A, Bennasar A, García-Valdés E, Holmes B, Lalucat J. 2011. Identification and genomovar assignation of clinical strains of Pseudomonas stutzeri. European Journal of Clinical Microbiology and Infectious Disease 31, 2133-2139. DOI 10.1007/s10096-012-1547-4.

Chapter 2 Scotta C, Gomila M, Mulet M, Lalucat J, García-Valdés E. 2013. Whole-Cell MALDI-TOF Mass Spectrometry and Multilocus Sequence Analysis in the discrimination of Pseudomonas stutzeri Populations: Three Novel Genomovars. Microbial Ecology 66, 522-532. DOI: 10.1007/s00248-013-0246-8.

Objectives

Chapter 3 Mulet M, Gomila M, Scotta C, Sánchez D, Lalucat J, García-Valdés E. 2012. Concordance between whole-cell matrix-assisted laser-desorption/ionization time-of- flight mass spectrometry and multilocus sequence analysis approaches in species discrimination within the genus Pseudomonas. Systematic and Applied Microbiology 35, 455-464. doi:10.1016/j.syapm.2012.08.007.

Chapter 4 Scotta C, Juan C, Cabot G, Oliver A, Lalucat J, Bennasar A, Albertí S. 2011. Environmental microbiota represents a natural reservoir for dissemination of clinically relevant metallo--lactamases. Antimicrobial Agents and Chemotherapy 55, 5376-5379. DOI: 10.1128/AAC.00716-11.

Chapter 5 Scotta C, Bennasar A, Moore ERB, Lalucat J, Gomila M. 2011. Taxonomic Characterization of ceftazidime-resistant Brevundimonas isolates and description of Brevundimonas faecalis sp. nov. Systematic and Applied Microbiology 34, 408-413. DOI:10.1016/j.syapm.2011.06.001.

Identification of clinical strains of P. stutzeri

Chapter 1:

Identification and genomovar assignation of clinical strains of Pseudomonas stutzeri

Scotta C, Mulet M, Sánchez D, Gomila M, Ramírez A, Bennasar A, García-Valdés E, Holmes B, Lalucat J. 2011. Identification and genomovar assignation of clinical strains of Pseudomonas stutzeri. European Journal of Clinical Microbiology and Infectious Diseases 31, 2133-2139. DOI: 10.1007/s10096-012-1547-4.

Chapter 1

Abstract

The identification of Pseudomonas stutzeri clinical isolates through conventional phenotypic methods was compared with identification through partial rpoD gene sequencing. We observed that commercial phenotypic systems easily confuse P. stutzeri with other Pseudomonas species. We also demonstrated that most of the clinical strains of P. stutzeri herein studied (79%) belonged to genomovar 1 of the species. We propose the use of partial rpoD gene sequence analysis as a complementary molecular tool for the precise routine identification and genomovar assignation of P. stutzeri clinical isolates, as well as for typing and epidemiological studies.

Identification of clinical strains of P. stutzeri

1.1. Introduction

Pseudomonas stutzeri is a widely distributed non-fluorescent denitrifying pseudomonad isolated mainly from environmental samples (Lalucat et al., 2006). Strains of the species can be ascribed to one of at least 19 intra-specific groups genomically and phylogenetically related (called genomovars), which cannot be differentiated clearly from each other by phenotypic or biochemical tests (Mulet et al., 2008). The genomovar concept was originally defined for P. stutzeri as a provisional taxonomic status for genotypically similar strains within a bacterial species. Members of the same genomovar have more than 70% similarity in DNA–DNA hybridisations. Members of different genomovars usually have similarity values below 65% (García-Valdés et al., 2010).

The organism is ubiquitous in hospital environments and it is an opportunistic, but rare, pathogen. Although there are some descriptions of P. stutzeri infections in patients with no underlying diseases (Köse et al., 2004), it is primarily opportunist, causing infections in immunocompromised hosts and seriously ill hospitalised patients with invasive medical devices. It has been recovered from wounds, the respiratory tract of intubated patients and from the urinary tract. It has been reported to cause bacteraemia, meningitis, pneumonia and osteomyelitis (Sader and Jones, 2005). Furthermore, a case of infective endocarditis with a relapse after 4 years was reported to be caused by genetically highly related P. stutzeri isolates (Grimaldi et al., 2009). Most infections due to P. stutzeri are iatrogenic, associated with the administration of contaminated solutions, medications and blood products, or with the presence of indwelling catheters in compromised patients.

Due to its genomic plasticity and capability to capture genes from the environment (Sikorski et al., 1998), P. stutzeri must be considered of relevance as a possible environmental reservoir of antibiotic resistance genes (García-Valdés et al., 2010). Yan et al. (2001) described the emergence of IMP- and VIM type metallo-β-lactamases

(MBL) in Pseudomonas species isolated in Taiwan. An integron-carrying blaIMP-16 MBL was recently described in a P. stutzeri isolate in Brazil (Carvalho-Assef et al., 2010).

Poirel et al. (2010) characterised a new MBL blaDIM-1 from a P. stutzeri clinical isolate in the Netherlands which conferred resistance to oxyiminocephalosporins, cephamycins and carbapenems, though not to aztreonam.

Despite the importance of the accurate identification of Pseudomonas species, previous studies demonstrated the unreliability of phenotypic methods, including API 20NE (bioMérieux), Vitek GNI+ (bioMérieux), MicroScan W/A (Dade MicroScan Inc.) and Crystal E/NF (Becton Dickinson Microbiological Systems), compared with different molecular techniques, to identify non-fermenting Gram-negative bacteria at the species level (Bosshard et al., 2006, O’Hara et al., 1997, Soler et al., 2003). Molecular markers are a complementary tool for the accurate identification and classification of Pseudomonas species, due to the high sensitivity and specificity that they provide. DNA

Chapter 1

sequencing techniques are being introduced in the clinical microbiology laboratory and they are likely to become routine in the near future (Millar et al., 2007). The superiority of molecular techniques has been emphasised for the identification of Gram-negative, oxidase-positive rods from patients with cystic fibrosis (Wellinghausen et al., 2005). The analysis of 16S rRNA gene sequences is a tool widely accepted for molecular identification in bacteria. However, since 16S rRNA gene sequences show very little polymorphism in species in the genus Pseudomonas, accurate molecular identification has to be achieved by other techniques, such as through rpoD gene sequence analysis (as well as other housekeeping genes), as shown for the genus Pseudomonas by Mulet et al. (2010, 2011) and Yamamoto et al. (2000). Effectively, the rpoD gene was shown to be a convenient gene when analysing Pseudomonas, not only for its high discriminatory power between species, but also for the high specificity and efficiency of the primers used, together with the lower sequences contamination of databases, at least nowadays, compared to that of 16S rRNA gene sequences. Moreover, the comparative analysis of this gene facilitates genomovar differentiation among P. stutzeri isolates (Cladera et al., 2004, Mulet et al., 2008). In this study, we analysed the utility of partial rpoD gene sequence analysis as an efficient tool for the identification and genomovar assignation of P. stutzeri strains isolated in clinical environments.

1.2. Methods

A collection of 159 P. stutzeri strains isolated from clinical environments, previously identified by phenotypic methods, where used in this study: 107 P. stutzeri isolates recovered from clinical material over a 19-year period up to 1986 in the United Kingdom and submitted to the National Collection of Type Cultures (NCTC) and identified through standard biochemical tests (Holmes, 1986), 17 isolates recovered from clinical material in Malmö, Sweden, during the period 1971-1989 (Roselló et al., 1991), identified by the API system (bioMérieux), 28 isolates from the culture collection of the Hospital Universitario Son Dureta in Palma de Mallorca, Spain (this study, Bennasar et al., 1998), identified by the API system (bioMérieux) or the MicroScan W/A system (Dade MicroScan Inc.) and, 7 strains recovered from clinical specimens in Copenhagen, Denmark (Stanier et al., 1966), also identified through standard biochemical tests.

Reference strains of P. stutzeri genomovars were included in the study, as well as P. balearica DSM 6083T, P. xanthomarina CCUG 46543T and P. mendocina ATCC 25411T as representatives of closely related species. P. aeruginosa CCM 1960T was used as outgroup. Two environmental strains (PE and V81) not yet assigned to genomovars were also included. A complete list of the strains included in the study is provided in Table S1.1 in the supplemental material.

The DNA extraction was as described by Wilson (1987). Procedures for the amplification and sequencing of the 16S rRNA gene and partial rpoD gene with specific Pseudomonas primers (PsEG30F ATYGAAATCGCCAARCG, PsEG790R

Identification of clinical strains of P. stutzeri

CGGTTGATKTCCTTGA), sequence alignments and the construction of phylogenetic trees were as described previously (Cladera et al., 2004, Mulet et al., 2010). 16S rRNA gene sequencing was used when an isolate did not appear to be affiliated with the Pseudomonas genus. Sequences have been deposited in the EMBL database (the accession numbers are listed in Table S1 in the supplemental material). The Unweighted Pair Group Method with Arithmetic Mean (UPGMA) analysis was done using the ‘Multivariate’ statistic tool included in PAST program (http://folk.uio.no/ohammer/ past/index.html), using the Jaccard correlation coefficient.

1.3. Results

The analysis of the partial sequence of the rpoD gene allowed us to confirm 138 of the isolates as P. stutzeri (86.8%) from the initial set of 159 presumptive P. stutzeri strains isolated from clinical environments. The phylogenetic tree in Fig. 1.1 shows the genomovar organisation of these 138 isolates of P. stutzeri. The majority of them (79%) were assigned to genomovar 1 (Fig. 1.1A), whilst 8.7% and 5.1% were assigned to genomovars 2 and 3, respectively; the remainder fell into five of the remaining 16 genomovars or could not be assigned to known gvs within the species (Fig. 1.1B).

Comparison between MicroScan W/A and rpoD gene sequence-based identification for 15 isolates from Son Dureta Hospital are summarised in Table 1.1. The analysis of these 15 isolates with MicroScan resulted in 12 different biotypes (data not shown). With this system, we observed isolates with a low percentage of assignment to P. stutzeri that, nevertheless, were confirmed as P. stutzeri through rpoD gene sequence based identification, as well as isolates with a high percentage of assignment to P. stutzeri that resulted in identification as other Pseudomonas species. The identification of these isolates with MicroScan relied mainly on the antibiotic resistance profile and the utilisation of malonic acid as the sole source of carbon.

The partial rpoD gene sequence analysis facilitated the identification to the species level of the remaining 21 Pseudomonas strains previously (incorrectly) ascribed to P. stutzeri purely on phenotypic grounds (Bennasar et al., 1998, Holmes, 1986). The phylogenetic affiliation of these isolates (13.2% of the clinical isolates) was analysed together with 107 Pseudomonas type strains (Mulet et al., 2010). These non-P. stutzeri isolates were assigned to P. mendocina (one strain), P. moraviensis (one strain), P. oleovorans (one strain), P. toyotomiensis (two strains), P. aeruginosa (one strain) and to 4–5 probably new Pseudomonas species (11 strains) (Fig. 1.2).

Chapter 1

Figure 1.1 Panel A

Figure 1.1. Phylogenetic tree based on the partial rpoD gene sequence analysis of Pseudomonas stutzeri. Boostrap values higher than 50% (from 1000 replicates) are indicated. Reference strains of each genomovar are highlighted in bold. The bar indicates sequence divergence. Panel A Distribution of clinical isolates among genomovars 1 and 5 of P. stutzeri.

Identification of clinical strains of P. stutzeri

Figure 1.1. Panel B

Figure 1.1. Panel B. Distribution of clinical isolates among genomovars 2 to 19.

Table 1.1. Comparison between MicroScan W/A and rpoD sequence-based identification for 15 P. stutzeri isolates from Son Dureta Hospital, Palma de Mallorca, Spain.

Isolate P. stutzeri probability rpoD based identification SD39 40.0% P. stutzeri gv8 SD106 97.2% P. stutzeri gv1 SD119 82.8% Pseudomonas sp. SD129 97.8% P. stutzeri gv n.a. SD130 93.3% Pseudomonas sp. SD136 96.2% P. stutzeri gv1 SD139 82.8% Pseudomonas sp. SD140 82.9% Pseudomonas sp. SD142 67.5% Pseudomonas sp. SD144 98.4% P. stutzeri gv1 SD146 84.5% P. stutzeri gv1 SD148 74.7% P. stutzeri gv1 SD150 93.7% Pseudomonas sp. SD151 98.4% P. stutzeri gv1 SD152 88.5% P. stutzeri gv3

Chapter 1

Figure 1.2. Phylogenetic tree based on the partial rpoD gene sequence analysis of Pseudomonas species (67 of the 107 Pseudomonas type strains used are shown). Bootstrap values higher than 50% (from 1,000 replicates) are indicated in the nodes. The bar indicates sequence divergence. Clinical isolates from this study are highlighted in bold.

Identification of clinical strains of P. stutzeri

The API 20NE strips are also used routinely in the medical microbiology laboratory for Pseudomonas identification. As indicated in Table 1.2, the phenotypical identification of 29 P. stutzeri strains representing the 19 genomovars of the species gave rise to an erroneous classification in 10 of them (34%). Moreover, Table 1.2 also shows the incorrect API 20NE identification of four strains classified in other Pseudomonas species by molecular sequencing methods. The UPGMA cluster analysis of 65 biochemical tests of 53 of the isolates studied previously (Holmes, 1986) was carried out in order to see the organisation of the isolates depending only on phenotypic traits. The results are shown in Fig. 1.3. We found no clear correlation with P. stutzeri genomovars and observed that these biochemical tests are not sufficient to discriminate P. stutzeri from some other Pseudomonas species.

1.3. Discussion

The rpoD gene analysis permitted the identification and genomovar assignation of 159 presumptive P. stutzeri strains isolated from clinical environments and previously identified in clinical laboratories by routine methods (this study, Bennasar et al., 1998, Holmes, 1986). The isolates were ascribed mostly to genomovar 1 of P. stutzeri, which is consistent with previously reported studies, where the concepts of ecotypes and niche adaptation in P. stutzeri were analysed (Lalucat et al., 2006).

It has been previously reported that the phenotypic identification of P. stutzeri strains could yield incorrect results. Effectively, as demonstrated in this and other studies, different commercial identification systems confuse P. stutzeri with Plesiomonas shigelloides, P. fluorescens (O’Hara et al., 1997), P. fragi, P. lundensis (Gavini et al., 1989) and with P. aeruginosa (Bosshard et al., 2006), or also with members of the genera Comamonas and Ochrobactrum. Different Pseudomonas species are likely to be confused with P. stutzeri when applying only phenotypic identification. Several studies have been carried out in order to try to determine discriminative phenotypic characters for the differentiation of P. stutzeri genomovars (Roselló et al., 1991 and Roselló-Mora et al., 1994), but they were not successful. UPGMA analysis in this study also indicated the difficulty of differentiating genomovars on phenotypic tests and the ease of confusing P. stutzeri with some other species.

Given these considerations, we propose the use of partial rpoD gene sequence comparative analysis as a simple and unambiguous approach for both the routine identification and the genomovar assignation of P. stutzeri clinical isolates. This method is also useful for epidemiology and molecular typing studies. To ensure the simplicity and reliability of this method, we recommend the utilisation of the PseudoMLSA database (http://www.uib.es/microbiologiaBD/Welcome.html) in a framework of effectively curated sequence sets, selected under non-redundancy and reference strains (i.e. those sequences of type strains) criteria; it is a powerful tool for the rapid identification of any Pseudomonas isolate through multigenic sequence analysis (Bennasar et al., 2010).

Chapter 1

Figure 1.3. Phenogram based on the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) analysis of 65 biochemical tests (Holmes, 1986) for 53 selected P. stutzeri clinical isolates. Identification of the isolates was based on the partial rpoD gene sequence analysis (except for Alcaligenes faecalis, for which 16S rRNA gene analysis was used). The biochemical tests included were: motility 37°C, motility room temperature, growth 37°C, growth room temperature, growth MacConkey, catalase, oxidase, nitrate, Simmons citrate, Christensen’s citrate, urease, gelatin stab, gelatin plate, KCN, H2S paper, H2S TSI, gluconate, malonate, ONPG, phenylpyruvic acid (PPA), arginine, lysine, ornithine, glucose, PWS, gas glucose, selenite 0.4%, casein hydrolysis, DNAse, glucose ASS, adonitol ASS, arabinose ASS, cellobiose ASS, dulcitol ASS, glycerol ASS, inositol ASS, lactose ASS, maltose ASS, mannitol ASS, raffinose ASS, rhamnose ASS, salicin ASS, sorbitol ASS, sucrose ASS, trehalose ASS, xylose ASS, ethanol ASS, fructose ASS, Thornley arginine, Tween 20, Tween 80, tyrosine hydrolysis, brown melanin-like pigment on tyrosine agar, nitrite, poly-β- hydroxybutyrate (PHBA) growth, PHBA inclusion, aesculin, cetrimide, fluorescence on Kings B, growth 5°C, growth 42°C, 3- ketolactose, lecithinase, starch hydrolysis, acid from 10% glucose, acid from 10% lactose.

Identification of clinical strains of P. stutzeri

Table 1.2. Comparison between API 20NE and rpoD gene identification for 29 P.stutzeri strains and related species.

Strain Other name Gv Origin API API identification Accuracy CCUG 11256T ATCC 17588 ref 1 clinical 1040655profile P. stutzeri (99.8%) Very good CCUG 29240 DNPR1 1 waste water 1044775 P. aeruginosa (92.7%) Good CCUG 29241 75873 1 clinical 1044755 P. stutzeri (76.0 % ) Dubious CCUG 29244 34962 1 clinical 1045754 O. anthropi (99.7 %) Very good CCUG 29245 76428 1 clinical 1040655 P. stutzeri (99.8 %) Very good A1501 1 rhizosphere 0040655 P. stutzeri (97.6%) Good

A732/80 1 clinical 1044675 P. stutzeri (98.9%) Good

CCUG 44592 ATCC 17591 ref 2 clinical 0044655 P. stutzeri (99.9%) Very good DSM50227 ref 3 clinical 1044655 P. stutzeri (99.9%) Excellent

CCUG 29242 CH87 3 soil 1044675 P. stutzeri (98.9 %) Good CCUG 29243 AN10 3 marine 1044654 P. stutzeri (99.9 %) Excellent 19SMN4 ref 4 marine 0040655 P. stutzeri (97.6%) Good

CCUG 29246 ST27MN3 4 marine 1040655 P. stutzeri (99.8 %) Very good DNSP21 ref 5 waste water 0044655 P. stutzeri (99.9%) Very good

CCUG 44596 DSM 50238 ref 7 soil 1040255 P. stutzeri (98.8 %) Good JM300 ref 8 soil 0046655 P. stutzeri (92.1%) Good

A60/68 8 clinical 1047455 P. fluorescens (92.4%) Good

P. aeruginosa (79.1%); ATCC 5595 KC ref 9 aquifer 0054675 Acceptable in genus P. stutzeri (18.5%) chemical C. testosteroni; CLN100 ref 10 3040474 Dubious deposit P. alcaligenes (42.6%) CCUG 50544 28a50 ref 11 soil 0046645 P. stutzeri (89.5 %) Acceptable O. anthropi (38.1%); CCUG 50543 28a39 ref 12 soil 1047675 Weak discrimination P. stutzeri (31.6 %) SD93936 12 clinical 1044674 P. stutzeri (99.0 %) Very good

A. salmomicida subsp. CCUG 50542 28a22 ref 13 soil 0046404 Dubious masoucida (89.3 %) O. anthropi (38.1%); CCUG 50541 28a3 ref 14 soil 1047675 Weak discrimination P. stutzeri (31.6 %) marine CCUG 50538 4C29 ref 15 1044464 C. acidovorans (59.4 %) Weak discrimination sediment CCUG 50539 24a13 ref 16 soil 1044655 P. stutzeri (99.9 %) Excellent CCUG 50540 24a75 ref 17 soil 1000455 C. testosteroni (53.5 %) Weak discrimination CCUG 50545 MT-1 ref 18 deep sea 1045675 P. stutzeri (89.5 %) Acceptable A563/77 n.a. clinical 1045645 P. stutzeri (77.4%) Weak discrimination

Other species studied and identified as P. stutzeri P. balearica LS401T marine 1040655 P. stutzeri (99.8 %) Very good

P. stutzeri (56.8 %); P. fluorescens ATCC 17482 1146045 Acceptable in genus P. fluorescens (32.8%) P. xanthomarina marine 1044665 P. stutzeri (98.8%) Good

Pseudomonas SD62327 clinical 1046455 P. stutzeri (90.0%) Acceptable gv: genomovar; ref: genomovar reference strain; n.a.: not assigned

1.4. Supplemental material

Supplemental Table S1.1. Bacterial strains used in this study. Reference strains of P. stutzeri genomovars are highlighted in bold.

Sequence Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference accession number P. stutzeri CCUG 11256T P. stutzeri gv1 (Ref.) AJ631316 Biochemical tests Clinical Copenhaguen, Denmark Lalucat et al., 2006 A48/66 P. stutzeri gv1 HE573591 Biochemical tests Clinical United Kingdom Holmes, 1986 A75/66 P. stutzeri gv1 HE573592 Biochemical tests Clinical United Kingdom Holmes, 1986 A42/69 P. stutzeri gv1 HE573593 Biochemical tests Clinical United Kingdom Holmes, 1986 A69/69 P. stutzeri gv1 HE573594 Biochemical tests Clinical United Kingdom Holmes, 1986 A94/69 P. stutzeri gv1 HE573595 Biochemical tests Clinical United Kingdom Holmes, 1986 A95/69 P. stutzeri gv1 HE573596 Biochemical tests Clinical United Kingdom Holmes, 1986 A63/70 P. stutzeri gv1 HE573597 Biochemical tests Clinical United Kingdom Holmes, 1986 A109/72 P. stutzeri gv1 HE573598 Biochemical tests Clinical United Kingdom Holmes, 1986 A446/72 P. stutzeri gv1 HE573599 Biochemical tests Clinical United Kingdom Holmes, 1986 A186/73 P. stutzeri gv1 HE573600 Biochemical tests Clinical United Kingdom Holmes, 1986 A304/73 P. stutzeri gv1 HE573601 Biochemical tests Clinical United Kingdom Holmes, 1986 A553/73 P. stutzeri gv1 HE573602 Biochemical tests Clinical United Kingdom Holmes, 1986 A66/74 P. stutzeri gv1 HE573603 Biochemical tests Clinical United Kingdom Holmes, 1986 A96/74 P. stutzeri gv1 HE573604 Biochemical tests Clinical United Kingdom Holmes, 1986 A238/74 P. stutzeri gv1 HE573605 Biochemical tests Clinical United Kingdom Holmes, 1986 A239/74 P. stutzeri gv1 HE573606 Biochemical tests Clinical United Kingdom Holmes, 1986 A552/74 P. stutzeri gv1 HE573607 Biochemical tests Clinical United Kingdom Holmes, 1986 A594/74 P. stutzeri gv1 HE573608 Biochemical tests Clinical United Kingdom Holmes, 1986 A626/74 P. stutzeri gv1 HE573609 Biochemical tests Clinical United Kingdom Holmes, 1986 A261/75 P. stutzeri gv1 HE573610 Biochemical tests Clinical United Kingdom Holmes, 1986

Supplemental Table S1.1. Continued. Sequence Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference accession number A525/75 P. stutzeri gv1 HE573611 Biochemical tests Clinical United Kingdom Holmes, 1986 A659/75 P. stutzeri gv1 HE573612 Biochemical tests Clinical United Kingdom Holmes, 1986 A5/76 P. stutzeri gv1 HE573613 Biochemical tests Clinical United Kingdom Holmes, 1986 A54/76 P. stutzeri gv1 HE573614 Biochemical tests Clinical United Kingdom Holmes, 1986 A122/76 P. stutzeri gv1 HE573615 Biochemical tests Clinical United Kingdom Holmes, 1986 A545/76 P. stutzeri gv1 HE573616 Biochemical tests Clinical United Kingdom Holmes, 1986 A690/76 P. stutzeri gv1 HE573617 Biochemical tests Clinical United Kingdom Holmes, 1986 A737/76 P. stutzeri gv1 HE573618 Biochemical tests Clinical United Kingdom Holmes, 1986 A37/77 P. stutzeri gv1 HE573619 Biochemical tests Clinical United Kingdom Holmes, 1986 A42/77 P. stutzeri gv1 HE573620 Biochemical tests Clinical United Kingdom Holmes, 1986 A342/77 P. stutzeri gv1 HE573621 Biochemical tests Clinical United Kingdom Holmes, 1986 A359/77 P. stutzeri gv1 HE573622 Biochemical tests Clinical United Kingdom Holmes, 1986 A597/77 P. stutzeri gv1 HE573623 Biochemical tests Clinical United Kingdom Holmes, 1986 A621/77 P. stutzeri gv1 HE573624 Biochemical tests Clinical United Kingdom Holmes, 1986 A181/78 P. stutzeri gv1 HE573625 Biochemical tests Clinical United Kingdom Holmes, 1986 A235/78 P. stutzeri gv1 HE573626 Biochemical tests Clinical United Kingdom Holmes, 1986 A296/78 P. stutzeri gv1 HE573627 Biochemical tests Clinical United Kingdom Holmes, 1986 A297/78 P. stutzeri gv1 HE573628 Biochemical tests Clinical United Kingdom Holmes, 1986 A401/78 P. stutzeri gv1 HE573629 Biochemical tests Clinical United Kingdom Holmes, 1986 A488/78 P. stutzeri gv1 HE573630 Biochemical tests Clinical United Kingdom Holmes, 1986 A529/78 P. stutzeri gv1 HE573631 Biochemical tests Clinical United Kingdom Holmes, 1986 A549/78 P. stutzeri gv1 HE573632 Biochemical tests Clinical United Kingdom Holmes, 1986 A582/78 P. stutzeri gv1 HE573633 Biochemical tests Clinical United Kingdom Holmes, 1986 A582/78a P. stutzeri gv1 HE573634 Biochemical tests Clinical United Kingdom Holmes, 1986 A636/78 P. stutzeri gv1 HE573635 Biochemical tests Clinical United Kingdom Holmes, 1986

Supplemental Table S1.1. Continued. Sequence accession Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference number A666/78 P. stutzeri gv1 HE573636 Biochemical tests Clinical United Kingdom Holmes, 1986 A670/78 P. stutzeri gv1 HE573637 Biochemical tests Clinical United Kingdom Holmes, 1986 A514/79 P. stutzeri gv1 HE573638 Biochemical tests Clinical United Kingdom Holmes, 1986 A99/80 P. stutzeri gv1 HE573639 Biochemical tests Clinical United Kingdom Holmes, 1986 A773/80 P. stutzeri gv1 HE573640 Biochemical tests Clinical United Kingdom Holmes, 1986 A205/81 P. stutzeri gv1 HE573641 Biochemical tests Clinical United Kingdom Holmes, 1986 A222/81 P. stutzeri gv1 HE573642 Biochemical tests Clinical United Kingdom Holmes, 1986 A367/81 P. stutzeri gv1 HE573643 Biochemical tests Clinical United Kingdom Holmes, 1986 A486/81 P. stutzeri gv1 HE573644 Biochemical tests Clinical United Kingdom Holmes, 1986 A496/81 P. stutzeri gv1 HE573645 Biochemical tests Clinical United Kingdom Holmes, 1986 A23/82 P. stutzeri gv1 HE573646 Biochemical tests Clinical United Kingdom Holmes, 1986 A92/82 P. stutzeri gv1 HE573647 Biochemical tests Clinical United Kingdom Holmes, 1986 A197/82 P. stutzeri gv1 HE573648 Biochemical tests Clinical United Kingdom Holmes, 1986 A200/82 P. stutzeri gv1 HE573649 Biochemical tests Clinical United Kingdom Holmes, 1986 A222/82 P. stutzeri gv1 HE573650 Biochemical tests Clinical United Kingdom Holmes, 1986 A19/83 P. stutzeri gv1 HE573651 Biochemical tests Clinical United Kingdom Holmes, 1986 A76/83 P. stutzeri gv1 HE573652 Biochemical tests Clinical United Kingdom Holmes, 1986 A443/83 P. stutzeri gv1 HE573653 Biochemical tests Clinical United Kingdom Holmes, 1986 A457/83 P. stutzeri gv1 HE573654 Biochemical tests Clinical United Kingdom Holmes, 1986 A4/84 P. stutzeri gv1 HE573655 Biochemical tests Clinical United Kingdom Holmes, 1986 A40/84 P. stutzeri gv1 HE573656 Biochemical tests Clinical United Kingdom Holmes, 1986 A42/84 P. stutzeri gv1 HE573657 Biochemical tests Clinical United Kingdom Holmes, 1986 A141/84 P. stutzeri gv1 HE573658 Biochemical tests Clinical United Kingdom Holmes, 1986 A179/84 P. stutzeri gv1 HE573659 Biochemical tests Clinical United Kingdom Holmes, 1986 A222/84 P. stutzeri gv1 HE573660 Biochemical tests Clinical United Kingdom Holmes, 1986

Supplemental Table S1.1. Continued. Sequence accession Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference number A228/84a P. stutzeri gv1 HE573661 Biochemical tests Clinical United Kingdom Holmes, 1986 A233/84 P. stutzeri gv1 HE573662 Biochemical tests Clinical United Kingdom Holmes, 1986 A240/84 P. stutzeri gv1 HE573664 Biochemical tests Clinical United Kingdom Holmes, 1986 A154/85 P. stutzeri gv1 HE573665 Biochemical tests Clinical United Kingdom Holmes, 1986 A225/85 P. stutzeri gv1 HE573666 Biochemical tests Clinical United Kingdom Holmes, 1986 A248/85 P. stutzeri gv1 HE573667 Biochemical tests Clinical United Kingdom Holmes, 1986 A284/85 P. stutzeri gv1 HE573668 Biochemical tests Clinical United Kingdom Holmes, 1986 A318/85 P. stutzeri gv1 HE573669 Biochemical tests Clinical United Kingdom Holmes, 1986 A234/88 P. stutzeri gv1 HE573663 Biochemical tests Clinical United Kingdom Holmes, 1986 31107 P. stutzeri gv1 HE573670 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 32662 P. stutzeri gv1 HE573671 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 34427 P. stutzeri gv1 HE573672 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 42776 P. stutzeri gv1 HE573673 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 51045 P. stutzeri gv1 HE573674 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 70614 P. stutzeri gv1 HE573675 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 72152 P. stutzeri gv1 HE573676 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 72389 P. stutzeri gv1 HE573677 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 72585 P. stutzeri gv1 HE573678 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 72661 P. stutzeri gv1 HE573679 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 74620 P. stutzeri gv1 HE573680 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 75873 P. stutzeri gv1 HE573681 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 76428 P. stutzeri gv1 HE573682 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 76722 P. stutzeri gv1 HE573683 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 77227 P. stutzeri gv1 HE573684 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 77228 P. stutzeri gv1 HE573685 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991

Supplemental Table S1.1. Continued. Sequence accession Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference number 81958 P. stutzeri gv1 HE573686 Biochemical tests Clinical Malmö, Sweden Rosselló-Mora et al., 1991 SD106 P. stutzeri gv1 HE573687 MicroScan Clinical Palma, Spain This study SD136 P. stutzeri gv1 HE573688 MicroScan Clinical Palma, Spain This study SD144 P. stutzeri gv1 HE573689 MicroScan Clinical Palma, Spain This study SD146 P. stutzeri gv1 HE573690 MicroScan Clinical Palma, Spain This study SD148 P. stutzeri gv1 HE573691 MicroScan Clinical Palma, Spain This study SD151 P. stutzeri gv1 HE573692 MicroScan Clinical Palma, Spain This study SD55473 P. stutzeri gv1 AJ631318 API 20NE Clinical Palma, Spain Bennasar et al., 1998 SD32047 P. stutzeri gv1 HE573693 API 20NE Clinical Palma, Spain This study SD17204 P. stutzeri gv1 HE573694 API 20NE Clinical Palma, Spain Bennasar et al., 1998 SD20240 P. stutzeri gv1 HE573695 API 20NE Clinical Palma, Spain Bennasar et al., 1998 ATCC 17589 P. stutzeri gv1 HE573696 Biochemical tests Clinical Copenhaguen, Denmark Stanier et al., 1996 ATCC 17593 P. stutzeri gv1 HE573696 Biochemical tests Clinical Copenhaguen, Denmark Stanier et al., 1996 ATCC 17591 P. stutzeri gv2 (Ref.) AJ631322 Biochemical tests Clinical Copenhaguen, Denmark Stanier et al., 1996 ATCC 17587 P. stutzeri gv2 HE573698 Biochemical tests Clinical Copenhaguen, Denmark Stanier et al., 1996 ATCC 17592 P. stutzeri gv2 HE573699 Biochemical tests Clinical Copenhaguen, Denmark Stanier et al., 1996 ATCC 17595 P. stutzeri gv2 HE573700 Biochemical tests Clinical Copenhaguen, Denmark Stanier et al., 1996 A85a/66 P. stutzeri gv2 HE573701 Biochemical tests Clinical United Kingdom Holmes, 1986 A60/72 P. stutzeri gv2 AJ631324 Biochemical tests Clinical United Kingdom Holmes, 1986 A235/73a P. stutzeri gv2 HE573702 Biochemical tests Clinical United Kingdom Holmes, 1986 A240/74 P. stutzeri gv2 HE573703 Biochemical tests Clinical United Kingdom Holmes, 1986 A546/74a P. stutzeri gv2 HE573704 Biochemical tests Clinical United Kingdom Holmes, 1986 A496/77 P. stutzeri gv2 HE573705 Biochemical tests Clinical United Kingdom Holmes, 1986 A319/81 P. stutzeri gv2 HE573706 Biochemical tests Clinical United Kingdom Holmes, 1986 A236/84 P. stutzeri gv2 HE573707 Biochemical tests Clinical United Kingdom Holmes, 1986

Supplemental Table S1.1. Continued. Sequence Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference accession number DSM 50227 P. stutzeri gv3 (Ref.) AM905860 Soil Unknown Lalucat et al., 2006

A490/75 P. stutzeri gv3 HE573708 Biochemical tests Clinical United Kingdom Holmes, 1986 A1/77 P. stutzeri gv3 HE573709 Biochemical tests Clinical United Kingdom Holmes, 1986 A51/82 P. stutzeri gv3 HE573710 Biochemical tests Clinical United Kingdom Holmes, 1986 A266/82 P. stutzeri gv3 HE573711 Biochemical tests Clinical United Kingdom Holmes, 1986 A228/84b P. stutzeri gv3 HE573712 Biochemical tests Clinical United Kingdom Holmes, 1986 A235/84 P. stutzeri gv3 HE573713 Biochemical tests Clinical United Kingdom Holmes, 1986 SD152 P. stutzeri gv3 HE573714 MicroScan Clinical Palma, Spain This study 19SMN4 P. stutzeri gv4 (Ref.) AJ631333 Marine sediment Barcelona, Spain Lalucat et al., 2006

DNSP21 P. stutzeri gv5 (Ref.) AJ631334 Wastewater Mallorca, Spain Lalucat et al., 2006

A655/78 P. stutzeri gv5 HE573715 Biochemical tests Clinical United Kingdom Holmes, 1986 DSM 50238 P. stutzeri gv7 (Ref.) AJ631339 Soil California Lalucat et al., 2006

JM300 P. stutzeri gv8 (Ref.) AJ631367 Soil California Rosselló-Mora et al., 1996

SD39 P. stutzeri gv8 HE573716 MicroScan Clinical Palma, Spain This study A60/68 P. stutzeri gv8 HE573717 Biochemical tests Clinical United Kingdom Holmes, 1986 KC P. stutzeri gv9 (Ref.) AJ631338 Aquifer California Sepúlveda-Torres et al., 2001

CLN100 P. stutzeri gv10 (Ref.) AJ518947 Chemical industry waste water Germany Lalucat et al., 2006

28a50 P. stutzeri gv11 (Ref.) AM939370 Soil, airport area. Tel Aviv, Israel Sikorski et al., 2005

28a39 P. stutzeri gv12 (Ref.) AM939371 Soil, airport area. Tel Aviv, Israel Sikorski et al., 2005

SD25545 P. stutzeri gv12 HE573718 API 20NE Clinical Palma, Spain This study 28a22 P. stutzeri gv13 (Ref.) AM939372 Soil, airport area. Tel Aviv, Israel Sikorski et al., 2005

28a3 P. stutzeri gv14 (Ref.) AM939373 Soil, airport area. Tel Aviv, Israel Sikorski et al., 2005

4c29 P. stutzeri gv15 (Ref.) AM939374 Marine sediment Dangast, Germany Sikorski et al., 2005

Supplemental Table S1.1. Continued. Sequence Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference accession number 24a13 P. stutzeri gv16 (Ref.) AM939375 Soil with mineral oil Espelkamp, Germany Sikorski et al., 2005

24a75 P. stutzeri gv17 (Ref.) AM939376 Soil with mineral oil Espelkamp, Germany Sikorski et al., 2005

MT-1 P. stutzeri gv18 (Ref.) AM939377 Marine sediment Mariana Trench Sikorski et al., 2005

Didemnum sp. (marine Romanenko et al., 2005, CCUG 46542 P. stutzeri gv19 (Ref.) AM905861 Maldives ascidian) Mulet et al., 2009 A563/77 P. stutzeri gv n.a.a HE573719 Biochemical tests Clinical United Kingdom Holmes, 1986 PE P. stutzeri gv n.a.a FN994779 Putidoil® Mallorca, Spain Mulet et al., 2008

V81 P. stutzeri gv n.a.a FN994217 Oil contaminated sand Galicia, Spain Mulet et al., 2008

SD129 P. stutzeri gv n.a.a HE573720 MicroScan Clinical Palma, Spain This study A160/74 P. stutzeri gv n.a.a HE573721 Biochemical tests Clinical United Kingdom Holmes, 1986 A732/80 P. stutzeri gv n.a.a HE573722 Biochemical tests Clinical United Kingdom Holmes, 1986 A776/80 P. stutzeri gv n.a.a HE573723 Biochemical tests Clinical United Kingdom Holmes, 1986 SD93936 P. stutzeri gv n.a.a HE573724 API 20NE Clinical Palma, Spain Bennasar et al. 1998 P. xhantomarina

CCUG 46453T AM905872 Halocynthia aurantium Sea of Japan Romanenko et al., 2005

P. balearica

DSM 6083T AJ633565 Wastewater Mallorca, Spain Bennasar et al., 1996

LS401 AJ633566 Marine Barcelona, Spain Lalucat et al., 2006

P. aeruginosa

CCM 1960T AJ633568 Unknown Unknown -

P. mendocina

ATCC 25411T AJ633567 Soil Mendoza, Argentina Lalucat et al., 2006

Supplemental Table S1.1. Continued. Sequence accession Strain Affiliation c Phenotypic method Sample (source) Geographical origin Reference number Other Pseudomonasb

A31/70 Pseudomonas sp. HE573725 Biochemical tests Clinical United Kingdom Holmes, 1986 A430/77 P. moraviensis HE573726 Biochemical tests Clinical United Kingdom Holmes, 1986 A577/77 P. oleovorans HE573727 Biochemical tests Clinical United Kingdom Holmes, 1986 A63/83 P. mendocina HE573728 Biochemical tests Clinical United Kingdom Holmes, 1986 A269/83 Pseudomonas sp. HE573729 Biochemical tests Clinical United Kingdom Holmes, 1986 A270/83 Pseudomonas sp. HE573730 Biochemical tests Clinical United Kingdom Holmes, 1986 A271/83 Pseudomonas sp. HE573731 Biochemical tests Clinical United Kingdom Holmes, 1986 SD62327 Pseudomonas sp. HE573732 API 20NE Clinical Palma, Spain Bennasar et al., 1998 SD34897 P. aeruginosa HE573733 API 20NE Clinical Palma, Spain This study SD29577 P. toyotomiensis HE573734 API 20NE Clinical Palma, Spain This study SD9377 P. toyotomiensis HE573735 API 20NE Clinical Palma, Spain Bennasar et al., 1998 SD119 Pseudomonas sp. HE573736 MicroScan Clinical Palma, Spain This study SD130 Pseudomonas sp. HE573737 MicroScan Clinical Palma, Spain This study SD139 Pseudomonas sp. HE573738 MicroScan Clinical Palma, Spain This study SD140 Pseudomonas sp. HE573739 MicroScan Clinical Palma, Spain This study SD142 Pseudomonas sp. HE573740 MicroScan Clinical Palma, Spain This study SD150 Pseudomonas sp. HE573741 MicroScan Clinical Palma, Spain This study A408/79 Alcaligenes faecalisd HE573742 Biochemical tests Clinical United Kingdom Holmes, 1986 SD43412 Acinetobacter sp.d HE573743 API 20NE Clinical Palma, Spain This study SD24438 Acinetobacter sp.d HE573744 API 20NE Clinical Palma, Spain Bennasar et al., 1998 SD23124 Halomonas sp.d HE573745 API 20NE Clinical Palma, Spain This study aNot assigned. bPhenotypically identified as P. stutzeri. cAffiliation through partial rpoD gene sequencing. dAffiliation through partial 16S rRNA gene sequencing.

WC-MALDI-TOF MS and MLSA of P. stutzeri

Chapter 2:

Whole-cell MALDI-TOF mass spectrometry and multilocus sequence analysis in the discrimination of Pseudomonas stutzeri populations: three novel genomovars

Scotta C, Gomila M, Mulet M, Lalucat J, García-Valdés E. 2013. Whole-Cell MALDI-TOF Mass Spectrometry and Multilocus Sequence Analysis in the Discrimination of Pseudomonas stutzeri Populations: Three Novel Genomovars. Microbial Ecology 66, 522-532. DOI: 10.1007/s00248-013-0246-8.

Chapter 2

Abstract

Pseudomonas stutzeri is a widely distributed species with very high genetic diversity and metabolic capacities, occupying many diverse ecological niches. A collection of 229 P. stutzeri strains isolated from different habitats and geographical locations has been previously characterised phylogenetically by rpoD gene sequencing analysis and in the present study 172 of them phenotypically by whole-cell MALDI-TOF mass spectrometry. Fifty-five strains were further analysed by multilocus sequencing analysis to determine the phylogenetic population structure. Both methods showed coherence in strain grouping; 226 strains were allocated in the 18 genomovars known presently. The remaining three strains are proposed as references for three novel genomovars in the species. The correlation and usefulness of sequence-based phylogenetic analysis and whole-cell MALDI-TOF mass spectrometry, which are essential for autoecological studies in microbial ecology, is discussed for the differentiation of P. stutzeri populations.

WC-MALDI-TOF MS and MLSA of P. stutzeri

2.1. Introduction

Pseudomonas stutzeri is a widely distributed nonfluorescent denitrifying pseudomonad. Although previous studies reported that P. stutzeri shows a notable phenotypic heterogeneity (Holmes, 1986, Palleroni et al., 1970, Rosselló et al., 1991, Rosselló- Mora et al., 1994, Stanier et al., 1966), a combination of morphological, biochemical and physiological characteristics allows its easy differentiation from other Pseudomonas species. The dry, winkled colonial morphology; the ability to use maltose and starch as sole carbon sources; the ability to produce nitrogen anaerobically from nitrate; and negative arginine dihydrolase and gelatinase tests are some of the most useful distinctive traits.

P. stutzeri has been isolated from different environments such as marine waters and sediment, intertidal sand samples and soil and freshwater habitats. Many strains were also recovered from clinical samples, bottled water, vertebrate faeces and paper-making chemicals (García-Valdés et al., 2010). The species is ecologically important due to its ability to degrade xenobiotics, the potential for denitrification, nitrogen fixation and the capability for natural genetic transformation. The high metabolic versatility observed by members of the P. stutzeri species is in accordance with its wide geographical distribution and habitats occupied.

Variety within the species is not limited to physiological traits; it has an extremely broad genotypic diversity. DNA-DNA hybridisations provided evidence for the recognition of 18 genomic groups (genomovars; gv) within the species (Mulet et al., 2008). The genomovar groupings have been confirmed by several molecular techniques (phylogenetic studies, DNA fingerprinting, chemotaxonomic or multi-locus enzyme electrophoresis). There are no phenotypic differences among genomovars that allow the description of a new species for each one. The only strains with biochemical and chemotaxonomic differences are former members of gv 6, which allowed the proposal of a novel species named Pseudomonas balearica (Bennasar et al., 1996). Pseudomonas chloritidismutans was described as a new species, but was later demonstrated that the only strain in the species belongs to P. stutzeri gv 3 (Cladera et al., 2006a). Recently, the whole genome sequences of several well-characterised P. stutzeri strains that are relevant in microbial ecology (strains A15, ZoBell, AN10 and JM300) have been determined, and they confirmed the genomovar groupings within the species (Brunet- Galmés et al., 2012, Busquets et al., 2012, Peña et al., 2012).

P. stutzeri has a global distribution, and local populations have been reported to be highly diverse (Mulet et al., 2011, Sikorski et al., 2002), with representatives of many of the known genomovars. In the present study, an exhaustive phylogenetic analysis was performed on a collection of 229 P. stutzeri strains isolated from multiple habitats and geographical locations to characterise the population structure of the species. Therefore, the distribution of P. stutzeri strains in genomovars was analysed, and conditions for new strains to be assigned to a particular genomovar were revised. The

Chapter 2

utility of different genes in the multilocus sequence analyses was used as a tool for species phylogenetic affiliation. Finally, the strain collection was analysed through whole-cell matrix assisted laser-desorption/ionisation time-of-flight mass spectrometry (WC-MALDI-TOF MS) to construct a database of mass spectra to better facilitate the identification of strains within the species and their respective genomovar. WC- MALDI-TOF MS has the potential for application in environmental microbiology to rapidly reveal cryptic species in large batches of related isolates (Muñoz et al., 2011, Welker and Moore, 2011). The groupings in 18 genomovars have been confirmed by both methods, and three new strains are proposed as representatives of three novel genomovars within the species.

2.2. Methods

2.2.1. Strains Studied and Growth Conditions

A total of 229 P. stutzeri strains have been examined. They comprised 136 strains isolated from clinical environments; 42 strains isolated from intertidal sand contaminated by Prestige’s crude oil (Mulet et al., 2011); 50 strains from our laboratory collection, which have been previously studied by multilocus sequence analysis, MLSA (Cladera et al., 2004, Mulet et al., 2008, 2010); and strain PE, which was isolated from a bioreactor seeded with the commercial compound Putidoil®. A complete list of the bacterial strains studied is provided in Supplementary Table S2.1. Three strains of P. balearica (former genomovar 6 of P. stutzeri) and the type strains of Pseudomonas xanthomarina and Pseudomonas mendocina have been included in the study as representatives of closely related species. The type of strain of Pseudomonas aeruginosa was used as outgroup. A total of 55 strains representing all genomovars were selected for detailed phylogenetic studies (Table 2.1). For biomass recovery, strains were cultured routinely at 30 °C on Luria-Bertani medium (Miller, 1972).

2.2.2. DNA Extraction, PCR, and Sequencing Protocols

Genomic DNA was obtained by lysis with sodium dodecyl sulphate-proteinase K and treatment with cetyltrimethylammonium bromide, as described by Wilson (1987). Partial sequences of the following genes were amplified and sequenced, as previously described (Guasp et al., 2000, Mulet et al., 2009, Santos and Ochman, 2004, Weisburg et al., 1991, Yamamoto et al., 2000): the RNA polymerase sigma 70 subunit (rpoD) gene (585-597 nucleotides), the 16S rRNA gene (1034 nucleotides), the DNA gyrase subunit β (gyrB) gene (821 nucleotides) and the RNA operon internally transcribed spacer 1 (ITS1) region (462-527 nucleotides). The primers used for PCR amplification and sequencing are listed in Supplementary Table S2.2. When no amplicon was obtained with the gyrB primer combination UP- 1E/APrU, the BAUP2/APrU primer combination was used. PCR products were purified using PCR clean up filter plates (Merck Millipore) and labelled with a BigDye® terminator v 3.1 cycle sequencing kit

WC-MALDI-TOF MS and MLSA of P. stutzeri

(Applied Biosystems). Sequencing was performed on an automatic Genetic analyser DNA sequencer 3130 (Applied Biosystems).

Table 2.1. List of the 61 strains analysed by multilocus sequence typing and MALDI- TOF mass spectrometry.

Name Gv Origin Reference P. stutzeri CCUG 11256T 1 Clinical Lalucat et al., 2006 A95/69 1 Clinical Holmes, 1986 A238/74 1 Clinical Holmes, 1986 SD136 1 Clinical Scotta et al., 2012, Chapter 1 SD55473 1 Clinical Bennasar et al., 1998 S1MN1 1 Wastewater Lalucat et al., 2006 B1SMN1 1 Wastewater Lalucat et al., 2006 ATCC 27951 1 Yougurt Lalucat et al., 2006 A655/78 1 Clinical Holmes, 1986 A776/80 1 Clinical Holmes, 1986 A160/74 1 Clinical Holmes, 1986 SD93936 1 Clinical Scotta et al., 2012, Chapter 1 A732/80 1 Clinical Holmes, 1986 ATCC 17591 2 Clinical Stanier et al., 1996 A60/72 2 Clinical Holmes, 1986 ZoBell 2 Marine ZoBell and Upham, 1944 DSM 50227 3 Soil Lalucat et al., 2006 AN10 3 Marine Lalucat et al., 2006 AN11 3 Marine Lalucat et al., 2006 L2SMN2 3 Marine Lalucat et al., 2006 ST27MN2 3 Marine Lalucat et al., 2006 Anaerobic chlorate-reducing DSM 13592 (AW-1) 3 Cladera et al., 2006a bioreactor 2FA 3 Culture collection Mulet et al., 2008 WM88 3 Soil-phosphite enriched Metcalf and Wolfe,1998 AER 5.1 3 Aircraft oil contaminated soil Lalucat et al., 2006 CCUG 36651 3 Water, borehole. Mulet et al., 2008 PTDA 3 Putidoil ® Mulet et al., 2008 19SMN4 4 Marine Lalucat et al., 2006 ST27MN3 4 Marine Lalucat et al., 2006 DNSP21 5 Wastewater Lalucat et al., 2006 JD4 5 Garden soil - Phragmites australis st103 5 Mulet et al., 2008 rhizosphere st104 5 Spartina patens rhizosphere Mulet et al., 2008 DSM 50238 7 Soil Lalucat et al., 2006 AER2.7 7 Aircraft oil contaminated soil Lalucat et al., 2006

Chapter 2

Table 2.1. Continued.

Name Gv Origin Reference 4FB3 7 Estuarine sediment Song et al., 2000 2FB7A 7 River sediment Song et al., 2000 JM300 8 Soil Roselló-Mora et al.,1996 SD39 8 Clinical Scotta et al., 2012, Chapter 1 A60/68 8 Clinical Holmes, 1986 KC 9 Aquifer Sepúlveda-Torres et al., 2001 Deposit of chemical CLN100 10 Lalucat et al., 2006 production plant 28a50 11 Soil Sikorski et al., 2005 28a39 12 Soil Sikorski et al., 2005 SD25545 12 Clinical Scotta et al., 2012, Chapter 1 28a22 13 Soil Sikorski et al., 2005 28a3 14 Soil Sikorski et al., 2005 4c29 15 Marine sediment Sikorski et al., 2005 Soil contaminated with 24a13 16 Sikorski et al., 2005 mineral oil Soil contaminated with 24a75 17 Sikorski et al., 2005 mineral oil MT-1 18 Mariana Trench Sikorski et al., 2005 Didemnum sp. Romanenko et al., 2005, CCUG 46542 19 (marine ascidian) Mulet et al., 2009 PE 20 Putidoil Mulet et al., 2011 A563/77 21 Clinical Holmes, 1986 V81 22 Oil contaminated sand Mulet et al., 2011 P. xhantomarina CCUG 46453T Marine ascidian Romanenko et al., 2005

P. balearica DSM 6083T Wastewater Bennasar et al., 1996

P. balearica LS401 Marine Lalucat et al., 2006

P. balearica st101 S. patents rhizosphere Mulet et al., 2008

P. aeruginosa CCM 1960T Unknown -

P. mendocina ATCC 25411T Soil Lalucat et al., 2006

Strains were assigned to a known genomovar by their phylogenetic affiliation based on partial sequences of the rpoD gene because this gene showed greater differentiation between genomovars than other housekeeping genes tested previously (Cladera et al., 2004, Mulet et al., 2010). Some strains that could not be affiliated with known genomovars were also analysed by partial sequencing of their 16S rRNA, gyrB gene and ITS1 region, for further phylogenetic analysis. The same strategy was used to confirm the strains phylogenetic assignation to genomovars with low isolate numbers.

2.2.3. Sequence Analysis

The sequence alignments were conducted using a hierarchical method for multiple alignments, implemented in the CLUSTAL X program (Thompson et al., 1997). 66

WC-MALDI-TOF MS and MLSA of P. stutzeri

Sequences that were aligned automatically were confirmed manually. Evolutionary distances derived from sequence-pair dissimilarities were calculated using the DNADIST program included in the Phylogenetic Inference Package [PHYLIP version 3.5c (Felsenstein, 1989)]. Gene distances were calculated from nucleotide sequences by the Jukes-Cantor method (Jukes and Cantor, 1969), and dendrograms were generated by neighbour-joining and bootstrap analysis. The tree bootstrap values were computed by resampling 1,000 times. The trees were visualised with the TreeView programme (Page, 1996). Together with the individual trees of the ITS1 region and 16S rRNA, gyrB and rpoD genes, a concatenated analysis of three genes (16S rRNA, gyrB, rpoD; a total of 2443 nt) or the four loci (16S rRNA, gyrB, rpoD, ITS1; 2948 nt) was performed to represent the combined molecular evolutionary relationships (Mulet et al., 2010). Allele and nucleotide diversity was calculated from aligned sequences with the DnaSP package (version 5.0; http://www.ub.edu/dnasp/) (Rozas and Rozas, 1999). Individual rarefaction curves were obtained with PAST programme (version 2.09, http://folk.uio.no/ohammer/past/) (Hammer et al., 2001).

2.2.4. DNA-DNA Hybridisation

Genomic DNA was isolated by a method previously described (Marmur, 1961). DNA- DNA relatedness values were calculated in duplicate using a non-radioactive method, as previously described (Ziemke et al., 1998). The reference DNA was double-labelled with DIG-11- dUTP and biotin-16dUTP using a nick-translation kit (Roche Diagnostics GmbH). DNA-DNA hybridisations were performed using the genomic DNA of P. stutzeri PE (reference strain of gv 20), P. stutzeri A563/77 (reference strain of gv 21), P. stutzeri V81 (reference strain of gv 22) and P. stutzeri 28a39 (reference strain of gv 12) as probes against the other strains studied. Hybridisation experiments were conducted under optimal and stringent temperatures calculated from the melting temperatures based on the G+C mol% content. Colour development was monitored at 405 nm using an iMark Microplate Absorbance Reader (BioRad).

2.2.5. Phenotypic Tests

The three strains (PE, A563/77 and V81) representing three putative novel genomovars were characterised phenotypically by API 20NE strips (Biomerieux) to confirm their assignation to P. stutzeri.

2.2.6. WC-MALDI-TOF Mass Spectrometry

WC-MALDI-TOF mass spectrometry was performed at Anagnostec and RIPAC GmbH, Germany (Kallow et al., 2010). Some strains were analysed as methodological controls two or three times. Strains were cultured on LB plates at 30 °C for 24-48 h. The methodology and processing of the raw data used are described in Scotta et al. (2011, see chapter 5) and Mulet et al. (2012b). The peak profiles obtained for each species within a mass range from 3,000 to 20,000 Da were analysed and compared using the

Chapter 2

BGP database software available at the website http://sourceforge.net/ projects/bgp. The percent similarities of identical mass peaks was calculated and used to generate a dendrogram using PermutMatrix software by applying an average linkage method (UPGMA hierarchical clustering) and Pearson’s distance correlation (Caraux and Pinloche, 2005). The dendrogram was constructed using the average value of duplicate analyses for each strain to assess topology coherence. The strains were also identified by comparing the resulting mass fingerprints with the SARAMIS (Spectral Archiving and Microbial Identification System, Release 3.36, Anagnostec and RIPAC GmbH, Germany) database.

2.2.7. Nucleotide Sequence Accession Numbers

The nucleotide sequences obtained in this study have been deposited in the EMBL database under accession numbers HE571074 to HE571128 and are listed in Supplementary Table S2.3. The gyrB gene sequence for P. stutzeri DSM 50238 (reference strain of genomovar 7) as well as the rpoD gene sequence for P. stutzeri JD4 (genomovar 5) has been updated in the database.

2.3. Results

2.3.1. MLSA

To study the sequence diversity and population structure, isolates of P. stutzeri from various origins were included in this study: 136 clinical isolates, 16 soil isolates, three wastewater isolates, 11 marine environment isolates, 42 isolates from intertidal oil contaminated sand and 21 extra isolates from different sources (Supplementary Table S2.1).

Four loci were selected for phylogenetic analysis. In addition to the 16S rRNA, rpoD and gyrB genes, which were proposed by Mulet et al. (2010) as appropriate for studying the phylogeny of the genus Pseudomonas, the ITS1 region was included as proposed by Guasp et al. (2000). The genetic diversity of the four loci was studied in 55 strains of P. stutzeri representing all of the genomovars described thus far (Table 2.2). The gyrB and rpoD genes showed a similar number of polymorphic sites (42.5 and 42.4 %, respectively), but the rpoD gene exhibited higher number of informative sites (38.8 %) than gyrB gene (37.1 %). The evolutionary pressure upon rpoD and gyrB genes was quantified through the dN/dS ratio. This value was lower than 1 in both protein-coding genes indicating that they are under purifying selection pressure.

To determine the genomovar differentiation power of each locus, the least square tendency lines comparison of phylogenetic similarities was conducted with 55 P. stutzeri and five closely related Pseudomonas strains (one P. mendocina, one P. xanthomarina and three P. balearica). Selected strains are indicated in Table 2.1. For each single gene, a matrix of phylogenetic similarity was constructed, and pair-wise 68

WC-MALDI-TOF MS and MLSA of P. stutzeri

comparisons were plotted (Fig. 2.1). The discriminatory power of each locus was calculated as the ratio between the rpoD gene slope and the slopes of other loci: rpoD/16S rRNA (14 times), rpoD/ITS1 (twice) and rpoD/gyrB (once). The most discriminating locus analysed was rpoD, followed by gyrB gene, ITS1 region and 16S rRNA gene. This result, together with the genetic diversity data, corroborates that the rpoD gene should be the elected locus when analysing P. stutzeri populations (Cladera et al., 2004, Mulet et al., 2008, Scotta et al., 2012 (see chapter 1)).

Analysis of the rpoD gene partial sequence allowed the direct assignment of 95 % of the 229 strains studied to a known genomovar (Fig. 2.2, Supplementary Fig. S2.1, and Supplementary Table S2.1). In a few cases (5 %), sequence analysis of more genes was required for genomovar assignment. This was the case for the following strains: PE, V81, A563/77, A60/68, A160/74, A655/78, A732/80, A776/80, SD93936, SD25545 and SD136 for which the 16S rRNA, gyrB and ITS1 loci were included in addition to the rpoD gene analysis. The clustering and branching order in the concatenated tree of three and four genes allowed the correct genomovar assignation of these strains (Fig. 2.3, Supplementary Fig. S2.2e).

Table 2.2. Nucleotide diversity for the rpoD gene among genomovars with more than one representative and among the four loci used in the 55 P. stutzeri strains analysed by MLSA.

Gv Nr Locus Fragment Nr Genetic Polymorphic informative Nucleotide dN/dS strains length alleles diversity sites % sites % diversity ratio 1 121 44 0.952 17.61 13.33 0.01886 0.047 2 13 4 0.679 0.85 0.51 0.00232 0.000 3 49 25 0.952 7.18 4.27 0.01251 0.210 4 2 1 0.000 0.00 0.00 0.00000 0.000 5 5 rpoD 585 5 1.000 2.74 0.00 0.01147 0.220 7 4 4 1.000 6.50 5.30 0.04110 0.023 12 2 2 1.000 1.71 0.00 0.01709 0.033 8 3 3 1.000 1.20 0.00 0.00798 0.050 19 7 2 0.286 0.17 0.00 0.00049 0.000 1 to 22 55 rpoD 585 43 0.987 42.39 38.80 0.14192 0.092 1 to 22 55 gyrB 824 50 0.995 42.48 37.14 0.14362 0.028 1 to 22 55 16SrRNA 1044 33 0.944 7.76 4.69 0.01372 - 1 to 22 55 ITS 553 36 0.968 18.81 14.10 0.07095 -

Topologies of the four individual trees were similar, and in most cases, they maintained the strains’ groupings (Supplementary Fig. S2.2). Members of the same genomovar clustered in the same phylogenetic subbranch in all trees with only a few exceptions. In the rpoD gene tree, strains A160/74, A732/80, A776/80 and SD93936 appeared in a separate single branch, and strain A655/78 was affiliated with gv 5; these strains appeared affiliated with gv 1 in the gyrB gene and 16S rRNA trees. In the ITS1 tree, strains A732/80, SD25545 and st103 did not cluster with any genomovar; in the 16S

Chapter 2

rRNA tree, strain st103 did not cluster with gv 5. The gv 1 and gv 5 strains were not resolved in the 16S rRNA and ITS1 trees.

For the concatenated analysis, sequences were aligned in the following order: 16S rRNA, gyrB gene, rpoD gene (three concatenated genes, 2443 nt, Fig. 2.3) and ITS1 region (four concatenated loci, 2948 nt, Supplementary Fig. S2.2). In the concatenated analysis, strains belonging to the same genomovar clustered together in the three and four gene trees. Although the genomovar grouping was well defined in the ITS1 tree, ITS1 genomovar discriminatory power was lower than the rpoD and gyrB genes, and no differences were found in the three or four gene trees topologies. For that reason and to preserve information homogeneity with other published data (Mulet et al., 2010), ITS1 region was excluded from further analysis.

Figure 2.1. Least square tendency lines for the comparison of phylogenetic similarities between 55 P. stutzeri strains and six closely related Pseudomonas.

In the three genes concatenated tree (16S rRNA, gyrB and rpoD; Fig. 2.3) strains A655/78, A160/74, A732/80, A776/80 and SD93936 are located between gv 1 and gv 5, with sequence similarities above 95.5 % with respect to both genomovars. This is the threshold value accepted for genomovar differentiation (see below). For that reason, DNA-DNA hybridisations were performed with the reference strains of gv 1 and 5 (CCUG 11256T and DNSP21), respectively, to demonstrate their affiliation to gv 1 (Supplementary Table S2.4).

WC-MALDI-TOF MS and MLSA of P. stutzeri

Figure 2.2. Schematic phylogenetic tree of the 229 P. stutzeri strains based on the analysis of rpoD gene. Distance matrix was calculated by the Jukes-Cantor method. Dendrogram was generated by neighbour-joining. P. aeruginosa type strain was used as outgroup. The bar indicates sequence divergence. Bootstrap values higher than 50% (from 1000 replicates) are indicated at the branching nodes. gv5 cluster includes strain A655/78 of gv1.

Chapter 2

Figure 2.3. Phylogenetic tree of the 55 selected P. stutzeri strains based on the phylogenetic analysis of three concatenated partial sequences of the 16S rRNA, gyrB and rpoD genes. Distance matrices were calculated by the Jukes-Cantor methods. Dendrograms were generated by neighbour-joining. P. aeruginosa type strain was used as outgroup. Bootstrap values higher than 50% (from 1000 replicates) are indicated at the branching nodes.

WC-MALDI-TOF MS and MLSA of P. stutzeri

Minimal intragenomovar similarities in the concatenated analysis of three genes were calculated (Table 2.3) for those genomovars in which more than one strain was studied, giving values of 96.7 % (gv 1, 13 strains), 99.7 % (gv 2, three strains), 98.6% (gv 3, 11 strains), 100%(gv 4, two strains), 98.3%(gv 5, four strains), 96.3 % (gv 7, four strains), 99.1 % (gv 8, three strains) and 96.7 % (gv 12, two strains). Intergenomovar similarities in the concatenated analysis of three genes were also analysed (Table 2.3); they ranged between 89.3 and 95.2 % in all genomovars, with the exception of gv 1 and gv 5 that had 97.7% similarity. Then, one given strain could be assigned to a known genomovar if its similarity value in the concatenated analysis of three genes was above 95.2 %, as previously reported (Mulet et al., 2008). Nevertheless, the threshold value of 97.8 % might be considered in the discrimination between genomovars 1 and 5 because these two genomovars are very closely related.

In the concatenated analysis, there were three strains for which the sequence similarity to their closest genomovar was lower than 96 %. Strain V81 had an 89.3 % sequence similarity with gv 8, whereas strains PE and A563/77 had a 91.8 % sequence similarity between them. The three of them were suspected to be representatives of novel genomovars.

Table 2.3. Consensus similarity indices between genomovars of P. stutzeri and the closest related species based on the 16s rDNA, rpoD and gyrB genes partial sequences.

Nr Intragv range P. P. P. P. Gv Closest gv strains Min Max xanthomarina balearica mendocina aeruginosa 1 13 96.7 100.0 97.7 gv5 87.7 88.8 86.3 85.6 2 3 99.7 99.8 93.5 gv16 86.9 86.8 84.1 82.3 3 11 98.6 100.0 93.2 gv19 87.6 87.7 85.1 83.3 4 2 100.0 100.0 93.2 gv3 87.0 87.0 83.3 83.3 5 4 98.3 99.4 97.7 gv1 87.1 89.4 86.1 85.7 7 4 96.3 99.4 91.4 gv1 86.7 88.0 85.8 84.6 8 3 99.1 99.3 90.6 gv14 89.7 88.3 85.0 84.0 9 1 93.4 gv2 87.9 87.5 85.4 83.3

10 1 95.2 gv18 91.4 86.4 83.4 82.5

11 1 90.9 gv14 89.7 86.4 83.2 81.0

12 2 96.7 96.7 90.9 gv14 90.0 86.8 84.0 82.5 13 1 90.5 gv12 89.5 85.9 83.3 81.9

14 1 90.9 gv5 90.5 87.3 85.0 83.6

15 1 92.1 gv18 91.5 87.0 82.7 81.8

16 1 94.0 gv9 87.3 87.2 85.1 82.7

17 1 92.4 gv5 87.3 88.1 85.7 85.6

18 1 95.2 gv10 92.5 86.5 83.3 82.0

19 1 94.2 gv3 87.5 88.0 85.5 85.3

20 1 91.8 gv21 89.2 86.3 82.6 81.6

21 1 91.8 gv20 88.4 85.3 83.0 81.6

22 1 89.3 gv8 87.8 86.5 83.0 81.8

Chapter 2

To validate the assignment of these three strains, DNA- DNA hybridisation experiments were performed (Table 2.4). The three strains had less than 53 % DNA-DNA relatedness between them and their closest genomovar, allowing us to conclude that they represent three new genomovars within the species. Strains PE, A563/77 and V81 are proposed as the reference strains for genomovars 20, 21 and 22, respectively. Their phenotypic traits are in accordance with those of P. stutzeri species (Supplementary Table S2.5). For example, they are able to produce nitrogen from nitrate and to grow with maltose as carbon source. It is remarkable that strain PE is able to liquefy gelatine, which is not a general trait of the species.

Table 2.4. DNA-DNA hybridisation relatedness values and concatenated MLSA gene sequence similarities (indicated in parentheses) between members of P. stutzeri gv 20, 21 and 22.

Labeled strains 28a39 gv12 PE gv 20 A563/77 gv 21 V81 gv22 PE gv20 - 100.0 (100) 43.5 (91.8) - A563/77 gv21 - 58.2 (91.88) 100.0 (100) - V81 gv22 30.1 (88.2) 31.2 (87.0) 41.8 (86.1) 100.0 (100) CCUG 11256T gv1 31.1 (88.3) 35.2 (87.2) 48.0 (86.2) 43.5 (86.7) JD4 gv5 27.8 (88.1) 47.2 (87.0) 44.3 (86.0) 36.8 (86.9) JM300 gv8 36.8 (89.7) 41.7 (87.7) 44.7 (87.7) 50.4 (89.2) CLN100 gv10 41.0 (89.3) 41.3 (88.9) 47.3 (88.3) 43.2 (87.9) 28a50 gv11 - 44.5 (88.3) 44.1 (89.2) - 28a39 gv12 100.0 (100) 42.1 (89.4) 52.7 (87.9) 47.0 (88.2) 28a22 gv13 - 41.5 (88.0) 46.5 (87.4) - 28a3 gv14 40.7 (90.9) 53.6 (89.2) 50.4 (88.8) 47.0 (88.6) 4c29 gv15 - 44.5 (89.0) 43.9 (88.0) - MT1 gv18 - 43.6 (89.3) 50.1 (88.7) - P. xanthomarina 29.2 (89.8) 35.1 (89.2) 53.3 (88.4) 47.2 (87.9) CCUG 46543T *Pooled standard deviation oscillated between 2.9 and 9.4.

2.3.2. Whole-Cell MALDI-TOF Mass Spectrometry

One hundred and seventy-two of the 229 strains representing all genomovars were analysed together with 127 Pseudomonas type strains. All of the P. stutzeri strains clustered together in the dendrogram, and the groupings were highly correlated with the genomovars. Figure 2.4 depicts the clustering of strains. All strains of the genomovars 2, 3, 4 and 7 were clustered in their corresponding group. Most strains of gv 1 (98 %; 103 of 105) were grouped in the same branch, with only two exceptions (Fig. 2.4 and Supplementary Fig. S2.3). The three representatives of P. balearica clustered together, and the type strains of P. aeruginosa and P. xanthomarina were clearly differentiated in the dendrogram. As expected, the single-strain of P. chloritidismutans was included with P. stutzeri gv 3 strains.

WC-MALDI-TOF MS and MLSA of P. stutzeri

Figure 2.4. Schematic dendrogram constructed by applying average linkage clustering and Pearson’s distance correlation from a similarity matrix of identical mass peaks, computed from whole cell mass spectra of the 172 P. stutzeri strains analyzed. The dendrogram was generated by considering the average value of the duplicates for each strain.

Chapter 2

The strains were also identified by comparing their resulting mass fingerprints with the SARAMIS database. From the 175 strains analysed, 170 strains were correctly assigned to the genus Pseudomonas: 113 strains were identified at the species level as P. stutzeri, 36 strains as Pseudomonas spp. and 21 strains as P. chloritidismutans. Most gv 1 strains (107 of 113) were identified as P. stutzeri. All of the 22 gv 3 strains analysed by MALDI-TOF were identified by SARAMIS as P. chloritidismutans (a species described with only 1 representative, actually considered a member of P. stutzeri gv 3; Cladera et al., 2006a) except 3 (A266/82, V73 and AN10). The remaining 5 strains were not identified as belonging to any of the genera present in the SARAMIS database but neither were they incorrectly assigned to another genus. These five strains were A60/68 (gv8), KC (gv9) and the three P. balearica strains.

2.4. Discussion

MLSA has been demonstrated as an excellent tool for species discrimination and phylogeny studies of the genus Pseudomonas (Mulet et al., 2010, 2012). In the present study, we corroborate these results and those from Cladera et al. (2006a) for the genomovars discrimination, and we included the description of three new genomovars. The best discriminating gene is rpoD, which allows a precise identification of genomovars in most cases. Its utility has also been tested by Parkinson et al. (2011) for the Pseudomonas syringae species complex and by Scotta et al. (2012) for clinical P. stutzeri strains (Scotta et al., 2012 and see chapter 1). The rpoD gene also allows culture-independent studies (Mulet et al., 2010). The ITS1 sequence may be considered a good candidate for typing purposes but not for phylogenetic approaches because of the lower selective pressure on this sequence with several noncoding regions. The analysis of the three genes (16S rDNA, gyrB and rpoD) has been necessary for the proposal of novel genomovars in only a few cases.

The good correlation between MLSA and WC-MALDITOF demonstrated that the latter is a convenient technique for culture-dependent approaches in the study of local populations. A combination of both approaches will allow an excellent monitoring of strains in the environment.

The most abundant strains generally isolated in independent experiments are members of genomovars 1, 2, 3 and 19. Although the number of genomovars currently stands at 22, and several environments from diverse geographical locations have been investigated for the presence of P. stutzeri, few representatives have been isolated from the other genomovars. An individual rarefaction study performed with the 229 P. stutzeri belonging to 22 genomovars showed that there are still new genomovars to be described in the species (Supplementary Fig. S2.4). The strains were also divided in two groups for the rarefaction analysis. The clinical strains (136) reached a saturation curve indicating that most probably no new genomovars have to be expected when analysing clinical strains. However, the curve for environmental strains (89) indicated a more

WC-MALDI-TOF MS and MLSA of P. stutzeri

diverse population. In the study of more samples, more genomovars have to be expected.

Mulet et al. (2011) demonstrated by means of culture dependent (43 isolates) and independent methods (29 rpoD gene clones) the presence of members of nine different genomovars in intertidal sand samples collected after the Prestige oil spill in northwestern Spain. The isolates were members of gv1, gv3, gv5, gv7, gv15, gv19, gv20 and gv22. This result demonstrates the high diversity of populations that can coexist in the same habitat. Sikorski et al. (2002) also demonstrated the complex composition in local P. stutzeri populations from marine sediments and soils.

Focusing on clinical isolates, 83.1 % belonged to genomovar 1 (113 strains), whereas genomovars 2 and 3 represented only 8.8 % (12 strains) and 5.1 % (seven strains) of the clinical isolates, respectively. Genomovars 8 (two strains), 12 (one strain) and 21 (one strain) represented less than the 3 % of the clinical isolates. Interestingly, the 92.6 % of the isolates from genomovar 1 (113 from 122 isolates) and the 80.0 % of the isolates from genomovar 2 (12 from 15) have been isolated from clinical samples. The three environmental isolates (ZoBell, PMG1 and PMG2) from genomovar 2 are of aquatic origin: strain ZoBell (from marine waters in the Pacific Ocean) and PMG1 and PMG2 (from hemodialysis water in a Berlin hospital setting). Based on the 16S rDNA sequence, Sikorski et al. (2002) assigned two further isolates from marine sediments to genomovar 2. It is difficult to find a correlation between the habitat from where a strain was isolated and the genomovar to which it was assigned. Genomovars 3 and 19 are the most abundant in nonclinical niches such as soil, contaminated soil, marine sediments and wastewater.

In general, it can be concluded that a genomovar can be predominant in a habitat because it is the best adapted to that specific environment. A good example is genomovar 18. Four P. stutzeri strains have been isolated from marine sediments at the deepest locations in the world, the Mariana trench (Tamegai et al., 1997), the Japan Trench (Kaneko et al., 2000) and the Izu-Ogasawara trench (Takami et al., 1999). These four bacteria are adapted to high pressure and are phylogenetically related in the 16S rDNA, and they had to be assigned to gv 18, with strain MT-1 as the reference strain (Sikorski et al., 2002, 2005). The presence of strains in diverse habitats indicates how they can evolve to exploit new environments. The high genetic diversity observed in the species could be the result of the many different ecological niches that are occupied by its members. Genomic analysis of strains assigned to different genomovars is still in progress and will give new insights into the evolution and niche adaptation of P. stutzeri.

Chapter 2

2.5. Supplemental material

Supplementary Figure S2.1 See below

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Figure S2.1 Phylogenetic tree of all P. stutzeri strains analysed based on partial sequences of the rpoD gene. Dendrogram was generated by neighbour-joining. Bootstrap values higher than 50% (from 1000 replicates) are indicated at the branching nodes. P. aeruginosa type strain was used as outgroup.

Chapter 2

(a) a) 16S rRNA gene

Supplementary Figure S2.2. Phylogenetic tree of the 55 selected P. stutzeri strains based on the analysis of 16S rRNA (a), ITS1 (b), gyrB (c) and rpoD (d) genes and the concatenated analysis of the partial sequences of the four genes (e). Distance matrices were calculated by the Jukes-Cantor method. Dendrograms were generated by neighbour- joining. P. aeruginosa type strain was used as outgroup. Bootstrap values higher than 50% (from 1000 replicates) are indicated at the branching nodes.

WC-MALDI-TOF MS and MLSA of P. stutzeri

(b)b) ITS

Supplementary Figure S2.2. Continued.

Chapter 2

c) gyrB gene

Supplementary Figure S2.2. Continued.

WC-MALDI-TOF MS and MLSA of P. stutzeri

d) rpoD gene

Supplementary Figure S2.2. Continued.

Chapter 2

(e) Four concatenated genes

Supplementary Figure S2.2 Continued.

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Figure S2.3. Schematic dendrogram constructed by applying average linkage clustering and Pearson’s distance correlation from a similarity matrix of identical mass peaks, computed from whole cell mass spectra of the 172 P. stutzeri strains analyzed. The dendrogram was generated by considering the average value of the duplicates for each strain.

Chapter 2

Supplementary Figure S2.3. Continued.

WC-MALDI-TOF MS and MLSA of P. stutzeri

Environmental

10 Clinical Genomovarsconfidence)(95%

0 0 20 40 60 80 100 120 140 160 Isolates

Supplementary Figure S2.4. Rarefaction curve for P. stutzeri genomovars. (a) Rarefaction curve for all strains studied; (b) Rarefaction curve according to the origin of the strains, clinical (136 strains) and environmental (89 strains).

Chapter 2

Supplementary Table S2.1. List of the 229 strains used in this study.

Name Gv Origin Reference P. stutzeri CCUG 11256T 1 Clinical Lalucat et al., 2006 A48/66 1 Clinical Holmes, 1986 A75/66 1 Clinical Holmes, 1986 A42/69 1 Clinical Holmes, 1986 A69/69 1 Clinical Holmes, 1986 A94/69 1 Clinical Holmes, 1986 A95/69 1 Clinical Holmes, 1986 A63/70 1 Clinical Holmes, 1986 A109/72 1 Clinical Holmes, 1986 A446/72 1 Clinical Holmes, 1986 A186/73 1 Clinical Holmes, 1986 A304/73 1 Clinical Holmes, 1986 A553/73 1 Clinical Holmes, 1986 A66/74 1 Clinical Holmes, 1986 A96/74 1 Clinical Holmes, 1986 A160/74 1 Clinical Holmes, 1986 A238/74 1 Clinical Holmes, 1986 A239/74 1 Clinical Holmes, 1986 A552/74 1 Clinical Holmes, 1986 A594/74 1 Clinical Holmes, 1986 A626/74 1 Clinical Holmes, 1986 A261/75 1 Clinical Holmes, 1986 A525/75 1 Clinical Holmes, 1986 A659/75 1 Clinical Holmes, 1986 A5/76 1 Clinical Holmes, 1986 A54/76 1 Clinical Holmes, 1986 A122/76 1 Clinical Holmes, 1986 A545/76 1 Clinical Holmes, 1986 A690/76 1 Clinical Holmes, 1986 A737/76 1 Clinical Holmes, 1986 A37/77 1 Clinical Holmes, 1986 A42/77 1 Clinical Holmes, 1986 A342/77 1 Clinical Holmes, 1986 A359/77 1 Clinical Holmes, 1986 A597/77 1 Clinical Holmes, 1986 A621/77 1 Clinical Holmes, 1986 A181/78 1 Clinical Holmes, 1986 A235/78 1 Clinical Holmes, 1986 A296/78 1 Clinical Holmes, 1986 A297/78 1 Clinical Holmes, 1986 A401/78 1 Clinical Holmes, 1986 88

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Table S2.1. Continued.

Name Gv Origin Reference A488/78 1 Clinical Holmes, 1986 A529/78 1 Clinical Holmes, 1986 A549/78 1 Clinical Holmes, 1986 A582/78 1 Clinical Holmes, 1986 A582/78a 1 Clinical Holmes, 1986 A636/78 1 Clinical Holmes, 1986 A655/78 1 Clinical Holmes, 1986 A666/78 1 Clinical Holmes, 1986 A514/79 1 Clinical Holmes, 1986 A99/80 1 Clinical Holmes, 1986 A732/80 1 Clinical Holmes, 1986 A773/80 1 Clinical Holmes, 1986 A776/80 1 Clinical Holmes, 1986 A205/81 1 Clinical Holmes, 1986 A222/81 1 Clinical Holmes, 1986 A367/81 1 Clinical Holmes, 1986 A486/81 1 Clinical Holmes, 1986 A496/81 1 Clinical Holmes, 1986 A23/82 1 Clinical Holmes, 1986 A92/82 1 Clinical Holmes, 1986 A197/82 1 Clinical Holmes, 1986 A200/82 1 Clinical Holmes, 1986 A222/82 1 Clinical Holmes, 1986 A19/83 1 Clinical Holmes, 1986 A76/83 1 Clinical Holmes, 1986 A443/83 1 Clinical Holmes, 1986 A457/83 1 Clinical Holmes, 1986 A4/84 1 Clinical Holmes, 1986 A40/84 1 Clinical Holmes, 1986 A42/84 1 Clinical Holmes, 1986 A141/84 1 Clinical Holmes, 1986 A179/84 1 Clinical Holmes, 1986 A222/84 1 Clinical Holmes, 1986 A228/84a 1 Clinical Holmes, 1986 A233/84 1 Clinical Holmes, 1986 A240/84 1 Clinical Holmes, 1986 A154/85 1 Clinical Holmes, 1986 A225/85 1 Clinical Holmes, 1986 A248/85 1 Clinical Holmes, 1986 A284/85 1 Clinical Holmes, 1986 A318/85 1 Clinical Holmes, 1986 A234/88 1 Clinical Holmes, 1986

Chapter 2

Supplementary Table S2.1. Continued.

Name Gv Origin Reference 31107 1 Clinical Roselló-Mora et al., 1991 32662 1 Clinical Roselló-Mora et al., 1991 34427 1 Clinical Roselló-Mora et al., 1991 42776 1 Clinical Roselló-Mora et al., 1991 51045 1 Clinical Roselló-Mora et al., 1991 70614 1 Clinical Roselló-Mora et al., 1991 72152 1 Clinical Roselló-Mora et al., 1991 72389 1 Clinical Roselló-Mora et al., 1991 72585 1 Clinical Roselló-Mora et al., 1991 72661 1 Clinical Roselló-Mora et al., 1991 74620 1 Clinical Roselló-Mora et al., 1991 75873 1 Clinical Roselló-Mora et al., 1991 76428 1 Clinical Roselló-Mora et al., 1991 76722 1 Clinical Roselló-Mora et al., 1991 77227 1 Clinical Roselló-Mora et al., 1991 77228 1 Clinical Roselló-Mora et al., 1991 81958 1 Clinical Roselló-Mora et al., 1991 ATCC 17589 1 Clinical Stanier et al., 1996 ATCC 17593 1 Clinical Stanier et al., 1996 SD106 1 Clinical Scotta et al., 2012, Chapter 1 SD136 1 Clinical Scotta et al., 2012, Chapter 1 SD144 1 Clinical Scotta et al., 2012, Chapter 1 SD146 1 Clinical Scotta et al., 2012, Chapter 1 SD148 1 Clinical Scotta et al., 2012, Chapter 1 SD151 1 Clinical Scotta et al., 2012, Chapter 1 SD17204 1 Clinical Bennasar et al., 1998 SD20240 1 Clinical Bennasar et al., 1998 SD32047 1 Clinical Scotta et al., 2012, Chapter 1 SD55473 1 Clinical Bennasar et al., 1998 SD17937 1 Sediment S' Albufera Bennasar et al., 1998 SD93936 1 Clinical Scotta et al., 2012, Chapter 1 V315 1 Oil contaminated sand Mulet et al., 2011 V320 1 Oil contaminated sand Mulet et al., 2011 S1MN1 1 Wastewater Lalucat et al., 2006 B1SMN1 1 Wastewater Lalucat et al., 2006 ATCC 27951 1 Yougurt Lalucat et al., 2006 CH87 1 Soil Palleroni et al., 1970 A15 1 Rice root, China Yan et al., 2008 CMT.9.A (DSM 4166) 1 Rhizosphere, Germany Yu et al., 2011 ATCC 17591 2 Clinical Stanier et al., 1996 ATCC 17587 2 Clinical Stanier et al., 1996

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Table S2.1. Continued.

Name Gv Origin Reference ATCC 17592 2 Clinical Stanier et al., 1996 ATCC 17595 2 Clinical Stanier et al., 1996 A85a/66 2 Clinical Holmes, 1986 A60/72 2 Clinical Holmes, 1986 A235/73 2 Clinical Holmes, 1986 A240/74 2 Clinical Holmes, 1986 A546/74a 2 Clinical Holmes, 1986 A496/77 2 Clinical Holmes, 1986 A319/81 2 Clinical Holmes, 1986 A236/84 2 Clinical Holmes, 1986 ZoBell 2 Marine ZoBell and Upham, 1944 PMG1 2 Hemodialysis water This study PMG2 2 Hemodialysis water This study DSM 50227 3 Soil Lalucat et al., 2006 AN10 3 Marine Lalucat et al., 2006 AN11 3 Marine Lalucat et al., 2006 L2SMN2 3 Marine Lalucat et al., 2006 ST27MN2 3 Marine Lalucat et al., 2006 DSM 13592 (AW-1) 3 Anaerobic chlorate-reducing bioreactor Cladera et al., 2006a 2FA 3 Culture collection Mulet et al., 2008 WM88 3 Soil-phosphite enriched Metcalf and Wolfe, 1998 AER 5.1 3 Aircraft oil contaminated soil Lalucat et al., 2006 CCUG 36651 3 Water, borehole. Mulet et al., 2008 SD152 3 Clinical Scotta et al., 2012, Chapter 1 A490/75 3 Clinical Holmes, 1986 A1/77 3 Clinical Holmes, 1986 A51/82 3 Clinical Holmes, 1986 A266/82 3 Clinical Holmes, 1986 A228/84b 3 Clinical Holmes, 1986 A235/84 3 Clinical Holmes, 1986 CH88 3 Soil Palleroni et al., 1970 V4 3 Oil contaminated sand Mulet et al., 2011 V27 3 Oil contaminated sand Mulet et al., 2011 V63 3 Oil contaminated sand Mulet et al., 2011 V64 3 Oil contaminated sand Mulet et al., 2011 V65 3 Oil contaminated sand Mulet et al., 2011 V67 3 Oil contaminated sand Mulet et al., 2011 V71 3 Oil contaminated sand Mulet et al., 2011 V73 3 Oil contaminated sand Mulet et al., 2011 V79 3 Oil contaminated sand Mulet et al., 2011

Chapter 2

Supplementary Table S2.1. Continued.

Name Gv Origin Reference V83 3 Oil contaminated sand Mulet et al., 2011 V110 3 Oil contaminated sand Mulet et al., 2011 V114 3 Oil contaminated sand Mulet et al., 2011 V127 3 Oil contaminated sand Mulet et al., 2011 V129 3 Oil contaminated sand Mulet et al., 2011 V187 3 Oil contaminated sand Mulet et al., 2011 V188 3 Oil contaminated sand Mulet et al., 2011 V189 3 Oil contaminated sand Mulet et al., 2011 V197 3 Oil contaminated sand Mulet et al., 2011 V204 3 Oil contaminated sand Mulet et al., 2011 V205 3 Oil contaminated sand Mulet et al., 2011 V224 3 Oil contaminated sand Mulet et al., 2011 V225 3 Oil contaminated sand Mulet et al., 2011 V227 3 Oil contaminated sand Mulet et al., 2011 V230 3 Oil contaminated sand Mulet et al., 2011 V231 3 Oil contaminated sand Mulet et al., 2011 V232 3 Oil contaminated sand Mulet et al., 2011 V278 3 Oil contaminated sand Mulet et al., 2011 V280 3 Oil contaminated sand Mulet et al., 2011 V316 3 Oil contaminated sand Mulet et al., 2011 V347 3 Oil contaminated sand Mulet et al., 2011 V362 3 Oil contaminated sand Mulet et al., 2011 V370 3 Oil contaminated sand Mulet et al., 2011 PutidoilA 3 Putidoil ® Mulet et al., 2011 PTDA 3 Putidoil ® Cladera et al., 2004 19SMN4 4 Marine Lalucat et al., 2006 ST27MN3 4 Marine Lalucat et al., 2006 DNSP21 5 Wastewater Lalucat et al., 2006 JD4 5 Garden soil Bennasar et al., 1998 V317 5 Oil contaminated sand Mulet et al., 2011 st103 5 Phragmites australis rhizosphere Mulet et al., 2008 st104 5 Spartina patens rhizosphere Mulet et al., 2008 DSM 50238 7 Soil Lalucat et al., 2006 AER2.7 7 Aircraft oil contaminated soil Lalucat et al., 2006 4FB3 7 Estuarine sediment Song et al., 2000 2FB7A 7 River sediment Song et al., 2000 JM300 8 Soil Roselló-Mora et al., 1996 SD39 8 Clinical Scotta et al., 2012, Chapter 1 SD39 8 Clinical Scotta et al., 2012, Chapter 1 A60/68 8 Clinical Holmes, 1986

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Table S2.1. Continued.

Name Gv Origin Reference KC 9 Aquifer Sepúlveda-Torres et al., 2001 CLN100 10 Deposit of chemical production plant Lalucat et al., 2006 28a50 11 Soil Sikorski et al., 2005 28a39 12 Soil Sikorski et al., 2005 SD25545 12 Clinical Scotta et al., 2012, Chapter 1 28a22 13 Soil Sikorski et al., 2005 28a3 14 Soil Sikorski et al., 2005 4c29 15 Marine sediment Sikorski et al., 2005 24a13 16 Soil contaminated with mineral oil Sikorski et al., 2005 24a75 17 Soil contaminated with mineral oil Sikorski et al., 2005 MT-1 18 Mariana Trench Sikorski et al., 2005 Romanenko et al., 2005, CCUG 46542 19 Didemnum sp. (marine ascidian) Mulet et al., 2009 V112 19 Oil contaminated sand Mulet et al., 2011 V116 19 Oil contaminated sand Mulet et al., 2011 V118 19 Oil contaminated sand Mulet et al., 2011 V226 19 Oil contaminated sand Mulet et al., 2011 V228 19 Oil contaminated sand Mulet et al., 2011 V229 19 Oil contaminated sand Mulet et al., 2011 PE 20 Putidoil Mulet et al., 2011 A563/77 21 Clinical Holmes, 1986 V81 22 Oil contaminated sand Mulet et al., 2011 Other Pseudomonas

P. xhantomarina CCUG 46453T Halocynthia aurantium Romanenko et al., 2005 P. balearica DSM 6083T Wastewater Bennasar et al., 1996 P. balearica LS401 Marine Lalucat et al., 2006

P. balearica st101 S. patents rhizosphere Mulet et al., 2008

P. aeruginosa ATCC 10145T Unknown Stanier et al., 1966 P. mendocina ATCC 25411T Soil Lalucat et al., 2006

Chapter 2

Supplementary Table S2.2. Primers used in this study.

Gene Primer Sequence 5’-3’ Reference 16S 16F27 AGAGTTTGATCMTGGCTCAG Weisburg et al., rRNA 16R1492 TACGGYTACCTTGTTACGACTT 1991 30F ATYGAAATCGCCAARCG Mulet et al., rpoD 790R CGGTTGATKTCCTTGA 2009 APrU TGTAAACGACGGCCAGTGCNGGRTCYTTYTCYTGRCA UP1E CAGGAAACAGCTATGACCAYGSNGGNGGNARTTYRA Yamamoto et gyrB M13(-21) TGTAAACGACGGCCAGT (sequencing) al., 2000 M13R CAGGAAACAGCTATGACC (sequencing) 16F945 GGGCCCGCACAAGCGGTGG 23R458 CTTTCCCTCACGGTAC Guasp et al., ITS1 rrn16S GAAGTCGTAACAAGG (sequencing) 2000 rrn23S CAAGGCATCCACC (sequencing)

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Table S2.3 Accession numbers of the 61 selected strains for the concatenated analysis used in this study (in bold are indicated the sequences obtained in this study).

Strain gv 16S rRNA gyrB rpoD ITS

CCUG 11256T gv1 U26262 AJ617557 AJ631316 AJ251910 ATCC 27951 gv1 AJ633553 AJ617558 AJ631317 HF571103 B1SMN1 gv1 AJ633556 AJ617561 AJ631320 AJ635306 S1MN1 gv1 AJ633557 AJ617562 AJ631321 AJ635307 A95/69 gv1 AJ633555 AJ617560 HE573596 AJ635305 A160/74 gv1 HF571089 HF571074 HE573721 HF571104 A238/74 gv1 HF571090 HF571075 HE573605 HF571105 A655/78 gv1 HF571091 HF571076 HE573715 HF571106 A732/80 gv1 HF571092 HF571077 HE573722 HF571107 A776/80 gv1 HF571093 HF571078 HE573723 HF571108 SD55473 gv1 AJ633554 AJ617559 AJ631318 AJ390583 SD93936 gv1 HF571094 HF571079 HE573724 HF571109 SD136 gv1 HF571095 HF571080 HE573688 HF571110 ATCC17591 gv2 U26261 AJ617563 AJ631322 AJ251901 ZoBell gv2 U26420 AJ617564 AGSL00000000 AJ390590 A60/72 gv2 AJ633558 AJ617565 AJ631324 AJ635308 DSM50227 gv3 U26415 AM905838 AM905860 AJ251903 AER5.1 gv3 AJ633561 AJ631257 AJ631329 AJ390587 ST27MN2 gv3 AJ633560 AJ617678 AJ631328 AJ635310 AN11 gv3 U25280 AJ617567 AJ631326 AJ251905 LSMN2 gv3 AJ633559 AJ617677 AJ631327 AJ635309 AN10 gv3 U22427 AJ617566 AJ631325 AJ251904 CCUG 36651 gv3 AY321589 AM905832 AM905868 HF571111 2FA gv3 AM905853 AM905828 AM905864 HF571112 WM88 gv3 AF038653 AM905833 AM905869 HF571113 DSM 13592 (AW-1) gv3 AY017341 AJ880092 AJ880091 AJ880096 PTDA gv3 AJ633562 AJ631259 AJ631330 AJ635311 19SMN4 gv4 U22426 AJ617679 AJ631333 AJ251906 ST27MN3 gv4 U26419 AJ617680 AJ631334 AJ251907 DNSP21 gv5 U26414 AJ620493 AJ631335 AJ251908 JD4 gv5 HF571096 AJ631263 AJ631336 AJ390588 st103 gv5 AM905851 AM905826 AM905862 HF571114 st104 gv5 AM905852 AM905827 AM905863 HF571115

Chapter 2

Supplementary Table S2.3. Continued.

Strain gv 16S rRNA gyrB rpoD ITS

DSM50238 gv7 U26416 AJ631262 AJ631339 AJ251909 AER2.7 gv7 HF571097 AJ631258 AJ631340 AJ390586 4FB3 gv7 AM905858 AM905835 AM905871 HF571116 2FB7A gv7 AM905857 AM905834 AM905870 HF571117 JM300 gv8 CP003725 AJ631264 AJ631337 AJ390581 A60/68 gv8 HF571098 HF571081 HE573717 HF571118 SD39 gv8 HF571099 HF571082 HE573716 HF571119 KC gv9 AF067960 AJ631265 AJ631338 AF356514 CLN100 gv10 AJ544240 AJ536591 AJ518947 AJ876634 28a50 gv11 AJ312162 AM939378 AM939370 AY850023 28a39 gv12 AJ312161 AM939379 AM939371 AY850024 SD25545 gv12 HF571100 HF571083 HE573718 HF571120 28a22 gv13 AJ312167 AM939380 AM939372 AY850025 28a3 gv14 AJ312163 AM939381 AM939373 AY850027 4C29 gv15 AJ270456 AM939382 AM939374 AY850029 24A13 gv16 AJ270451 AM939383 AM939375 AY850026 24a75 gv17 AJ312229 AM939384 AM939376 AY850030 MT-1 gv18 AB004241 AM939385 AM939377 AY850031 CCUG 46542 gv19 AB176955 AM905825 AM905861 HF571121 PE gv20 HF571101 HF571084 FN994779 HF571122 A563/77 gv21 HF571102 HF571085 HE573719 HF571123 V81 gv22 FN995247 HF571086 FN994217 HF571124 P. balearica st101 - AM905859 AM905837 AM905873 HF571125 P. balearica SP1402T - U26418 AB039394 AJ633565 AJ279238 P. balearica LS401 - U26417 AJ633102 AJ633566 AJ279239 P. xhantomarina CCUG 46543T - AB176954 AM905836 AM905872 HF571126 P. aeruginosa CCM 1960T - X06684 AJ633104 AJ633568 HF571127 P. mendocina ATCC 25411T - D84016 AJ633103 AJ633567 HF571128

WC-MALDI-TOF MS and MLSA of P. stutzeri

Supplementary Table S2.4. DNA-DNA hybridisation relatedness values and concatenated MLSA gene sequence similarities (indicated in brackets) between members of Pseudomonas stutzeri gv1 and gv5.

A655/78 A776/80 CCUG 11256T gv1 84.8 (97.7) 74.2 (96.9) B1SMN1 gv1 86.5 (97.7) 69.1 (97.4) A160/74 gv1 85.9 (96.7) 67.8 (99.9) A655/78 gv1 100 (100) 80.8 (96.8) A732/80 gv1 100 (96.7) 89.1 (99.9) A776/80 gv1 100 (96.8) 100 (100) DNSP21 gv5 57.0 (95.9) 53.6 (95.1) JD4 gv5 58.4 (95.9) 51.5 (95.1) *Pooled standard deviations between 3.7 and 5.0.

Chapter 2

Supplementary Table S2.5. API 20 NE profile of the P. stutzeri reference strains of novel genomovars 20, 21 and 22. +, positive, -, negative, w, weak.

PE gv20 A563/77 gv21 V81 gv22

Oxidase + + + Nitrate reduction + + + Triptophanase - - - Glucose fermentation - - - Arginine dihydrolase - - - Urease - - - Esculine (β-glucosidase) - - - Gelatinase + - - p-nitrophenil-β-galactosidase - - - Assimilation of: Glucose + + + Arabinose + + w Mannose - - - Manitol + + + N-acetyl-glucosamine - - - Maltose + + w Gluconate + + + Capric acid + - w Adipic acid - + - Malic acid + + + Citrate + + + Phenylacetic acid - - -

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

Chapter 3:

Concordance between whole-cell matrix- assisted laser-desorption/ionization time- of-flight mass spectrometry and multilocus sequence analysis approaches in species discrimination within the

genus Pseudomonas

Mulet M, Gomila M, Scotta C, Sánchez D, Lalucat J, García-Valdés E. 2012. Concordance between whole-cell matrix-assisted laser-desorption/ionization time-of- flight mass spectrometry and multilocus sequence analysis approaches in species discrimination within the genus Pseudomonas. Systematic and Applied Microbiology 35, 455-464. DOI:10.1016/j.syapm.2012.08.007.

Chapter 3

Abstract

Multilocus sequence analysis (MLSA) is one of the most accepted methods for the phylogenetic assignation of Pseudomonas strains to their corresponding species. Furthermore, updated databases are essential for correct bacterial identification and the number of Pseudomonas species is increasing continuously. Currently, 127 species are validly described in Euzeby’s List of Species with Standing in Nomenclature, and 29 novel species have been described since the publication of the last comprehensive MLSA phylogenetic study based on the sequences of the 16S rDNA, gyrB, rpoB and rpoD genes. Therefore, an update of the sequence database is presented, together with the analysis of the phylogeny of the genus Pseudomonas. Whole-cell matrix-assisted laser-desorption/ionization time-of-flight (WC-MALDI-TOF) mass spectrometry (MS) analysis has been applied very recently to the identification of bacteria and is considered to be a fast and reliable method. A total of 133 type strains of the recognized species and subspecies in the genus Pseudomonas, together with other representative strains, were analyzed using this new technique, and the congruence between the WC-MALDI- TOF MS and MLSA techniques was assessed for the discrimination and correct species identification of the strains. The utility of both methods in the identification of environmental and clinical strains is discussed.

100

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

1.1. Introduction

The genus Pseudomonas is one of the most complex bacterial genera and, to date, it is the genus of Gram-stain-negative bacteria with the largest number of species, since 117 species and subspecies have been recognized in Bergey’s Manual of Systematic Bacteriology (Palleroni, 2005). Furthermore, the number of species described is growing continuously: 102 species were recognized in 2006, 118 in 2009, and 125 in 2010. The current number of validly published species is 127, with 10 subspecies, as included in Euzeby’s List of Species with Standing in Nomenclature (Euzéby, 1997). The most recently described species (in 2011) were as follows: Pseudomonas protegens (Ramette et al., 2011), Pseudomonas composti (Gibello et al., 2011), Pseudomonas litoralis (Pascual et al., 2012), Pseudomonas baetica (López et al.,. 2011), Pseudomonas batumici (Kiprianova et al., 2011), Pseudomonas zeshuii (Feng et al., 2011) and Pseudomonas entomophila (Mulet et al., 2012a).

Strains of Pseudomonas species are environmentally important bacteria in the recycling of nutrients, and they are also important in medicine and biotechnology. Two interrelated characteristics are present in the genus Pseudomonas: a high number of species and their ubiquity. A remarkable degree of physiological and genetic adaptability has to be expected due to such a universal distribution. Indeed, the genus is widely distributed in nature, covering many different habitats and colonizing soils, waters, plants and animals. Some species are pathogenic for humans (Pseudomonas aeruginosa), animals (P. baetica or Pseudomonas anguilliseptica, fish pathogens), and plants (Pseudomonas syringae). In contrast, many other species are beneficial in the rhizosphere, and some are used as biocontrol agents of plant diseases, such as P. protegens, a recently described member of the fluorescens group. Certain species are utilized in biotechnology on the basis of their diverse metabolic pathways, such as Pseudomonas putida. Accordingly, accurate and reliable identification methods are needed.

The genus Pseudomonas is defined by bacteria that are straight or slightly curved rods, Gram-negative and usually motile. The organisms are aerobic when oxygen is the electron acceptor, but nitrate can be an alternative electron acceptor in some cases. Pseudomonas strains are positive or negative for oxidase and positive for catalase. Xanthomonadins are not produced. All strains are chemoorganotrophic and some species are able to accumulate poly-hydroxyalkanoates as a reserve material. Strains of the species possess hydroxylated fatty acids (3-OH 10:0 and 12:0) and ubiquinone 9 in their membranes as chemotaxonomic markers. The genomic G + C content is 58-69 mol% (Palleroni, 2005).

Although the taxonomy of Pseudomonas and associated identification methods have evolved with the available methodologies, the rapid and reliable identification of strains remains the most important task in any taxonomic study. The genus Pseudomonas was described by Migula in 1894 according to the morphological characteristics of its members (Migula, 1895, 1900). For many years, the genus comprised many species that

101

Chapter 3

were not always well-characterized until the work of Stanier et al. (1966) in which the physiological and biochemical properties clearly established the taxonomical basis for identification of the species. In 1984, the genus was revised, and a subdivision of five groups was implemented on the basis of DNA-DNA hybridization and rRNA-DNA hybridization results (Palleroni, 1984). Later, the five groups were recognized as being associated with the Proteobacteria (De Ley, 1992, De Vos et al., 1983, 1985, 1989), with the members of the genus Pseudomonas “sensu stricto” belonging to the rRNA- DNA group I, in the subclass Gammaproteobacteria. Since then, several authors have reviewed the status of the taxonomy of the genus Pseudomonas (Anzai et al., 2000, Moore et al., 1996, Peix et al., 2009). Recently, Mulet et al. (2010) have demonstrated that the analysis of the sequences of four housekeeping genes in all known species of the genus clarified the phylogeny and greatly facilitated the identification of new strain. The multilocus sequence analysis (MLSA) approach based on the sequence analysis of the four housekeeping genes has proven reliable for the species discrimination and strain identification in Pseudomonas (Mulet et al., 2012).

In parallel to the sequence-based techniques, chemotaxonomical methods have also been of value in elucidating the taxonomy of the genus. Fatty acid methyl ester composition and polyacrylamide gel electrophoresis of total proteins are currently used in polyphasic taxonomic studies and for the identification of species within the genus. Whole-cell matrix-assisted laser-desorption time-of-flight mass spectrometry (WC- MALDI-TOF MS) has been known to be useful for bacterial analysis since 1975, although it has been applied only recently to systematic microbiology (Welker and Moore, 2011). The MALDI-TOF MS methodology has been expanded to include clinical microbiology studies for identifying Gram-negative bacilli in blood cultures or in cultures of patients with cystic fibrosis (Loonen et al., 2012, Prod’hom et al., 2010), non-clinical environmental microorganisms in studies for the differentiation of Arthrobacter strains (Varghaa et al., 2006), halophilic prokaryotes (Muñoz et al., 2011), or the Rhizobiaceae family (Ferreira et al., 2011). The identification results have been compared with those obtained using phenotypic methodologies (API, Vitek or BD Phoenix automated identifications), and have provided satisfactory results. WC- MALDI-TOF MS has been applied to the genus Pseudomonas as a complementary technique in the proposal of novel species, such as Pseudomonas arsenicoxydans, or to characterize species in the P. putida group or in the taxonomic description of P. entomophila (Campos et al., 2010, Mulet et al., 2012). A classification at the Pseudomonas strain level by WC-MALDI-TOF MS has been proposed using a ribosomal protein-matching profiling, initially for P. putida and more recently for 10 type strains of Pseudomonas. The results were compared with those obtained using only gyrB gene sequences (Hotta et al., 2010, Teramoto et al., 2007).

In both MLSA and WC-MALDI-TOF, the accuracy of the identification depends on the reference database. Therefore, our aim was to present a comprehensive study of all Pseudomonas type strains in order to corroborate the utility of both these methods for species discrimination and identification within the genus. In the present study, the 16S

102

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

rRNA, gyrB, rpoB and rpoD genes of 29 new Pseudomonas type strains were analyzed and added to the study of 107 Pseudomonas type strains reported previously (Mulet et al., 2010). Phylogenetic trees were reconstructed showing the taxonomic locations of the new species within the genus. Several non-type strains have also been included in this study to show the intraspecies similarity percentage and to evaluate the species discriminatory power in the comparison of closely related strains. Simultaneously, the 141 Pseudomonas strains were analyzed by WC-MALDI-TOF MS in order to establish the congruence of both approaches. The usefulness of the information obtained via both MLSA and WC-MALDI-TOF MS techniques was evaluated. 3.2. Methods

3.2.1. Bacterial strains and culture conditions

A total of 141 Pseudomonas strains were analyzed in the study, including 133 Pseudomonas type strains, two subspecies of Pseudomonas chlororaphis (P. chlororaphis subsp. aurantiaca and P. chlororaphis subsp. aureofaciens) and Pseudomonas pseudoalcaligenes, the later synonym of Pseudomonas oleovorans (Saha et al., 2010). In addition to the type strains, four taxonomically well-characterized strains of the Pseudomonas stutzeri group were also included: two strains of the species P. stutzeri (both members of the genomovar 1, ATCC 27951 and A15) and two strains of Pseudomonas balearica (LS401 and st101). “Pseudomonas alkylphenolia” JCM 16553 was also included, even though it has no standing in the nomenclature (Veeranagouda et al., 2011). The 30 new species included in the present study are shown in Table 3.1. However, P. batumici and P. zeshuii, published at the time of preparing this manuscript, were not included. Strains were routinely cultured using Luria Bertani (LB) broth or agar. The identity of the strains received from culture collections was assessed by sequencing the 16S rRNA gene simultaneously with the gyrB, rpoB and rpoD genes.

3.2.2. Sequencing conditions and sequence analysis

The DNA extraction, amplification and sequencing methods for 34 new strains of Pseudomonas have been described previously by Mulet et al. (2010). The primers used were BAUP2F-APrUR, PsEG30F-PsEG790R and LAP5-LAS27 for the amplification and sequencing of the gyrB, rpoD and rpoB genes, respectively (Mulet et al., 2008). When needed, new sets of combinations (PsEG30F/70R for the rpoD gene and LAS5/VIC6 for the rpoB gene) were used, as indicated in Footnote in supplementary Table S3.1 (Mulet et al., 2010, Tayeb et al., 2008). A series of individual trees were generated from the 16S rRNA, gyrB, rpoB and rpoD partial gene alignments. Concatenated gene trees were constructed, using the individual alignments in the following order: 16S rRNA (1309 nt), gyrB (803 nt), rpoD (791 nt), and rpoB (923 nt). Groups (G) and subgroups (SG) were defined by the length and branching order of the concatenated gene tree. The name of the first species described in a group or subgroup

103

Chapter 3

was chosen to designate it. The resulting groupings were supported by high bootstrap values. The nucleotide sequences determined in this study have been deposited in the PseudoMLSA database (http://www.uib.es/microbiologiaBD/Welcome.php) (Bennasar et al., 2010) and EMBL database under the following accessions numbers: gyrB, HE800469 to HE800487; rpoB, HE800503 to HE800522; and rpoD, HE800488 to HE800502 (see Supplementary Table S3.1).

3.2.3. WC-MALDI-TOF mass spectrometry

WC-MALDI-TOF mass spectrometry assays for all 141 strains were performed at Anagnostec and RIPAC GmbH, Germany (Kallow et al., 2010). Some strains were analyzed twice or three times as methodology controls. Strains were cultured on LB plates at 30◦C for 24-48 h. The cells were analyzed on a Flexi Mass stainless steel target using a whole-cell protocol with a 1 µL matrix solution of saturated -cyano-4- hydroxy-cinnamic acid in a mixture of acetonitrile:ethanol:water (1:1:1), acidified with 3% (v/v) trifluoroacetic acid.

For each strain, the mass spectra were prepared in duplicate and analyzed using an AXIMA Confidence instrument (Shimadzu/Kratos, UK) in the linear positive ion extraction mode. The mass spectra were accumulated from 100 profiles, each from five nitrogen laser pulse cycles, by scanning the entire sample spot. The ions were accelerated with pulsed extraction at a voltage of 20 kV. The raw mass spectra were processed automatically for baseline correction and peak recognition. The profiles of the peaks obtained for each species within a mass range from 3000 to 20,000 Da were analyzed and compared using the BGP database software available at the website http://sourceforge.net/projects/bgp. The percentage similarities of identical mass peaks were calculated and used to generate a dendrogram using the Permutmatrix software, applying an average-linkage method (UPGMA hierarchical clustering) and Pearson’s distance correlation (Caraux et al., 2005). The dendrogram was constructed using the median value of duplicate analysis for each strain in order to assess the coherence of the topology. The strains were also identified by comparing the resulting mass fingerprints with the SARAMIS (Spectral Archiving and Microbial Identification System, Release 3.36, Anagnostec and RIPAC GmbH, Germany) database.

Correlation analyses based on the Pearson moment between WC-MALDI-TOF MS results and concatenated phylogenetic MLSA were performed using SIGMA Plot v11 software.

104

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

Table 3.1. Strains used in this study.

Species Strain Source Reference “P. alkylphenolia” JCM 16553 Soil; South Korea Veeranagouda et al., 2011 P. arsenicoxydans CECT 7543T Camarones river; Chile (Atacama Campos et al.,2010a Desert) P. baetica CECT 7720T Fish pathogen isolated from López et al., 2011 wedge sole, Dicologoglossa cuneata (Moreau); Spain P. bauzanensis DSM 22558T Soil contaminated with Zhang et al., 2010a hydrocarbon and heavy metal; Italy P. benzenivorans DSM 8628T Groundwater contaminated from Lang et al., 2010 an industrial plant; USA P. caeni CECT 7778T Sludge of an anaerobic Xiao et al., 2010a ammonium-oxidizing bioreactor; China P. composti C2T Compost; Spain (Madrid) Gibello et al., 2011a P. cuatrocienegasensis 1NT Evaporated lagoon; México Escalante et al., 2009a (Cuatro Ciénegas) P. deceptionensis CECT 7677T Marine sediment; Antarctica Carrion et al., 2010a (Deception Island) P. delhiensis RLD-1T Soil contaminated by polycyclic Prakash et al., 2007a aromatic compounds of fly ash dumping site; India P. duriflava KCTC 22129T Soil; China Liu et al., 2008a P. entomophila L48T Drosophila; Mexico Mulet et al., 20 12a (Guadaloupe island) P. extremaustralis DSM 17835T Temporary water pond; López et al., 2010a Antarctica P. indoloxydans JCM 14246T A pesticide-contaminated site; Manickam et al., 2008 India P. japonica JCM 21532T Activated sludge from sewage Pungrasmi et al., 2008a treatment plant; Japan P. litoralis CECT 7670T Seawater sample; Spain Pascual et al., 2011a P. lurida P 513/18T Grasses, phyllosphere; Germany Behrendt et al., 2007a P. pelagia JCM 15562T Culture of the Antarctic green Hwang et al., 2009a alga, Pyramimonas gelidicola; Antarctic P. pohangensis DSM 17875T Sea shore sand; Korea Weon et al., 2006a P. protegens DSM 19095T Isolated from tobacco roots; Ramette et al., 2010a Switzerland P. sabulinigri KCTC 22137T Black sand; South Korea Kim et al., 2009a P. saponiphila DSM 9751T Ability to degrade xenobiotic Lang et al., 2010 compounds; USA P. segetis IMSNU 14101T Soil; Korea Park et al., 2006a P. seleniipraecipitans LMG 25475T Soil; USA Hunter and Manter et al., 2011a P. taeanensis KCTC 22612T Crude oil-contaminated Lee et al., 2010a seawater; Korea P. taiwanensis DSM 21245T Soil; Taiwan Wang et al., 2009a P. toyotomiensis NCIMB 14511T Soil immersed in hot-spring Hirota et al., 2011a water containing hydrocarbons; Japan

105

Chapter 3

Table 3.1. Continued.

Species Strain Source Reference P. tuomuerensis CECT 7766T Bird's nest on the bank of the Qiongtailan Xin et al., 2009a River; China P. vranovensis DSM 16006T Soil besides highway; Czech Republic Tvrzová et al., 2006a P. xiamenensis JCM 13530T Activated sludge sample at Qianpu sewage Lai and Shao, 2008a treatment plant; China P. stutzeri ATCC 27951 gv1 Yogurt; Argelia (1960) Cladera et al., 2004 P. stutzeri A15 gv1 Nitrogen fixer; isolated from rice roots; Vermeiren et al., 1999 China P. balearica LS401 Marine; Barcelona (1988) Cladera et al., 2004 P. balearica st101 Spartina patens rhizosphere Mulet et al., 2008 The other type strains were used in a previous study (Mulet et al., 2012). aThese references are cited in http://www.bacterio.cict.fr (Euzèby 1997).

3.3. Results

3.3.1. Multilocus sequence analysis

The 16S rRNA, gyrB, rpoB and rpoD genes were analyzed for the 141 strains of Pseudomonas and the sequences of each gene for the new species analyzed were aligned with the sequences of the 107 Pseudomonas type strains from a previous study (Mulet et al., 2010). The individual genes for all the strains were concatenated in the order: 16S rRNA, gyrB, rpoD, and rpoB, which provided a unique sequence of 3826 nt for each strain. The rpoB of Pseudomonas pohangensis could not be amplified with any combination of primers and PCR conditions tested, and it was, therefore, excluded from the four-gene concatenated analysis.

The concatenated phylogenetic gene tree for the Pseudomonas species type strains exhibited two main lineages designated “Pseudomonas fluorescens” and “P. aeruginosa” (Fig. 3.1). The P. fluorescens lineage had six groups (G): P. fluorescens (57 species distributed in nine subgroups [SG]), P. syringae (12 species); Pseudomonas lutea (3 species); P. putida (12 species); P. anguilliseptica (8 species) and Pseudomonas straminea (4 species). The P. aeruginosa lineage had four groups: P. aeruginosa (14 species); P. oleovorans (5 species); P. stutzeri (4 species); Pseudomonas oryzihabitans (2 species) and a new group, Pseudomonas pertucinogena (7 species). Two species, Pseudomonas rhizospherae and P. indica, did not belong to any group or subgroup in the P. fluorescens and P. aeruginosa lineages, respectively. Newly analyzed species Pseudomonas caeni and Pseudomonas duriflava, and the previously studied Pseudomonas luteola, should be considered outliers of the genus because they did not belong to any intragenous lineage (Fig. 3.1). The 30 new type strains and “P. alkylphenolia” were phylogenetically scattered in 11 of the 19 previously described groups and subgroups in the Pseudomonas phylogenetic tree (Mulet et al., 2010), and five of them were in the Pseudomonas pertucinogena G. The distribution was as

106

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

follows: P. lurida and P. extremoaustralis (P. fluorescens SG); P. deceptionensis (Pseudomonas fragi SG); P. arsenicoxydans (Pseudomonas mandelii SG); P. baetica (Pseudomonas koreensis SG); P. protegens and Pseudomonas saponiphila (P. chlororaphis SG); P. japonica, P. vranovensis, “Pseudomonas alkylphenolia”, Pseudomonas taiwanensis and P. entomophila (P. putida G); Pseudomonas seleniipraecipitans (P. straminea G); Pseudomonas benzenivorans, Pseudomonas taeanensis and Pseudomonas segetis (P. anguilliseptica G); P. indoloxydans and P. toyotomiensis (P. oleovorans G); Pseudomonas tuomuerensis, Pseudomonas cuatrocienegasensis, P. composti and Pseudomonas delhiensis (P. aeruginosa G); and Pseudomonas sabulinigri, P. pelagia, P. litoralis, P. bauzanensis and P. xiamenensis (P. pertucinogena G). However, P. caeni and P. duriflava could be considered as outliers. The concatenated tree of the 16S rRNA, gyrB and rpoD genes placed the type strain P. pohangensis close to the Pseudomonas corrugata SG.

The tree topology previously published for the type strains of 107 species was preserved, maintaining all the main groups and subgroups, with only one exception, that of P. indica which was formerly included in the P. aeruginosa G, and should now be located in an independent branch in the P. aeruginosa lineage. The distances within the groups and the intragroup mean values were recalculated, including the type strains of 30 new species (Table 3.2).

Some changes in the classification since the publication of the 107 type strain phylogenetic relationship study of the genus also have to be considered: P. aurantiaca and P. aureofaciens have been reclassified as subspecies of P. chlororaphis (Peix et al., 2007), and P. pseudoalcaligenes should now be considered as a later synonym of P. oleovorans (Saha et al., 2010).

3.3.2. WC-MALDI-TOF MS analysis

A total of 141 strains of Pseudomonas were analyzed by WC-MALDI-TOF MS. The non-type strains of Pseudomonas were included as internal tests in order to determine the accuracy of the method for evaluating both the intraspecies variability and the two different colony morphologies observed for P. toyotomiensis. Several strains were analyzed twice on different dates, including Pseudomonas mosselii, P. putida and Pseudomonas plecoglossicida (in 2009 and 2010), in order to assess the accuracy of the method. All respective duplicates of the results were in agreement, which demonstrated the high level of method reproducibility.

The dendrogram constructed from the percentage similarity of the square matrix of mass peaks spectra is shown in Fig. 3.2A and 3.2B. The dendrogram was generated by considering the duplicate analysis (data not shown) using median values for each strain.

107

Chapter 3

, Pseudomonas pelagia, P. litoralis, Pseudomonas bauzanensis and Pseudomonas 108

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

The similarities between the duplicates were higher than 70% in 89% of the cases: the mean similarity between duplicate analyses was 88%, with a standard deviation of 13%. The similarities between type strains of different species were, in most cases, lower than 60%. The different strains of P. stutzeri and P. balearica, in addition to P. chlororaphis subspecies and P. oleovorans and Pseudomonas alcaliphila, clustered together in the dendrogram (mean similarity values between 60 and 75%). Additionally, the two different colony morphologies of P. toyotomiensis clustered together in the dendrogram with a mean similarity of 80%.

Table 3.2. Percentage of minimum similarity intragroup distances within the groups or subgroups of Pseudomonas species type strains.

4 concatenated genes Group or Subgroup Number of (G/SG) strains %Minmum Intragroup mean similarity within value (%) ± the G/SG standard deviation P. fluorescens SG 22 93.2 95.4±1.3 P. gessardii SG 5 94.8 97.1±1.8 P. corrugata SG 5 95.2 97.0±1.8 P. asplenii SG 2 99.2 99.6±0.5 P. chlororaphis SG 5 93.7 96.4±2.5 P. koreensis SG 3 95.6 97.4±2.0 P. jessenii SG 6 95.2 96.7±1.6 P. mandelii SG 5 95.9 97.2±1.5 P. fragi SG 5 93.0 95.7±2.6 P. syringae G 12 91.4 95.2±2.4 P. lutea G 3 90.6 94.4±4.3 P. putida G 12 88.6 92.5±2.8 P. aeruginosa G 14 86.7 90.2±3.2 P. oryzihabitans G 2 99.2 99.6±0.5 P. oleovorans G 6 93.8 96.4±2.1 P. straminea G 4 92.4 95.0±3.1 P. anguilliseptica 8 87.5 90.6±3.9 P. stutzeri G 8 87.0 92.4±4.9

Fig. 3.1. Phylogenetic tree of the strains of Pseudomonas used in this study based on the phylogenetic analysis of four concatenated genes (16S rRNA, gyrB, rpoB and rpoD genes). Distance matrices were calculated by the Jukes-Cantor method. Dendrograms were generated by neighbour-joining. Cellvibrio japonicum Ueda107 was used as outgroup. The bar indicates sequence divergence. Bootstrap values of more than 500 (from 1000 replicates) are indicated at the nodes. Strains marked in bold correspond to the new strains of this study.

109

Chapter 3

Figue 3.2.A See below

110

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

Figure 3.2. B. Dendrogram constructed applying average linkage clustering and Pearson’s distance correlation from a similarity matrix of identical mass peaks, computed from whole cell mass spectra of all Pseudomonas strains analyzed. The dendrogram was performed considering the media value of the duplicates for each strain.

3.3.3. Resolution at the group and subgroup level within the genus Pseudomonas.

As indicated in Figure 3.3, the resolution at the group or subgroup level within the genus Pseudomonas, as established by MLSA, was maintained in the WC-MALDI-TOF MS dendrogram. In the MLSA tree, the P. fluorescens group was composed of nine subgroups. The P. syringae group, in the P. fluorescens lineage, included all the type species of the group in a robust branch, with the exception of Pseudomonas avellanae. However, Bull et al., have suggested that P. avellanae represents a distinct group, since the genetic distance is below the cut-off for differentiating species (Bull et al., 2011). All the members of the P. mandelii, P. fragi and Pseudomonas asplenii subgroups were in the same cluster. The P. corrugata SG, Pseudomonas jessenii SG and P. chlororaphis SG mainly preserved their groupings, although, in some cases, some of

111

Chapter 3

their members clustered out with the group. The P. chlororaphis SG established by the MLSA analysis was split into two groups in the WC-MALDI-TOF MS analysis, one with P. chlororaphis and its subspecies (aurantiaca and aureofaciens) and the other with P. saponiphila and P. protegens. In the P. koreensis SG, the three species were separated but were in the P. fluorescens G. The branches with lower bootstrap values and with the phylogenetically most distant species in the MLSA tree were not supported in the WC-MALDI-TOF MS dendrogram, as was the case for P. corrugata and Pseudomonas mediterranea in the P. corrugata SG, and Pseudomonas mucidolens in the Pseudomonas gessardii SG. All the species of the P. fluorescens G were included in the P. fluorescens group (100%), although, in some cases, they were not exactly within the same subgroup.

The other branches of the P. fluorescens lineage in the MLSA, P. lutea G (3 species), P. putida G (12 species) and P. straminea G (4 species), were well defined and located in independent branches in the WC-MALDI-TOF MS analysis, with only two exceptions: P. taiwanensis (P. putida G) and P. seleniipraecipitans (P. straminea G). The phylogenetic distances between the members of the P. anguilliseptica G were relatively large and its members did not conform to a single group in the WC-MALDI-TOF MS dendrogram.

Figure. 3.3. Concordance between MALDI-TOF mass spectrometry and MLSA analysis in the different Pseudomonas groups. Columns in white color show the strains belonging to their correspondent group in MLSA tree and MALDI-TOF dendrogram. Columns in black color, show the strains present in their correspondent group in the MLSA tree but not in the MALDI-TOF dendrogram.

112

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

In the P. aeruginosa lineage, four groups were defined by MLSA: P. aeruginosa G, P. oleovorans G, P. oryzihabitans G and P. stutzeri G. The four species of the P. stutzeri G, the other strains of the species P. stutzeri (A15 and ATCC 27951) and P. balearica (LS401 and st101) clearly clustered together, as did Pseudomonas psychro psychrotolerans and P. oryzihabitans in the P. oryzihabitans G. Ten of the 14 species included in the P. aeruginosa G also clustered together in the WC-MALDI-TOF dendrogram, with the exceptions of the species P. composti, P. delhiensis, Pseudomonas thermotolerans, and P. tuomuerensis. The bootstrap value for the P. aeruginosa G node was lower than 50%.

P. pertucinogena formed a new group, together with the former outlier P. luteola, and included the P. caeni and P. duriflava species. Five newly described species should now be included in this group (P. bauzanensis, P. litoralis, P. pelagia, P. sabulinigri, and P. xiamenensis), together with P. pertucinogena and Pseudomonas pachastrellae. This group was perfectly defined by the WC-MALDI-TOF MS analysis.

In general, a good correlation was observed between the pairwise comparisons of the MLSA and the WC-MALDI-TOF MS results. A correlation of 0.678 (with a p value of 0.0) was obtained when all the Pseudomonas strains analyzed were considered but the correlation was higher when individual groups were considered. P. lutea G and P. stutzeri G showed the better correlations, with values close to 1 (0.999 and 0.924, respectively, with p values < 0.05). P. fluorescens G, P. oleovorans G, P. pertucinogena G, and P. syringae G showed correlation coefficients of approximately 0.5 with p values lower than 0.05, indicating that MLSA and MALDI-TOF MS values were positively correlated. The four species of the P. straminea G showed correlation coefficients of 0.563 and a p value of 0.245. p-Values greater than 0.05 indicate that there is no significant relationship between the two variables. In both methodologies, the P. anguilliseptica G and P. aeruginosa G showed branches that were less conserved, with correlation coefficients of less than 0.5 (p values < 0.05). The individual SGs in the P. fluorescens G had lower correlation coefficients with no significant relationship between the variables.

3.3.4. Resolution at the genus and species levels

The strains were also identified by comparing their resulting mass fingerprints with the SARAMIS database. From the 141 Pseudomonas strains analyzed, 124 strains were correctly assigned to the Pseudomonas genus: 81 were identified as Pseudomonas sp., and 43 were identified at the species level. From the 43 strains identified by SARAMIS at the species level, only 21 were correctly identified, whereas the other 22 were not assigned to the correct species, even though they were assigned to the associated group. At the time of performing the analysis, only 24 Pseudomonas species were represented in the SARAMIS database (24 of 133 species, representing approximately 18% of the known species). The remainders of the 141 strains, 17 strains (12%) were not identified as belonging to any of the genera present in the SARAMIS database but neither were they incorrectly assigned to another genus.

113

Chapter 3

Additionally, the WC-MALDI-TOF mass spectra were obtained for 40 Pseudomonas isolates with environmental and clinical origins. The spectra were grouped into five clusters, and several representative strains of each cluster were identified by sequencing their rpoD genes. The isolates of each cluster belonged to the same species (data not shown).

3.4. Discussion

The MLSA method used in this study revealed that the Pseudomonas genus could be reconstructed into five main groups, which were consistent with the gene analyses applied by several authors: 16S rRNA (Anzai et al., 2000, Moore et al., 1996); rpoB (Tayeb et al., 2008); FliA, RpoS, RpoH (Kiil et al., 2008); gyrB and rpoD (Yamamoto et al., 2000); atpD, carA, recA, and 16S rRNA (Hilario et al., 2004); 16S rRNA, gyrB, rpoD and rpoB (Mulet et al., 2010); gyrB, gltA and gapA (Guttman et al., 2008); split tree decomposition (Guttman et al., 2008) or Pseudomonas comparative genomics (Kiil et al., 2008, Silby et al., 2011). These main groups corresponded to classical, well- defined groups that were supported by their MLST and WC-MALDI-TOF characteristics and by their ecological roles in nature, reflecting specific life styles and environmental niches. These MLSA-derived groups are described as follows: (1) The P. fluorescens group is very diverse (Silby et al., 2011), with a saprophytic lifestyle, commonly recovered from soil, water and plant surfaces. Many strains of these species are used as biocontrol and plant growth-promoting agents; (2) The P. syringae group comprises plant pathogens, with more than 50 different pathovars; (3) members of the P. putida group are ubiquitous bacteria isolated from soils (polluted or not), rhizosphere and waters, and they have significant degradative abilities; (4) the P. stutzeri group represents environmental bacteria having important roles in nutrient cycling, and it is genetically highly diverse (Guttman et al., 2008, Lalucat et al., 2006); (5) the P. aeruginosa group is clearly separated from the other species in the genus but includes phylogenetically distant species that occupy many different habitats, including humans. These five groups were clearly defined by both the MLSA and WC-MALDI-TOF techniques.

The multilocus sequence analysis can be considered as the current method of choice for deriving the phylogenetic relationships between species in the genus Pseudomonas, and this method is used to build the reference backbone for the taxonomy of its members. However, complementary methods are needed for accurate, rapid and cost-effective identification for clinical, environmental and biotechnological purposes. WC-MALDI- TOF mass spectrometry is a powerful technology for bacteria species-level discrimination and is useful in bacterial identification. Nevertheless, a comprehensive database is needed in both types of analysis as a reference for comparative purposes.

In the present study, the MLSA database was further complemented by analyzing 141 species and subspecies type strains in the genus Pseudomonas, and the utility of WC- MALDI-TOF MS was assessed for species discrimination. The sequence data was also

114

WC-MALDI-TOF MS and MLSA of the genus Pseudomonas

deposited in the PseudoMLSA database (Bennasar et al., 2010), which is a web-based tool to facilitate the identification of new strains.

All the species and subspecies were well-discriminated in the WC-MALDI-TOF MS analysis. The similarities between species were lower than 60%. The different strains of P. stutzeri and P. balearica, in addition to P. chlororaphis subspecies and P. oleovorans and P. alcaliphila, clustered together in the dendrogram, with mean similarity values between 60 and 75%. The analysis of the environmental and clinical Pseudomonas strains confirmed the accuracy and utility of the WC-MALDI-TOF MS analysis for species-level identification.

The present work demonstrated a good correlation between both methodologies. Even when the 19 groups or subgroups established using the MLSA phylogenetic analysis could not be discriminated consistently using the WC-MALDI-TOF MS analysis, a good correspondence with the WC-MALDI-TOF MS dendrogram was found (82.9% of the strains were grouped exactly by both methodologies). P. lutea G, P. oryzihabitans G, P. pertucinogena G and P. stutzeri G matched perfectly using both methodologies. All the type strains of the P. fluorescens G were included in the P. fluorescens grouping by WC-MALDI-TOF MS, although some species were not in the same SG. P. putida G (12 strains), P. straminea G (5 strains), and P. syringae G (12 strains) demonstrated good correspondence, with the exception of only one species in each group: P. taiwanensis (P. putida G), P. seleniipraecipitans (P. straminea) and P. avellanae (P. syringae G), as well as P. anguilliseptica G and P. aeruginosa G. These results were well supported by the correlation values of individual groups. This good correspondence in the groupings indicated a strong phylogenetic signal in the mass spectral analysis. This result can be explained by the fact that the most important signals in the mass spectra correspond to ribosomal proteins and these proteins co-evolved with the 16S rDNA, which has a strong weight in the MLSA technique. Those strains not ascribed phylogenetically to a defined group were similarly not grouped in the WC- MALDI-TOF MS dendrogram.

In conclusion, the MLSA approach should continue to be considered as the most adequate taxonomical tool for assessing the phylogeny of the genus Pseudomonas. However, for species-level differentiation and identification purposes in ecological and clinical microbial studies, the WC-MALDI-TOF MS approach can be a good method of choice because it is fast and accurate when the reference database is complete.

115

Chapter 3

3.5. Supplemental Material.

Table S3.1. GenBank accession numbers of the sequences used in this study.

Species 16S rRNA gyrB gene rpoD gene rpoB gene “P. alkylphenolia” JCM 16553 AY324319 HE577792 HE577794 HE577798 P. arsenicoxydans CECT 7543T FN645213 HE800469 HE800488 HE800503 P. baetica CECT 7720T FM201274 HE800470 FN678357 HE800504 P. bauzanensis DSM 22558T GQ161991 HE800471 HE800489 HE800505 P. benzenivorans DSM 8628T FM208263 HE800472 HE800490 HE800506 P. caeni CECT 7778T EU620679 HE800473 HE800491b1 HE800507 P. composti C2T FN429930 HE800474a1 FR716577 HE800508 P. cuatrocienegasensis 1NT EU791281 HE800475 HE800492 HE800509 P. deceptionensis CECT 7677T GU936597 HE800476 GU936596 HE800510c1 P. delhiensis RLD-1T DQ339153. HE800477 HE800493 HE800511 P. duriflava KCTC 22129T EU046271 HE800478 HE800494 HE800512 P. entomophila L48T NC_008027 NC_008027 NC_008027 NC_008027 P. extremaustralis DSM 17835T AJ583501 HE800479 HE800495 JN814371 P. indoloxydans JCM 14246T DQ916277 AB548144 HE800496 AB548148 P. japonica JCM 21532T AB126621 GQ996725 HE577795 HE577800 P. litoralis CECT 7670T FN908483 FN908486 FN908485 FN908484 P. lurida P 513/18T AJ581999 HE800480 HE800497 HE800513c2 P. oryzihabitans ATCC 43272T D84004 FN554210 FN554494 HE800519 P. pelagia JCM 15562T EU888911. FN908496 FN908495 FN908494 P. pohangensis DSM 17875T DQ339144 HE800481 HE800498 - P. protegens DSM 19095T AJ278812 HE800482 X84416 HE800514 P. sabulinigri KCTC 22137T EU143352. FN908493 FN908492 FN908491 P. saponiphila DSM 9751T FM208264 HE800483 HE800499 HE800515 P. segetis IMSNU 14101T AY770691 HE800484a2 HE800500b2 HE800516 P. seleniipraecipitans LMG 25475T FJ422810 HE800485 HE800501 HE800517 P. taeanensis KCTC 22612T FJ424813 HE800486 HE800502 HE800518 P. taiwanensis DSM 21245T EU103629 HE800487 HE577796 HE577797 P. toyotomiensis NCIMB 14511T AB453701 AB494447 AB548145 AB548147 P. tuomuerensis CECT 7766T DQ868767 AB571150 AB571152 AB571151 P. vranovensis DSM 16006T AY970951 HE577791 HE577793 HE577799 P. xiamenensis JCM 13530T DQ088664 DQ350612 EF596884 EF667149 P. stutzeri ATCC 27951 AJ633553 AJ617559 AJ631318 HE800520 P. stutzeri A15 NC_009434 NC_009434 NC_009434 NC_009434 P. balearica LS401 U26417 AJ633102 AJ633566 HE800521 P. balerica st101 AM905859 AM905837 AM905873 HE800522 Accession numbers indicated in bold are for sequences determined in this study. The new combinations of primers used for amplification are indicated as: a1, UP -1E-APrU and a2, M13(- 21)/M13R for the gyrB gene; b1, 70F/70R and b2, PsEG30F/70R for rpoD gene; and c1, LAP5/VIC6 and c2, VIC4-LAP27 for rpoB gene (28, 42). (-) Not determined.

116

Environmental microbiota as reservoir for dissemination of metallo-β-lactamases

Chapter 4:

Environmental microbiota represents a natural reservoir for dissemination of clinically relevant metallo--lactamases

Scotta C, Juan C, Cabot G, Oliver A, Lalucat J, Bennasar A, Albertí S. 2011. Environmental microbiota represents a natural reservoir for dissemination of clinically relevant metallo-β-lactamases. Antimicrobial Agents and Chemotherapy 55, 5376-5379. DOI: 10.1128/AAC.00716-11.

117

Chapter 4

Abstract

A total of 10 metallo--lactamase-producing isolates of six different species, including Brevundimonas diminuta (n=3), Rhizobium radiobacter (n=2), Pseudomonas monteilii (n= 1), Pseudomonas aeruginosa (n =2), Ochrobactrum anthropi (n = 1), and Enterobacter ludwigii (n = 1), were detected in the sewage water of a hospital. The presence of blaVIM-13 associated with a Tn1721-class 1 integron structure was detected in all but one of the isolates (E. ludwigii, which produced VIM-2), and in two of them (R. radiobacter), this structure was located on a plasmid, suggesting that environmental bacteria represent a reservoir for the dissemination of clinically relevant metallo-- lactamase genes.

118

Environmental microbiota as reservoir for dissemination of metallo-β-lactamases

4.1. Introduction

Metallo--lactamases (MBLs) have emerged worldwide as a major source of acquired broad-spectrum -lactam resistance. They hydrolyze virtually all classes of -lactams (except monobactams), including carbapenems, which often represent the last option for the treatment of infections with multidrug-resistant Gram-negative bacteria.

There are two dominant types of transferable MBLs among clinical isolates, IMP and VIM. Most of the IMP- and VIM-type MBL genes are present as gene cassettes inserted into integrons located on the chromosome or on plasmids. These integrons may be associated with transposon-like structures which may contribute to their variable location and spread (Walsh et al., 2005). Interestingly, these MBL genes have been found almost exclusively in the hospital setting and the role of nonclinical habitats as a reservoir for bacteria that carry these acquired resistance determinants has been poorly investigated (Quinteira et al., 2005, Quinteira and Peixe, 2006).

In this study, we evaluated the presence of MBL-producing bacteria in the sewage water of Son Llàtzer Hospital (Mallorca, Spain) in order to obtain epidemiological data which could complement the results from a previous survey that investigated the incidence of MBL-producing Pseudomonas aeruginosa strains in this hospital (Juan et al., 2008).

4.2. Methods and Results

Duplicates of up to six 10-fold dilutions of 1 liter of sewage water collected 20 m downstream of the hospital wastewater discharge site were plated on three different media specially designed for the selection of pseudomonads (Gould S1 agar [Gould et al., 1985], King B agar [King 1954], and Cetrimide agar [Merck, Darmstadt, Germany]) containing 30 g/ml ceftazidime (Combinopharm, Madrid, Spain). A total of 37 bacterial isolates corresponding to different colony morphologies were collected using this strategy and tested for the presence of MBL using the MBL E-test according to the manufacturer’s instructions (bioMérieux, Marcy l’Etoile, France). Only 16 isolates were positive by this test.

Although these 16 MBL E-test-positive isolates exhibited different colony morphologies, their identification by 16S rRNA gene amplification and sequencing as previously described (Weisburg et al., 1991) showed that they belonged to only eight different species, including Brevundimonas diminuta, Rhizobium radiobacter, Pseudomonas monteilii, P. aeruginosa, Ochrobactrum anthropi, Enterobacter ludwigii, Acinetobacter johnsonii, and Stenotrophomonas maltophilia (Table 4.1). Isolates belonging to the same species were not genetically related, as we demonstrated by enterobacterial repetitive intergenic consensus sequencing-PCR (Versalovic et al., 1991; data not shown). Furthermore, pulsed-field gel electrophoresis (PFGE) typing (Gutierrez et al., 2007) revealed that the two P. aeruginosa isolates were different and not related to the MBL producing P. aeruginosa clinical isolate (PA-SL2) collected in a

119

Chapter 4

previous survey (Juan et al., 2008, data not shown). Given that S. maltophilia produces an intrinsic MBL, we did not further investigate those isolates.

In order to verify the presence of MBLs in the MBL Etest positive isolates, we determined their ability to hydrolyze imipenem and whether this hydrolysis was EDTA sensitive (Lauretti et al., 1999). The capacity to hydrolyze imipenem that was exhibited by all of the isolates was inhibited by EDTA in all cases, except for the A. johnsonii isolates, which showed only a weak hydrolysis that was not inhibited (Table 4.1). Moreover, the A. johnsonii isolates were found to produce the class D carbapenemase OXA-58 by PCR and sequencing, suggesting a false-positive MBL E-test result. In contrast, PCR amplification using primers specific for blaVIM-1, blaVIM-2, and blaVIM-13 and conditions previously described (Gutierrez et al., 2007, Juan et al., 2008) revealed the presence of VIM-type MBLs in all of the other isolates (Table 4.1). Interestingly, sequence analysis of the resulting amplicons revealed the presence of blaVIM-13 (Juan et al., 2008) in all of the isolates except E. ludwigii, which presented blaVIM-2 (Table 4.1). Moreover, the P. monteilii isolate was positive for both blaVIM-13 and blaVIM-2.

Given that blaVIM-13 was predominant among the isolates collected, we focused on the characterization of the microorganisms harboring this MBL gene. The susceptibility of the blaVIM-13-harboring isolates and reference strains to a number of antibiotics was determined by E-test (bioMérieux) following the manufacturer’s instructions (Table 4.2). All of the blaVIM-13- harboring isolates had similar patterns of multiresistance, showing, in addition to the MBL-mediated resistance to penicillins, cephalosporins, and carbapenems, resistance to gentamicin, tobramycin, and amikacin, with the exception of the P. monteilii isolate, which was susceptible to aminoglycosides. Furthermore, most of them showed increased resistance to ciprofloxacin and trimethoprim- sulfamethoxazole, compared to that of the reference strain. All of the isolates were uniformly susceptible to colistin and minocycline, except B. diminuta and O. anthropi, which were resistant to colistin, and P. aeruginosa, which was resistant to minocycline.

PCR amplification and sequencing, using the primers and conditions previo usly described (Juan et al., 2008), showed that the integron harboring blaVIM-13 was the same in all of the isolates and identical to the integron previously described in P. aeruginosa clinical isolate PA-SL2 (GenBank accession number EF577407.1) (Juan et al., 2008) (Fig. 4.1). According to previously published data (Juan et al., 2008), blaVIM-13 in PA- SL2 is located in a class 1 integron, where it is flanked on the left by intI1 and on the right by aacA4 and qacE1. Furthermore, compared to blaVIM-1, blaVIM-13 shows a higher efficiency of hydrolysis of carbapenems but a lower efficiency of hydrolysis of ceftazidime and cefepime, due to two substitutions (Leu224His, Arg228Ser) within the active site center (Juan et al., 2008). Extended cloning and sequencing experiments in this work revealed that, in P. aeruginosa PA-SL2, the integron harboring blaVIM-13 was flanked on the left by the resolvase and transposase encoding genes (tnpR and tnpA, respectively) of the Tn1721 transposon (GenBank accession number EU195449) (Fig. 4.1), suggesting that the integron could be mobilized by the Tn1721 machinery.

120

Table 4.1. Characteristics of the MBL E-test-positive isolates described in this study.

MIC (µg/ml) IMP hydrolytic e Isolate EDTA inhibition Enzyme(s) IMPb IMP+EDTA activityc B. diminuta 1 > 32 1.5 29 ± 3.3 + VIM-13 B. diminuta 2 16 2 8.1 ± 0.14 + VIM-13 B. diminuta 3 > 32 2 53.7 ± 3.5 + VIM-13 R. radiobacter 4 > 32 <1 197.3 ± 5.0 + VIM-13 R. radiobacter 5 > 32 <1 111.1 ± 5.0 + VIM-13 P. monteilii 6 > 32 <1 74.0 ± 27.0 + VIM-13, VIM-2 P. aeruginosa 7 > 32 <1 34.3 ± 13.1 + VIM-13 P. aeruginosa 8 > 32 2 27.5 ± 2.3 + VIM-13 O. anthropi 9 16 2 34.8 ± 6.2 + VIM-13 E. ludwigii 10 > 32 <1 28.5 ± 1.1 + VIM-2 A. johnsonii 11 32 2 3.2 ± 0.4 - OXA-58 A. johnsonii 12 16 2 2.7 ± 0.5 - OXA-58 A. johnsonii 13 32 4 4.7 ± 2.1 - OXA-58 S. maltophilia 14 > 32 4 NDd ND ND S. maltophilia 15 > 32 3 ND ND ND S. maltophilia 16 > 32 4 ND ND ND PA-SL2 (positive control) 24 1 53.8 ± 5.4 + VIM-13 PAdacB (negative control) ND ND 1.4 ± 0.3 - AmpCH a Previously described VIM-13-producing P. aeruginosa strain PA-SL2 (Juan et al., 2008) and an AmpC-hyperproducing mutant of PAO1 (Moyà et al., 2009) were used as positive and negative controls, respectively. b IMP, imipenem. c Mean (nm/min/mg protein) ± standard deviation of three independent experiments. d ND, not determined. e A plus sign indicates 50% inhibition of hydrolytic activity.

Table 4.2. MICs of environmental isolates harboring blaVIM-13.

MIC (g/mL)a Strain or Isolate CAZ FEP PIP TZP ATM IPM MEN GEN TOB AMK CIP CST SXT MIN B. diminuta (ATCC 11568T) >256 16 4 1 >256 1 0.5 4 8 8 12 96 0.032 0.016

B. diminuta (1) >256 >256 128 96 >256 >32 >32 >256 96 16 >32 128 >32 0.047

B. diminuta (2) >256 >256 96 48 >256 16 12 16 16 16 >32 256 >32 0.047

B. diminuta (3) >256 >256 >256 >256 >256 >32 >32 48 48 12 >32 48 >32 0.094

R. radiobacter (4) >256 >256 >256 >256 12 >32 >32 >256 48 48 >32 <0.064 >32 1.5

R. radiobacter (5) >256 >256 >256 >256 12 >32 >32 >256 48 48 >32 <0.064 >32 1.5

T P. monteilii (ATCC 700476 ) 3 6 12 12 24 1.5 2 3 1.5 4 0.064 0.5 4 1

P. monteilii (6) 32 24 96 96 - >32 >32 2 2 0.75 >32 0.25 >32 2

P. aeruginosa (PAO1) 1 1 3 3 1 1.5 0.38 - - - 0.125 - - -

P. aeruginosa (PA-SL2) 32 32 >256 >256 4 24 12 >256 48 16 >32 - - -

P. aeruginosa (7) 48 24 64 32 3 >32 24 >256 64 12 32 1 >32 64

P. aeruginosa (8) 48 24 128 128 2 >32 8 48 16 4 1.5 0.5 >32 16

O. anthropi (CCUG 24695T) >256 128 >256 >256 >128 1 0.125 0.5 0.75 6 0.125 8 0.032 1

O. anthropi (9) >256 >256 >256 >256 >256 16 8 48 48 16 1 4 0.064 0.25

aCAZ,ceftazidime; FEP, cefepime; PIP, piperacillin; TZP, piperacillin-tazobactam; ATM, aztreonam; IPM, imipenem; MEM, meropenem; GEN, gentamicine; TOB, tobramycin; AMK, amikacin; CIP, ciprofloxacin; CST, colistin; SXT, trimethoprim-sulfamethoxazole; MIN, minocycline.

Environmental microbiota as reservoir for dissemination of metallo-β-lactamases

Moreover, the integron contained four open reading frames, including tniB (GenBank accession number AJ863570) (Fig. 4.1), which could represent a remnant of the original tni locus of the Tn402-In16 integron.

To investigate whether the genes flanking the integron harboring blaVIM-13 in PA-SL2 were also present in the environmental isolates, we performed a series of PCR amplifications using the set of primers represented in Fig. 4.1 and listed in Table 4.3. As shown in Fig. 4.1, all of the B. diminuta isolates, one R. radiobacter isolate, and one P. aeruginosa isolate showed positive PCR results with all of the pairs of primers. Furthermore, all of the PCRs yielded products of the same size as those obtained with DNA from P. aeruginosa clinical strain PA-SL2. The other P. aeruginosa isolate and isolates of R. radiobacter and P. monteilii yielded PCR products with sizes identical to that of PA-SL2 on the right flank of the integron, while on the left flank they showed different results that ranged from positive reactions with PCR products larger than the expected sizes to absence of amplification. Finally, genomic DNA amplification of the O. anthropi isolate was positive with only one pair of primers located on the left side of the integron, which yielded a product 700 bp larger than that obtained with PA-SL2. The presence of a blaVIM-like gene in a transposon-integron structure in both clinical and environmental microorganisms has been reported for other MBL genes, such as blaVIM-2 (Juan et al., 2010), suggesting that the MBL integrons could be mobilized using the transposon machinery.

To investigate whether the wide spread of blaVIM-13 among different environmental microorganisms was due to the location of this gene on a plasmid, genomic DNA of each of the environmental isolates harboring blaVIM-13 was digested with I-Ceu1, separated by PFGE, and hybridized with blaVIM-13 and rRNA probes as described previously (Héritier et al., 2003). In the R. radiobacter isolates, the blaVIM-13 probe hybridized with bands which did not hybridize with the rRNA genes, suggesting that in these isolates, the blaVIM-13 gene is located in a plasmid, whereas matching of blaVIM-13 and rRNA probes in all of the other isolates indicated a chromosomal location (data not shown).

Altogether, our results suggest that environmental microbiota may represent an important reservoir of genetic determinants of antimicrobial resistance such as a class 1 integron harboring blaVIM-13 and that the “sewage habitat” can be considered a gathering place where many different species, including potential pathogens like P. aeruginosa, exist and those genetic determinants might be transferred among them.

123

Chapter 4

tnpA tnpR intl vim13 aacA4 qacEΔ1 sul1 orf5 tniB

TnpAV13F2 TnpRintF1 IntFI2 QacEΔ1F SulFINR SulFINF TniBV13F

400 bp 1,200 bp 1,100 bp 2,000 bp B 800 bp

1. B. diminuta + + + + + 2. B. diminuta + + + + + 3. B. diminuta + + + + +

4. R. radiobacter * (900) - + + + 5. R. radiobacter + + + + +

6. P. monteilii * (1,800) * (1,100) + + + 7. P. aeruginosa - - + + + 8. P. aeruginosa + + + + +

9. O. anthropi * (1,100) - - - -

Figure 4.1. Structure of the class 1 integron carrying blaVIM-13 and its flanking regions in P aeruginosa clinical isolate PA-SL2 and environmental isolates. (A) The genes in the class 1 integron carrying blaVIM-13 in PA-SL2 are shown as white arrows, and the genes flanking the integron are shown as gray arrows. The black arrows below the genes indicate the positions of the primers used for PCR amplifications, while the values in the braces are the sizes of the PCR products obtained using the genomic DNA from P. aeruginosa clinical isolate PA-SL2 as the template. (B) Results of PCR amplification of the genomic DNA from environmental isolates harboring blaVIM-13 with the primers shown in panel A. Symbols: +, positive PCRs with products identical in size to those obtained with the genomic DNA of PA-SL2; -, negative PCRs; *, positive PCRs with amplicon sizes (in base pairs, in parentheses) different from those obtained with the genomic DNA of PA-SL2.

124

Environmental microbiota as reservoir for dissemination of metallo-β-lactamases

Table 4.3. Primers used in this study.

Primer Sequence (5’-3’) Target gene Reference 16S 27F AGAGTTTGATCMTGGCTCAG Ribosomal RNA Lane, 1991 16S 1492R TACGGYTACCTTGTTACGACTT VIM-2A ATGTTCAAACTTTTGAGTAGTAAG bla VIM-2 Poirel et al., 2000 VIM-2B CTACTCAACGACTGAGCG VIM1AO-F GTTAAAAGTTATTAGTAGTTTATTG bla VIM-1 Juan et al., 2008 VIM1AO-R CTACTCGGCGACTGAGC OXA-CF ACAGAARTATTTAAGTGGG bla OXA Hujer et al., 2006 OXA-CR GGTCTACAKCCMWTCCCCA INT1F CTCTCACTAGTGAGGGGC Class I Integron Juan et al., 2008 INT1R ATGAAAACCGCCACTGCG integrase 5CS GGCATCCAAGCAGCAAG Class I Integron Lévesque et al., 1995 3CS AAGCAGACTTGACCTGA ERIC2 AAGTAAGTGACTGGGGTGAGCG Enterobacterial Repetitive Intergenic Versalovic et al., 1991 ERIC1R ATGTAAGCTCCTGGGGATTCAC Consensus QacEΔ1F GAAAGGCTGGC TTTTTCTTG qacE Δ1-tniB fragment TniBV13F GACAACCTCTCGCGCAACC qacE Δ1-tniB fragment TnpAV13F2 GGCAGAGCTGCACGGCG tnpA-tnpR fragment This study TnpRintF1 TGGCCCGCAA CCTCGATGA tnpA-tnpR fragment

IntFI2 GCTCACCGCTTGATGCGC tnpA-intI fragment SULFINF TCGCAGTCGCGACGCCAG sul1- tniB fragment SULFINR CTGGCGTCGCGACTGCGA qacE Δ1- sul1 fragment

125

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Chapter 5:

Taxonomic characterization of ceftazidime-resistant Brevundimonas isolates and description of Brevundimonas faecalis sp. nov.

Scotta C, Bennasar A, Moore ERB, Lalucat J, Gomila M. 2011. Taxonomic Characterization of ceftazidime-resistant Brevundimonas isolates and description of Brevundimonas faecalis sp. nov. Systematic and Applied Microbiology 34, 408-413. DOI:10.1016/j.syapm.2011.06.001.

127

Chapter 5

Abstract

Three ceftazidime-resistant strains isolated from the sewage water of a municipal hospital in Palma de Mallorca, Spain, were analysed phenotypically and genotypically to clarify their taxonomic positions. Sequence determinations and phylogenetic analyses of the 16S rRNA genes indicated that strains CS20.3T, CS39 and CS41 were affiliated with the species of the alphaproteobacterial genus Brevundimonas, most closely related to B. bullata, B. diminuta, B. naejangsanensis and B. terrae. Additional sequences analyses of the ITS1 region of the rRNA operon and the genes for the housekeeping enzymes DNA gyrase -subunit and RNA polymerase -subunit, genomic DNA-DNA hybridisation similarities, cell fatty acid profiles and physiological and biochemical characterizations supported the recognition of CS20.3T (CCUG 58127T = CECT 7729T) as a distinct and novel species, for which the name Brevundimonas faecalis sp. nov.is proposed. Strains CS39 and CS41 were ascribed to the species B. diminuta.

128

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

5.1. Introduction

Two species described originally as Pseudomonas diminuta and Pseudomonas vesicularis were reclassified into a new genus, Brevundimonas, with B. diminuta defined as the type species of the genus (Segers et al., 1994). In 1999, several species of Caulobacter were transferred to Brevundimonas and the description of the genus was emended markedly (Abraham et al., 1999). At the time of this study, Brevundimonas comprised 21 validly published species isolated from various sources: B. diminuta (fresh water) (Leifson et al., 1954; Segers et al., 1994); B. vesicularis (urinary bladder epithelium) (Büsing et al., 1953, Galarneault and Leifson, 1964, Segers et al., 1994); B. alba (soil) (Abraham et al., 1999, Poindexter 1964); B. aurantiaca (Chlorella culture) (Abrham et al., 1999, Poindexter, 1964); B. aveniformis (activated sludge) (Ryu et al., 2007); B. bacteroides (fresh water) (Abraham et al., 1999, Poindexter, 1964); B. basaltis (sand) (Choi et al., 2010); B. bullata (soil) (Gray and Thornton, 1928; Kang et al., 2009); B. halotolerans (brackish water); B. intermedia (fresh water) (Abraham et al., 1999, Poindexter, 1964); B. kwangchunensis (alkaline soil) (Yoon et al., 2006a); B. lenta (soil) (Yoon et al., 2007); B. mediterranea (marine water) (Fritz et al., 2005); B. naejangsanensis (soil) (Kang et al., 2009); B. nasdae (condensation water) (Li et al., 2004); B. poindexterae (activated sludge) (Abraham et al., 2010); B. staleyi (activated sludge) (Abraham et al., 2010); B. subvibroides (fresh water) (Abraham et al., 1999, Poindexter 1964); B. terrae (alkaline soil) (Yoon et al., 2006b); B. vancanneytii (clinical blood sample) (Estrela and Abraham, 2010); and B. variabilis (fresh water) (Abraham et al., 1999, Poindexter, 1964).

Brevundimonas species have rarely been associated with human infections and their clinical significance, if any, remains undetermined (Ballows et al., 1991). Nevertheless, hospital-acquired Brevundimonas infections have been reported (Gilad et al., 2000, Han and Andrade, 2005, Oberhelman et al., 1994, Planes et al., 1992). Moreover, intrinsic resistance to quinolones has been noted in B. diminuta ATCC 11568T, while susceptibilities to aminoglycosides and cephalosporins have been reported among strains of B. diminuta and B. vesicularis (Gilad et al., 2000, Han and Andrade, 2005). The role of non-clinical niches as reservoirs for bacteria carrying the genes responsible for antibiotic resistance and the dynamics of the spread of these genes is a focus that is being studied in detail by several research groups (Quinteira and Peixe, 2006).

In this study, the taxonomic status of three Gram-negative strains, CS20.3T, CS39 and CS41, isolated during an investigation of ceftazidime-resistant micro-organisms in the sewage water of one of the largest hospitals in Palma de Mallorca (Spain) has been assessed. A polyphasic taxonomic study showed that one of the strains, CS20.3T, represents a distinct and new species of the genus Brevundimonas within the Alphaproteobacteria.

129

Chapter 5

5.2. Methods and results

Colonies from the three isolates grown on LB agar at 30º C for 48 hours were circular, convex, light-yellow, with a smooth edge and 2 mm in diameter, except CS20.3T, which was 1 mm in diameter. After 4 days of incubation, a light brown, raised centre appeared in each colony. None of the strains produced fluorescent diffusible pigments. Morphology and flagella insertion were determined, using transmission electron microscopy of cells at the exponential growth phase in LB broth (Sharlau). The samples were negatively-stained with phosphotungstic acid (1% w/v, pH 7.0), as described by Lalucat (1988). A Hitachi model H600 electron microscope was used, at 75 kV. Cells were observed to be rod-shaped (1.2 - 1.5 m long, 0.5 m wide), and motile by means of a single polar flagellum (Supplementary Fig. S5.1).

Total DNA was extracted using a method described previously (Wilson, 1987). In addition of 16S rRNA genes, rRNA operon internally-transcribed spacer 1 (ITS1) region, fragments of the genes for DNA gyrase subunit β (gyrB) and RNA polymerase subunit β (rpoB) were amplified and sequenced as previously described (Gomila et al., 2005, Guasp et al., 2000, Tayeb et al., 2008). If necessary, gyrB PCR products were cloned into the pGEM-T easy vector system, following the manufacturer´s instructions (Promega, Spain). The gene sequences were aligned with closely related sequences retrieved from the Genbank Nucleotide sequence database (http://www.ncbi.nlm.nih.gov/ genbank/). Alignments of the sequences were done using a hierarchical method for multiple alignments, implemented in the program CLUSTAL X (Thompson et al., 1997). Alignments obtained automatically were checked manually. Evolutionary distances, derived from sequence-pair dissimilarities, were calculated using the Jukes and Cantor correction (Jukes and Cantor, 1969) included in the program DNADIST of the Phylogenetic Inference Package (PHYLIP version 3.5c, Felsenstein 1989). Phylogenetic trees were constructed, using the Neighbour-Joining distance method. Topologies of the trees were analysed using TreeView (Page, 1996), and bootstrap (1,000 replications) estimates of branching order were calculated (Felsenstein, 1989).

The sequences for the nearly-complete (1,320 nucleotide positions) 16S rRNA genes of the isolates revealed that the strains CS20.3T, CS39 and CS41 belong to the Brevundimonas genus (Fig. 5.1). In the phylogenetic tree, generated using the Neighbor-Joining evolutionary distance algorithm, the three isolates joined the clade of species comprising B. diminuta, B. naejangsanensis, B. terrae and B. vancanneytii. The same topology was obtained using other algorithms: i.e., DNA Maximum Likelihood and DNA Parsimony. Strains CS39 and CS41 clustered with B. diminuta ATCC 11568T, with 16S rRNA gene sequence similarities of 99.9% (one nucleotide difference). Strain CS20.3T appeared in a separate branch of the dendrogram (bootstrap value of 47%). Strain CS20.3T 16S rRNA gene sequence similarities were 99.3% with B. diminuta ATCC 11568T, 98.6% with B. bullata CCUG 57113T, 98.5% with B. 130

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov. naejangsanensis CCUG 57609T, 98.5% with B. terrae KCTC 12418T and 98.0% with B. vancanneytii CCUG 1797T. The sequence similarities of strain CS20.3T with all other species of Brevundimonas were less than 97.5%.

ITS1 gene sequences (approximately 700 nucleotide positions) were analysed. Branch lengths between strains were deeper, reflecting the higher level of resolution offered by ITS1 sequence comparisons. Strains CS39 and CS41 appeared in the same branch as B. diminuta ATCC11568T, with sequence similarities of 97.3% and 99.4%, respectively. CS20.3T appeared in a distinct branch of the tree, with ITS1 sequence similarities of 87.2% to those of B. bullata CCUG 57113T, 82.2% to B. diminuta ATCC 11568T, 79.9% to B. naejangsanensis CCUG 57609T and 74.9% to B. terrae KCTC 12418T (supplementary Fig. S5.2 and Table S5.1).

The PCR-amplification primers targeting gyrB gene generated PCR-products of approximately 400 nucleotide positions, although non-specific products were produced when amplifying some Brevundimonas species (strains CS20.3T, CS39, CS41, B. diminuta ATCC 11568T and B. terrae KCTC 12418T). The PCR products from the gyrB amplification of strain CS20.3T and B. diminuta ATCC 11568T were cloned into the pGEM-T easy vector system and sequenced. In the gyrB sequence phylogenetic tree, strain CS20.3T clustered with B. diminuta ATCC 11568T, B. naejangsanensis CCUG 57609T and B. bullata CCUG 57113T, with sequence similarity values lower than 85% (supplementary Fig. S5.3 and Table S5.2). This degree of gyrB sequence similarity suggests that strain CS20.3T is genotypically different enough to be considered distinct at the species level.

A fragment of approximately 700 nucleotide positions of the rpoB gene sequence was also analysed for the strains CS39 and CS41, which showed similarities of 98.4% to each other (20 nucleotide differences) and 98.9% and 99.0%, respectively, with the sequence of B. diminuta ATCC 11568T. The rpoB sequences of the two isolated strains exhibited more than 5% sequence difference with the sequences of all other Brevundimonas species analysed. We were not able to amplify the rpoB gene for strain CS20.3T.

All sequences determined in this study have been deposited in the public databases under the following accession numbers: FR775448-FR775451 for 16S rRNA gene, FR775452- FR775458 for ITS1, FR775459- FR775462 for gyrB gene and FR775463- FR775467 for rpoB gene.

Based on the 16S rRNA gene sequence comparative analyses, genomic DNA-DNA hybridization studies were carried out on the isolated strains with the most closely related species of Brevundimonas (i.e., with 16S rRNA gene similarity values greater than 98.0 %). Genomic DNAs were isolated by the method of Marmur (Marmur, 1961). DNA-DNA hybridisations were performed as described by Urdiain et al. 2008, using 131

Chapter 5 the genomic DNAs of B. faecalis CS20.3T and B. diminuta ATCC 11568T as probes against the DNAs from other strains of Brevundimonas spp. The genomic DNA-DNA similarities of strain CS20.3T with the type strains of the phylogenetically closest species were less than 50%, confirming that it is genotypically divergent enough to be considered a distinct and novel species. Isolates CS39 and CS41 showed DNA-DNA relatedness levels greater than 70 % with B. diminuta ATCC 11568T, indicating that these two strains should be assigned to this species (supplementary Table S5.3).

Figure 5.1. Neighbor-Joining tree based on 16S rRNA gene sequences showing phylogenetic relationships between Brevundimonas faecalis CS20.3T and closest related Brevundimonas species.

132

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

A previously reported reversed-phase high-performance liquid chromatography method was followed, with the modifications reported by Urdiain et al., (2008), to determine the base compositions of the DNAs. The G+C content of the genomic DNA of CS20.3T was determined to be 65.1 %, which is within the range of 62-68 % that has been recorded for the species of Brevundimonas (Palleroni, 1984).

Biochemical characterisations of substrate utilization and metabolite production were performed for the three isolates and the type strains of the most closely related species of Brevundimonas, using the API 20NE identification system for Gram negative non- enterobacterial rods, and the API ZYM system for the characterization of 19 enzymatic reactions according to the instructions of the manufacturer (bioMérieux). The GN2 MicroPlateTM assay of substrate oxidation (Bochner, 2009) was also carried out, according to manufacturer´s instructions (Biolog, Inc.), with homogeneous suspensions of cells grown on blood agar. Growth at various temperatures, from 4ºC to 42ºC, was tested on LB medium (Sharlau) and growth at 0.5% - 6.0% (w/v) NaCl was tested for the three isolates. Strain CS20.3T differed from all other species of Brevundimonas, with respect to several metabolic-phenotypic characteristics (Table 5.1). It can be distinguished from the phylogenetically most closely related species by its inability to catalyse the decomposition of hydrogen peroxide, to reduce nitrate, to produce acid from glucose and its inability to grow at 3% NaCl, at 4ºC or 42ºC. Moreover it can be differentiated from the most closely related Brevundimonas species by its ability to grow with N-acetyl-glucosamine or with capric acid and its inability to grow with malic acid as sole carbon sources. Typically, strains of B. diminuta should not reduce nitrate but, as shown in Table 5.1, strains CS39 and CS41 are able to do so. A case of a strain of B. diminuta with this ability was reported, as well, by Ballard et al. (1968). Thus, it seems that nitrate reduction is a variable characteristic in B. diminuta strains. Although gelatinase activity has been reported as negative in B. diminuta (Palleroni, 1984), positive reactions for this enzyme were observed for B. diminuta ATCC 11568T and isolate CS39. This result was also reported by Li et al., 2004. API ZYM did not contribute with any differential characteristic. Substrate oxidation profiles, obtained through Biolog GN2, are listed in supplementary Table S5.4. Strain CS20.3T can be differentiated from the B. diminuta cluster by its ability to assimilate L-histidine, hydroxy-L-proline, L-rhamnose, and propionic acid; and by its inability to assimilate acetic acid, urocanic acid, dextrin, α-ketobutyric acid, α-ketoglutaric acid, α-ketovaleric acid, L-phenylalanine, α-D-glucose, turanose, α-D-glucose-1-phosphate, cellobiose, succinic acid mono-methyl-ester, succinic acid and D-glucose- 6-phosphate.

Gas chromatography of cell fatty acid (CFA) methyl esters was performed for the three isolates in a standardized protocol, similar to that of the MIDI Sherlock MIS system (http://www.ccug.se/pages/CFA_method_2008.pdf), and compared with the results for the type strains of the most closely related species. Cell biomasses for all strains compared were harvested from blood agar medium, incubated at 30ºC, except for B. diminuta ATCC11568T, which was incubated at 37ºC. CFAs were identified, quantified 133

Chapter 5 and the relative amount of each fatty acid was expressed as a percentage of the total fatty acids in the profile of that strain. The major cellular fatty acids (CFAs) detected in T CS20.3 were C18:c and C16:0 (59.0 and 25.5%, respectively, of total CFAs) as indicated in supplementary Table S5.5. These CFA profiles were similar to those reported for Brevundimonas species (Abraham et al., 1999). Few chemotaxonomic- phenotypic differences were detected among the type strains of the most closely related species. The CFA profiles of strains CS39 and CS41 were practically indistinguishable from that of the Brevundimonas diminuta type strain.

Table 5.1. Differential phenotypic characteristics between the isolates and closest related Brevundimonas species. Strains: 1. B. faecalis sp. nov. CS20.3T; 2. B. diminuta CS39; 3. B. diminuta CS41; 4. B. diminuta ATCC 11568T; 5. B. terrae KCTC 12418T; 6. B. naejangsanensis CCUG 57609T; 7. B. bullata CCUG 57113T; 8. B. vancanneytii CCUG 1797T. Data has been obtained in this study unless indicated. +, positive, -, negative, w, weak, nd, not determined.

Characteristic 1 2 3 4 5 6 7 8g Oxidase + + + +a + + +/w b + Catalase - + + + + + w/ - b -c Growth at: 4 ºC - - - - + + w nd 20 ºC + + + + + + + nd 30 ºC + + + + + + + nd 37 ºC + + + + + + + nd 42 ºC - + + + - + - nd Growth at 3% NaCl - + + nde -d +d -d + Hydrolysis of: Tween 80 (OF) - - - - + + - - Urea - - - -f - - - - Gelatine - + - + - - - - Nitrate reduction - + + - - - - + Glucose fermentation - - + - - - - - Growth in: Glucose ------w - N-Acetylglucosamine + ------Capric Acid + ++ ++ +f - + - + Adipic Acid ------w - Malic Acid - - - - - + - + aData from Palleroni et al.,1984 and Segers et al., 1994; different results for the type strains were obtained by Li et al., 2004. bData taken from Kang et al., 2009. cDifferent results at CCUG webpage. dData taken from the original description article in each case. eThere is no reference, but it is weak positive at CCUG webpage for B. diminuta CCUG 1427T. fDifferent results reported by Li et al., 2004. gData taken from Estrela et al., 2010.

134

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Matrix-assisted linear desorption/ionization-time-of-flight mass spectrometry (MALDI- TOF MS) assays for isolates CS20.3T, CS39 and CS41, as well as the type strains of the most closely related species, were performed at Anagnostec, GmbH, Germany (Kallow et al., 2010). The cells were analysed on a Flexi Mass stainless steel target, using a whole-cell protocol with 1L matrix solution of saturated -cyano-4-hydroxy-cinnamic acid in a mixture of acetonitrile:ethanol:water (1:1:1), acidified with 3% (v/v) trifluoroacetic acid. For each strain, mass spectra were prepared in duplicate and analyzed on an AXIMA Confidence instrument (Shimadzu/Kratos, Manchester, UK), in the linear positive ion extraction mode. Mass spectra were accumulated from 100 profiles each from five nitrogen laser pulse cycles, scanning the entire sample spot. Ions were accelerated with pulsed extraction at a voltage of 20 kV. Raw mass spectra were processed automatically for baseline correction and peak recognition. Resulting mass fingerprints were exported to SARAMIS (Spectral Archiving and Microbial Identification System, Release 3.36, Anagnostec GmbH, Germany), and analysed. Percent similarities of identical mass peaks were calculated and used to generate dendrograms, applying single-linkage agglomerate calculations. In the MALDI-TOF MS cluster analysis derived from mass signals of whole-cell protein profiles, the duplicate spectra profiles for each strain that was analyzed clustered at 75% similarity (B. naejangsanensis CCUG 57609T) or greater.

The different species differentiated from one another with 50% (between B. diminuta ATCC 11568T and B. naejangsanenssis CCUG 57609T), or less peak profile similarity. Strains CS39 and CS41 clustered with B. diminuta ATCC 11568T (approximately 80% similarity), further supporting the observations that these isolated strains represent strains of B. diminuta. Strain CS20.3T constituted a distinct branch of the dendrogram, with mass peak profiles most similar (approximately 35% similarity) to those of B. terrae KCTC 12418T and with approximately 30% similarity to those of B. diminuta (Fig. 5.2). MALDI-TOF MS profiles for all the strains studied have been included as supplementary Fig. S5.4. These data further support the conclusion that strain CS20.3T comprises a species distinct and separate from all other Brevundimonas species, even at the level of expression of the most abundant cellular proteins.

Considering all the genotypic and phenotypic data, including genomic DNA-DNA hybridization similarity results and assessments phylogenetic relationships, strains CS39 and CS41 were classified as members of B. diminuta species. We propose strain CS20.3T to represent a distinct and novel species within the genus Brevundimonas, for which the name Brevundimonas faecalis sp. nov. is proposed. Brevundimonas faecalis CS20.3T was deposited at the CCUG, Culture Collection of the University of Göteborg (CCUG 58127T) and at the Spanish Culture Collection (CECT 7729T). Isolates CS39 and CS41 were deposited at the CCUG as CCUG 58128 and CCUG 58129, respectively.

135

Chapter 5

Figure 5.2. Dendrogram of relatedness between B. faecalis CS20.3T and phylogenetically closest members of Brevundimonas based on MALDI-TOF MS analysis.

5.3. Description of Brevundimonas faecalis sp. nov.

Brevundimonas faecalis (fae.cal'is. L.n. fuex, dregs; N.L. adj. faecalis relating to feces). Cells are Gram negative, aerobic rods (1.2 - 1.5 m long, 0.5 m wide), motile by means of a short-wavelength single flagellum. Colonies on LB agar medium are circular with a smooth border, slightly convex, creamy yellow in colour and 1.0 mm in diameter after 48 h of incubation at 30 ºC. It does not grow at 4 ºC or at 42 ºC. Growth occurs in the presence of 0-1.5% but not with 3% NaCl. Neither nitrate nor nitrite is utilized as terminal electron acceptors. Oxidase activity is positive but catalase is negative. Indole formation, glucose fermentation, arginine dihydrolase, urease, -glucosidase, gelatinase and PNPG tests are negative. In the API ZYM assay, alkaline phosphatase, esterase (C4), ester lipase (C8), leucine arylamidase, trypsine, chymotripsine, acid phophatase and phosphoamidase activities were detected, but lipase (C14), valine arylamidase, cystine arylamidase, - and -galactosidase, -glucuronidase, - and -glucosidase, N- acetyl--glucosaminidase, -mannosidase and -fucosidase activities were absent. It grows with N-acetyl-glucosamine and capric acid but not with glucose, arabinose, manose, manitol, maltose, gluconate, adipic acid, malic acid, citrate and phenylacetic acid. It is able to assimilate L-histidine, hydroxyl-L-proline, L-leucine, L-alaninamide, Tween 40 and 80, L-rhamnose, D-alanine, L-alanine, L-proline, L-alanylglycine, propionic acid, L-asparagine, L-aspartic acid, L-serine, L-glutamic acid, L-threonine, pyruvic acid methyl ester, β-hydroxybutyric acid, glycyl-L-aspartic acid, and glycyl-L- glutamic acid as carbon sources. The main cellular fatty acids are C18:17c and C16:0. The G+C mol % of the DNA is 65.14.

Strain CS20.3T (CCUG 58127T=CECT 7729T) is the type strain, isolated from sewage water from a hospital in Palma de Mallorca (Spain).

136

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

5.3. Supplemental material

Figure S5.1. Cells of Brevundimonas faecalis CS20.3T by transmission electron microscopy. Negative stain with Phosphotungtic acid 1%.

137

Chapter 5

Figure S5.2. Neighbor-Joining tree based on ITS1 sequences showing positions of Brevundimonas faecalis CS20.3T and closest related Brevundimonas species.

138

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Figure S5.3. Neighbor-Joining tree based on gyrB gene sequences showing positions of B. faecalis CS20.3T and related Brevundimonas species.

139

Chapter 5

Brevundimonas faecalis CS20.3T

Brevundimonas diminuta CS39

Brevundimonas diminuta CS41

Figure S5.4. See below.

140

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Brevundimonas diminuta ATCC 11568T

Brevundimonas terrae KCTC 12418T

Brevundimonas naejangsanensis CCUG 57609T

Figure S5.4. See below.

141

Chapter 5

Brevundimonas bullata CCUG 57113T

Figure S5.4: MALDI-TOF MS profiles of the cellular extracts of the isolated strains and the phylogenetically closest Brevundimonas.

142

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Table S5.1. ITS1 sequence similarity matrix. Strains: 1. B. faecalis sp nov. CS20.3T; 2. B. diminuta CS39; 3. B. diminuta CS41; 4. B. diminuta ATCC11568T; 5. B. terrae KCTC 12418T; 6. B. naejangsanensis CCUG 57609T; 7. B. bullata CCUG 57113T; 8. B. vancanneytii CCUG 1797T.

1 2 3 4 5 6 7 8 B. diminuta CS39 (1) 100.0 B. diminuta CS41 (2) 97.3 100.0 B. naejangsanensisT (3) 96.2 95.7 100.0 B. diminutaT (4) 97.3 99.4 95.5 100.0 B. bullataT (5) 81.5 82.3 78.5 82.7 100.0 B. terraeT (6) 72.5 70.5 69.0 70.3 77.2 100.0 C. segnisT (7) 63.9 62.9 62.2 62.3 60.1 57.4 100.0 B. faecalis CS20.3T (8) 81.1 81.9 80.0 82.3 87.3 75.0 58.9 100.0

Table S5.2. gyrB gene sequence similarity matrix. Strains: 1. B. faecalis sp nov. CS20.3T; 2. B. diminuta CS39; 3. B. diminuta CS41; 4. B. diminuta ATCC11568T; 5. B. terrae KCTC 12418T; 6. B. naejangsanensis CCUG 57609T; 7. B. bullata CCUG 57113T; 8. B. vancanneytii CCUG 1797T.

1 2 3 4 5 6 7 8 B. faecalis CS20.3T (1) 100.0 B. diminutaT (2) 84.8 100.0 B. bacteroidesT (3) 77.1 79.8 100.0 B. vesicularis T (4) 71.3 72.1 80.1 100.0 B. intermediaT (5) 79.4 74.6 85.6 81.6 100.0 B. bullataT (6) 79.2 80.3 78.3 74.6 75.8 100.0 B. naejangsanensisT (7) 81.9 91.4 77.9 71.7 72.9 78.1 100.0 H. huttienseT (8) 57.1 52.7 56.6 53.4 58.2 53.5 47.9 100.0

143

Chapter 5

Table S5.3. DNA-DNA hybridization of B. faecalis CS20.3T and phylogenetically closest related Brevundimonas species.

% B. faecalis % B. diminuta %16S rDNA sequence Strain T T similarity with B. faecalis CS20.3 * ATCC 11568 * CS20.3T

B. faecalis CS 20.3T 100 48 100.0

B. diminuta CS 39 50 72 99.3

B. diminuta CS 41 50 81 99.3

B. diminuta ATCC 11568T 46 100 99.2

B. terrae KCTC 12418T 22 36 98.4

B. naejangsanensis CCUG 57609T 36 60 98.5

B. bullata CCUG 57113T 44 36 98.7

*Reference DNA strains were double labelled with DIG-11-dUTP and biotin-16dUTP, using a nick-translation kit (Boehringer Manheim). Pooled standard deviations in both experiments were 1.86 and 1.94.

144

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Table S5.4. Carbon source utilization (Biolog GN2) among the Brevundimonas strains studied. Strains: 1. B. faecalis sp nov. CS20.3T; 2. B. diminuta CS39; 3. B. diminuta CS41; 4. B. diminuta ATCC11568T; 5. B. terrae KCTC 12418T; 6. B. naejangsanensis CCUG 57609T; 7. B. bullata CCUG 57113T; 8. B. vancanneytii CCUG 1797T. Data are from this study except for B. vancanneytii (Estrela et al., 2010). +, positive, -, negative, w, weak, nd, not determined.

Carbon source 1 2 3 4 5 6 7 8 i-Erythritol ------+ D-Melibiose ------+ Acetic Acid - + + w - w - + p-Hydroxy Phenylacetic Acid ------+ Bromosuccinic Acid ------+ L-Histidine + + + +a - + +c + Urocanic Acid ------+c + α-Cyclodextrin ------D-Fructose ------+ β-Methyl-D-Glucoside ------+ Cis-Aconitic Acid ------+ Itaconic Acid ------+ Succinamic Acid ------+ Hydroxy-L-Proline ++ + + + + + - + Inosine ------Dextrin ------+ + L-Fucose ------+ D-Psicose ------+ Citric Acid ------+ α-Keto Butyric Acid - + + - +a +b + + Glucuronamide ------+ L-Leucine + + + +a + + +c + Uridine ------+ Glycogen ------D-Galactose ------+ D-Raffinose ------+ Formic Acid ------+ α-Keto Glutaric Acid - - - - - w - + L-Alaninamide + + + + + + + + L-Ornithine ------+ Thymidine ------Tween 40 + + + + + + +c + Gentiobiose ------+ L-Rhamnose + ------+ D-Galactonic Acid Lactone ------+ α-Ketovaleric Acid - + + + - + +c + D-Alanine + + + + + + + + L-Phenylalanine ------+c + 145

Chapter 5

Table S5.4. Continued.

Carbon source 1 2 3 4 5 6 7 8 Phenyethylamine ------Tween 80 + + + +a + + +c + α-D-Glucose ------+ + D-Sorbitol ------+ D-Galacturonic Acid ------+ D,L-Lactic Acid ------+ L-Alanine + + + + + + + + L-Proline + + + + + + + + Putrescine ------+ N-Acetyl-D-Galactosamine ------m-Inositol ------+ Sucrose ------+ D-Gluconic Acid ------+ Malonic Acid ------+ L-Alanylglycine + + + + + + + + L-Pyroglutamic Acid ------+ 2-Aminoethanol ------+ N-Acetyl-D-Glucosamine ------+ α-D-Lactose ------+ D-Trehalose ------+ D-Glucosaminic Acid ------+ Propionic Acid + + + - + -b - + L-Asparagine + + + + + + + + D-Serine ------+ 2,3-Butanediol ------+ Adonitol ------+ Lactulose ------nd Turanose ------w + D-Glucuronic Acid ------+ Quinic Acid ------+ L-Aspartic Acid + + + + + + + + L-Serine + + + + w + + + Glycerol ------+ L-Arabinose ------+ Maltose ------+ Xylitol ------nd α-Hydroxybutyric Acid ------+ D-Saccharic Acid ------+ L-Glutamic Acid + + + + + + + + L-Threonine + + + w w + +c + D,L-α-Glycerol Phosphate ------+ D-Arabitol ------+

146

Taxonomic characterization of Brevundimonas isolates and description of B.faecalis sp. nov.

Table S5.4. Continued.

Carbon source 1 2 3 4 5 6 7 8 D-Mannitol ------+ Pyruvic Acid Methyl Ester + + w + + + + + β-Hydroxybutyric Acid + + + + + + + + Sebacic Acid ------+ Glycyl-L-Aspartic Acid + + + + + + + + D,L-Carnitine ------nd α-D-Glucose-1-Phosphate ------+ + D-Cellobiose ------wc nd D-Mannose ------+ Succinic Acid Mono-Methyl-Ester - + - - - + - + γ-Hydroxybutyric Acid ------+ Succinic Acid - - - - - + - + Glycyl-Lglutamic Acid + + + + + + + + γ-Amino Butyric Acid ------+ D-Glucose-6-Phosphate ------+ + aDifferent results were reported by Yoon et al., 2006b. bDifferent results were reported by Kang et al., 2009. cDifferent results were reported by Yoon et al., 2007.

147

Chapter 5

Table S5.5. Cellular fatty acid compositions (%) of the isolated strains and related reference type strains. Strains: 1. B. faecalis sp. nov. CS20.3T; 2. B. diminuta CS39; 3. B. diminuta CS41; 4. B. diminuta ATCC 11568T; 5. B. terrae KCTC 12418T; 6. B. naejangsanensis CCUG 57609T; 7. B. bullata CCUG 57113T; 8. B. vancanneytii CCUG 1797T.

Fatty acid 1 2 3 4 5* 6 7 8 12:0 3OH 1.9 2.2 2.3 2.4 2.5 2.3 1.1 1.5 12:1 3OH ------0.9 - 13:0 ISO2OH 2.4 2.3 2.4 2.7 - - 2.6 1.9 14:0 0.9 1.2 1.2 1.3 4.2 1.0 0.9 1.2 15:1 8c - 0.6 0.4 0.4 0.4 - 0.8 0.6 15:0 2.0 2.0 1.4 1.3 3.5 0.5 3.8 2.4 16:1 7c 2.3 2.9 3.0 3.4 - 4.2 7.4 2.7 16:0 25.5 20.7 21.9 21.4 36.4 32.7 17.4 23.7 17:1 8c 1.4 1.9 1.3 1.0 1.0 0.5 4.0 2.2 17:1 6c 1.0 1.1 0.8 0.6 0.5 - 1.9 - 17:0 0.7 0.8 0.6 0.4 1.4 0.5 0.8 1.4 17:0 cyclo ------1.2 18:0 - - - - 0,7 0.5 - - 18:17c/12t/9t 59.0 60.5 62.8 63.1 39.6 49.3 57.1 58.9 11 methyl 18:1 7c - 0.5 - - 6.4 - 0.7 19:0 cyclo 8c 1.5 1.9 0.5 0.5 - 7.6 - 1.7 Unclassified 1.2 1.4 1.3 1.4 - - - 0,6 * Data taken from Yoon et al., 2006b, fatty acids were determined after incubation of cells in TSA at 37ºC.

148

Conclusions

General conclusions

1. The collection of environmental and clinical Pseudomonas stutzeri strains has been increased and consolidated.

2. Precise identification of clinical strains of the genus Pseudomonas and especially of Pseudomonas stutzeri can be achieved through rpoD gene sequence analysis. Identifications based only on the phenotype can led to misidentifications of strains in the species P. stutzeri.

3. MLSA of the 16S rDNA, gyrB and rpoD genes represent an excellent tool for the assessment of the phylogeny of P. stutzeri populations. rpoD gene sequence is the most discriminating gene for studying P. stutzeri genomovars, followed by gyrB gene. Compared to rpoD and gyrB genes, the ITS is not discriminative enough to assign P. stutzeri strains to a specific genomovar.

4. Based on MLSA, the threshold similarity value for genomovar assignation between members of gv 1 and 5 should be 97.7%, and 95.2% for the differentiation of the rest of genomovars.

5. MLSA, WC MALDI-TOF MS and DNA-DNA hybridization support that strains PE, A563/77 and V81 represent three novel genomovars within the species P. stutzeri (gv 20, 21 and 22, respectively).

6. Clinical populations of P. stutzeri are mostly represented for three genomovars (gv 1, 2 and 3) and no new genomovars have to be expected when analysing clinical strains. However, new genomovars are expected in non-clinical habitats. In general, it can be concluded that there are some genomovars more adapted to a specific habitat, although no a clear correlation exists between the habitat of isolation and the genomovar to which it was assigned.

7. MALDI-TOF MS is a good chemotaxonomic approach for identifying species of the Pseudomonas genus and for the delineation of P. stutzeri populations. Strain groupings based on MALDI-TOF MS and MLSA are good correlated.

8. Our results suggest that MLSA approach should continue to be considered as the most adequate taxonomical tool for assessing the phylogeny of the genus Pseudomonas. However, for species-level differentiation and identification purposes in ecological and clinical microbial studies, the WC-MALDI-TOF MS approach is a good method of choice, because it is fast and accurate when the reference database is complete.

9. Environmental microbiota may represent an important reservoir of genetic

determinants of antimicrobial resistance (i.e., class 1 integron harboring blaVIM- 13). Sewage waters can be considered a collecting point where many different species, including potential pathogens, like P. aeruginosa, exist and those genetic determinants might be transferred among them.

151

Conclusions

10. Based on the genotypic and phenotypic data, including genomic DNA-DNA hybridization results, strains CS39 and CS41, isolated from sewage water of the Hospital Son Llàtzer in Mallorca, were classified as members of Brevundimonas diminuta species. Strain CS20.3T, isolated also from sewage water of Hospital Son Llàtzer, represents a novel species in the genus Brevundimonas for which the name B. faecalis is proposed. These three isolates, CS20.3T, CS39 and CS41, were the first described Brevundimonas isolates carrying carbapenem resistance

genes (blaVIM-13 metallo--lactamase genes).

152

References

Abraham W-R, Strömpl C, Meyer H, Lindholst S, Moore ERB, Christ R, Vancanneyt M, Tindall BJ, Bennasar A, Smit J, Tesar M. 1999. Phylogeny and polyphasic taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis maris (Poindexter) comb. nov. as the type species, and emended description of the genera Brevundimonas and Caulobacter. International Journal of Systematic Bacteriology 49, 1053-1073. Abraham W-R, Estrela AB, Nikitin DI, Smit J, Vancanneyt M. 2010. Brevundimonas halotolerans sp. nov., Brevundimonas poindexterae sp. nov. and Brevundimonas staleyi sp. nov., prosthecate bacteria from aquatic habitats. International Journal of Systematic and Evolutionary Microbiology 60, 1837-1843. Amoozegar MA, Shahinpei A, Sephay AA, Makhdoumi-Kakhki A, Seyedmahdi S, Schumann P, Ventosa A. 2014. Pseudomonas salegens sp. nov., a halophilic member of the genus Pseudomonas isolated from a wetland. International Journal of Systematic and Evolutionay Microbiology 64, 3565-3570. Anzai Y, Kim H, Park J, Wakabayashi H, Oyaizu H. 2000. Phylogenetic affiliation of the pseudomonads based on 16S rRNA sequence. International Journal of Systematic and Evolutionary Microbiology 50, 1563-1589. Ballard RW, Doudoroff M, Stanier RY. 1968. Taxonomy of the aerobic Pseudomonads: Pseudomonas diminuta and Pseudomonas vesiculare. Journal of General Microbiology 53, 349-361. Ballows A, Hausler WJ, Herrmann KL, Isenberg HD, Shadomy HJ. 1991. Manual of Clinical Microbiology. 5th edition. Bennasar A, Rosselló-Mora R, Lalucat J, Moore ER. 1996. 16S rRNA gene sequence analysis relative to genomovars of Pseudomonas stutzeri and proposal of Pseudomonas balearica sp. nov. International Journal of Systematic Bacteriology 46, 200-205. Bennasar A, Guasp C, Lalucat J. 1998. Molecular methods for the detection and identification of Pseudomonas stutzeri in pure culture and environmental samples. Microbial Ecology 35, 22-33. Bennasar A, Mulet M, Lalucat J, García-Valdés E. 2010. PseudoMLSA: a database for multigenic sequence analysis of Pseudomonas species. BMC Microbiology 10, 118-124. Bochner B. 2009. Global phenotypic characterization of bacteria. FEMS Microbiology Reviews 33, 191-205. Bosch R, García-Valdés E, Moore ERB. 1999. Genetic characterization and evolutionary implications of a chromosomally encoded naphthalene-degradation upper pathway from Pseudomonas stutzeri AN10. Gene 236,149-157. Bosch R, García-Valdés E, Moore ERB. 2000. Complete nucleotide sequence and evolutionary significance of a chromosomally encoded naphthalene degradation lower pathway from Pseudomonas stutzeri AN10. Gene 245, 65-74. Bosshard PP, Zbinden R, Abels S, Böddinghaus B, Altwegg M, Böttger EC. 2006. 16S rRNA gene sequencing versus the API 20 NE system and the VITEK 2 ID-

155

References

GNB card for identification of nonfermenting Gram-negative bacteria in the clinical laboratory. Journal of Clinical Microbiology 44, 1359-1366. Brenner DJ, Staley JT, Krieg NR. 2001. Classification of prokaryotic species and the concept of bacterial speciation. In Garrity GM (ed.), Bergey's manual of systematic bacteriology, 2nd ed., vol. I, p. 27-31. Springer, New York, N.Y. Brunet-Galmés I, Busquets A, Peña A, Gomila M, Nogales B, García-Valdés E, Lalucat J, Bennasar A, Bosch R. 2012. Complete genome sequence of the naphthalene-degrading bacterium Pseudomonas stutzeri AN10 (CCUG 29243). Journal of Bacteriology 194, 6642-6643. Bull CT, Clarke CR, Cai R, Vinatzer BA, Jardini TM, Koike ST. 2011. Multilocus sequence typing of Pseudomonas syringae sensu lato confirms previously described genomospecies and permits rapid identification of P. syringae pv. coriandricola and P. syringae pv. apii causing bacterial leaf spot on parsley. Phytopathology 101, 847- 858. Busquets A, Peña A, Gomila M, Bosch R, Nogales B, García-Valdés E, Lalucat J, Bennasar A. 2012. Genome sequence of Pseudomonas stutzeri strain JM300 (DSM 10701), a soil isolate and model organism for natural transformation. Journal of Bacteriology 194, 5477-5478. Büsing KH, Doll W, Freytag K. 1953. Die Bakterienflora der medizinische Blutegel. Archiv für Mikrobiologie 19, 52-86. Campos VL, Valenzuela C, Yarza P, Kämpfer P, Vidal R, Zaror C, Mondaca MA, Lopez-Lopez A, Rosselló-Móra R. 2010. Pseudomonas arsenicoxydans sp. nov., an arsenite-oxidizing strain isolated from the Atacama desert. Systematic and Applied Microbiology 334, 193-197. Caraux G, Pinloche S. 2005. Permutmatrix: a graphical environment to arrange gene expression profiles in optimal linear order. Bioinformatics 21, 1280-1281. Carvalho-Assef A, Gomesi MZR, Silva ARA, Werneck L, Rodrigues CAS, Souzas MJ, Asensi MD. 2010. IMP-16 in Pseudomonas putida and Pseudomonas stutzeri: Potential reservoirs of multidrug resistance. Journal of Medical Microbiology 59, 1130-1131. Cladera AM, Bennasar A, Barceló M, Lalucat J, García-Valdés E. 2004. Comparative genetic diversity of Pseudomonas stutzeri genomovars, clonal structure, and phylogeny of the species. Journal of Bacteriology 186, 5239-5248. Cladera AM, García-Valdés E, Lalucat J. 2006a. Genotype versus phenotype in the circumscription of bacterial species: the case of Pseudomonas stutzeri and Pseudomonas chloritidismutans. Archives of Microbiology 184, 353-361. Cladera AM, Sepúlveda-Torres LC, Valens-Vadell M, Meyer J, Lalucat J, García- Valdés E. 2006b. A detailed phenotypic and genotypic description of Pseudomonas strain OX1. Systematic and Applied Microbiology 29, 422-430. Choi J-H, Kim M-S, Roh SW, Bae J-W. 2010. Brevundimonas basaltis sp. nov., isolated from black sand in Korea. International Journal of Systematic and Evolutionary Microbiology 60, 1488-1492. Christie-Oleza JA, Nogales B, Martín-Cardona C, Lanfranconi MP, Albertí S, Lalucat J, Bosch R. 2008. ISPst9, an ISL3-like insertion sequence from

156

References

Pseudomonas stutzeri AN10 involved in catabolic gene inactivation. International Microbiology 11, 101-110. De Ley J. 1992. The Proteobacteria: ribosomal rna cistron similarities and bacterial taxonomy. In: Balows A, Truper HG, Dworkin M, Harder W, Schleifer KH (Eds.), The prokaryotes, a handbook on the biology of bacteria, ecophysiology, isolation, identification and applications, 2nd edition, vol. 2, Springer, Berlin, pp. 2111-2140. De Vos P, De Ley J. 1983. Intra- and intergeneric similarities of Pseudomonas and Xanthomonas ribosomal ribonucleic acid cistrons. International Journal of Systematic Bacteriology 33, 487-509. De Vos P, Goor M, Gillis M, De Ley J. 1985. Ribosomal ribonucleic acid cistron similarities of phytopathogenic Pseudomonas species. International Journal of Systematic Bacteriology 35, 169-184. De Vos P, Van Landschoot A, Segers P, Tytgat R, Gillis M, Bauwens M, Rossau R, Goor M, Pot B, Kersters K, Lizzaraga P, De Ley J. 1989. Genotypic relationships and taxonomic localization of unclassified Pseudomonas and Pseudomonas-like strains by deoxyribonucleic acid: ribosomal ribonucleic acid hybridizations. International Journal of Systematic Bacteriology 39, 35-49. Doudoroff M, Palleroni N. 1974. Gram negative aerobic rods and cocci. Genus I. Pseudomonas Migula 1894, 23. In: Buchanan E, Gibbons NE (eds.) Bergey's Manual of Determinative Bacteriology, 8th edition, pp. 217-249. Baltimore: Williams & Wilkins. Estrela A, Abraham W-R. 2010. Brevundimonas vancanneytii sp. nov. isolated from blood of a patient with endocarditis. International Journal of Systematic and Evolutionary Microbiology 60, 2129-2134. Euzéby JP. 1997. List of names with standing in nomenclature. International Journal of Systematic Bacteriology 47, 590-592. URL: www.bacterio.cict.fr. Felsenstein J. 1989. PHYLIP-phylogeny inference package (version 3.0). Cladistics 5, 164-166. Feng Z, Zhang J, Huang X, Zhang J, Chen M, Li S. 2012. Pseudomonas zeshuii sp. nov., isolated from herbicide-contaminated soil. International Journal of Systematic and Evolutionary Microbiology 62, 2608-2612. Ferreira L, Sánchez-Juanes F, García-Fraile P, Rivas R, Mateos PF, Martínez- Molina E, González-Buitrago JM, Velázquez E. 2011. MALDI-TOF mass spectrometry is a fast and reliable platform for identification and ecological studies of species from family Rhizobiaceae. PLoS One 6(5), e20223. Fritz I, Strömpl C, Nikitin DI, Lysenko AM, Abraham W-R. 2005. Brevundimonas mediterranea sp. nov., a non-stalked species from the Mediterranean Sea. International Journal of Systematic and Evolutionary Microbiology 55, 479-486. Galarneault TP, Leifson E. 1964. Pseudomonas vesiculare (Büsing et al.) nov. comb. International Bulletin of Bacteriological Nomenclature and Taxonomy 14, 165-168. García-Valdés E, Castillo MM, Bennasar A, Guasp C, Cladera AM, Bosch R, Engesser KH, Lalucat J. 2003. Polyphasic characterization of Pseudomonas stutzeri CLN100 which simultaneously degrades chloro- and methylaromatics: a

157

References

new genomovar within the species. Systematic and Applied Microbiology 26, 390- 403. García-Valdés E, Mulet M, Lalucat J. 2010. Insights into the life styles of Pseudomonas stutzeri. In: Ramos J-L, Filloux A. (ed.), Pseudomonas, Molecular Microbiology, Infection and Biodiversity. Springer Press, USA. Vol.6: 177-198. Gavini F, Holmes B. Izard D, Beji A, Bernigaud A, Jakubczak E. 1989. Numerical taxonomy of Pseudomonas alcaligenes, P. pseudoalcaligenes, P. mendocina, P. stutzeri and related bacteria. International Journal of Systematic Bacteriology 39, 135-144. Gevers D, Coenye T (2007). Phylogenetic and genomic analysis. In: Hurst C, Crawford RL, Garland JL, Lipson DA, Mills AL, Stenzenbach L (eds.), Manual of Environmental Microbiology, 3rd ed., pp. 157-68. ASM Press Whashington DC. Gibello A, Vela AI, Martín M, Mengs G, Alonso PZ, Garbi C, Fernández- Garayzábal JF. 2011. Pseudomonas composti sp. nov., isolated from compost samples. International Journal of Systematic and Evolutionary Microbiology 61, 2962–2966. Gilad J, Borer A, Peled N, Riesenberg K, Tager S, Appelbaum A, Schlaeffer F. 2000. Hospital-acquired Brevundimonas vesicularis septicaemia following open- heart surgery: case report and literature review. Scandinavian Journal of Infectious Diseases 32, 90-91. Grimaldi D, Podglajen I, Aubert A, Buu-Hoï A, Diebold B, Mainardi JL. 2009. Case of indolent endocarditis due to Pseudomonas stutzeri with genetic evidence of relapse after 4 years. Journal of Clinical Microbiology 47, 503-504. Gomila M, Gascó J, Busquets A, Gil J, Bernabeu R, Buades JM, Lalucat J. 2005. Identification of culturable bacteria present in hemodialysis water and fluid. FEMS Microbiology Ecology 52, 101-114. Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. 2007. DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. International Journal of Systematic and Evolutionary Microbiology 57, 81-91. Gould WD, Hagedorn C, Bardinelli TR, Zablotowicz RM. 1985. New selective media for enumeration and recovery of fluorescent pseudomonads from various habitats. Applied and Environmental Microbiology 49, 28-32. Gray PHH, Thornton HG. 1928. Soil bacteria that decompose certain aromatic compounds. Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. II. 73, 74-96. Guasp C, Moore ER, Lalucat J, Bennasar A. 2000. Utility of internally transcribed 16S-23S rDNA spacer regions for the definition of Pseudomonas stutzeri genomovars and other Pseudomonas species. International Journal of Systematic and Evolutionary Microbiology 50, 1629-1639. Gutiérrez O, Juan C, Cercenado E, Navarro F, Bouza E, Coll P, Pérez JL, Oliver A. 2007. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Spanish hospitals. Antimicrobial Agents and Chemotherapy 51, 4329-4335.

158

References

Guttman DS, Morgan RL, Wang PW. 2008. The evolution of Pseudomonads. In: Fatmi M'B, Collmer A, Iacobellis NS, Mansfield JW, Murillo J, Schaad NW, Ullrich M. (Eds.), Pseudomonas syringae pathovars and related pathogens. Identification, Epidemiology and Genomics. Biomedical and Life Sciences, Springer, Netherlands, pp. 307-319. Hammer Ø, Harper DAT, Ryan PD. 2001. PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4, 9pp. Han XY, Andrade RA. 2005. Brevundimonas diminuta infections and its resistance to fluoroquinolones. Journal of Antimicrobial Chemotherapy 55, 853-859. Héritier C, Poirel L, Aubert D, Nordmann P. 2003.Genetic and functional analysis of the chromosome-encoded carbapenem-hydrolyzing oxacillinase OXA-40 of Acinetobacter baumannii. Antimicrob. Agents Chemother.47:268-273. Hilario E, Buckley TR, Young JM. 2004. Improved resolution on the phylogenetic relationships among Pseudomonas by the combined analysis of atpD, carA, recA and 16S rDNA. Antonie van Leeuwenhoek 86, 51-64. Holmes B. 1986. Identification and distribution of Pseudomonas stutzeri in clinical material. Journal of Applied Bacteriology 60, 401-411. Holmes AJ, Holley MP, Mahon A, Nield B, Gillings M, Stokes HW. 2003. Recombination activity of a distinctive integron-gene cassette system associated with Pseudomonas stutzeri populations in soil. Journal of Bacteriology 185, 918- 928. Hotta Y, Teramoto K, Sato H, Yoshikawa H, Hosoda A, Tamura H. 2010. Classification of genus Pseudomonas by MALDI-TOF MS based on ribosomal protein coding in S10-spc-alpha operon at strain level. Journal of Proteome Research 9, 6722-6728. Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, Ecker DJ, Massire C, Eshoo MW, Sampath R, Thomson JM, Rather PN, Craft DW, Fishbain JT, Ewell AJ, Jacobs MR, Paterson DL, Bonomo RA. 2006. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrobial Agents and Chemotherapy 50, 4114-4123. Juan C, Beceiro A, Gutiérrez O, Albertí S, Garau M, Pérez JL, Bou G, Oliver A. 2008. Characterization of the new metallo-beta-lactamase VIM-13 and its integron- borne gene from a Pseudomonas aeruginosa clinical isolate in Spain. Antimicrobial Agents and Chemotherapy 52, 3589-3596. Juan C, Zamorano L, Mena A, Albertí S, Pérez JL, Oliver A. 2010. Metallo-beta- lactamase-producing Pseudomonas putida as a reservoir of multidrug resistance elements that can be transferred to successful Pseudomonas aeruginosa clones. Journal of Antimicrobial Chemotherapy 65, 474-478. Jukes TH, Cantor CR. 1969. Evolution of protein molecules. In: Munro HN (ed), Mammalian protein metabolism (vol. 3). Academic Press, Inc., New York, NY, pp 21-132. Kallow W, Erhard M, Shah HN, Raptakis E, Welker M. 2010. MALDI-TOF MS for microbial identification: years of experimental development to an established

159

References

protocol. In: Shah HN, Gharbia SE, Encheva V (eds), Mass Spectrometry for Microbial Proteomics, John Wiley & Sons, London, pp 255-277. Kaneko H, Inoue A, Horikoshi K. 2000. Effects of hydrostatic pressure and temperature on growth and lipid composition of the inner membrane of barotolerant Pseudomonas sp. BT1 isolated from deep sea. Bioscience, Biotechnology and Biochemistry 64, 72-79. Kang S-J, Choi N-S, Choi JH, Lee J-S, Yoon J-H, Song JJ. 2009. Brevundimonas naejangsanensis sp. nov., a proteolytic bacterium isolated from soil, and reclassification of Mycoplana bullata into the genus Brevundimonas as Brevundimonas bullata comb. nov. International Journal of Systematic and Evolutionary Microbiology 59, 3155-3160. Kiil K, Binnewies TT, Willenbrock H, Kirkelund Hansen S, Yang L, Jelsbak L, Ussery DW, Friis C. 2008. Comparative genomics of Pseudomonas, chapter 1. In: Bernd HA (Eds), Pseudomonas. Model Organism, Pathogen, Cell Factory. Edited by Bernd H.A. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. Rehm. King EO. 1954. The simple media for the demonstration of pyocyanin and fluorescin. The Journal of Laboratory Clinical Medicine 44, 301-307. Kiprianova EA, Klochko VV, Zelena LB, Churkina LN, Avdeeva LV. 2011. Pseudomonas batumici sp. nov., the antibiotic-producing bacteria isolated from soil of the caucasus black sea coast. Mikrobiolohichnyî Zhurnal 73, 3-8. Köse M, Öztürk M, Kuyucu T, Günes T, Akcakus M, Sümerkan B. 2004. Community-acquired pneumonia and empyema caused by Pseudomonas stutzeri: case report. The Turkish Journal of Pediatrics 46, 177-178. Kunitsky C, Osterhout G, Sasser M. 2005. Identification of microorganisms using fatty acid methyl esters (FAME) analysis and the MIDI Sherlock® microbial identification system. In: Miller MJ (Ed.), Encyclopedia of rapid microbiological methods, volume 1. PDA/DHI, United States. Lalucat J. 1988. Analysis of Refractile (R) Bodies. In: Mayer E (Ed.), Methods in Microbiology - Electron Microscopy in Microbiology (vol. 20). Academic Press, London, pp. 79–90. Lalucat J, Bennasar A, Bosch R, García-Valdés E, Palleroni N. 2006. Biology of Pseudomonas stutzeri. Microbiology and Molecular Biology Reviews 70, 510-547. Lane DJ. 1991. 16S/23S rRNA sequencing In: Stackebrand E, Goodfellow M (eds.). Nucleic Acid Techniques in Bacterial Systematics Wiley, Chichester. Lang E, Burghartz M, Spring S, Swiderski J, Spröer C. 2010. Pseudomonas benzenivorans sp. nov. and Pseudomonas saponiphila sp. nov., represented by xenobiotics degrading type strains. Current Microbiology 60, 85-91. Lauretti L, Riccio ML, Mazzario A, Cornaglia G, Amicosante G, Fontana R, Rossolini GM. 1999. Cloning and characterization of blaVIM, a new integron-borne metallo-β-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrobial Agents and Chemotherapy 43, 1584-1590. Leifson E, Hugh R. 1954. A new type of polar monotrichous flagellation. Journal of General Microbiology 10, 68-70.

160

References

Lévesque C, Piché L, Larose C, Roy PH. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrobial Agents and Chemotherapy 39, 185-191. Li Y, Kawamura Y, Fujiwara N, Naka T, Liu H, Huang X, Kobayashi K, Ezaki T. 2004. Sphingomonas yabuuchiae sp. nov. and Brevundimonas nasdae sp. nov., isolated from the Russian space laboratory. International Journal of Systematic and Evolutionary Microbiology 54, 819-825. Loonen AJM, Jansz AR, Stalpers J, Wolffs PFG, van den Brule AJC. 2012. An evaluation of three processing methods and the effect of reduced culture times for faster direct identification of pathogens from BacT/ALERT blood cultures by MALDI-TOF MS. European Journal of Clinical Microbiology Infectious Disease 31, 1575-1583. López JR, Diéguez AL, Doce A, de la Roca E, de la Herran R, Navas JI, Toranzo AE, Romalde JL. 2011. Pseudomonas baetica sp. nov., a novel fish pathogen isolated from wedge sole, Dicologoglossa cuneata (Moreau). International Journal of Systematic and Evolutionary Microbiology 62, 874-882. Manfredi R, Nanetti A, Ferri M, Chiodo F. 2000. Pseudomonas spp. complications in patients with HIV disease: an eight-year clinical and microbiological survey. European Journal of Epidemiology 16, 111-118. Manickam N, Ghosh A, Jain RK, Mayilraj S. 2008. Description of a novel indole- oxidizing bacterium Pseudomonas indoloxydans sp. nov., isolated from a pesticide- contaminated site. Systematic and Applied Microbiology 31, 101-107. Marmur J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. Journal of Molecular Biology 3, 208-218. Metcalf WW, Wolfe RS. 1998. Molecular genetic analysis of phosphite and hypophosphite oxidation by Pseudomonas stutzeri WM88. Journal of Bacteriology 180, 5547-5558. Migula W. 1895. Bacteriaceae (Stabchenbacterien). In: Engler A, Prantil K (Eds.) Die Naturlichen Pfanzenfamilien. Leipzig, W Engelmann, Leipzig, Teil I, Abteilung Ia. pp. 20-30. Migula W. 1900. System der Bakterien. Handbuck der Morphologie, Entwickelung- geschichte und Systematik der Bakterien, vol. 2. Verlag von Gustav Fischer, Jena, pp. 875-954. Miller J. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Millar BC, Xu J, Moore JE. 2007. Molecular Diagnostics of Medically Important Bacterial Infections. Current Issues in Molecular Biology 9, 21-40. Moore ERB, Mua M, Arnscheidt A, Böttger EC, Hutson RA, Collins MD, Van De Peer Y, De Wachter R, Timmis KN. 1996. The determination and comparison of the 16S rDNA gene sequences of species of the genus Pseudomonas (sensu stricto) and estimation of the natural intrageneric relationships. Systematic and Applied Microbiology 19, 476-492.

161

References

Moya B, Dötsch A, Juan C, Blázquez J, Zamorano L, Haussler S, Oliver A. 2009. Beta-lactam resistance response triggered by inactivation of a nonessential penicillin-binding protein. PLos Pathogens 5(3), e1000353. Mulet M, Gomila M, Gruffaz C, Meyer JM, Palleroni NJ, Lalucat J, García- Valdés E. 2008. Phylogenetic analysis and siderotyping as useful tools in the taxonomy of Pseudomonas stutzeri: description of a novel genomovar. International Journal of Systematic and Evolutionary Microbiology 58, 2309-2315. Mulet M, Bennasar A, Lalucat J, García-Valdés E. 2009. An rpoD-based PCR procedure for the identification of Pseudomonas species and for their detection in environmental samples. Molecular and Cellular Probes 23, 140-147. Mulet M, Lalucat J, García-Valdés E. 2010. DNA sequence-based analysis of the Pseudomonas species. Environmental Microbiology 12, 1513-1530. Mulet M, David Z, Nogales B, Bosch R, Lalucat J, García-Valdés E. 2011. Pseudomonas diversity in crude-oil-contaminated intertidal sand samples obtained after the Prestige oil spill. Applied and Environmental Microbiology 77, 1076-1085. Mulet M, Gomila M, Lemaitre B, Lalucat J, García-Valdés E. 2012a. Taxonomic characterization of Pseudomonas strain L48 and formal proposal of Pseudomonas entomophila sp. nov. Systematic and Applied Microbiology 35, 145-149. Mulet M, Gomila M, Scotta C, Sánchez D, Lalucat J, García-Valdés E. 2012b. Concordance between whole-cell matrix-assisted laser-desorption/ionization time- of-flight mass spectrometry and multilocus sequence analysis approaches in species discrimination within the genus Pseudomonas. Systematic and Applied Microbiology 35, 455-464. Muñoz R, López-López A, Urdiain M, Moore ERB, Rosselló-Móra R. 2011. Evaluation of matrix-assisted laser desorption ionization-time of flight whole cell profiles for assessing the cultivable diversity of aerobic and moderately halophilic prokaryotes thriving in solar saltern sediments. Systematic and Applied Microbiology 34, 69-75. Oberhelman RA, Humbert JR, Santorelli FW. 1994. Pseudomonas vesicularis causing bacteraemia in a child with sickle cell anaemia. Southern Medical Journal 87, 821-822. Obradors N, Aguilar J. 1991. Efficient biodegradation of high-molecular-weight polyethylene glycols by pure cultures of Pseudomonas stutzeri. Applied and Environmental Microbiology 57, 2383-2388. O´Hara C, Westbrook GL, Miller M. 1997. Evaluation of Vitek GNI+ and Becton Dickinson microbiology systems crystal E/NF identification systems for identification of members of the Family Enterobacteriaceae and other Gram- negative, glucose fermenting and non-glucose-fermenting bacilli. Journal of Clinical Microbiology 35, 3269-3273. Page RDM. 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358. Palleroni NJ, Doudoroff M, Stanier RY, Solanes RE, Mandel M. 1970. Taxonomy of the aerobic pseudomonads: the properties of the Pseudomonas stutzeri group. Journal of General Microbiology 60, 215-231.

162

References

Palleroni NJ. 1984. Genus I. Pseudomonas Migula 1894. In: Krieg NR, Holt JG. (Eds.), Bergey's Manual of Systematic Bacteriology, vol. 1, Williams & Wilkins, Baltimore, MD, pp. 141-199. Palleroni NJ, Moore ERB. 2004. Pseudomonas. Volume 1 Genomics, Life Style and Molecular Architecture, p 3-44. Ed. Ramos JL. Springer US Palleroni NJ. 2005. Pseudomonas. In: Brenner DJ, Krieg NR, Staley JT. (Eds.), Bergey's Manual of Systematic Bacteriology, 2nd ed, vol. 2, Springer, New York, NY, pp. 323-379. Pascual J, Lucena T, Ruvira MA, Giordano A, Gambacorta A, Garay E, Arahal DR, Pujalte MJ, Macián MC. 2012. Pseudomonas litoralis sp. nov., isolated from Mediterranean seawater. International Journal of Systematic and Evolutionary Microbiology 62, 438-444. Parkinson N, Bryant R, Bew J, Elphinstone J. 2011. Rapid phylogenetic identification of members of the Pseudomonas syringae species complex using the rpoD locus. Plant Pathology 60, 338-344. Peña A, Busquets A, Gomila M, Bosch R, Nogales B, García-Valdés E, Lalucat J, Bennasar A. 2012. Draft genome of Pseudomonas stutzeri strain ZoBell (CCUG 16156), a marine isolate and model organism for denitrification studies. Journal of Bacteriology 194, 1277-1278. Peix A, Valverde A, Rivas R, Igual JM, Ramírez-Bahena MH, Mateos PF, Santa- Regina I, Rodríguez-Barrueco C, Martínez-Molina E, Velázquez E. 2007. Reclassification of Pseudomonas aurantiaca as a synonym of Pseudomonas chlororaphis and proposal of three subspecies, P. chlororaphis subsp. chlororaphis subsp. nov., P. chlororaphis subsp. aureofaciens subsp. nov., comb. nov. and P. chlororaphis subsp. aurantiaca subsp. nov., comb. nov. International Journal of Systematic and Evolutionary Microbiology 57, 1286–1290. Peix A, Ramirez-Bahena MH, Velázquez E. 2009. Historical evolution and current status of the taxonomy of genus Pseudomonas. Infection, Genetics and Evolution 9, 1132–1147. Planes AM, Ramírez A, Fernández F, Capdevilla JA, Tolosa C. 1992. Pseudomonas vesicularis bacteraemia. Infection 20, 367-368. Poindexter JS. 1964. Biological properties and classification of the Caulobacter group. Bacteriological Reviews 28, 231-295. Poirel L, Naas T, Nicolas D, Collet L, Bellais S, Cavallo JD, Nordmann P. 2000. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrobial Agents and Chemotherapy 44, 891-897. Poirel L, Rodríguez JM, Naiemi NA, Debets-Ossenkopp YJ, Nordmann P. 2010. Characterization of DIM-1, an integron-encoded metallo-β-lactamase from a Pseudomonas stutzeri clinical isolate in the Netherlands. Antimicrobial Agents and Chemotherapy 54, 2420-2424. Prod'hom G, Bizzini A, Durussel C, Bille J, Greub G. 2010. Matrix-assisted laser desorption ionization-time of flight mass spectrometry for direct bacterial

163

References

identification from positive blood culture pellets. Journal of Clinical Microbiology 48, 1481-1483. Quinteira S, Ferreira H, Peixe L. 2005. Fist isolation of blaVIM-2 in an environmental isolate of Pseudomonas pseudoalcaligenes. Antimicrobial and Agents Chemotherapy 49, 2140-2141. Quinteira S, Peixe L. 2006. Multiniche screening reveals the clinically relevant metallo-beta-lactamase VIM-2 in Pseudomonas aeruginosa far from the hospital setting: and ongoing dispersion process? Applied and Environmental Microbiology 72, 3743-3745. Ramette A, Frapolli M, Fischer-Le Saux M, Gruffaz C, Meyer JM, Défago G, Sutra L, Moënne-Loccoz Y. 2011. Pseudomonas protegens sp. nov., widespread plant-protecting bacteria producing the biocontrol compounds 2,4- diacetylphloroglucinol and pyoluteorin. Systematic and Applied Microbiology 34, 180-188. Ramírez- Bahena MH, Cuesta MJ, Flores-Félix JD, Mulas R, Rivas RL, Castro- Pinto J, Brañas J, Mulas D, Gonzáles-Andrés F, Velázques E, Peix A. 2014. Pseudomonas helmanticensis sp. nov., isolated from forest soil. International Journal of Systematic and Evolutionary Microbiology 64, 2338-2345. Romanenko LA, Uchino M, Falsen E, Lysenko AM, Zhukova NV, Mikhailov VV. 2005. Pseudomonas xanthomarina sp. nov., a novel bacterium isolated from marine ascidian. Journal of General and Applied Microbiology 51, 65-71. Roselló R, García-Valdés E, Lalucat J, Ursing J. 1991. Genotypic and phenotypic diversity of Pseudomonas stutzeri. Systematic and Applied Microbiology 14, 150- 157. Roselló-Mora RA, Lalucat J, Dott W, Kämpfer P. 1994. Biochemical and chemotaxonomic characterization of Pseudomonas stutzeri genomovars. Journal of Applied Microbiology 76, 226-233. Rosselló-Mora RA, Lalucat J, Moore ERB. 1996. Strain JM300 represents a new genomovar within Pseudomonas stutzeri. Systematic and Applied Microbiology 19, 596-599. Rozas J, Rozas R. 1999. DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15, 174-175. Ryu SH, Park M, Lee JR, Yun P-Y, Jeon CO. 2007. Brevundimonas aveniformis sp. nov., a stalked species isolated from activated sludge. International Journal of Systematic and Evolutionary Microbiology 57, 1561-1565. Sader HS, Jones RN. 2005. Antimicrobial susceptibility of uncommonly isolated non- enteric Gram-negative bacilli. International Journal of Antimicrobial Agents 25, 95- 109. Saha R, Spröer C, Bec B, Bagley S. 2010. Pseudomonas oleovorans subsp. lubricantis subsp. nov., and reclassification of Pseudomonas pseudoalcaligenes ATCC 17440T as later synonym of Pseudomonas oleovorans ATCC 8062T. Current Microbiology 60, 294–300. Sánchez D, Mulet M, Rodríguez AC, David Z, Lalucat J, García-Valdés E. 2014. Pseudomonas aestusnigri sp. nov., isolated from crude oil-contaminated intertidal

164

References

sand samples after the Prestige oil spill. Systematic and Applied Microbiology 37, 89-94. Santos SR, Ochman H. 2004. Identification and phylogenetic sorting of bacterial lineages with universally conserved genes and proteins. Environmental Microbiology 6, 754-759. Scotta C, Bennasar A, Moore ER, Lalucat J, Gomila M. 2011. Taxonomic characterisation of ceftazidime-resistant Brevundimonas isolates and description of Brevundimonas faecalis sp. nov. Systematic and Applied Microbiology 34, 408-413. Scotta C, Mulet M, Sánchez D, Gomila M, Ramírez A, Bennasar A, García-Valdés E, Holmes B, Lalucat J. 2012. Identification and genomovar assignation of clinical strains of Pseudomonas stutzeri. European Journal of Clinical Microbiology and Infectious Disease 31, 2133-2139. Segers P, Vancanneyt M, Pot B, Torck U, Hoste B, Dewettinck D, Falsen E, Kersters K, De Vos P. 1994. Classification of Pseudomonas diminuta Leifson and Hugh 1954 and Pseudomonas vesicularis Büsing, Döll, and Freytag 1953 in Brevundimonas gen. nov. as Brevundimonas diminuta comb. nov. and Brevundimonas vesicularis comb. nov., respectively. International Journal of Systematic Bacteriology 44, 499-510. Sepúlveda-Torres LC, Zhou JZ, Guasp C, Lalucat J, Knaebel D, Plank JL, Criddle CS. 2001. Pseudomonas sp. strain KC represents a new genomovar within Pseudomonas stutzeri. International Journal of Systematic and Evolutionary Microbiology 51, 2013-2019. Sikorski J, Graupner S, Lorenz MG, Wackernagel W. 1998. Natural genetic transformation of Pseudomonas stutzeri in a non-sterile soil. Microbiology 144, 569-576. Sikorski J, Möhle M, Wackernagel W. 2002. Identification of complex composition, strong strain diversity and directional selection in local Pseudomonas stutzeri populations from marine sediment and soils. Environmental Microbiology 4, 465- 476. Sikorski J, Lalucat J, Wackernagel W. 2005. Genomovars 11 to 18 of Pseudomonas stutzeri identified among isolates from soil and marine sediment. International Journal of Systematic and Evolutionary Microbiology 55, 1767-1770. Silby MW, Winstanley C, Godfrey SAC, Levy SB, Jackson RW. 2011. Pseudomonas genomes: diverse and adaptable. FEMS Microbiology Reviews 35, 652-680. Soler L, Marco F, Vila J, Chacón MR, Guarro J, Figueres J. 2003. Evaluation of two miniaturized systems, MicroScan W/A and BBL Crystal E/NF, for the identification of clinical isolates of Aeromonas spp. Journal of Clinical Microbiology 41, 5732-5734. Song B, Palleroni NJ, Häggblom M. 2000. Isolation and characterization of diverse halobenzoate-degrading denitrifying bacteria from soils and sediments. Applied and Environmental Microbiology 66, 3446-3453. Spiers AJ, Buckling A, Rainey PB. 2000. The causes of Pseudomonas diversity. Microbiology 146, 2345-2350.

165

References

Stanier RY, Palleroni NJ, Doudoroff M. 1966. The aerobic Pseudomonads: a taxonomic study. Journal of General Microbiology 43, 159-271. Takami H, Kobata K Nagahama T, Kobayashi H, Inoue A, Horikoshi K. 1999. Biodiversity in deep-sea sites located near the south part of Japan. Extremophiles 3, 97-102. Tamegai H, Li L, Masui N, Kato C. 1997. A denitrifying bacterium from the deep sea at 11,000-m depth. Extremophiles 1, 207-211. Tan RJS, Lim EW, Sakazaki R. 1977. Unusual cause of urinary-tract infection by Pseudomonas stutzeri in Singapore. Japanese Journal of Experimental Medicine 47, 311-313. Tao Y, Zhou Y, He X, Hu X, Li D. 2014. Pseudomonas chengduensis sp. nov., isolated from landfill leachate. International Journal of Systematic and Evolutionary Microbiology 64, 95-100. Tayeb L, Ageron E, Grimont F, Grimont PA. 2005. Molecular phylogeny of the genus Pseudomonas based on rpoB sequences and application for the identification of isolates. Research in Microbiology 156, 763-773. Tayeb LA, Lefevre M, Passet V, Diancourt L, Brisse S, Grimont PAD. 2008. Comparative phylogenies of Burkholderia, Ralstonia, Comamonas, Brevundimonas and related organisms derived from rpoB, gyrB and rrs gene sequences. Research in Microbiology 159, 169-177. Teramoto K, Sato H, Sun L, Torimura M, Tao H, Yoshikawa H, Hotta Y, Hosoda A, Tamura H. 2007. Phylogenetic classification of Pseudomonas putida strains by MALDI-MS using ribosomal subunit proteins as biomarkers. Analytical Chemistry 79, 8712-8719. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882. Tourkya B, Boubellouta T, Dufour E, Leriche F. 2009. Fluorescence spectroscopy as a promising tool for a polyphasic approach to pseudomonad taxonomy. Current Microbiology 58, 39-46. Urdiain M, López-López A, Gonzalo C, Busse HJ, Langer S, Kämpfer P, Rosselló- Móra R. 2008. Reclassification of Rhodobium marinum and Rhodobium pfennigii as Afifella marina gen. nov. comb. nov. and Afifella pfennigii comb. nov., a new genus of photoheterotrophic Alphaproteobacteria and emended descriptions of Rhodobium, Rhodobium orientis and Rhodobium gokarnense. Systematic and Applied Microbiology 31, 339-351. Vaisvila R, Morgan RD, Posfai J, Raleigh EA. 2001. Discovery and distribution of super-integrons among Pseudomonads. Molecular Microbiology 42, 587-601. Vancanneyt M, Torck U, Dewettinck D, Vaerewijck M, Kersters K. 1996. Grouping of pseudomonads by SDS-PAGE of whole-cell proteins. Systematic and Applied Microbiology 19, 556-568. van Niel CB, Allen MB. 1952. A note on Pseudomonas stutzeri. Journal of Bacteriology 64, 413-422.

166

References

Varghaa M, Takátsb Z, Konopkac A, Nakatsua CH. 2006. Optimization of MALDI- TOF MS for strain level differentiation of Arthrobacter isolates. Journal of Microbiological Methods 66, 399-409. Veeranagouda Y, Lee K, Cho AR, Cho K, Anderson EM, Lam JS. 2011. Ssg, a putative glycosyltransferase, functions in lipo- and exopolysaccharide biosynthesis and cell surface-related properties in Pseudomonas alkylphenolia. FEMS Microbiology Letters 315, 38-45. Vermeiren H, Willems A, Schoofs G, de Mot R, Keijers V, Hai WL, Vanderleyden J. 1999. The rice inoculant strain Alcaligenes faecalis A15 is a nitrogen-fixing Pseudomonas stutzeri. Systematic and Applied Microbiology 22, 215-224. Versalovic J, Koeuth T, Lupski JR. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Research 19, 6823-6831. Walsh RT, Toleman MA, Poirel L, Nordmann P. 2005. Metallo-beta-lactamases: the quiet before the storm? Clinical Microbiology Reviews 18, 306-325. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173, 697-703. Welker M, Moore ERB. 2011. Applications of whole-cell matrix-assisted laser- desorption/ionization time-of-flight mass spectrometry in systematic microbiology. Systematic and Applied Microbiology 34, 2-11. Wellinghausen N, Köthe J, Wirths B, Sigge A, Poppet S. 2005. Superiority of molecular techniques for identification of gram-negative, oxidase-positive rods, including morphologically nontypical Pseudomonas aeruginosa, from patients with cystic fibrosis. Journal of Clinical Microbiology 43, 4070-4075. Wilson K. 1987. Preparation of genomic DNA from bacteria. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds), Current Protocols in Molecular Biology, John Wiley & Sons, New York, pp 241–242. Xie F, Ma H, Quan S, Liu D, Chen G, Chao Y, Qian S. 2014. Pseudomonas kunmingensis sp. nov., a novel exopolysaccharides-producing bacterium isolated from a phosphate mine. International Journal of Systematic and Evolutionary Microbiology 64, 559-564. Yamamoto S, Kasai H, Arnold DL, Jackson RW, Vivian A, Harayama S. 2000. Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the nucleotide sequences of gyrB and rpoD genes. Microbiology 146, 2385-2394. Yan JJ, Hsueh PR, Ko WC, Luh KT, Tsai SH, Wu HM, Wu JJ. 2001. Metallo-β- Lactamases in clinical Pseudomonas isolates in Taiwan and identification of VIM-3, a novel variant of the VIM-2 enzyme. Antimicrobial Agents and Chemotherapy 45, 2224-2228. Yan Y, Yang J, Dou Y, Chen M, Ping S, Peng J, Lu W, Zhang W, Yao Z, Li H, Liu W, He S, Geng L, Zhang X, Yang F, Yu H, Zhan Y, Li D, Lin Z, Wang Y, Elmerich C, Lin M, Jin Q. 2008. Nitrogen fixation island and rhizophere competence traits in the genome of root-associated Pseudomonas stutzeri A1501. Proceedings of the National Academy of Science of the United States of America 21, 7564-7569.

167

References

Yoon J-H, Kang S-J, Oh HW, Lee J-S, Oh T-K. 2006a. Brevundimonas kwangchunensis sp. nov., isolated from an alkaline soil in Korea. International Journal of Systematic and Evolutionary Microbiology 56, 613-617. Yoon J-H, Kang S-J, Lee J-S, Oh T-K. 2006b. Brevundimonas terrae sp. nov., isolated from an alkaline soil in Korea. International Journal of Systematic and Evolutionary Microbiology 56, 2915-2919. Yoon J-H, Kang S-J, Lee J-S, Oh HW, Oh T-K. 2007. Brevundimonas lenta sp. nov., isolated from soil. International Journal of Systematic and Evolutionary Microbiology 57, 2236-2240. Yu H, Yuan M, Lu W, Yang J, Dai S, Li Q, Yang Z, Dong J, Sun L, Deng Z, Zhang W, Chen M, Ping S, Han Y, Zhan Y, Yan Y, Jin Q, Lin M. 2011. Complete genome sequence of the nitrogen-fixing and rhizosphere-associated bacterium Pseudomonas stutzeri strain DSM 4166. Journal of Bacteriology 193, 3422-3423. Ziemke F, Höfle MG, Lalucat J, Rosselló-Mora R. 1998. Reclassification of Shewanella putrefaciens Owen’s genomic group II as Shewanella baltica sp. nov. International Journal of Systematic Bacteriology 48, 179-186. Zobell CE, Upham HC. 1944. A list of marine bacteria including description of sixty species. Contribution from the Scripps Institution of Oceanography 5, 239-292.

168