Caedibacter taeniospiralis-rebC homologues intherespectivestrains, whileredcirclesindicate itsabsence. (shown inpurple). Greencirclesat theendofeachbranch indicatethepresence ofFecI2 designation “RebP”to Reborthologsthatclusterwith C. taeniospiralis al pseudomonads represented inFigure1aandcompletegenomes Figure6ofRaymann Supplementary Figure 1. . 1 . C. taeniospiralis
Stenotrophomonas maltophilia R551-3-rebB
Xanthomonas axonopodis pv. citri str. 306-reb4
Xanthomonas axonopodis pv. citri str. 306-reb3 Burkholderia ambifaria AMMD-reb4 AMMD-reb4 ambifaria Burkholderia
Azospirillum brasilense Sp245-reb1 Azospirillum brasilense Sp245-reb2 RebD andits
Burkholderia glumae BGR1-reb3 Burkholderia gladioli BSR3-reb1
Burkholderia gladioli BSR3-reb2 Burkholderia glumae BGR1-reb5 taeniospiralis-rebD Caedibacter RebA, RebB,andRebC arehighlightedinyellow. The cluster containing Burkholderia pseudomallei 305-reb SIR-1-reb1 pacifica Plesiocystis Burkholderia glumae BGR1-reb4
Burkholderia mallei SAVP1-reb1 Xanthomonas axonopodis pv. citri str. 306-reb2 DSS3-reb3 pomeroyi Ruegeria
0.4 Polymorphum gilvum SL003B-26A1-reb3 SL003B-26A1-reb3 gilvum Polymorphum
Stenotrophomonas maltophilia R551-3-reb1 PA14-PA14_27685 aeruginosa Pseudomonas Burkholderia glumae BGR1-reb6
Stenotrophomonas maltophilia R551-3-rebA
Pseudomonas mucidolens LMG2223-reb3 LMG2223-reb3 mucidolens Pseudomonas Pseudomonas aeruginosa LESB58-reb3 LESB58-reb3 aeruginosa Pseudomonas
Phylogenetic treeforReb proteinsfrom38bacteria(comprisedof Pseudomonas chlororaphis B25-reb3 B25-reb3 chlororaphis Pseudomonas
Azorhizobium caulinodans-reb1 caulinodans-reb1 Azorhizobium
Pseudomonas libanensis BS2975-reb3 BS2975-reb3 libanensis Pseudomonas
Pseudomonas palleroniana BS3265-reb3 BS3265-reb3 palleroniana Pseudomonas Pseudomonas synxantha BS33R-reb3 BS33R-reb3 synxantha Pseudomonas Azorhizobium caulinodans-reb3 caulinodans-reb3 Azorhizobium
Pseudomonas Burkholderia glumae BGR1-reb2
Burkholderia gladioli BSR3-reb3 Pseudomonas antarctica BS2772-reb3 BS2772-reb3 antarctica Pseudomonas
Azospirillum brasilense Sp245-reb3 Pseudomonas fluorescens A506-reb3 A506-reb3 fluorescens Pseudomonas
Chromobacterium violaceum ATCC 12472-reb5 12472-reb5 ATCC violaceum Chromobacterium
Marinomonas mediterranea MMB1-reb4 NEP1-reb2 fluorescens Pseudomonas
Plesiocystis pacifica SIR-1-reb7 SIR-1-reb7 pacifica Plesiocystis
Rhodospirillum centenum-reb1 centenum-reb1 Rhodospirillum
Marinomonas mediterranea MMB1-reb3 pf5-reb3 protegens Pseudomonas Rhodospirillum centenum-reb5 centenum-reb5 Rhodospirillum
Shewanella denitrificans OS217-reb4
Shewanella denitrificans OS217-reb5 Rhodospirillum centenum-reb2 centenum-reb2 Rhodospirillum
Burkholderia gladioli BSR3-reb5 SIR-1-reb8 pacifica Plesiocystis Rhodospirillum centenum-reb3 centenum-reb3 Rhodospirillum orthologs isshowninblue. We haveassignedthe Azospirillum brasilense Sp245-reb4
Xanthomonas axonopodis pv. citri str. 306-reb5 centenum-reb4 Rhodospirillum
Xanthomonas axonopodis pv. citri str. 306-reb6 306-reb6 str. citri pv. axonopodis Xanthomonas Stenotrophomonas maltophilia R551-3-reb2 OS217-reb1 denitrificans Shewanella
Burkholderia gladioli BSR3-reb4 P. aeruginosa Plesiocystis pacifica SIR-1-reb6 SIR-1-reb6 pacifica Plesiocystis
Burkholderia glumae BGR1-reb1 Plesiocystis pacifica SIR-1-reb3 SIR-1-reb3 pacifica Plesiocystis
Shewanella denitrificans OS217-reb3 Marinomonas mediterranea MMB1-reb2 MMB1-reb2 mediterranea Marinomonas
Plesiocystis pacifica SIR-1-reb5 Shewanella denitrificans OS217-reb2 OS217-reb2 denitrificans Shewanella Plesiocystis pacifica SIR-1-reb4
Marinomonas mediterranea MMB1-reb1 MMB1-reb1 mediterranea Marinomonas Plesiocystis pacifica SIR-1-reb2
Maricaulis maris MCS10-reb MCS10-reb maris Maricaulis
Aliivibrio fischeri ES114-reb2 ES114-reb2 fischeri Aliivibrio Aliivibrio fischeri ES114-reb3 ES114-reb3 fischeri Aliivibrio
PA14_27630 andPA14_27640 Burkholderia ambifaria AMMD-reb2 Aliivibrio fischeri ES114-reb5 ES114-reb5 fischeri Aliivibrio Polymorphum gilvum SL003B-26A1-reb1
Burkholderia ambifaria AMMD-reb1 Aliivibrio fischeri ES114-reb4 ES114-reb4 fischeri Aliivibrio
Burkholderia lata-383 Aliivibrio fischeri ES114-reb1 ES114-reb1 fischeri Aliivibrio
Saccharophagus degradans 2-40-reb 2-40-reb degradans Saccharophagus Azorhizobium caulinodans-reb2
Chromobacterium violaceum ATCC 12472-reb6 Burkholderia ambifaria AMMD-reb3
Aliivibrio fischeri ES114-reb6 ES114-reb6 fischeri Aliivibrio
Xanthomonas campestris pv. campestris str. ATCC ATCC str. campestris pv. campestris Xanthomonas Azorhizobium caulinodans-reb4 Caedibacter taeniospiralis-rebB taeniospiralis-rebB Caedibacter Ruegeria pomeroyi DSS3-reb1
Ruegeria pomeroyi DSS3-reb2
Xanthomonas axonopodis pv. citri str. 306-reb1 306-reb1 str. citri pv. axonopodis Xanthomonas Bukholderia sp. CCGE1003-reb1
Pseudomonas antarctica BS2772-reb2 BS2772-reb2 antarctica Pseudomonas Caedibacter taeniospiralis-rebA taeniospiralis-rebA Caedibacter Polymorphum gilvum SL003B-26A1-reb2
Bukholderia sp. CCGE1003-reb2 Pseudomonas palleroniana BS3265-reb2 BS3265-reb2 palleroniana Pseudomonas
Xanthomonas oryzae pv. oryzae PXO99A-reb PXO99A-reb oryzae pv. oryzae Xanthomonas Pseudomonas aeruginosa PA14-PA14_27630
Pseudomonas aeruginosa PA14-PA14_27640 Pseudomonas libanensis BS2975-reb2 BS2975-reb2 libanensis Pseudomonas
Pseudomonas aeruginosa Pseudomonas AR0440-reb2 aeruginosa AR0440-reb1
Pseudomonas fluorescens A506-reb2 A506-reb2 fluorescens Pseudomonas Pseudomonas aeruginosa Pseudomonas LESB58-reb1 aeruginosa LESB58-reb2 Pseudomonas synxantha BS33R-reb2 BS33R-reb2 synxantha Pseudomonas
Chromobacterium violaceum ATCC 12472-reb3
Pseudomonas protegens pf5-reb1 pf5-reb1 protegens Pseudomonas
Pseudomonas chlororaphis B25-reb2 B25-reb2 chlororaphis Pseudomonas Chromobacterium violaceum ATCC 12472-reb4 Pseudomonas protegens CHA0-reb2 CHA0-reb2 protegens Pseudomonas Chromobacterium violaceum ATCC 12472-reb2
Chromobacterium violaceum ATCC 12472-reb1
Pseudomonas mucidolens LMG2223-reb2 LMG2223-reb2 mucidolens Pseudomonas Pseudomonas mucidolens LMG2223-reb1 LMG2223-reb1 mucidolens Pseudomonas
Pseudomonas fluorescens NEP1-reb1 Pseudomonas antarctica BS2772-reb1 BS2772-reb1 antarctica Pseudomonas
Pseudomonas protegens pf5-reb2
et BS3265-reb1 palleroniana Pseudomonas
Pseudomonas libanensis BS2975-reb1 BS2975-reb1 libanensis Pseudomonas Pseudomonas protegens CHA0-reb1 Pseudomonas fluorescens A506-reb1 A506-reb1 fluorescens Pseudomonas PseudomonassynxanthaBS33R-reb1
Pseudomonas chlororaphis B25-reb1 Figure S1 Pseudomonas psychrotolerans
Pseudomonas citronellolis Figure S2
Pseudomonas salegens
Pseudomonas xinjiangensis Pseudomonas resinovorans
Pseudomonas sabulinigri Pseudomonas guangdongensis
Pseudomonas furukawaii
Pseudomonas aeruginosa PA14 PA14 aeruginosa Pseudomonas Pseudomonas denitrificans denitrificans Pseudomonas Pseudomonas oryzae
Pseudomonas pohangensis
Pseudomonas sihuiensis
Pseudomonas stutzeri
Pseudomonas mendocina
Pseudomonas extremorientalis
Pseudomonas pseudoalcaligenes
Pseudomonas alcaliphila Pseudomonas xanthomarina
Pseudomonas simiae Pseudomonas knackmussii Pseudomonas trivialis
Pseudomonas Pseudomonas extremaustralis Pseudomonas veronii poae
Pseudomonas alkylphenolia Pseudomonas cerasi Pseudomonas antarctica (1/2) Pseudomonas asplenii Pseudomonas orientalis Pseudomonas Pseudomonas fuscovaginae entomophila
Pseudomonas rhodesiae Pseudomonas monteilii Pseudomonas plecoglossicida Pseudomonas lurida Pseudomonas mosselii Pseudomonas palleroniana (1/1) Pseudomonas fulva Pseudomonas tolaasii Pseudomonas parafulva Pseudomonas cremoricolorata Pseudomonas cedrina Pseudomonas oryzihabitans Pseudomonas umsongensis Pseudomonas azotoformans Pseudomonas Pseudomonas alcaligenes agarici Pseudomonas granadensis Pseudomonas synxantha (3/8) Pseudomonas putida Pseudomonas rhizosphaerae
Pseudomonas libanensis (2/2) Pseudomonas Pseudomonas reinekei moraviensis Pseudomonas brenneri Pseudomonas Pseudomonas fluorescens koreensis (7/19)
Pseudomonas mandelii Pseudomonas mucidolens (2/2) Pseudomonas amygdali Pseudomonas Pseudomonas prosekii lini
Pseudomonas yamanorum Pseudomonas frederiksbergensis Pseudomonas syringae Pseudomonas savastanoi
Pseudomonas protegens (7/8) Pseudomonas arsenicoxydans Pseudomonas avellanae
Pseudomonas cichorii
Pseudomonas fragi
Pseudomonas corrugata Pseudomonas psychrophila Pseudomonas taetrolens Pseudomonas brassicacearum Pseudomonas viridiflava
Pseudomonas thivervalensis
Pseudomonas chlororaphis (47/48)
Pseudomonas mediterranea
0.02
Supplementary Figure 2. Phylogenetic tree showing all Pseudomonas species with complete genomes available in the Pseudomonas Genome DB. Indicated in parentheses are the number of full genomes with rebP1 homologues out of the total number of full genome sequences available for a species. Species with partial genome sequences are marked by red asterisks. Figure S3 a WT ΔrebP1P2 ΔrebP1P2 rebP1P2
b MCS-gfp PrebP1-gfp WT WT ΔrebZΔfecI2 ΔrebZ ΔfecI2
c d PrebP1-mScarlet and PPA1/04/03-gfp in WT PrebP1-mScarlet in ΔrebZΔfecI2 rebZ fecI2
Supplementary Figure 3. a, SEM images of SDS-insoluble fractions prepared from the indicated strains. Scale bar = 500 nm. b, Fluorescence microscopy images of top-down views of three-day-old
PA14 colony biofilms expressing PrebP1-gfp. Dotted lines demarcate the edge of the biofilm. Scale bar = 25 mm. c, Representative image of thin section prepared from a three-day-old biofilm containing the constructs PrebP1-mScarlet and PPA1/04/03-gfp. Scale bar = 10 μm. d, Left panels: Bright-field and fluorescence microscopy images of top-down views of three-day-old colony biofilms containing PrebP1- mScarlet in the ∆rebZ∆fecI2 complemented strain background. Dotted lines demarcate the edge of the biofilm. Scale bar = 25 mm. Right panel: Representative image of a thin section prepared from a three-day-old biofilm formed by the complemented strain expressing PrebP1-mScarlet. Dotted lines denote the air-biofilm interface (top) and the biofilm-agar interface (bottom). Scale bar = 10 μm. Supplementary Table 1: Strains
Strain Number Description Source Appears in figure Pseudomonas aeruginosa UCBPP-PA14 Clinical isolate UCBPP-PA14. (2) 2c-f PA14 ΔpelB-G LD2720 PA14 with deletion in PA14_24490-24560. (3) 1b-d, Table S1 PA14 ΔpelB-G LD2936 PA14 with deletion in PA14_24490-24560 This study S4a ΔPA14_27630-27640 and PA14_27630-27640.
PA14 ΔpelB-G LD3026 PA14 ΔpelB-G ΔPA14_27630-27640 with This study S4a ΔPA14_27630-27640:: wild-type PA14_27630-27640 PA14_27630-27640 complemented back into the site of deletion.
PA14 LD3224 PA14 with PrebP1-mScarlet inserted at the This study 2a-b attB::PrebP1-mScarlet attB site using pLD3210. PA14 LD3319 PA14 ΔPA14_27690-27700 with This study 1e-f ΔPA14_27690-27700 PrebP1P2-mScarlet inserted at the attB attB::PrebP1-mScarlet site using pLD3210.
PA14 ΔPA14_27690 LD3148 PA14 ΔPA14_27690 with PrebP1-gfp This study S4b attB::PrebP1-gfp inserted at the attB site using pLD2757.
PA14 ΔPA14_27700 LD3149 PA14 ΔPA14_27700 with PrebP1-gfp This study S4b attB::PrebP1-gfp inserted at the attB site using pLD2757 and an extra copy of rebP1 N-terminally tagged with gfp under the control of a weak RBS.
PA14 attB::PrebP1- LD3657 PA14 with PrebP1-mScarlet inserted at the This study S4c mScarlet attB site and PPA1/04/03-gfp inserted at the glmS::PPA1/04/03-gfp glmS site by mating pLD3655 into LD3224. PA14 LD3320 PA14 ΔPA14_27690-27700 strain with This study S4d ΔPA14_27690-27700:: wild-type PA14_27690-27700 PA14_27690-27700 complemented back into the site of attB::PrebP1-mScarlet deletion. Made by mating pLD3179 into LD3319. The strain also has PrebP1- mScarlet inserted at the attB site using pLD3210. PA14 attB::MCS- LD3294 PA14 without a promoter driving mScarlet This study 2a-b mScarlet expression inserted at the attB site using pLD3208.
PA14 attB::PPA1/04/03- LD3295 PA14 with lac-derived constitutive This study 2a-b mScarlet PA1/04/03 promoter driving mScarlet expression inserted at the attB site using pLD3293. PA14 LD2935 PA14 with deletion in PA14_27630-27640. This study 2c-f ΔPA14_27630-27640 PA14 LD3765 PA14 constitutively expressing mScarlet. This study 2d glmS::PPA1/04/03- Made by mating pLD3433 into LD0. mScarlet PA14 LD3766 PA14 ΔPA14_27630-27640 constitutively This study 2d ΔPA14_27630-27640 expressing mScarlet. Made by mating glmS::PPA1/04/03- pLD3433 into LD2935. mScarlet PA14 LD3016 PA14 ΔPA14_27630-27640 with wild-type This study 2e-f ΔPA14_27630-27640:: PA14_27630-27640 complemented back PA14_27630-27640 into the site of deletion. PA14 gacA::Tn LD1560 MAR2xT7 transposon insertion into (4) 2e-f PA14_30650. Arabidopsis thaliana Col-0 J. Reed, 2a,e UNC- Chapel Hill Caenorhabditis elegans unc-44(e362) LD3326 (5) 2b,f M. Chalfie, Columbia University Escherichia coli UQ950 LD44 E. coli DH5α λ(pir) strain for cloning; F- D. Lies, Δ(argF-lac) 169φ80dlacZ58(ΔM15) Caltech glnV44(AS) rfbD1 gyrA96(NaIR) recA1 endA1 spoT thi-1 hsdR17 deoR λpir+ BW29427 LD661 Donor strain for biparental conjugation; W. Metcalf, thrB1004 pro thi rpsL hsdS lacZ University ΔM15RP4-1360 Δ(araBAD)567 of Illinois ΔdapA1341::[erm pir(wt)] S17-1 LD2901 StrR, TpR, F-RP4-2-Tc::Mu aphA::Tn7 (6) recA λpir lysogen ß2155 LD69 Helper strain. thrB1004 pro thi strA hsdsS (7) lacZΔM15 (F′ lacZΔM15 lacIq traD36 proA+ proB+) ΔdapA::erm (Ermr) pir::RP4 [::kan (Kmr) from SM10] Saccharomyces cerevisiae InvSc1 LD676 MATa/MATα leu2/leu2 trp1-289/trp1-289 Invitrogen ura3-52/ ura3-52 his3-Δ1/his3-Δ1 Supplementary Table 2: Primers
Primer Sequence Used for number plasmid LD2609 acgtacgtctcgagtctagatttaagaaggagatatacatatgagtaaaggagaagc pLD3208
LD2635 actgactggagctcataaaacgaaaggcccagtctttcg
LD2113 acgtacgtacACTAGTccagatcctgcagaacgtc pLD3210, pLD2757 LD2114 acgtacgtacGAATTCgatgtgactccctgtgagtgaa
LD1087 AGGGCCAATCGATAGAGTTT
LD1088 TCTTCGTGATCTGAAGCCATT
LD3139 acgtacgtacgcatgctg AGTAAAGGAGAAGAACTTTTCACTGG pLD3655
LD3141 acgtacgtacgctagc GGCGGATTTGTCCTACTCAG
LD2731 acgtacgtacACTAGTtatttagaaaaataaacaaataggggttccgc pLD3293
LD2732 acgtacgtacGAATTCgcttaatttctcctctttaattctagatgtgtg
LD2507 ggaattgtgagcggataacaatttcacacaggaaacagctCTACGATTGGGTGTCCTTGC pLD3136 (LD2507-2510),
LD2508 TGTTCACGCCACTACACCCGCGACGTTTCACAAGACAGA pLD1853 (LD2507 and LD2509 TCTGTCTTGTGAAACGTCGCGGGTGTAGTGGCGTGAACA LD2510)
LD2510 aggcaaattctgttttatcagaccgcttctgcgttctgatAGCGCTTCGACGAACAAC
LD2507 ggaattgtgagcggataacaatttcacacaggaaacagctCTACGATTGGGTGTCCTTGC pLD3142
LD2521 TATGGATCGTCCGAATCAGCGCGACGTTTCACAAGACAGA
LD2522 TCTGTCTTGTGAAACGTCGCGCTGATTCGGACGATCCATA
LD2523 aggcaaattctgttttatcagaccgcttctgcgttctgatCTCGCTACCCTTTCCGAATA LD2525 ggaattgtgagcggataacaatttcacacaggaaacagctACATGTCTGGGCACTCCTG pLD3143
LD2526 CACGCCACTACACCCTGCCTGTCACCCAGGTAACAGCC
LD2527 GGCTGTTACCTGGGTGACAGGCAGGGTGTAGTGGCGTG
LD2510 aggcaaattctgttttatcagaccgcttctgcgttctgat AGCGCTTCGACGAACAAC
LD2295 ggaattgtgagcggataacaatttcacacaggaaacagctCAAAGGTTCGGTTTCGGCCG pLD3061
LD2296 ttaaagaggagaaattaagcATGAGTTTTCCGACCGCAGTC
LD2297 GACTGCGGTCGGAAAACTCATgcttaatttctcctctttaattctagatgtgtg
LD2298 CCAGGCCTGGCGCCGACGGAtatttagaaaaataaacaaataggggttccgc
LD2299 ccctatttgtttatttttctaaataTCCGTCGGCGCCAGG
LD2300 aggcaaattctgttttatcagaccgcttctgcgttctgatACGCACGCTACATCAGACGC
LD2191 ggaattgtgagcggataacaatttcacacaggaaacagctCGCGCGCAACTCTTCTAT pLD2934 (LD2191- LD2194), LD2192 gagttttccgaccgcagtcCTGCTGACGGTGCTCAAAG pLD3016 LD2193 ctttgagcaccgtcagcagGACTGCGGTCGGAAAACTC (LD2191& LD2194)
LD2194 aggcaaattctgttttatcagaccgcttctgcgttctgatGAAATATCGGACAGCGATGC
LD2811 acgtacgtGCTGAGC AGTAAAGGAGAAGCTGTGATTAAAG pLD3433
LD2812 acgtacgtGCT GAGCAGTAAAGGAGAAGCTGTGATTAAAG Supplementary Table 3: Plasmids
Plasmids Number Description Source pMQ30 LD621 Yeast-based allelic-exchange vector; sacB+, CEN/ ARSH, (8) URA3+, GmR . pLD2722 LD2722 MCS-gfp GmR, TetR flanked by Flp recombinase target (9) (pSEK103) (FRT) sites to resolve out resistance cassettes pLD3208 LD3208 MCS-mScarlet GmR, TetR flanked by Flp recombinase This study (pSEK109) target (FRT) sites to resolve out resistance cassettes. Cloned by swapping gfp sequence with mScarlet (XhoI + SacI) pFLP2 LD743 Site-specific excision vector with cI857-controlled FLP (10) recombinase encoding sequence, sacB, ApR. pLD3210 LD3210 487 bp of rebP1 promoter sequence inserted at the MCS This study (PrebP1-mScarlet) (SpeI and EcoRI) of pLD3208 pLD2757 LD2757 487 bp of rebP1 promoter sequence inserted at the MCS This study (PrebP1-gfp) (SpeI and EcoRI) of pLD2722 pLD3655 LD3655 gfp coding region cloned into pAKN69 plasmid replacing This study the yfp coding region excised with SphI and NheI pLD3293 LD3293 lac-derived constitutive promoter PA1/04/03 inserted at the This study (mScarlet+) MCS (SpeI and EcoRI) of pLD2722 pLD3136 LD3136 ΔPA14_27690-27700 flaking fragments introduced into This study pMQ30 by gap repair cloning in yeast strain InvSc1 pLD3142 LD3142 ΔPA14_27690 flaking fragments introduced into pMQ30 by This study gap repair cloning in yeast strain InvSc1 pLD3143 LD3143 ΔPA14_27700 flaking fragments introduced into pMQ30 by This study gap repair cloning in yeast strain InvSc1 pLD3179 LD3179 Full genomic sequence of PA14_27690-27700 PCR This study fragment introduced into pMQ30 by gap repair cloning in yeast strain InvSc1. Verified by illumina sequencing. pLD2934 LD2934 ΔrebP1P2 flaking fragments introduced into pMQ30 by This study gap repair cloning in yeast strain InvSc1 pLD3061 LD3061 rebP1P2 flanking fragments around, with a third fragment This study of lac-derived constitutive PA1/04/03 promoter, introduced into pMQ30 by gap repair cloning in yeast strain InvSc1. pLD3016 LD3016 Full genomic sequence of rebP1P2 and native promoter This study PCR fragment introduced into pMQ30 by gap repair cloning in yeast strain InvSc1. Verified by illumina sequencing. pLD3433 LD3433 mScarlet coding region cloned into pAKN69 plasmid This study replacing the yfp coding region that was excised with BlpI and NheI. Supplementary File 1. Pseudomonas aeruginosa strains that contain homologues of rebP1 (PA14_27630), fecI2 (PA14_27690) and the reb gene cluster PA14_27630-PA14_27700. Strains were identified with a nucleotide NCBI BLAST against 312 complete genomes in Pseudomonas aeruginosa (taxid:287). 189 strains contained the reb cluster with rebP1 and fecI2; in one strain the cluster lacked fecI2. 122 strains lacked the reb cluster, rebP1 and fecI2.
Supplementary File 2. Compilation of all 126 proteins (represented by two or more peptides) found in the SDS-insoluble fraction by tandem mass spectrometry. SUPPLEMENTARY REFERENCES
1. Raymann, K., Bobay, L.-M., Doak, T. G., Lynch, M. & Gribaldo, S. A genomic survey of Reb homologs suggests widespread occurrence of R-bodies in proteobacteria. G3 3, 505–516 (2013).
2. Rahme, L. G. et al. Common virulence factors for bacterial pathogenicity in plants and animals. Science 268, 1899–1902 (1995).
3. Madsen, J. S. et al. Facultative control of matrix production optimizes competitive fitness in Pseudomonas aeruginosa PA14 biofilm models. Appl. Environ. Microbiol. 81, 8414–8426 (2015).
4. Liberati, N. T. et al. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc. Natl. Acad. Sci. U. S. A. 103, 2833–2838 (2006).
5. Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71–94 (1974).
6. Simon, R., Priefer, U. & Pühler, A. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Biotechnology 1, 784–791 (1983).
7. Dehio, C. & Meyer, M. Maintenance of broad-host-range incompatibility group P and group Q plasmids and transposition of Tn5 in Bartonella henselae following conjugal plasmid transfer from Escherichia coli. J. Bacteriol. 179, 538–540 (1997).
8. Shanks, R. M. Q., Caiazza, N. C., Hinsa, S. M., Toutain, C. M. & O’Toole, G. A. Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl. Environ. Microbiol. 72, 5027–5036 (2006).
9. Jo, J., Cortez, K. L., Cornell, W. C., Price-Whelan, A. & Dietrich, L. E. An orphan cbb3-type cytochrome oxidase subunit supports Pseudomonas aeruginosa biofilm growth and virulence. Elife 6, (2017).
10. Hoang, T. T., Karkhoff-Schweizer, R. R., Kutchma, A. J. & Schweizer, H. P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212, 77–86 (1998).