(Arecaceae): Évolution Du Système Sexuel Et Du Nombre D'étamines

Home , Acanthophoenix, Acanthophoenix rubra, Acoelorrhaphe, Actinokentia, Actinorhytis, Adonidia merrillii

Etude de l’appareil reproducteur des palmiers (Arecaceae) : évolution du système sexuel et du nombre d’étamines Elodie Alapetite

To cite this version:

Elodie Alapetite. Etude de l’appareil reproducteur des palmiers (Arecaceae) : évolution du système sexuel et du nombre d’étamines. Sciences agricoles. Université Paris Sud - Paris XI, 2013. Français. NNT : 2013PA112063. tel-01017166

HAL Id: tel-01017166 https://tel.archives-ouvertes.fr/tel-01017166 Submitted on 2 Jul 2014

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

UNIVERSITE PARIS-SUD

ÉCOLE DOCTORALE : Sciences du Végétal (ED 145) Laboratoire d’Ecologie, Systématique et Evolution (ESE)

DISCIPLINE : Biologie

THÈSE DE DOCTORAT SUR TRAVAUX

soutenue le 17/05/2013

par

Elodie ALAPETITE

ETUDE DE L’APPAREIL REPRODUCTEUR DES PALMIERS (ARECACEAE) : EVOLUTION DU SYSTEME SEXUEL ET DU NOMBRE D’ETAMINES

Directeur de thèse : Sophie NADOT Professeur (Université Paris-Sud Orsay)

Composition du jury :

Rapporteurs : Jean-Yves DUBUISSON Professeur (Université Pierre et Marie Curie – Paris VI) Porter P. LOWRY Professeur (Missouri Botanical Garden USA et Muséum National d’Histoire Naturelle Paris) Examinateurs : Anders S. BARFOD Professeur (Aarhus University Danemark) Isabelle DAJOZ Professeur (Université Paris Diderot – Paris VII) Michel DRON Professeur (Université Paris-Sud Orsay)

Résumé

Les palmiers constituent une famille emblématique de monocotylédones, comprenant 183 genres et environ 2500 espèces distribuées sur tous les continents dans les zones tropicales et subtropicales. Leurs feuilles et leurs stipes, très caractéristiques, les rendent facilement reconnaissables dans la nature. En revanche leurs fleurs passent souvent inaperçues. Elles sont généralement petites (quelques centimètres), trimères, unisexuées, peu colorées (blanches ou vertes) et regroupées sur de grandes inflorescences. Cependant les palmiers présentent une diversité importante au niveau du système sexuel et du nombre d’étamines. Les trois systèmes sexuels principaux des angiospermes : hermaphrodisme, monoécie et dioécie, sont présents chez les palmiers. Le nombre d’étamines varie entre quelques unités (oligandrie) et des dizaines, voire centaines, d’unités (polyandrie) chez certains genres. Nous avons étudié l’évolution du système sexuel et du nombre d’étamines à l’échelle de la famille. Nous avons pour cela utilisé une phylogénie comprenant tous les genres de palmiers, bien résolue, datée et qui a été publiée récemment. Notre étude a montré que l’ancêtre commun à tous les palmiers était probablement monoïque et possédait des fleurs oligandres à 6 étamines. A partir de ces états ancestraux, plusieurs transitions ont eu lieu : vers l’hermaphrodisme et la monoécie d’une part, et vers la polyandrie d’autre part. Dans l’objectif d’initier une recherche sur une éventuelle explication fonctionnelle de l’augmentation du nombre d’étamines, nous avons comparé celui-ci à la production de pollen, en étudiant la quantité totale de pollen produite par les fleurs de 82 espèces. Notre étude a montré que, chez deux sous-familles, les fleurs ont tendance à produire plus de pollen quand le nombre d’étamines est plus élevé. Nous avons également réalisé la phylogénie moléculaire d’une sous-tribu (les Ptychospermatinae) dans laquelle la variation du nombre d’étamines est exceptionnelle. De futures études sur la génétique, le développement, l’écologie et la biologie de la pollinisation sont nécessaires.

Mots clés : Arecaceae, évolution, morphologie de la fleur, nombre d’étamines, palmiers, production de pollen, phylogénie moléculaire, système sexuel

Reproductive structures in palms (Arecaceae): evolution of sexual system and stamen number

Abstract

Palms (Arecaceae) are an emblematic family of monocots of 183 genera and around 2500 species distributed on all continents, throughout tropical and subtropical areas. Their characteristic leaves and stems make palms immediately recognizable in the field. The inconspicuous palm flowers are usually considered as rather dull. They are usually small (a few centimetres), trimerous, often unisexual, colourless (white or greenish) and grouped into huge inflorescences. However palms exhibit a large diversity in sexual system and in stamen number, diversity that is still poorly understood. The three main sexual systems of angiosperm, hermaphroditism, dioecy and monoecy are present in palms. Stamen number ranges between a few units (oligandry) to several dozens and even several hundreds of units (polyandry) in some genera. We studied the evolution of sexual system and stamen number at the family level. We used as historical framework a well-supported and dated phylogeny, published recently. Our study showed that the putative ancestor of palms was monoecious and

bore oligandrous flowers with 6 stamens. From these ancestral states, several transitions occurred: towards hermaphroditism and dioecy and towards polyandry respectively. In order to initiate a research on a possible functional significance of increase in stamen number, we investigated the relationship between stamen number and pollen production, by extracting the total pollen content from flowers of 82 species. Our study showed a tendency towards higher pollen production when the number of stamen increases in two subfamilies. We also produced molecular phylogeny of a subtribe (Ptychospermatinae) in which the range of variation in stamen number is exceptional. Further investigations into genetic, developmental, ecology and pollination biology are needed.

Keywords: Arecaceae, palms, sexual system, stamen number, evolution, flower morphology, pollen production, molecular phylogeny

Laboratoire : UMR 8079 - Ecologie, Systématique et Evolution Université Paris-Sud, Bât. 360 91405 Orsay cedex

Remerciements

Je tiens à remercier tout particulièrement Sophie NADOT, ma directrice de thèse, pour ses précieux conseils et encouragements ainsi que pour la généreuse confiance qu’elle m’a accordée. Merci de m’avoir permis de travailler sur les palmiers, un groupe de végétaux particulièrement intriguant et fascinant, qui a affermit mon gout pour la botanique. Je remercie Sophie également de m’avoir fait partager son expérience de l’enseignement et de m’avoir confié des TD et des TP si intéressants et enrichissants.

Je remercie tous les membres de l’équipe DEV : permanents Béatrice ALBERT, Hervé SAUQUET et non permanents Boris DOMENECH, Julien MASSONI, Charlotte PRIEU, Elisabeth REYES, Franck SIMONNET pour les discussions et la belle synergie scientifique qui règne dans notre équipe. Je remercie également ceux qui sont partis vivre de nouvelles aventures, Julie SANNIER et Olivier CHAUVEAU. Ils ont beaucoup aidé la novice que j’étais en biologie moléculaire.

Je remercie Christian RAQUIN et Yves LOUBLIER pour leur soutien et leur precieux conseils dans mes expériences sur le pollen.

Je remercie les spécialistes des palmiers qui m’ont conseillé et accompagné durant toute cette thèse : Anders BARFOD de l’Université d’Aarhus au Danemak, Bill BAKER des Jardins Botaniques Royaux de Kew, Jean-Christophe PINTAUD, Bertha LUDENA, James TREGEAR de l’IRD de Montpellier. Je tiens à remercier chaleureusement Lauren GARDINER et Laszlo CSIBA qui m’ont aidé pour les prélèvements de matériel à Kew.

Je remercie les stagiaires qui ont partagé mon travail et ont j’espère pris goût à la botanique et à la recherche, Nicolas MAINGRET, Aurélie NALIN, Vanessa VILARD, Gérard IMANI, Stéphanie VALLEE. Ils m’ont tous été d’une aide précieuse dans mes recherches.

Je remercie tous les membres du labo ESE pour leur accueil et leur soutien, avec une pensée spéciale pour celles et ceux qui ont partagé leur bureau et leurs pauses thé avec moi.

Je tiens finalement à remercier les membres de mon jury d’avoir accepté d’évaluer mon travail et je m’excuse pour tous ceux que j’ai sans doute oubliés.

Table des matières

Introduction ...... 13

Partie I : L’évolution de la morphologie de l’inflorescence et de la fleur ...... 15

Les plantes et l’évolution ...... 15 L’évolution des traits morphologiques...... 15 Les Angiospermes...... 17 La fleur ...... 21 Le contrôle génétique de la mise en place des organes floraux ...... 26 La morphologie de la fleur et la pollinisation ...... 27 Les inflorescences ...... 29

Partie II : La famille des palmiers ...... 31

Les habitats des palmiers...... 32 Particularités morphologiques et anatomiques...... 33 Des palmiers et des hommes : importance économique et conservation ...... 38 Classification et relations phylogénétiques...... 40

Objectifs et méthodes...... 45

Organisation du manuscrit ...... 47

Chapitre 1 : Evolution du système sexuel chez les palmiers...... 49

Contexte et objectifs de l’étude...... 51 Caractéristiques des inflorescences et des fleurs de palmiers...... 51 Synthèse des résultats...... 55

Article 1...... 57

Chapitre 2 : Evolution du nombre d’étamines chez les palmiers...... 107

Contexte et objectifs de l’étude...... 109 Synthèse des résultats...... 111

Article 2...... 113

Chapitre 3 : Evolution du nombre d’étamines chez les Ptychospermatinae ...... 157

Contexte et objectifs de l’étude...... 159 Choix des marqueurs moléculaires ...... 160 Synthèse des résultats...... 164

Article 3...... 165

Conclusion générale ...... 217

Synthèse des résultats...... 219

Perspectives...... 220

L’évolution du système sexuel...... 220 L’évolution du nombre d’étamines ...... 222 La relation entre système sexuel et nombre d’étamines...... 224

Références ...... 225

Annexes...... 243

Annexe 1 : Reconstruction de l’évolution de l’organisation des fleurs sur l’inflorescence ...... 245 Annexe 2 : protocoles utilisés pour la dissection des fleurs de palmier, l’extraction et le comptage des grains de pollen...... 247 Annexe 3 : ficher de données PROTEUS ...... 249 Annexe 4 : article présentant la phylogénie moléculaire des Archontophoenicinae...... 267

Avertissement Les figures présentées dans les articles font l’objet d’une numératation particulière, indépendante de celle utilisée dans le manuscrit. Les références propres à chaque article sont présentées à la fin de ceux-ci.

Introduction

Partie I : L’évolution de la morphologie de l’inflorescence et de la fleur

Les plantes et l’évolution

Les plantes, la diversité de leurs morphologies et de leurs propriétés, sont étudiées depuis l’Antiquité et encore aujourd’hui, dans une optique utilitaire et de connaissance fondamentale. Elles sont décrites et classées pour pouvoir être reconnues, étudiées et utilisées. En revanche le contexte théorique dans lequel elles sont étudiées a profondément changé à mesure que la vision du monde vivant se modifiait. Après une vision cyclique de la nature portée par les philosophes grecs dans laquelle tous les phénomènes naturels se répètent indéfiniment, après une vision fixiste du vivant influencée par le christianisme, une vision historique du monde a émergé. Les entités vivantes s’inscrivent alors dans une progression temporelle irréversible au cours de laquelle elles se modifient peu à peu. Dans Les Animaux sauvages (1756), Buffon écrit ainsi que « le grand ouvrier de la Nature est le temps ». Si la théorie transformisme de Lamarck a initié la formalisation de cette nouvelle vision (Corsi 2001), c’est Darwin qui dans son livre L’Origine des espèces (1859) définit les fondements de la théorie de l’évolution. Ce nouveau paradigme a profondément bouleversé les sciences biologiques. Les plantes et tous les autres organismes vivants actuels sont perçus comme les fruits d’une histoire qui a un commencement et un sens. Dire que l’évolution possède un sens signifie qu’elle est irréversible (tout comme l’Histoire humaine), mais n’implique pas qu’elle ait un but.

L’évolution des traits morphologiques

La morphologie est définie comme la forme et la structure externe des êtres vivants (Larousse 2013). Lorsque l’on étudie la morphologie d’un organisme, on s’intéresse notamment à la quantité, à la forme, à la répartition et à l’organisation des éléments qui le composent. Ainsi pour décrire la morphologie d’une plante, on peut par exemple préciser la forme des feuilles, leur agencement par rapport à la tige (phyllotaxie) ou le nombre des pétales de la fleur. L’étude de la morphologie constitue l’un des fondements de la botanique. Depuis les débuts de cette discipline, les traits morphologiques ont toujours servi à décrire les espèces et à les classer (par exemple Linné 1753, Bentham & Hooker 1883 ou Cronquist 1981). La théorie de l’évolution implique que les organismes se modifient au cours du temps, au point de former des espèces différentes. Ceci a ouvert de nouvelles perspectives à l’étude de la morphologie. Dans ce cadre théorique, la diversité morphologique des plantes est considérée comme le résultat d’un processus évolutif, l’adaptation (Bock & von Wahlert

1965). Les traits morphologiques les mieux adaptés à l’environnement ou à l’exécution d’une fonction précise dans cet environnement confèrent un avantage sélectif aux individus qui les présentent. Les gènes qui codent pour ces traits sont transmis aux descendants (hérédité) et sont donc davantage représentés dans les générations suivantes, provoquant ainsi une modification progressive de la morphologie des espèces. Lorsque ces modifications permettent aux individus d’occuper de nouvelles niches écologiques (nouveaux milieux, nouvelles interactions biotiques), un isolement reproductif peut survenir, favorisant l’émergence d’une nouvelle espèce (Levin 1971). La diversification des espèces est donc étroitement liée à celle des morphologies. Cependant, la variabilité morphologique inter-individuelle sur laquelle s’exerce la sélection naturelle n’est pas infinie mais s’exprime entre les limites fixées par un patron de développement (Maynard-Smith et al. 1985). La notion de plan d’organisation, c’est-à-dire la place des organes les uns par rapport aux autres, a d’abord été mise en évidence chez les animaux (Geoffroy Saint-Hilaire 1829) et a été confortée par la découverte des gènes homéotiques (Lewis 1978). Ces gènes très conservés dans les différents règnes du vivant, déterminent les plans d’organisation des organismes, contraignant ainsi l’évolution des formes et structurant la diversité. Chez les plantes, des gènes contrôlant le développement ont été identifiés ; il s’agit des gènes à MADS-box (Purugganan et al. 1995 ; Becker & Theissen 2003 ; Smaczniak et al. 2012). Ces gènes sont connus notamment pour contrôler la mise en place des différents verticilles de pièces florales (modèle ABC entre autres), mais ils ont également été mis en évidence chez des groupes de végétaux ne possédant pas de fleur. Par exemple chez les mousses ils jouent potentiellement un rôle dans la mise en place des organes végétatifs et reproducteurs (Singer et al. 2007). L’adaptation des plantes au milieu terrestre et leur diversification est probablement liée à l’évolution de leur plan d’organisation (Kenrick & Crane 1997 ; Graham et al. 2000). La diversité des formes est donc permise par des modifications des réseaux de gènes ancestraux régulant le développement et par la génération de nouveaux processus de développement (Becker et al. 2000 ; Theissen et al. 2000). Cette relation entre développement et évolution a donnée naissance à une nouvelle discipline appelée « Evo-Devo » (voir Goodman & Coughlin 2000 pour une description). D’autres processus évolutifs peuvent influencer la morphologie des plantes. La transmission des caractères morphologiques d’une génération à l’autre est soumise à la sélection naturelle et à la sélection sexuelle (Grant 1995 ; Skogsmyr & Lankinen 2002). Mais le hasard joue également un rôle important. En 1968, Motoo Kimura a introduit la théorie neutraliste de l’évolution qui montre que de nombreux allèles ne sont ni avantageux, ni désavantageux, et

donc ne sont pas ou peu soumis à la sélection. Leur devenir au sein des populations ne dépend que du taux de mutation et de la dérive génétique. La dérive génétique est un processus qui participe à l’évolution des formes chez les plantes (Husband & Barrett 1992). L’hybridation est également une composante importante de l’évolution des plantes (Rieseberg et al. 1993). Elle intervient lorsque la reproduction de deux plantes apparentées proches par flux de pollen donne une descendance fertile. On estime que plus de 70% des espèces naturelles de plantes proviennent d’hybrides (Rieseberg et al. 1993). Ces hybrides peuvent potentiellement présenter des caractères morphologiques nouveaux par rapport aux plantes parentes (Rieseberg & Wendel 1993 ; Morjan & Rieseberg 2004). En résumé, parmi l’ensemble des possibilités permises par la génétique et le développement d’une lignée évolutive donnée (contraintes phylogénétiques), les traits morphologiques évoluent de manière neutre ou bien ceux qui sont les mieux adaptés sont sélectionnés (contraintes fonctionnelles et environnementales).

Si la théorie de l’évolution permet d’expliquer en grande partie la diversité des traits morphologiques, elle permet aussi de comprendre les ressemblances entre les organismes. La similitude des traits morphologiques chez différentes espèces peut être expliquée par le fait qu’elles ont hérité ces traits d’un ancêtre commun ou bien par le fait qu’elles partagent les mêmes conditions écologiques. Dans le premier cas, les traits morphologiques sont des homologies et peuvent être utilisés pour reconstruire les relations phylogénétiques entre les espèces. Dans le deuxième cas, il s’agit d’un phénomène de convergence. Les convergences sont fréquentes chez les plantes tant au niveau de leur morphologie que de leur fonctionnement (Reich et al. 1997).

Les Angiospermes

Les angiospermes constituent le groupe le plus important des plantes terrestres tant en nombre de taxons qu’en abondance. Près de 90% des espèces des plantes terrestres (embryophytes) sont des angiospermes (Crepet & Niklas 2009). Ces espèces occupent tous les types de milieux de la toundra aux forêts tropicales, à l’exception des plus arides. Elles constituent en outre les éléments de base de ces nombreux écosystèmes tant par la structuration du milieu que par la production primaire (Wing & Boucher 1998). Le nombre d’espèces connues actuellement est estimé à environ 352 000 espèces (Paton et al. 2008). Mais cette estimation varie selon les études en fonction du taux de synonymie (Scotland & Wortley 2003). De nouvelles espèces d’angiospermes sont encore découvertes aujourd’hui, notamment dans les

« hotspots » (Myers et al. 2000) de biodiversité (par exemple Baker & Heatubun 2012). Le nombre d’espèces encore inconnues correspondrait à environ 10 à 20% du nombre des espèces décrites (Joppa et al. 2010).

Les angiospermes (Fig. 1) constituent un groupe monophylétique (Angiosperms Phylogeny Group 2009). On peut distinguer au sein des angiospermes deux grands groupes monophylétiques, les monocotylédones et les eudicotylédones qui s’enracinent au sein d’en ensemble paraphylétique couramment nommé « angiospermes basales ». Les angiospermes se différencient des autres plantes à graines par un certain nombre de synapomorphies principalement associées à l’appareil reproducteur. Parmi celles-ci on trouve la condensation des organes reproducteurs dans la fleur (cf. description ci-dessous), qui leur donne leur nom de « plantes à fleurs ». Il y a aussi la présence d’une structure enveloppant les ovules qui se transforme en fruit : le carpelle. Le mot « angiosperme » signifie d’ailleurs « graine contenue dans un vase ou récipient ». La double fécondation (la cellule reproductrice contenue dans le grain de pollen se divise pour donner deux noyaux reproducteurs ; l’un fusionne avec l’oosphère pour donner le zygote tandis que l’autre fusionne avec les deux noyaux polaires pour former l’albumen, réserve nutritive pour l’embryon) et les étamines portant deux paires de sacs polliniques sont également des caractéristiques du groupe (Soltis et al. 2009).

L’origine des angiospermes est un sujet de recherche qui suscite de nombreuses études. En se basant sur des critères morphologiques, les Gnétales, un groupe de gymnospermes, ont longtemps été considérées comme le groupe frère des angiospermes. Certaines phylogénies moléculaires ont remis en cause cette hypothèse en montrant la monophylie des gymnospermes actuelles. Ils seraient donc les plus proches parents actuels des angiospermes (Bowe et al. 2000 ; Chaw et al. 2000). Cependant les études incluant les lignées fossiles, semblent montrer que le groupe frère des angiospermes serait constitué d’espèces aujourd’hui éteintes (discuté dans Mathiews 2009). Finalement la phylogénie des plantes à graines est encore incertaine et varie considérablement selon les caractères étudiés et les marqueurs moléculaires (Doyle 2012). La période de divergence des angiospermes et des autres plantes à graines est donc encore controversée et pourrait avoir eu lieu au Jurassique moyen ou avant (Wikström et al. 2001 ; Clarke et al. 2011). La plupart du temps, la datation des phylogénies et l’estimation des périodes de divergence des lignées évolutives, sont difficiles à cause du manque de congruence entre les données moléculaires et paléontologiques, des éventuels

Fig. 1 : Classification des Angiospermes basée sur les relations phylogénétiques (Sauquet & Nadot 2013 d’après Angiosperm Phylogeny Group 2009)

problèmes d’identification des fossiles et de la variété des méthodes que l’on peut utiliser (par exemple Wikström et al. 2001 ; Sauquet et al. 2012). Peu de temps après leur apparition, les angiospermes ont connu une période de diversification très rapide au cours du Crétacé, comme le montre bien le registre fossile (Wing & Boucher 1998). Cette importante et rapide diversification était considérée par Darwin comme un « abominable mystère » (Friedman 2009) car elle n’était pas en adéquation avec sa théorie. En effet la théorie de l’évolution des espèces telle qu’elle a été élaborée par Darwin propose que les caractéristiques des organismes évoluent graduellement et lentement en suivant les modifications du milieu. Différentes hypothèses ont été proposées pour expliquer cette période de diversification rapide. Il semblerait que la duplication du génome entier (De Bodt et al. 2005), la possibilité de coloniser de nombreuses aires géographiques (Vamosi & Vamosi 2010), la capacité à utiliser les ressources plus efficacement que les autres végétaux (temps de génération court ; Berendse & Scheffer 2009) et surtout la capacité à développer des interactions mutualistes avec d’autres organismes soient autant de facteurs ayant permis une diversification rapide. Les angiospermes interagissent notamment avec des animaux disperseurs de graines (Herrera 2002), des champignons mycorhyziens (Selosse et al. 2006) et les bactéries (Friesen et al. 2011). Mais l’interaction des plantes avec les animaux pollinisateurs, notamment les insectes, semble être la plus importante pour expliquer le succès évolutif des angiospermes (Regal 1977 ; Pellmyr 2002). Cette hypothèse avait déjà été proposée à l’époque de Darwin, par Saporta (Saporta & Marion 1885, cité dans Friedman

2009) et a été largement étudiée depuis. L’interaction plante-pollinisateur est étroitement liée à la morphologie de la fleur. D’une part les variations morphologiques de la fleur ont augmenté les possibilités d’isolement reproductif (changements dans l’identité des pollinisateurs, dans la localisation du dépôt de pollen sur le pollinisateur par exemple), permettant d’empêcher les croisements avec les individus apparentés. D’autre part de nombreuses structures florales ont été mises en place car elles rendaient la pollinisation plus ciblée et plus efficace, permettant la survie de populations à faibles effectifs. C’est entre autre pour ces raisons que la fleur dans son ensemble et certaines de ses caractéristiques sont considérées comme les principales innovations évolutives des angiospermes ayant contribuées à leur succès et à leur taux de diversification élevé.

La fleur

Le plan d’organisation de la fleur est conservé chez la majorité des angiospermes. Il est composé de quatre groupes d’organes presque toujours placés dans le même ordre sur un axe court. De l’extérieur vers l’intérieur, on trouve les sépales (calice), les pétales (corolle), les étamines (androcée) et les carpelles (gynécée ou pistil). La seule exception notable se retrouve chez Lacandonia schismatica (Triuridaceae) où les étamines sont centrales et entourées par les carpelles (Ronse De Craene et al. 2003). Les pétales et les sépales forment le périanthe et ils sont appelés tépales lorsque leur aspect ne permet pas de les distinguer. Le gynécée est le lieu de formation des ovules qui donneront les graines après fécondation. Par analogie avec les modèles de reproduction animale, le gynécée est considéré comme l’appareil reproducteur « femelle » de la fleur. Les étamines, lieu de formation du pollen, sont considérées comme les organes « mâles » de la fleur. La fleur constitue donc le lieu de la reproduction sexuée des angiospermes. Certaines espèces possèdent des fleurs contenant les organes femelles et mâles. Ce sont des fleurs hermaphrodites. D’autres présentent des fleurs unisexuées, contenant uniquement les organes femelles ou les organes mâles. Deux types principaux de systèmes sexuels sont alors définis pour qualifier ces espèces, suivant la répartition des fleurs unisexuées sur les différents individus. Si les fleurs unisexuées des deux sexes sont portées par le même individu, le système sexuel est qualifié de monoïque. Si les fleurs unisexuées sont portées par des individus différents, femelles et mâles, le système sexuel est qualifié de dioïque. Si le plan d’organisation de la fleur est bien conservé, tant chez les fleurs hermaphrodites qu’unisexuées, en revanche il existe une incroyable diversité d’organisation, de forme, de couleur et de nombre de pièces au sein de chaque groupe d’organes. La phyllotaxie : la phyllotaxie des organes floraux est l’angle qui sépare deux organes par rapport au centre de la fleur. On distingue trois grands types de phyllotaxie : spiralée (angle moyen de divergence est 137.5°, les organes de même catégorie tendent à suivre les nombres d’une série de Fibonacci garantissant la meilleure régularité), verticillée (angles de divergence égaux entre les organes d’un verticille mais différents avec l’organe d’un autre verticille) et irrégulière. Chez les angiospermes basales les phyllotaxies spiralées et verticillées coexistent et semblent avoir passé de l’une à l’autre plusieurs fois au cours de leur évolution (Endress 2011). Au contraire la phyllotaxie spiralée est absente chez les monocotylédones et chez la plupart des eudicotylédones (à l’exception de certaines Ranunculales et Rosidées ; Ronce De Craene & Smet 1998). La phyllotaxie irrégulière est courante chez les fleurs qui ont des organes floraux nombreux, notamment des étamines nombreuses (chez les Nymphaeales et les

Magnoliales parmi les angiospermes basales, chez les Arecales parmi les monocotylédones ou encore chez les Ranunculales parmi les eudicotylédones ; Ronce De Craene & Smet 1998 ; Dransfield et al. 2008 ; Endress 2011). Une phyllotaxie en verticilles plus ou moins complexe, s’accompagnant d’une modification éventuelle de la mérosité entre les verticilles (voir ci- dessous), est présente chez la majorité des angiospermes les plus dérivées (Endress 2011). La mérosité : la mérosité (ou mérie) fait référence au nombre d’organes de chaque catégorie et par extension au nombre d’organes présents dans chaque verticille ou groupe. La mérosité est majoritairement de 3 (trimère) chez les monocotylédones et de 5 (pentamère) chez les eudicotylédones. Des variations autour de ce pattern de base ont eu lieu ; réduction du nombre d’organes par verticille (par exemple chez les Poaceae) ou augmentation (duplication des verticilles par exemple). Les rares cas de tétramérie (mérosité de 4) dérivent de la perte d’un organe dans deux verticilles de 3 organes (ex : Proteaceae) ou de la perte d’un organe dans un verticille pentamère (ex : Oleaceae). La mérosité est plus fluctuante chez les angiospermes basales. La trimérie se retrouve chez les Magnoliales, les Laurales et les Pipérales, la pentamérie uniquement chez les Canellaceae. Pour les fleurs à phyllotaxie spiralée, la mérosité au sein d’une série fluctue selon les fleurs en suivant un nombre des séries de Fibonacci (ex : Calycanthaceae). Ce phénomène se retrouve également chez les eudicotylédones basales notamment chez les Ranunculaceae. Dans ce dernier groupe on trouve également des fleurs pentamères alors que les fleurs de eudicotylodénes basales sont majoritairement dimères (mérosité de 2) ou trimères (Endress 2011).

La symétrie : deux grandes catégories de symétrie sont retrouvées au niveau de la fleur des angiospermes, la symétrie radiale ou actinomorphie (plusieurs plans de symétrie identiques) et la symétrie bilatérale ou zygomophie (un seul plan de symétrie). La symétrie est en général définie à partir du périanthe mais l’androcée est également considéré dans certains cas. Quelques exceptions existent, avec des espèces présentant des fleurs dissymétriques (ex : au sein des Fumarioideae, une sous-famille des Papaveraceae) ou asymétriques (ex : certaines Fabaceae, Cannaceae). L’actinomorphie est considérée comme l’état ancestral de la symétrie chez les angiospermes. La zygomorphie apparait assez tard dans le registre fossile et a avoir évoluée à de nombreuses reprises indépendamment durant l’histoire évolutive des angiospermes (Jabbour et al. 2008 ; Citerne et al. 2010). On la retrouve ainsi chez les monocotylédones (ex : Zingiberales, Orchidaceae) et chez les eudicotylédones (ex : Fabaceae, Asteraceae). Au contraire les angiospermes basales présentent une symétrie radiale comme la plupart des eudicotylédones ayant divergé précocement (ex : Ranunculales ; Damerval &

Nadot 2007). La zygomorphie est considérée comme une innovation évolutive clé, promoteur de la diversification. En effet elle est associée à un positionnement plus précis du pollinisateur sur la fleur et ainsi une pollinisation plus efficace et un meilleur degré de spécificité. Ce degré de spécificité rend possible l’isolement reproducteur et ainsi la spéciation (Sargent 2004).

Le périanthe : Le plus souvent le périanthe est composé de deux verticilles d’organes différents, le plus externe est un verticille de sépales (calice) et le plus interne un verticille de pétales (corolle). Les pétales et les sépales présentent une organisation relative variée ; ils sont soit imbriqués (se recouvrant partiellement suivant un pattern fixé), valvés (jointifs sans se recouvrir) ou ouverts (séparés). Ils peuvent également être fusionnés, partiellement ou totalement. Il existe une très grande variabilité de formes pour les organes du périanthe et leurs fonctions peuvent également être différentes. Chez de nombreuses familles, les sépales sont plus petits et moins colorés que les pétales. Ils servent en grande partie à la protection du bouton floral. Au contraire les pétales sont souvent colorés et voyants, participant ainsi à la reconnaissance visuelle à longue distance des insectes ou animaux pollinisateurs (Thomson & Wilson 2008 ; Dyer et al. 2012). Dans certains cas, les sépales et les pétales ne peuvent pas être morphologiquement distingués, leurs aspects étant parfaitement similaire, on parle alors de tépales (ex. Magnolideae, Asparagales). Le périanthe est particulièrement modifié et complexe chez certaines espèces à symétrie bilatérale et à pollinisation très spécialisée (ex : Orchidaceae chez les monocotylédones ; Fabales, Lamiales chez les eudicotylédones). La modification peut aboutir par exemple à la formation d’un éperon, structure dédiée à la présentation de grandes quantités de nectar aux pollinisateurs. Les éperons sont considérés comme une innovation évolutive clé des angiospermes, favorisant l’isolement reproducteur et donc la spéciation (Hodges & Arnold 1995). La disparition des sépales est un événement rare ; il intervient lorsque la fonction de protection du bouton floral a été transférée aux pétales (ex : Apiaceae, Rubiaceae) ou à la préfeuille florale (Acanthaceae ; Endress 2011). Les sépales sont parfois réduits et occupent une autre fonction que la protection, comme par exemple une fonction dans la dispersion des graines chez les Asteraceae (pappus). La disparition ou la réduction des pétales s’est produite plusieurs fois (ex : Cyperaceae, Fagales). Il semble, en fonction de la distribution de la présence ou de l’absence des pétales selon les groupes taxonomiques, que les pétales ont évolué, disparu et réapparu plusieurs fois au cours de l’histoire des angiospermes (Endress 2011). Chez certains groupes, le périanthe est perdu entièrement, le bouton floral étant protégé par les bractées ou les préfeuilles (ex : Chloranthaceae, Piperales, Poales, Betulaceae ;

Endress 2011). La simplification du périanthe, voir sa disparition, est souvent associée à une pollinisation par le vent (Linder 1998 ; Culley et al. 2002 ; Friedman & Barrett 2008). Une des conséquences de la perte du périanthe est que la position et le nombre des organes internes, notamment les étamines, deviennent très labiles (Endress 1990).

L’androcée : L’androcée est constitué de l’ensemble des étamines, lieu de production du pollen (D’Arcy 1996). Au sein de la fleur les étamines peuvent être arrangées en verticilles ou en spirale. Lorsque les étamines sont nombreuses l’arrangement peut être plus complexe et irrégulier (Ronse De Craene & Smets 1987 ; Ronse De Craene & Smets 1998). Le nombre d’étamines est très variable chez les angiospermes et il a augmenté et diminué de très nombreuses fois au cours de l’histoire évolutive de ce groupe. Les fleurs possédant un grand nombre d’étamines sont qualifiées de « polyandres » tandis que par opposition, celles possédant un petit nombre d’étamines sont qualifiées d’«oligandre » (Ronse De Craene & Smets 1998). Plusieurs centaines ou plusieurs milliers d’étamines se retrouvent chez différentes familles (Arecaceae, Lecythidaceae ou Cactaceae par exemple). Une augmentation aussi importante du nombre d’étamines nécessite un réceptacle floral élargi par exemple chez Tambourissa (Monimiaceae ; Endress & Lorence 1983) ou des filets très fins. Certaines morphologies florales semblent incompatibles avec des étamines nombreuses. C’est notamment le cas de la zygomorphie (Jabbour et al. 2008) et des inflorescences très compactées des Asteraceae par exemple. L’évolution du nombre d’étamines est discutée plus en détails dans le chapitre 2 de cette thèse. Certaines étamines peuvent être stériles, c’est-à-dire que les anthères ne produisent pas de pollen ou du pollen non fonctionnel, on parle alors de staminodes. Les staminodes peuvent se trouver dans les fleurs hermaphrodites côtoyant les étamines et dans les fleurs unisexuées femelles, constituant les vestiges des étamines. Les staminodes peuvent avoir différentes fonctions dans la pollinisation, telles que l’attraction des pollinisateurs ou la production de récompenses pour ces derniers (Walker-Larsen & Harder 2000 ; Ronce De Craene & Smets 2001).

Le gynécée : Le gynécée est composé de l’ensemble des carpelles qui contiennent les ovules. On distingue trois parties distinctes dans un carpelle, le stigmate, partie distale sur laquelle se posent les grains de pollen, le style, partie médiane dans laquelle progresse le tube pollinique et l’ovaire, partie basale qui renferme les ovules. Chez la majorité des angiospermes, les carpelles sont soudés (syncarpie) et les styles sont unifiés au moins sur une partie de leur

longueur. Les tubes polliniques sont ainsi répartis entre les différents carpelles même si les grains de pollen ont une répartition hétérogène sur les stigmates. Une sélection des meilleures cellules reproductrices mâles est alors effectuée à l’échelle du gynécée (Armbruster et al. 2002). La syncarpie est considérée comme une innovation évolutive clé des angiospermes et elle est apparue plusieurs fois au cours de leur histoire chez les monocotylédones et chez les eudicotylédones (Endress 2011). Chez la majorité des angiospermes basales, un seul carpelle est présent ou lorsqu’il y en a plusieurs, ils ne sont pas soudés (apocarpie). Chez les monocotylédones, le nombre de carpelles est le plus souvent 3 alors que chez la majorité des eudicotylédones il oscille entre 2 et 5. Chez les angiospermes basales et les eudicotylédones ayant divergé le plus précocement, le nombre de carpelles peut être plus élevé. Ils sont alors organisés en plusieurs verticilles ou en spirale. Les plus grands nombres de carpelles se retrouvent chez les Monimiaceae (2000 carpelles chez Tambourissa ficus ; Lorence 1985) et chez les Ranunculaceae (10 000 carpelles chez Laccopetalum giganteum ; Tamura 1995 cité dans Endress 2011). On observe une corrélation entre un grand nombre de carpelles et l’apocarpie et entre un nombre plus faible de carpelles et la syncarpie. Cette corrélation est probablement due à des contraintes architecturales qui ne permettent pas d’organiser un grand nombre de carpelles de manière à ce qu’ils puissent être fusionnés (Endress 2006). Une des caractéristiques morphologiques importantes du gynécée est la position de l’ovaire par rapport au réceptacle floral. Il est dit infère lorsqu’il est situé en dessous du plan d’insertion des pièces florales et donc inclus dans un réceptacle floral concave. Il est dit supère lorsqu’il est situé au dessus du plan d’insertion des pièces florales et donc positionné au dessus d’un réceptacle floral convexe. Les ovaires infères sont supposés protéger les ovules de la prédation, notamment par les pollinisateurs pouvant être également phytophages tels que les coléoptères (Grant 1950).

La « synorganisation » des organes floraux : L’une des tendances évolutives majeures de la fleur des angiospermes est l’augmentation de la « synorganisation » des différents organes. La « synorganisation » est définie comme la connexion de deux ou plus éléments structurels pour former un système fonctionnel (Soltis et al. 2009). Elle résulte de l’imbrication ou de la fusion des organes au sein d’un verticille ou entre les verticilles. Nous avons vu notamment que les pièces de la corolle peuvent être soudées pour donner des structures morphologiquement complexes telles que l’éperon et qui jouent un rôle prépondérant dans la pollinisation par les animaux. Les carpelles sont également fréquemment soudés afin d’optimiser la reproduction (voir ci-dessus). La fusion des étamines, bien que plus rare que celle des pétales ou des

carpelles, se retrouve chez certains groupes et pourrait jouer un rôle dans l’optimisation du transfert du pollen par les pollinisateurs (Ren & Tang 2010). Chez les Asteraceae notamment, les anthères sont soudées et forment un tube autour du gynécée. La fusion d’organes appartenant à des verticilles différents intervient principalement entre les pétales et les étamines et entre les étamines et les carpelles. Dans le deuxième cas, la « synorganisation » permet la présentation secondaire du pollen sur le gynécée (Endress 2011). L’acquisition et la perte de la « synorganisation » des fleurs ont eu lieu plusieurs fois durant l’histoire évolutive des angiospermes (Soltis et al. 2009).

Le contrôle génétique de la mise en place des organes floraux

Les nombreuses variations de la morphologie de la fleur décrites ci-dessus s’inscrivent dans un cadre développemental et sont régulées par des mécanismes génétiques dont l’étude est en plein essor. La découverte des gènes à MADS-box a ouvert la voie à la compréhension du contrôle génétique de la mise en place des organes floraux (Coen & Meyerowitz 1991). Le premier modèle proposé est connu sous le nom de « modèle ABC » et suggère que la détermination de l’identité des organes est réalisée par l’action de gènes appartenant à trois fonctions différentes A, B et C (Coen & Meyerowitz 1991). Selon ce modèle, l’action des gènes de la fonction A permet la mise en place des sépales et conjointement avec ceux de B la mise en place des pétales. L’action des gènes de la fonction C au centre de la fleur permet le développement des carpelles par arrêt de croissance du méristème et conjointement avec ceux de B, le développement des étamines. Chez Arabidopsis thaliana, les gènes de la fonction A sont APETALA1 et APETALA2, ceux de la fonction B, APETALA3 et PISTILLATA et AGAMOUS pour la fonction C. Par exemple, la mutation du gène AGAMOUS provoque le remplacement des étamines par des pétales. D’autres modèles ont été proposés par la suite, ajoutant par exemple des gènes de la fonction E (famille des gènes SEPALLATA) activant les gènes du modèle ABC (Pelaz et al. 2000 ; Honma & Goto 2001 ; Castillejo et al. 2005). Il a été proposé que les différentes protéines codées par ces gènes interagissent en quartets (Theissen & Melzer 2007). Un modèle alternatif au modèle ABC, FBC propose que la formation des sépales soit permise par l’absence d’expression des gènes B plutôt que par l’expression des gènes A. Les gènes de la fonction F s’exprimeraientt dans toute la fleur pour permettre la formation du méristème floral (Schwarz-Sommer et al. 1990). Les autres caractéristiques de la morphologie de la fleur sont soumises au contrôle d’autres gènes. Par exemple la mise en place de la symétrie bilatérale est notamment contrôlée par les gènes CYCLOIDEA, DICHOTOMA, RADIALIS et DIVARICATA chez Antirrhinum majus et par des

orthologues de ces gènes chez d’autres espèces (Busch & Zachgo 2009 ; Preston et al. 2011). Chez Linaria vulgaris, un mutant naturel présentant une symétrie radiale au lieu de la symétrie bilatérale habituelle, présente une modification épigénétique de l’orthologue de CYCLOIDEA (Cubas et al. 1999). Le rôle de l’épigénétique dans l’évolution de la morphologie florale est un champ de recherche qui reste encore largement à explorer. Si les gènes à MADS-box semblent être responsables du contrôle de la mise en place des organes floraux chez toutes les angiospermes (Bowman 1997), les limites de leurs zones d’activité au sein de la fleur en développement peuvent être un peu différentes suivant les groupes. Le modèle ABC proposé d’abord chez les eudicotylédones (Arabidopsis et Antirrhinum) présente des limites franches entre les zones d’expression des différents gènes, permettant une détermination forte des différents verticilles d’organes. En revanche, chez les angiospermes basales, il semble que les limites d’expression soient moins clairement définies, résultant en un gradient dans la morphologie des organes (voir Frohlich 2007). Chez le nénuphar par exemple, il y a une continuité entre les pétales et les étamines (continuité liée à l’organisation spiralée des organes floraux). Les modifications de limites des zones d’expression des gènes à MADS-box et les nouvelles interactions établies par les protéines qu’ils codent ont probablement participé à la diversification des angiospermes (Theissen et al. 2000).

La morphologie de la fleur et la pollinisation

De nombreux traits morphologiques des fleurs sont des adaptations au processus de pollinisation, c’est-à-dire au transfert du pollen des anthères d’une fleur au pistil de la même ou d’une autre fleur pour permettre la reproduction sexuée. Ce transfert peut se faire passivement au sein d’une même fleur ou grâce à des agents de pollinisation entre des fleurs différentes. Lorsque le pollen fécondant provient du même individu que les ovules, on parle d’autogamie (autofécondation). Dans le cas contraire on parle d’allogamie. Il est fréquent de rencontrer chez les angiospermes un système de reproduction mixte, autogamie et allogamie. Différentes stratégies évitant ou limitant l’autogamie ont été sélectionnées : la dioecie, l’auto-incompatibilité, la dichogamie mais aussi des adaptations morphologiques comme par exemple l’hétérostylie ou l’énantiostylie (Barrett 2002). L’autogamie peut néanmoins constituer un avantage en permettant le maintien de la reproduction dans les milieux pauvres en agents de pollinisation, où le transfert de pollen est limitant (Wilcock & Neiland 2002).

Les agents de pollinisation peuvent être abiotiques (vent et eau) ou biotiques (animaux). De nombreux traits floraux constituent des adaptations à l’interaction de la plante avec les agents de pollinisation, afin d’optimiser le transfert du pollen. Des modifications importantes de la morphologie en fonction des différents pollinisateurs ont ainsi été mises en évidence (par exemple Whittall & Hodges 2007 ; Thomson & Wilson 2008). Des expériences de modification de la morphologie dans des populations naturelles ont montré que certains traits floraux sont bien le résultat d’une adaptation (Campbell 2009). En revanche, un effet de la sélection sur les variations phénotypiques n’est pas toujours mis en évidence dans les populations actuelles. Il semble donc que la mise en place des traits floraux constituant une adaptation à la pollinisation se soit faite rapidement durant les périodes d’intense diversification et qu’en dehors de ces périodes la sélection intervienne peu (Harder & Johnson 2009). Environ 90 % des angiospermes ont leur pollen transporté par des animaux (entomophilie), en grande majorité des insectes (Hyménoptères, Diptères, Lépidoptères et Coléoptères) mais aussi des oiseaux et des chauves-souris (Fleming et al. 2009). Dans ce cas, un certain nombre de traits floraux servent au signalement et à la reconnaissance des fleurs par les pollinisateurs : notamment la couleur, la symétrie, les guides nectarifères, les odeurs, le relief de la structure des pétales. Il semble que les premières espèces d’angiospermes avaient déjà mis en place cette interaction plante-pollinisateur et que leur pollen était transporté par les insectes (Thien et al. 2000). Environ 10% des espèces d’angiospermes ont leur pollen transporté par le vent (anémophilie). Ce mode de pollinisation a évolué plusieurs fois à partir de la pollinisation par les insectes, dans des lignées indépendantes. Ce mode de transfert de pollen est souvent associé à de petites fleurs, peu voyantes, au périanthe réduit. Il est probablement avantageux pour assurer la reproduction dans des conditions environnementales où les pollinisateurs sont rares (Culley et al. 2002 ; Friedman & Barrett 2008 ; Friedman & Barrett 2009). De nombreuses caractéristiques morphologiques des fleurs liées à la pollinisation sont apparues plusieurs fois dans l’histoire évolutive des angiospermes, dans des lignées parfois très éloignées phylogénétiquement. Cela peut s’expliquer par le fait que les pressions écologiques et environnementales étant très fortes sur la morphologie de la fleur, des morphologies identiques pourront être sélectionnées chez des espèces non apparentées mais vivant dans des conditions environnementales proches. Il en résulte que les convergences sont fréquentes dans l’histoire évolutive de la fleur et qu’il faut y être particulièrement attentif si l’on utilise ces caractères pour la phylogénie ou la classification.

L’optimisation du transfert de pollen et l’interaction avec l’agent de pollinisation ne sont pas les seules forces de sélection qui peuvent s’appliquer sur la morphologie florale. Par exemple la résistance aux herbivores ou à des stress environnementaux peut également exercer une contrainte sur l’évolution des traits (Strauss & Whittall 2006).

Les inflorescences

Chez de nombreuses espèces d’angiospermes, les fleurs ne sont pas solitaires mais réunies en inflorescence. Différentes architectures d’inflorescences existent et leur classification est parfois difficile. En revanche leur organisation est souvent caractéristique d’un groupe taxonomique (Prenner et al. 2009). On distingue couramment les inflorescences dont l’axe principal est indéterminé (racèmes), de celles dont l’axe est déterminé (cymes). Les inflorescences peuvent être simples, c’est-à-dire ne comportant qu’un seul axe, ou bien porter de plus ou moins nombreux embranchements. L’existence et la position des bractées et bractéoles (aussi appelées préfeuilles) sont également des caractéristiques importantes de l’architecture des inflorescences. Par exemple, chez de nombreux eudicotylédones, une paire de bractées constitue les premiers organes d’un axe d’inflorescence alors que chez les monocotylédones il n’y en a qu’une (Prenner et al. 2009). La taille et le nombre d’inflorescences portées par un même pied sont variables en fonction notamment de stratégies de reproduction et des ressources disponibles (Shoen & Dubuc 1990). La répartition des organes reproducteurs au sein des fleurs permet la mise en place d’un premier niveau de diversité dans les modes de reproduction. Les fleurs peuvent ainsi être hermaphrodites ou unisexuées. La répartition de ces fleurs hermaphrodites ou unisexuées sur les inflorescences permet la mise en place d’un deuxième niveau de diversité dans les modes de reproduction. Des associations complexes de fleurs unisexuées et hermaphrodites sur la même inflorescence, sur des inflorescences différentes ou sur des plantes différentes sont retrouvées chez certains groupes. Des hypothèses sur la fonction des différentes architectures des inflorescences ont été proposées et concernent différents aspects de la reproduction (résumées dans Jordan & Harder 2006). Les différents types d’inflorescences pourraient influencer le comportement des agents de transport du pollen et ainsi la dispersion du pollen. Ils joueraient notamment un rôle dans l’attraction des pollinisateurs et leur comportement au sein de l’inflorescence. L’architecture de l’inflorescence influencerait également la répartition des ressources entre les fruits produits ainsi que la prédation et la dispersion des fruits et des graines.

Comme pour la morphologie des fleurs certaines caractéristiques des inflorescences ont été sélectionnées plusieurs fois au cours de l’histoire évolutive des angiospermes, suggérant à nouveau que les pressions environnementales sont fortes et conduisent à des phénomènes de convergence. Néanmoins la diversité des architectures des inflorescences est également le fruit d’une interaction entre l’adaptation et les processus de développement (Prusinkiewicz et al. 2007). Le contrôle génétique du développement des inflorescences est de plus en plus étudié. Il semble que des gènes tels que LEAFY, APETALA1 et TERMINAL FLOWER1 jouent un rôle important dans la mise en place de l’inflorescence chez Arabidopsis thaliana (Prenner et al. 2009).

Partie II : La famille des palmiers

Les palmiers (Arecaceae ou Palmae) constituent une famille emblématique d’Angiospermes monocotylédones. Cette famille compte 183 genres et approximativement 2 500 espèces (Palmweb 2013), distribués dans toutes les zones tropicales et subtropicales du globe (Fig. 2). Les palmiers sont présents majoritairement dans la région Asie-Pacifique (environ 1 600 espèces), en Amérique centrale et du Sud (environ 730 espèces) et de manière moins diversifiée en Afrique (environ 65 espèces).

Fig. 2 : Distribution des espèces actuelles de palmiers (Dransfield et al. 2008)

Les palmiers constituent les seuls représentants de l’ordre des Arecales (Fig. 1). Selon la dernière classification APGIII (Angiosperm Phylogeny Group 2009), ils appartiennent au groupe des Commelinidae, au sein desquels néanmoins les relations phylogénétiques restent incertaines. Les palmiers pourraient ainsi être le groupe frère des Dasypogonaceae ou bien des autres membres des Commelinidae (Poales, Commelinales et Zingiberales). La monophylie de la famille est bien soutenue tant par les caractères morphologiques que par les marqueurs moléculaires (Baker et al. 2009). Cependant peu de caractères morphologiques sont exclusifs aux palmiers et non partagés par d’autres membres des Monocotylédones. L’appareil végétatif des Cyclanthaceae est par exemple très similaire à celui des palmiers (Stevens 2001). C’est le mode de développement des feuilles (présenté plus loin) qui semble être la caractéristique majeure de la famille.

La diversification des différentes lignées de palmiers pourrait avoir commencé au milieu du Crétacé il y a environ 100 millions d’années sur le supercontinent Laurasie (représentant actuellement l’Amérique du Nord et l’Europe ; Couvreur et al. 2011). Baker et al. (2012a et b) suggèrent que la répartition actuelle des espèces est plus probablement le résultat de phénomènes de dispersion sur de longues distances plutôt que due au phénomène de vicariance.

La famille des palmiers a été largement étudiée et décrite. L’ensemble des travaux concernant son évolution et sa classification a été réuni dans un livre, Genera Palmarum (Dransfield et al. 2008). Une grande partie des informations présentée dans la suite de cette introduction fait référence à cet ouvrage.

Les habitats des palmiers

Les palmiers occupent des habitats tropicaux et sub-tropicaux très diversifiés (Dransfield et al. 2008). Ils sont présents dans toutes les forêts tropicales humides (Fig. 3a et b), sous la forme d’arbustes de sous-bois, de grands arbres émergeant de la canopée ou de lianes (palmiers grimpants ou rotins tels que les espèces du genre Calamus) s’accrochant aux troncs des autres arbres. Ils constituent les végétaux les plus communs des zones montagneuses tropicales. On les trouve également dans les habitats humides tels que les mangroves (Fig. 3c) et les forêts inondées d’Amazonie (varzea), ils sont présents sur les littoraux (Fig. 3d), dans les forêts sèches, les savanes et les oasis (Fig. 3e). Dans les zones sub-tropicales, les habitats sont également variés. Par exemple, le genre Serenoa est présent dans les forêts de pins en Floride (Fig. 4a), Rhopalostylis dans les forêts légèrement tempérées de Nouvelle-Zélande, Trachycarpus dans les montagnes de l’Himalaya (Fig. 4b) et Chamaerops dans les végétations de type maquis en Afrique du Nord et en Méditerranée (Fig. 4c). La principale limitation écologique à la distribution des palmiers est la température. En effet ces organismes ne peuvent pas entrer en dormance (cf. description morphologique ci-dessous) et ne peuvent donc pas survivre à de longues périodes de gel qui induisent des dommages irréversibles à leurs cellules (Tomlison 2006). La présence de palmiers dans un milieu semble également fortement corrélée à la disponibilité en eau (Bjorholm et al. 2005 ; Kreft et al. 2006) et en énergie (liée au rayonnement solaire ; Eiserhardt et al. 2011). Le genre Nannorrhops est le seul à présenter des conditions de vie réellement désertiques.

Fig. 3 : Illustration de la diversité morphologique des palmiers et de leurs habitats en zone tropicale, de gauche à droite et de bas en haut : (a) forêt tropicale humide en Amazonie, Bactris, Attalea, Euterpe et Astrocaryum, (b) Howea fosteriana à Lord Howe Island en Australie, (c) Nypa fruticans en Papouasie, (d) Cocos nucifera en Nouvelle Guinée, Areca catechu et (e) Phoenix dactylifera à Oman (photographies (a) Couvreur et al. 2011 (b-e) Palmweb)

La plus grande diversité spécifique de palmiers (90%) se trouve dans les forêts tropicales humides (Couvreur et al. 2011). Ils constituent l’un des membres les plus remarquables et les plus importants de ce biome. Par leur diversité et leur abondance, ils jouent des rôles écologiques majeurs entre autres dans la structuration et la composition des sols ou les interactions plantes-animaux (Henderson 2002 ; Dransfield 2008).

Particularités morphologiques et anatomiques

L’appareil végétatif de la majorité des palmiers présente une architecture caractéristique et aisément reconnaissable. Il se constitue d’un tronc, appelé stipe, pouvant être de grande taille et portant des feuilles palmées ou pennées (Fig. 5).

Les palmiers appartiennent au groupe des Monocotylédones dont les membres se caractérisent par l’absence de croissance secondaire. Si la majorité des Monocotylédones sont des

herbacées à faible longévité, certaines espèces sont néanmoins capables d’occuper la strate arborée et d’accroitre leur durée de vie. C’est le cas chez les palmiers mais aussi chez les bambous, les pandanus et les Zingibérales (Stevens 2001). La transition vers des formes de vie arborées a eu lieu vraisemblablement plusieurs fois de manière indépendante dans ce groupe (Fig. 1). L’accroissement de la taille peut potentiellement constituer un avantage compétitif pour la photosynthèse mais aussi pour la dispersion du pollen et des graines. Une des principales caractéristiques des palmiers est donc leur capacité à former des organismes à port arboré, et ayant une longévité importante, uniquement à partir de processus de croissance primaire (Tomlison 2006). En effet tous les tissus d’un palmier sont issus de méristèmes primaires racinaires et apicaux en constant fonctionnement, complétés par des méristèmes intercalaires. Une fois établis, les tissus primaires ne pourront donc pas être remplacés et resteront actifs pendant la durée de vie du palmier, qui peut se mesurer en siècles. En ce sens les palmiers sont différents des arbres considérés comme « vrais » car produisant du bois, que l’on retrouve parmi les conifères et les eudicotylédones. Ces organismes produisent continuellement de nouveaux tissus vasculaires secondaires à partir du cambium. Celui-ci génère le bois (xylème) vers l’intérieur et le liber (phloème) vers l’extérieur. Ces tissus ne fonctionnent que durant quelques décennies, puis deviennent inactifs et conservent uniquement leurs propriétés mécaniques. Le bois ainsi formé permet le maintien du port érigé du tronc. Le constant renouvellement des tissus vasculaires rend possible la survie de l’individu pendant plusieurs siècles. L’absence de croissance secondaire pose donc un certain nombre de questions concernant la formation du stipe et la longévité des palmiers. Les stipes peuvent atteindre de grandes hauteurs et maintenir un port érigé en développant d’abondantes fibres lignifiées, associées ou non aux vaisseaux conducteurs (Tomlison et al. 2011). Ces fibres se retrouvent également dans les feuilles à qui elles confèrent leur résistance. Le système vasculaire et les fibres occupent l’intégralité du stipe en grands faisceaux verticaux. Lors de la croissance du jeune palmier, le stipe croît d’abord en diamètre jusqu'à atteindre la circonférence de maturité, avant de croitre en hauteur. Le diamètre est donc fixé précocement. Chez certaines espèces néanmoins le stipe peut présenter une augmentation ultérieure du diamètre par l’augmentation de la taille et du nombre des fibres.

Compte-tenu des caractéristiques morphologiques et anatomiques présentées ci-dessus, le stipe des palmiers est le plus généralement non ramifié. En effet un axe dont les capacités mécaniques et de transport sont fixées et limitées par la croissance primaire ne peut pas porter de trop nombreux et volumineux embranchements. Certains palmiers néanmoins peuvent

avoir des bourgeons axillaires (à la base des feuilles) qui se développent pour former de nouveaux axes (ex : Chamaedorea) ou parfois présenter une division dichotomique du méristème apical (ex : Nypa ; Dransfield et al. 2008). Le développement des bourgeons et les divisions de l’apex sont le plus souvent situés à la base du stipe principal et chaque embranchement produit son propre système racinaire (Tomlinson et al. 2011). Cependant chez Hyphaene coriaceae, les divisions de l’apex se font à différents niveaux du stipe, donnant un aspect général inhabituel à ce palmier.

Fig. 4 : Illustration de la diversité morphologique des palmiers et de leurs habitats en zone sub-tropicale, de gauche à droite: (a) Serenoa repens en Floride, (b) Trachycarpus martianus au Népal, (c) Chamaerops humilis à Majorque (photographies Palmweb)

La longévité des cellules du stipe, les mécanismes qui leur permettent de rester fonctionnellement et métaboliquement actives durant une très longue période sont encore mal connus et constituent un vaste champ de recherche pour l’avenir (Tomlinson et al. 2012). L’absence de croissance secondaire confère des avantages aux palmiers qui échappent ainsi à certaines limitations écologiques rencontrées par les arbres possédant un cambium. Ils sont plus résistants aux feux, aux pathogènes et au vent (Tomlison 2006). L’activité permanente des tissus primaires leur enlève néanmoins la capacité à entrer en dormance, expliquant leur vulnérabilité au gel et ainsi leur répartition presque exclusivement tropicale et subtropicale. Des modifications du stipe sont également observées chez une catégorie de palmiers présentant un mode de vie particulier, les palmiers grimpants ou rotins (ex : Calamus). Chez

ces espèces, le stipe est fortement allongé (jusqu’à plusieurs centaines de mètres) et porte des épines et des structures permettant de s’accrocher aux autres arbres (Sunderland 2012).

L’extrémité du stipe porte un méristème apical solitaire qui produit les feuilles. Chez la plupart des palmiers adultes, les feuilles sont arrangées en hélice ou en spirale et la phyllotaxie suit les séries de Fibonacci (Dransfield et al. 2008). Comme pour la majorité des Monocotylédones, la feuille se divise en trois parties : une partie basale pouvant entourer entièrement le stipe (cette structure est alors appelée la gaine), un pétiole et la partie terminale portant les folioles. Cette dernière présente deux grands types d’organisation, palmée ou pennée (Fig. 5). Contrairement aux feuilles palmées, les feuilles pennées possèdent un axe prolongeant le pétiole et portant les folioles. Observées en détail, les feuilles de palmiers sont extrêmement complexes. L’implantation des folioles peut suivre des patterns variés, en hélice, en spirale, avec des angles et des tailles d’«entre-nœuds » différents. Les folioles sont souvent pliées ou ondulées créant des feuillets aux orientations et aux angles variés. Leur extrémité est parfois découpée de façon régulière ou irrégulière. Les combinaisons possibles de ces caractères expliquent la grande diversité morphologique des feuilles de palmiers. Leur mode de développement est unique parmi les plantes à fleurs. Les feuilles se développent en structure pliée mais non divisée lorsqu’elles sont en bouton et deviennent composées par la séparation des folioles durant l’expansion.

Fig. 5 : Illustration des deux principales morphologies de feuille, de gauche à droite : (a) palmée (Licuala lauterbachii) et (b) pennée (Calamus gibbsianus) (photographies Palmweb)

En période de floraison, le stipe produit une ou plusieurs unités reproductrices ou inflorescences. Celles-ci sont le plus souvent ramifiées et produisent de très nombreuses petites fleurs. Cependant chez certaines espèces, il existe un seul axe d’inflorescence, généralement en forme de pointe (ex : Geonoma). Les inflorescences sont positionnées par rapport aux feuilles de deux manières différentes en fonction de leur mode de développement. Dans un premier cas, les inflorescences se développent à la base des feuilles par transformation du bourgeon axillaire en axe reproducteur (en général un seul par feuille). Elles parviennent à maturité au milieu des feuilles ou bien en dessous après la chute des feuilles qui les soutenaient. Les feuilles et les inflorescences se développent en série, de manière indéfinie (situation qualifiée de pléonanthique). Dans un deuxième cas, le stipe poursuit sa croissance végétative sans produire d’inflorescence jusqu’au moment où le méristème apical se change en méristème d’inflorescence. Une panicule terminale et massive, située au dessus des feuilles, est alors produite entrainant la mort de l’axe, incapable de reprendre une croissance végétative. Cette situation qualifiée d’hapaxanthique est rare chez les palmiers (ex : Corypha, Metroxylon et Tahina ; Dransfield et al. 2008). Les fleurs de palmiers sont généralement petites, de quelques millimètres à quelques centimètres. Les Phytelepheae constituent une exception au sein de la famille, avec des fleurs femelles pouvant atteindre une vingtaine de centimètres. Les fleurs de palmiers présentent le plan d’organisation trimère caractéristique de la plupart des Monocotylédones. Chez la majorité des espèces, les fleurs possèdent trois sépales, trois pétales et un ou trois ovules. Cependant le périanthe peut être parfois composé de six tépales (ex : Nypa, Chelyocarpus et Elaeis) ou réduit à un anneau avec des lobes (ex : Thrinax ou Phytelephas). Si le nombre de pièces du périanthe et du gynécée est très peu variable, en revanche il existe chez les palmiers une très grande variabilité dans le nombre d’étamines (Uhl & Moore 1980). Les botanistes ont longtemps pensé que le pollen des palmiers était dispersé par le vent. Mais des études plus détaillées ont montré que la pollinisation se fait presque exclusivement par des insectes appartenant aux groupes des coléoptères, des hyménoptères et des diptères (Henderson 1986, 2002 ; Barfod et al. 2011). La description de l’évolution des inflorescences et des fleurs chez les palmiers est l’un des objectifs de cette thèse, elle est étudiée en détail dans les Chapitres 1 et 2.

Les fruits des palmiers présentent une large diversité, entre autres, de forme, de taille, de texture, et d’organisation interne. La forme est la plus souvent obovoïde ou ellipsoïdale. La taille est très variable de quelques millimètres de diamètre chez les espèces de Geonoma à

près de 50 cm de long chez Lodoicea maldavica par exemple. La plupart sont lisses mais certaines peuvent porter des écailles (ex : Raphia farinifera) ou des poils (ex : Wettinia quinaria). Certains sont secs, d’autres charnus. La grande majorité des palmiers sont adaptés à une dispersion des graines par les animaux (Zona et Henderson 1989, Henderson 2002).

Les palmiers constituent des organismes uniques, par le mode de croissance de leur stipe et la morphologie de leurs feuilles mais ils sont aussi connus pour être la famille des records biologiques. Ceux-ci incluent le stipe le plus large (pouvant dépasser un mètre de diamètre chez Jubaea chiliensis) et le plus long (près de 200 m chez les palmiers grimpants tels Calamus), la plus grande feuille (25 m et plus chez Raphia regalis), la plus grande inflorescence (8 m de longueur et plus de 24 millions de fleurs chez Corypha umbraculifera), le plus grand fruit et la plus grande graine (jusqu’à 25 kg chez Lodoicea maldavica).

Des palmiers et des hommes : importance économique et conservation

Les palmiers fournissent de nombreux services écosystémiques et ont un intérêt économique important. Ils se classent troisièmes après les Poaceae et les Fabaceae, dans la liste des familles les plus importantes sur le plan de l’économie et de l’utilité alimentaire (Haynes et McLaughlin 2000). La majorité des ressources fournies par les palmiers sont exploitées dans le milieu naturel par les populations locales (exploitation de subsistance) mais quelques espèces constituent des cultures d’intérêt majeur, comme le cocotier (Cocos nucifera ; Fig. 3d), le palmier dattier (Phoenix dactylifera ; Fig. 3e) ou le palmier à huile (Elaeis guineensis). Les espèces de palmiers non domestiquées sont importantes pour les populations aux ressources souvent limitées, vivants à proximité des forêts tropicales. Ils fournissent des matériaux pour la construction des maisons, les outils, les meubles et les vêtements, ils sont utilisés comme combustible et constituent une source de nourriture et de substances médicinales. De nombreuses espèces de palmiers sont également utilisées comme plantes ornementales dans les jardins des zones tropicales et subtropicales et dans les serres des jardins botaniques du monde entier. Outre des qualités esthétiques indéniables, ils sont également appréciés pour leur haute résistance à la transplantation. Le stipe est en effet capable de retenir une grande quantité d’eau, ce qui les rend tolérants aux déplacements. Ils ont également une capacité illimitée à générer de nouvelles racines adventices par un mécanisme encore inconnu (Tomlinson et al. 2006).

Malgré l’importance des populations naturelles de palmiers pour le maintien des écosystèmes tropicaux (principalement les forêts humides) et pour la subsistance des populations humaines locales, un certain nombre d’espèces sont aujourd’hui menacées de disparition. Les effectifs des populations sont réduits principalement par la surexploitation et la destruction des habitats. La majorité de la diversité spécifique des palmiers se trouve dans les forêts tropicales humides qui connaissent aujourd’hui un déclin dû à la déforestation au profit de l’agriculture. L’effet négatif de la déforestation est double : un effet direct de destruction des individus et des habitats et un effet indirect de la fragmentation des habitats (Galetti et al. 2006). En effet, les petites populations isolées sont plus vulnérables à l’extinction. De plus, l’habitat fragmenté constitue un milieu défavorable pour les agents de dispersion, pollinisateurs et disséminateurs de graines, fragilisant un peu plus les populations de palmiers. Une quarantaine d’espèces de palmiers sont présents dans la Liste Rouge de l’IUCN (IUCN 2012). La plupart sont classées comme vulnérables ou ayant un risque d’extinction faible. Six espèces sont considérées comme en danger d’extinction et deux en danger critique, Hyophorbe lagenicaulis (Page 1998) et Tahina spectabilis (Rakotoarinivo et Dransfield 2012). Une espèce semble être aujourd’hui éteinte dans le milieu naturel, Cryosophila williamsii (Evans 1998). Le nombre important d’espèces dans la famille, leur vaste distribution et leur présence dans des zones parfois difficiles d’accès, rendent le suivi de la viabilité des populations de palmiers difficile. De nombreuses données concernant leur statut sont certainement à mettre à jour et à compléter et des espèces sont peut être en voie d’extinction sans qu’il soit possible de le détecter. Si certaines espèces font déjà l’objet de mesures de protection, comme par exemple Livistona alfredii dans le « Millstream National Park » (Australie ; Dowl 1998), la conservation des palmiers ne pourra être efficace que par la création de nouvelles aires protégées et l’éducation des autorités et des populations concernées. Sauvegarder ces espèces dans les jardins botaniques et les banques de graines ne peut constituer qu’une mesure provisoire.

Jusqu’à maintenant peu d’études ont été réalisées sur la capacité des palmiers à répondre aux changements climatiques. De nombreuses espèces insulaires ou de zones montagneuses pourraient être fortement menacées (Dransfield 2008). En revanche des déplacements d’aires de répartition en relation avec la hausse des températures ont déjà été observés. Trachycarpus fortunei voit ainsi son aire de répartition s’étendre vers le Nord en Europe au fur et à mesure des variations des minimums hivernaux de température (Walther et al. 2007).

Classification et relations phylogénétiques

La taxonomie des palmiers est actuellement une discipline très dynamique et un effort considérable a été fourni durant les dernières décennies pour réaliser des révisions taxonomiques des différents genres et tribus. Ces travaux ont été synthétisés dans le livre de Dransfield et al. (2008) qui présente la classification et les caractéristiques des 183 genres. Ces genres sont répartis dans 5 sous-familles (les Calamoideae, les Nypoideae, les Coryphoideae, les Ceroxyloideae et les Arecoideae), 28 tribus (Fig. 6) et 27 sous-tribus. Cette classification se base sur les relations phylogénétiques mises en évidence par diverses études utilisant des caractères morphologiques et moléculaires. Les groupes (sous-familles, tribus et sous-tribus) ont été reconnus sur le critère de la monophylie. Notons que dans deux tribus, les Areceae et les Trachycarpeae, les preuves étaient insuffisantes pour inclure certains genres dans les sous-tribus. Ils sont considérés comme « non placés » (unplaced) dans la classification (Fig. 6).

Les Calamoideae regroupent environ un quart des espèces connues de palmier (21 genres et 645 espèces) et leur aire de répartition s’étend sur les zones tropicales d’Amérique, d’Afrique et de la région indopacifique. Les membres de cette sous-famille se distinguent par des écailles présentes sur le gynécée et sur le fruit (Dransfield et al. 2008). On trouve notamment dans cette sous-famille les genres de palmiers grimpants aussi appelés rotins (ex : Calamus). Comprenant 391 espèces, Calamus est le genre le plus diversifié des palmiers. Les Calamoideae se placent comme le groupe frère de tous les autres palmiers dans diverses études phylogénétiques (Asmussen et al. 2006 ; Baker et al. 2009). La sous-famille Nypoideae est particulière au sein des palmiers car elle ne contient qu’un seul genre monospécifique (Nypa fructicans). Nypa est le palmier de mangrove dont l’aire de répartition s’étend en Asie et dans la zone ouest du Pacifique. Ce palmier présente une morphologie particulière, notamment au niveau de l’inflorescence, qui le distingue des autres sous-familles. Les études phylogénétiques placent généralement cette espèce comme groupe frère de tous les palmiers excepté les Calamoideae (Asmussen et al. 2006 ; Baker et al. 2009). Les Coryphoideae constituent une large sous-famille (45 genres et 519 espèces) incluant le genre très diversifié Licuala (153 espèces). Leur aire de répartition comprend toute la ceinture tropicale. La majorité des espèces (plus des 2/3) vivant en dehors des forêts tropicales humides appartiennent à cette sous-famille (Thomas et de Franceschi 2012). Ils se reconnaissent notamment à leurs feuilles palmées portées par la plupart des espèces. On

retrouve dans ce groupe le palmier dattier, Phoenix dactylifera (tribu des Phoeniceae). Les Coryphoideae sont groupe frère du clade comprenant les Ceroxyloideae et les Arecoideae.

Fig. 6 : Classification des palmiers basée sur les études phylogénétiques (Dransfield et al. 2008)

Les Ceroxyloideae constituent une sous-famille de taille modeste mais dont l’aire de répartition est très diversifiée. Les 8 genres et 47 espèces sont répartis dans trois tribus. La tribu Cyclospatheae contient un seul genre présent uniquement dans les Caraïbes et en Amérique du Nord. Les Ceroxyleae regroupent des genres morphologiquement et génétiquement similaires mais éloignés géographiquement (l’un à Madagascar, un autre en Australie et deux autres dans les Andes). Les Phytelepheae sont originaires d’Amérique du Sud. Malgré une diversité morphologique (des structures végétatives et reproductives) importante entre les sous-tribus, la sous-famille apparaît monophylétique dans de nombreuses phylogénies moléculaires (Asmussen et Chase 2001 ; Asmussen et al. 2006 ; Savolainen et al. 2006 ; Trénel et al. 2007 ; Baker et al. 2009). Elle constitue le groupe frère des Arecoideae. Les Arecoideae constituent la plus large et la plus diversifiée sous-famille des palmiers. Ses représentants sont présents dans les régions tropicales du globe, en Amérique centrale et du Sud, en Afrique, à Madagascar et sont particulièrement nombreux dans la région

indopacifique. Ils se distinguent par des feuilles pennées et par l’organisation des fleurs sur les inflorescences (cf Chapitre 1). On trouve notamment dans ce groupe, le cocotier, Cocos nucifera et le palmier à huile, Elaeis guineensis (tribu des Cocoseae). La monophylie de ce groupe est bien soutenue par les études de phylogénie moléculaire (Asmussen et Chase 2001 ; Asmussen et al. 2006 ; Savolainen et al. 2006 ; Baker et al. 2009 ; Baker et al. 2011).

Les délimitations des genres au sein de la famille ont été fréquemment redéfinies. Des divisions taxonomiques ont parfois été réalisées à partir de variations morphologiques infimes ou bien à partir de spécimens incomplets. Les palmiers ayant des périodes de floraison aléatoires il est parfois difficile d’échantillonner les fleurs et les fruits, caractères pourtant essentiels pour différencier de nombreuses espèces de palmiers. Au fur et à mesure des nouvelles missions de terrain et des révisions taxonomiques, les contours des genres sont modifiés, de nouveaux sont créés et d’autres abandonnés. Par exemple, Jeanson (2011a) a suggéré de replacer les espèces du genre Wallichia au sein du genre Arenga. De nouvelles espèces sont encore régulièrement découvertes. Elles sont alors rattachées à un genre existant (par exemple Adonidia maturbongsii, Baker et Heatubun 2012) ou bien classées dans un nouveau genre (par exemple, Dransfieldia, Baker et al. 2006 ou Tahina, Dransfield 2008). Les phylogénies moléculaires ont permis de progresser dans la compréhension des contours des genres en révélant la paraphylie de certains d’entre eux. Ainsi, le genre Lanonia a été créé pour accueillir 8 espèces qui semblaient appartenir au genre Licuala (Henderson & Bacon 2011) sur des critères morphologiques.

Les premières tentatives de classification des palmiers, rendant compte de leur évolution, ont été réalisées grâce à l’observation de grandes tendances évolutives mais sans reconstruction phylogénétique (notamment Moore 1973 ; Uhl et Dransfield 1987). De nombreuses études ont ensuite été menées pour élucider les relations phylogénétiques au sein de la famille, d’abord à partir de caractères morphologiques et anatomiques, puis très rapidement à partir de caractères moléculaires. Ces travaux ont permis de tester les premières classifications. Certains groupes ont été confortés, d’autres modifiés pour aboutir à la classification la plus récente, présentée en Fig. 6 et dont les subdivisions actuellement identifiées (sous-familles et tribus) ont été présentées ci-dessus (Dransfield et al. 2005 ; Dransfield et al. 2008). Les phylogénies basées sur les caractères morphologiques se sont d’abord concentrées sur des niveaux taxonomiques inférieur à celui de la famille (par exemple Henderson 1990 ; Barfod 1991 ; Zona 1999). La première étude à l’échelle de la famille a associé à des caractères

morphologiques, des caractères moléculaires, le polymorphisme de longueur des fragments de restriction de l’ADN chloroplastique (RFLP ; Uhl et al. 1995). Des phylogénies moléculaires à l’échelle de la famille, s’appuyant sur des séquences d’ADN, ont été publiées par la suite. Elles ont pour la plupart utilisé des marqueurs chloroplastiques tel trnL-trnF (Baker et al. 1999 ; Asmussen et al. 2000 ; Amussen et Chase 2001 ; Asmussen et al. 2006), rps16 (Asmussen et al. 2000 ; Amussen et Chase 2001 ; Asmussen et al. 2006), rbcL (Amussen et Chase 2001 ; Hahn 2002 ; Asmussen et al. 2006), atpB (Hahn 2002) ou matK (Asmussen et al. 2006). Deux marqueurs nucléaires ont été testés à l’échelle de la famille : une partie de l’ADN ribosomique (18S ; Hahn 2002) et le gène à faible nombre de copies codant pour la malate synthétase (MS ; Lewis et Doyle 2001). D’autres marqueurs nucléaires ont été développés chez les palmiers, mais utilisés à des niveaux taxonomiques inférieurs, pour résoudre les relations phylogénétiques au sein d’une sous-famille par exemple. Citons notamment les régions non-codantes de l’ADN ribosomique (ITS ; Baker et al. 2000) et deux gènes à faible nombre de copies (PRK et RPB2, codant respectivement pour la phosphoribulokinase et une sous-unité de l’ARN polymérase II ; Lewis & Doyle 2002 ; Roncal et al. 2005). Les marqueurs chloroplastiques sont fréquemment utilisés car ils sont présents en de nombreuses copies identiques dans une même cellule et sont ainsi plus facilement amplifiés par PCR. Ils ont en outre prouvé leur efficacité à différents niveaux taxonomiques dans divers groupes de plantes. Cependant les palmiers ayant un temps de génération très long, il semble que l’évolution de leur génome chloroplastique soit lente (Asmussen & Chase 2001). Des études ont montré que le taux de substitution des nucléotides est plus faible chez les palmiers comparativement à d’autres Monocotylédones (Gaut et al. 1992 ; Gaut et al. 1996). Ces conclusions ont pourtant été remises en cause (notamment Cuenca & Asmussen-Lange 2007) et il semblerait plutôt que les taux de substitution soient variables au sein de la famille, selon la lignée et le marqueur. Pour les reconstructions phylogénétiques, les marqueurs nucléaires sont en général plus délicats à utiliser que les marqueurs chloroplastiques, notamment lorsqu’ils sont présents en multiples copies divergentes (paralogues). Différentes copies assemblées dans une même étude et présentant des histoires évolutives différentes peuvent provoquer des confusions dans les relations phylogénétiques. Pour contourner ce problème les marqueurs sont choisis au sein de l’ADN ribosomique dont on pense que les multiples copies évoluent de manière concertée ou parmi des gènes à faible nombre de copies. Cependant des paralogues peuvent tout de

même exister dans certains groupes et gêner la reconstruction phylogénétique (Baker et al. 2000 ; Lewis & Doyle 2002 ; Feliner & Rossello 2007). Le choix des marqueurs moléculaires à l’échelle des tribus et des sous-tribus est discuté dans le Chapitre 3 de cette thèse.

Comme pour de nombreux groupes d’Angiospermes (Angiosperm Phylogeny Group 2009), les phylogénies moléculaires ont apporté de grandes améliorations à la classification des palmiers. L’une des modifications les plus importantes suggérées par les phylogénies moléculaires concerne l’identité de la lignée groupe frère de tous les autres palmiers. Le genre Nypa a longtemps été considéré comme occupant cette place la plus à la base de l’arbre phylogénétique (Uhl et al. 1995). Il s’avère au vu des phylogénies moléculaires que ce sont les Calamoideae qui constituent le groupe frère de tous les autres palmiers (Asmussen et al. 2006 ; Baker et al. 2009). Les phylogénies moléculaires ont également contribué à améliorer la compréhension de l’évolution de la famille et des biomes qui lui sont associés. En 2009, Baker et al. ont publié une synthèse de toutes les études phylogénétiques sous la forme d’un super-arbre (et d’une super-matrice). Cette phylogénie présente une résolution satisfaisante au niveau des genres, même si certaines relations ne sont pas encore bien résolues notamment au sein des Arecoideae. Elle a été datée (Couvreur et al. 2011) à l’aide de différents fossiles (les fossiles identifiés comme appartenant à la famille des palmiers sont passés en revue dans Dransfield et al. 2008). La phylogénie a ainsi permis d’estimer l’âge de diversification des différentes lignées, d’étudier les taux de diversification (Couvreur et al. 2011) mais aussi de commencer à expliquer la répartition géographique des espèces (Baker et al. 2012 a et b). Elle offre également un cadre et un support pour étudier l’évolution des caractères morphologiques (Nadot et al. 2011).

Objectifs et méthodes

Mon travail s’inscrit dans une thématique générale de compréhension de l’évolution de la morphologie de la fleur des angiospermes. Celle-ci en effet présente une variabilité beaucoup plus importante que celle observée au niveau des organes reproducteurs d’autres groupes. La fleur est ainsi considérée comme étroitement liée au succès évolutif de ce groupe. Néanmoins, la compréhension des mécanismes évolutifs, souvent multiples et imbriqués, qui ont conduit à cette variabilité est délicate. En effet les seules données dont nous disposons sont le phénotype et le génotype (souvent partiel) des espèces actuelles, c’est-à-dire le résultat de l’évolution. Depuis quelques décennies, nos connaissances des relations phylogénétiques dans les différents groupes du vivant ont considérablement progressé (voir par exemple, Tree of Life Web Project, Maddison et al. 2007). Des avancées ont été réalisées en biologie moléculaire permettant d’obtenir des données moléculaires pour un très grand nombre d’espèces et en informatique permettant de traiter ces larges jeux de données. Des phylogénies robustes et bien résolues sont maintenant disponibles pour des niveaux taxonomiques différents. Elles fournissent un excellent cadre théorique pour l’étude de l’évolution des caractères morphologiques. Regarder l’évolution d’un caractère dans un cadre phylogénétique constitue une des premières étapes de la compréhension des mécanismes qui ont conduit à sa diversité et à sa répartition actuelle chez différents organismes.

Si l’aspect général des palmiers, à travers la morphologie de leur appareil végétatif, est extrêmement reconnaissable et emblématique, leur appareil reproducteur et ses spécificités sont beaucoup moins connus. Les inflorescences et les fleurs des palmiers possèdent des caractères constants et d’autres extrêmement variables, pouvant parfois sembler labiles. Parmi les caractères qui varient peu à l’échelle de la famille, il y a notamment l’architecture des inflorescences. Celles-ci sont le plus souvent constituées d’un axe principal indéterminé, présentant des ramifications portant les fleurs. En revanche la répartition des organes reproducteurs entre les fleurs (hermaphrodite ou unisexuée) et l’organisation de ces fleurs sur les inflorescences sont des caractères variables. Il en résulte une grande diversité dans les systèmes sexuels au sein de la famille. Le périanthe trimère ou le nombre d’ovules (1 ou 3) sont également des caractères très bien conservés à l’échelle de la famille. Au contraire, le nombre d’étamines est l’un des traits floraux présentant la plus grande variabilité tant au niveau inter-générique qu’intra-générique.

L’objectif principal de ma thèse est d’étudier l’évolution du système sexuel et du nombre d’étamines, deux caractères liés à la morphologie de l’appareil reproducteur et qui sont particulièrement variables à l’échelle de la famille des palmiers.

Les caractéristiques des inflorescences et des fleurs des espèces de palmiers sont étudiées et constituent souvent des critères essentiels pour les divisions taxonomiques. Les descriptions morphologiques des différents genres et espèces de palmiers forment une littérature abondante et riche, en partie synthétisée dans un livre « Genera Palmarum » (Dransfield et al. 2008). Durant ma thèse j’ai rassemblé une partie de ces informations, en me concentrant sur les traits morphologiques liés au système sexuel et au nombre d’étamines, afin de les étudier dans un contexte phylogénétique. J’ai notamment étudié la distribution de la variabilité de ces traits le long de l’arbre phylogénétique, identifié les états ancestraux et les transitions qui ont eu lieu au cours de l’histoire évolutive du groupe. Afin de compléter les informations de la littérature concernant le nombre d’étamines et commencer à comprendre les mécanismes évolutifs qui ont contribué à la diversité de ce caractère, j’ai réalisé des observations sur des fleurs provenant de collections. Ainsi, pour 82 espèces le nombre d’étamines a été compté et la production de grains de pollen par fleur a été estimée. D’importants progrès ont été réalisés dans les connaissances phylogénétiques de la famille des palmiers. De nombreuses phylogénies ont été publiées, se basant d’abord sur des caractères morphologiques, puis essentiellement sur des caractères moléculaires. Ces recherches ont abouti en 2009 à la parution d’une phylogénie incluant au moins un représentant de tous les genres de la famille (Baker et al. 2009). Cette phylogénie a été révisée et datée en 2011 (Couvreur et al. 2011) et offre un cadre solide pour notre étude. Cependant dans certains groupes, les relations phylogénétiques au niveau des genres et des espèces sont encore incertaines et demandent à être complétées. Durant ma thèse, j’ai donc réalisé une phylogénie au niveau spécifique d’une sous-tribu de 12 genres, dont les espèces présentent une variation particulièrement importante du nombre d’étamines.

Organisation du manuscrit

Le premier chapitre est consacré à l’étude de l’évolution du système sexuel chez les palmiers. La morphologie des fleurs hermaphrodites et unisexuées et leur organisation sur les inflorescences sont détaillées en relation avec les différents systèmes sexuels présents dans la famille. L’évolution du système sexuel est reconstruite sur l’arbre phylogénétique des genres afin d’étudier les transitions qui ont eu lieu à l’échelle de la famille. Les relations entre les systèmes sexuels et la pollinisation, ainsi que les bases génétiques de la détermination des sexes sont également évoquées. Le deuxième chapitre traite de l’évolution du nombre d’étamines à l’échelle de la famille. Cette étude se base sur les données de la littérature et sur des observations personnelles de fleurs provenant de collections. Afin d’appréhender les mécanismes évolutifs qui ont contribué à la diversité de ce caractère, le nombre d’étamines est confronté à la production de grains de pollen par fleur. Dans un troisième chapitre est présentée une étude de l’évolution du nombre d’étamines à une échelle taxonomique inférieure. Une phylogénie moléculaire de la sous-tribu des Ptychospermatinae est réalisée et utilisée pour reconstruire l’évolution du nombre d’étamines. Les implications de cette phylogénie pour la taxonomie de ce groupe sont également discutées. La synthèse des résultats et les perspectives sont présentées dans une conclusion générale.

Chapitre 1 : Evolution du système sexuel chez les palmiers

Contexte et objectifs de l’étude

La répartition des fleurs hermaphrodites et/ou unisexuées dans les différents groupes de fleurs, au sein d’une inflorescence, entre les inflorescences et entre les individus, constitue un caractère très variable chez les palmiers. Cela aboutit à une grande variabilité dans la distribution spatiale des organes mâles et femelles qui est l’une des composantes principales du système sexuel au sens large. Les autres composantes impliquent notamment la temporalité de maturation des organes sexuels et les modalités de croisement (fécondation croisée ou auto-fécondation ; Barrett 2002). Cette étude constitue un article de revue dont les objectifs sont : (1) de faire une synthèse de la répartition spatiale et temporelle des sexes au sein des fleurs, des inflorescences et des individus chez les palmiers ; (2) d’étudier la morphologie des fleurs hermaphrodites et unisexuées, et notamment le dimorphisme entre les fleurs mâles et femelles ; (3) de construire l’évolution des systèmes sexuels ; (4) d’étudier le lien entre la répartition des sexes et la pollinisation et (5) de faire une synthèse des connaissances sur les bases génétiques de la détermination du sexe.

Caractéristiques des inflorescences et des fleurs de palmiers

La répartition des sexes chez une espèce est classiquement divisée en trois catégories : l’hermaphroditisme, la monoécie et la dioécie. Dans chacune de ces catégories, les fleurs hermaphrodites ou unisexuées peuvent être organisées de manière différente sur les inflorescences. Pour comprendre la diversité des systèmes sexuels chez les palmiers, il est nécessaire d’étudier la diversité des formes des inflorescences et la diversité des modes de répartition des fleurs sur ces inflorescences (la reconstruction de ce caractère est présentée en Annexe 1).

Les palmiers produisent de nombreuses fleurs (de plusieurs centaines à plusieurs millions) regroupées sur des inflorescences souvent massives. On retrouve ainsi chez Corypha umbraculifera l’une des plus grandes inflorescences des angiospermes (8 mètres de long et 24 millions de fleurs). Ces inflorescences constituent le plus souvent un système monopodial, indéterminé et ramifié. Elles sont formées d’un axe principal né à la base d’une feuille (ou plus rarement à la base d’une feuille modifiée ou d’une bractée). Cet axe ne porte pas de

ramification dans la partie proximale, appelé pédoncule, mais en porte dans la partie distale, appelé rachis (Fig. 7 ; Uhl & Dransfield 1984). Ces inflorescences sont parfois qualifiées de panicule, même si ce terme est le plus souvent réservé à des inflorescences déterminées (Prenner et al. 2009). Chez certaines espèces cependant les inflorescences ne possèdent qu’un axe principal et aucune ramification, elles sont en général en forme de pointe (qualifiées de « spicate » en anglais ; Dransfield et al. 2008). La première bractée formée, appelée prophylle, englobe l’inflorescence en développement et parfois même l’inflorescence mature. Le pédoncule peut porter une ou plusieurs bractées vides tandis que le rachis présente une bractée à chaque insertion de ramification latérale. Ces ramifications peuvent elles-mêmes porter d’autres ramifications qui seront accompagnées par des bractées. Le pattern de ramification de l’axe principal se retrouve donc au niveau des embranchements latéraux et cela jusqu’à cinq ou six fois chez certaines espèces (ramification d’ordre cinq ou six). Toutes les ramifications, y compris l’axe principal, se terminent par une partie portant les fleurs, appelée rachilla. Cette architecture de l’inflorescence est ainsi bien conservée à l’échelle de la famille même si quelques variations sont apparues dans certains groupes (Uhl & Dransfield 1984).

Fig. 7 : Morphologie caractéristique des inflorescences de palmiers, système monopodial, indéterminé et ramifié ; à gauche Prestoea acuminata ; à droite Archontophoenix myolensis (photographies Palmweb)

Les fleurs peuvent être hermaphrodites (organes mâle et femelle dans la même fleur) ou unisexuées (organes mâle et femelle dans des fleurs différentes). Chez certaines espèces, les

fleurs sont solitaires, accompagnées d’une bractée et d’un pédicelle portant une bractéole. Elles peuvent également être sessiles, la bractée et la bractéole étant alors réduites ou absentes. Chez certaines Calamoideae et Coryphoideae (Borasseae), les fleurs possèdent deux bractéoles alors que le cas le plus courant chez les monocotylédones est une seule (Prenner et al. 2009). Les fleurs peuvent également être réunies en groupes de différents types. Les plus courants sont des groupes à organisation sympodiale, aussi appelés cincinni, dans laquelle la bractéole d’une fleur porte une seconde fleur, dont la bractéoles porte une troisième fleur et ainsi de suite (Uhl & Dransfield 1984 ; Dranfield et al. 2008). Dans ce cas l’inflorescence des palmiers est tout à fait particulière car elle réunit deux types d’organisations emboîtées, l’une ordonnant les ramifications de l’inflorescence et l’autre ordonnant les fleurs sur les rachillae (Fig. 8). Les espèces hermaphrodites présentent souvent des fleurs solitaires (par exemple chez les Cryosophileae, Coryphoideae). Celles-ci peuvent être également organisées en cincinni de deux fleurs (Lepidocaryeae, Calamoideae) ou plus chez les Chuniophoeniceae, Corypheae et chez certains Trachycarpeae (Coryphoideae). La répartition des fleurs unisexuées mâles et femelles chez les espèces monoiques est variable. Elles sont assez fréquemment réunies en groupes bisexués et ainsi placées sur le même rachilla. Chez la majorité des Arecoideae et chez les Caryoteae (Coryphoideae), les fleurs sont regroupées dans des cincinni de trois fleurs, appelés triades. Une triade est composée d’une fleur femelle entourée de deux fleurs mâles. Il est possible que des fleurs mâles en paires ou solitaires soient présentes dans la partie distale du rachilla, par formation de triades incomplètes. Chez les Chamaedoreeae (Arecoideae), un groupement de fleurs particulier est présent : une rangée de fleurs dont la première est une fleur femelle et les suivantes des fleurs mâles, appelée acervulus. Chez les Calamoideae, on peut trouver des organisations différentes et atypiques. Chez Oncocalamus par exemple, un groupe central de 1 à 3 fleurs femelles est entouré de deux cincinni latéraux de 2 à 4 fleurs mâles, constituant un mode d’organisation des fleurs unique chez les palmiers. Chez Raphia, la partie proximale du rachilla porte les fleurs femelles tandis que la partie distale porte les fleurs mâles. La répartition des fleurs unisexuées sur des rachillae unisexués (Nypoideae) ou sur des inflorescences unisexuées (notamment Arecoideae) est relativement rare chez les palmiers. Les fleurs unisexuées des espèces dioiques sont souvent solitaires. Chez les Calamoideae, chez les Borasseae (Coryphoideae), une différence d’organisation des fleurs entre les individus mâles et femelles est observée : les fleurs femelles sont solitaires (parfois accompagnées d’une fleur mâle stérile) et les fleurs mâles réunies en cincinni. Les

Phytelepheae (Ceroxyloideae) constituent un groupe à part parmi les palmiers puisque ce sont les seuls à présenter une organisation monopodiale de leur groupe de fleurs unisexuées.

Organisation sympodiale des fleurs

Ramification monopodiale

Fig. 8 : La double organisation des inflorescences de palmiers : système monopodial, indéterminé et ramifié des axes de l’inflorescence, organisation sympodiale des fleurs (schéma adapté à partir de Uhl & Dransfield 1984 et Dransfield et al. 2008)

Les fleurs unisexuées présentent fréquemment un dimorphisme qui s’exprime au niveau de la taille, de la morphologie globale et de celle des organes reproducteurs. Dans ces fleurs unisexuées, des organes stériles de l’autre sexe sont souvent présents (Nadot et al. 2011). Il s’agit du pistillode dans les fleurs mâles et des staminodes dans les fleurs femelles. La présence de ces organes stériles leur donnant un aspect structurel et morphologique de fleurs hermaphrodites. Les fleurs sont néanmoins fonctionnellement mâles ou femelles. Dans certains cas, les organes stériles sont très réduits ou absents et seuls les organes d’un sexe sont apparents dans les fleurs. Elles sont donc structurellement (morphologiquement) et fonctionnellement unisexuées. Le pistillode et les staminodes sont probablement des organes reliques (héritage d’un pattern de développement de fleur hermaphrodite) ou peuvent potentiellement jouer un rôle dans le processus de pollinisation (Walker-Larsen & Harder 2000 ; Ronse de Craene & Smet 2001). Ils participent à l’attraction visuelle des pollinisateurs. En effet Lorsque les récompenses ne sont présentes que dans un type de fleurs, les pollinisateurs sont capables de les identifier et de les visiter préférentiellement. Les organes stériles évitent ce processus et favorisent ainsi une pollinisation croisée efficace. Les

staminodes peuvent également être consommés par les pollinisateurs. Chez Calyptrogyne ghiesbreghtiana par exemple, les chauves-souris pollinisatrices les consomment (Dransfield et al. 2008). Le pistillode peut également abriter des nectaires, presque équivalents à ceux présents au niveau du gynécée des fleurs femelles. De telles structures ont été trouvées par exemple chez Euterpe precatoria et Dypsis befojo (Dransfield et al. 2008).

Synthèse des résultats

Il existe une grande diversité au niveau des systèmes sexuels chez les palmiers. Les trois systèmes principaux des angiospermes, hermaphrodisme, monoécie et dioécie sont représentés. Ils le sont néanmoins dans des proportions différentes que celles retrouvées à l’échelle des angiospermes. Ainsi la majorité des espèces de palmiers sont monoïques (52%) contre 3 à 19% seulement chez l’ensemble des angiospermes. Certains systèmes sexuels plus complexes, associant des fleurs hermaphrodites et unisexuées au sein de la même espèce, sont également représentés et le plus fréquent semble être l’andromonoécie. Différentes organisations des fleurs sont associées à chaque système sexuel. Les fleurs peuvent être solitaires ou organisées en groupes. L’organisation des fleurs la plus répandue chez les espèces monoïques est le cincinnus. Il s’agit d’un système sympodial regroupant des fleurs unisexuées. Lorsque le cincinnus est composé d’une fleur femelle entourée de deux fleurs mâles, il est appelé triade. La grande majorité des espèces hermaphrodites et monoïques présentent un décalage temporel de maturation des sexes (dichogamie). La protandrie et la protogynie existent chez les palmiers, mais il semble que la protandrie soit plus fréquente. Les fleurs unisexuées présentent, dans certains groupes, un dimorphisme important, au niveau de la taille, de la forme globale et des organes. Aucune tendance dans le dimorphisme de taille n’a été détectée ; les fleurs femelles peuvent être plus grandes que les fleurs mâles et inversement suivant les groupes. La présence d’organes infertiles (staminodes et pistillode) est également variable. Certaines espèces peuvent posséder les deux types d’organes alors que d’autres n’en possèdent qu’un ou en sont totalement dépourvues. La reconstruction de l’évolution du système sexuel sur l’arbre phylogénétique des palmiers révèle que l’état ancestral est la monoécie. De nombreuses transitions entre les différents systèmes sexuels ont eu lieu au cours de l’histoire évolutive de la famille. Des transitions ont également eu lieu entre des fleurs fonctionnellement unisexuées mais structurellement

bisexuées (présentant des staminodes ou un pistillode) et des fleurs structurellement unisexuées. Il semble évident que le système sexuel ait un effet sur la pollinisation et sur l’interaction avec les nombreux insectes qui visitent les inflorescences de palmiers (pollinisateurs et phytophages). Cependant cette relation est encore peu étudiée. Des gènes MADS-box impliqués dans le modèle ABC ont été mis en évidence chez le palmier à huile (Elaeis guineensis). Des hormones pourraient être impliquées dans la détermination des sexes au cours du développement des inflorescences et des fleurs. Le séquençage de génomes entiers ouvre de nouvelles perspectives pour la compréhension des bases génétiques qui sous-tendent la diversité des systèmes sexuels.

Cet article est le résultat de la mise en commun de travaux de plusieurs chercheurs. Ma participation à ce travail concerne essentiellement la répartition spatiale des organes sexuels et l’évolution du système sexuel. J’ai notamment contribué à la rédaction des parties « Sexual expression in space », « Morphology of sexual expression » et « Evolution of sexual expression ». J’ai effectué les recherches conduisant aux résultats présentés dans la Table 1 et la Figure 5, sur la fréquence et l’évolution des systèmes sexuels dans la famille. Les données utilisées pour la reconstruction du système sexuel sont disponibles dans l’Annexe 1 du manuscrit de thèse. J’ai conçu et réalisé certaines figures de l’article : Table 1 et Figures 3 à 6. L’article de revue présenté sera soumis très prochainement au journal « Pespectives in Plant Ecology, Evolution and Systematics ».

Article 1

Diversity and evolution of sexual expression in palms (Arecaceae)

Sophie Nadot1,5, Elodie Alapetite1, William J. Baker3, James W. Tregear4, Anders S Barfod1,2

1Univ Paris-Sud, Laboratoire Ecologie, Systématique et Evolution, UMR 9079, Orsay, F- 91405, France 2Department of Biological Sciences, Aarhus University, Ny Munkegade 114, DK-8000 Aarhus C, Denmark 3Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK, 4Institut de Recherche pour le Développement (IRD), Palm Developmental Biology Group, UMR DIADE, 911 Avenue Agropolis BP 64501, 34394, Montpellier cedex 5, France 5Author for correspondence: [email protected]

Contents Introduction Overview of sexual expression in palms Sexual expression in space Plasticity of sexual expression Sexual expression in time Morphology of sexual expression The floral groundplan Sexual dimorphism Evolution of sexual expression Evolutionary pathways leading to separate sexual expression Hermaphroditic flowers: multiple gains or multiple losses? Sex and pollination Towards understanding the genetic basis of sexual separation in palms Molecular regulation of palm flower development Determination of flower and plant sexual dimorphism How might dichogamy be achieved in palms? Sexual expression in palms: immediate and long term prospects Conclusions Acknowledgements Literature cited

Keywords Palms; Palmae; dioecy; monoecy; Sexual system; Evolution; Flower morphology; Phylogeny; Pollination;

Introduction The amazing diversity of reproductive structures and strategies in flowering plants has fascinated botanists and evolutionary biologists ever since (Darwin, 1877) first published on the subject. Although the floral groundplan is highly conserved, with a sterile perianth surrounding sexual organs in which female organs almost invariably occupy the centre of the flower, there is seemingly endless variation in the shape, size, colour and number of floral organs across angiosperms. The reasons for such extensive reproductive diversity remain a

major issue in evolutionary biology. In the broad sense sexual systems relate to sexual expression in space and time, as well as to mating strategies (outcrossing vs. selfing). The term ‘breeding system’ is sometimes employed to describe the spatial arrangement of sexes (both sexes within the same flower, in different flowers borne on the same plant or each sex on a different plant), although it usually refers more specifically to the mating system (i.e., degree of outcrossing). Sexual expression in flowering plants is classically broken down into three main categories: hermaphroditism (in which all flowers are bisexual), monoecy (male and female flowers borne on the same plant), and dioecy (male and female flowers borne on different plants), although occasionally, combinations of unisexual and bisexual flowers in variable proportions can occur. Hermaphroditism is the most common pattern across angiosperms and is generally considered as the ancestral state, although some uncertainty remains concerning the ancestral flower of all angiosperms (see Endress and Doyle 2009). (Renner and Ricklefs 1995) noted the existence of dioecy in almost half of the angiosperm families, 7% of the genera and 6% of the species. These figures are affected by major changes in angiosperm classification over the last 15 years (Angiosperm Phylogeny Group 1998; 2003; 2009), but are nevertheless still widely cited. Less attention has been paid to monoecy in comparison to hermaphroditism and dioecy. In a survey of various temperate and tropical floras it was estimated that monoecy occured in 3 to 19% of angiosperm species (de Jong et al. 2008). Darwin (1877) considered monoecy an adaptation to favour out-crossing. More recently it has been considered a means to reduce pollen-stigma interference (Bertin and Newman 1993) and to allow flexible adjustment of sex allocation (Korpelainen 1998). (Renner and Ricklefs 1995) pointed to the fact that monoecy, like dioecy, is often associated with abiotic pollination. Besides these well-defined categories, a wide variety of sexual strategies exist in flowering plants, involving temporal separation of sexual phases (dichogamy) and various combinations of bisexual, male and female flowers that may even vary between populations of the same species. Among the angiosperms, the palm family stands out as being particularly diverse in sexual expression both in space and time. The family is a relatively species-rich group comprising ca. 2500 species, of which more than 90% are found in tropical rainforest (Couvreur, Forest, and baker, 2011). Palms are conspicuous, typically large-bodied organisms that often have major ecological impact in the plant communities where they occur (Peters et al., 2004). They are highly prized by rural dwellers as a source of food, shelter and many other services, in addition to including species of major economic importance (e.g., oil palm, date palm, coconut and rattan). Although somewhat constrained by their relatively simple

modular body plan, they display an impressive amount of variation in the architectural design of their leaf, stem and floral parts (Tomlinson, 2006). This huge diversity applies not least to sexual expression. Palm inflorescences range from unbranched, spicate structures to highly branched panicles, the ultimate branches (rachillae) bearing sessile flowers that are either solitary or grouped in sympodial clusters of two, three or more. Male and female functions are often separated in varied patterns in space and time, presumably to ensure cross-pollination in association with the pollinating vectors, and probably also to increase fitness by optimising the pollen/ovule ratio (Cruden, 2000).

The aim of this paper is: 1) to give a review of sexual expression across the palm family; 2) to summarize current knowledge of the developmental and genetic basis of sexual expression; 3) to reconstruct the evolution of some of the key characters leading to separation of male and female functions; and 4) to discuss putative evolutionary pathways of sexual expression in the family.

Overview of sexual expression in palms

Sexual expression in space

As mentioned above, sexual expression is unusually diversified in palms. Hermaphroditism, dioecy and monoecy are by far the most common states, but the so-called condition of “polygamy” (i.e., various combinations of bisexual and unisexual flowers on the same individual or on separate plants) also occurs (Dransfield et al., 2008). At both the genus and species level the prevalence of monoecy is highly pronounced, occurring in 61% and 52% of all genera and species respectively (Table 1). The spatial distribution of male and female functions takes place at various structural levels: within flowers (between floral organs) in hermaphroditic species; within flower clusters (between flowers), within inflorescences (between regions of the inflorescence); within individuals (between inflorescences) in some monoecious species; and between individuals in dioecious species (Fig. 1).

Monoecy - Monoecy in palms is found in several tribes of the family, and is achieved through various ways. Of the 54% of monoecious palm species, the vast majority is found in the species-rich Arecoideae, the largest subfamily of palms with more than half of all palm species (phylogenetic relationships among tribes and subfamilies of palms are shown on Fig. 2. In this almost entirely monoecious clade, most species are characterized by having flowers gathered in triads or clusters derived from triads. The triad is a highly condensed cincinnus consisting of a female flower, flanked by two, male flowers (Fig. 1). Male and female functions may be further separated by the concentration of fully developed triads at the base of the rachillae, with partially developed “triads” of 1-2 male flowers being produced distally. Monoecy with flowers organized in triads (consisting of one female flower flanked by two male flowers) also occurs in tribe Caryoteae in subfamily Coryphoideae (tribe Caryoteae), although the three genera vary in sexual expression. Caryota and some species of Arenga bear complete triads comprising both sexes, whereas remaining Arenga species and Wallichia present unisexual inflorescences by reduction of triads to pairs of male flowers or solitary female flowers (Dransfield and Mogea 1984)(Jeanson, 2011), resulting in monoecy at the individual level or, apparently, dioecy in some instances (Dransfield et al., 2008). A comparable phenomenon occurs in some Arecoideae (Elaeis and Attalea (tribe Cocoseae), Lepidorrhachis and Marojeya (tribe Areceae), and Wettinia (tribe Iriarteae)), where reduction

of triads results in unisexual inflorescences, with both male and female inflorescences occurring on the same individual (Baker and Hutton, 2006). The tribe Chamaedoreeae stands out in that in most genera flowers are grouped in rows along the rachillae, the so-called acervulus which is a specialized inverted type of cincinnus (Uhl and Moore 1978; Dransfield, Uhl et al. 2008). Each row has one proximal female flower followed by distal male flowers, the distal ones maturing first. Developmental studies (Ortega-Chavez and Stauffer 2011) studied the acervulus in Hyophorbe and provided insight into how this develops by a combination of rapid development and adnation, reminiscent of what is found in the unrelated genus Cordia (Boraginaceae). Other types of spatial arrangements of male and female flowers are found elsewhere in the palm family. For example, species of the African genus Raphia (tribe Lepidocaryeae, subfamily Calamoideae) bear solitary female flowers on the proximal parts of the rachillae and solitary male flowers on the distal parts, with dyads of one of each sex sometimes found at the junction, the sympodial dyad being a synapomorphy for the Calamoideae. In Oncocalamus, another member of the same tribe, the complex sympodial flower clusters consist of up to 11 flowers. The central 1-3 flowers are female and flanked by two cincinni of 2-4 male flowers. In the monotypic genus Nypa (Nypoideae), the solitary female flowers are borne on the club-shaped apex of the inflorescence, whereas the likewise solitary male flowers are densely packed on catkin-like rachillae, which are borne on lateral branching systems.

Dioecy - Complete separation of sexes on different individuals is observed in almost one third (29%) of palm species. Dioecy is the predominant sexual system in Calamoideae and Ceroxyloideae, where it occurs in 87% and 91% of the species respectively. In Calamoideae, flowers are borne in dyads (or apparent derivatives thereof) that display complex patterns of shifts between sexes as well as floral sterilisation and loss. In the species rich genus Calamus (tribe Calameae) for example, female plants carry dyads combining a sterile male flower and a functional female flower, and male plants bear solitary flowers, whereas in Mauritiella (tribe Lepidocaryeae) both female and male plants carry solitary flowers. In all dioecious Ceroxyloideae, flowers are solitary. Remarkable arrangements occur in the ceroxyloid tribe Phytelepheae, where the large male flowers are clustered in groups of a few flowers along the rachis and the solitary female flowers are spirally arranged along the rachis.

In the otherwise monoecious Arecoideae, the tribe Chamaedoreeae is notable in that it includes the only two truly dioecious genera present in the entire subfamily, namely Chamaedorea (the only genus of the tribe with solitary flowers) and Wendlandiella. In this latter genus, male flowers are arranged in rows (acervuli), like in the monoecious members of the tribe whereas the female flowers are solitary. Approximately 10% of the species in Coryphoideae are dioecious, the rest of the species bearing hermaphroditic flowers or being monoecious. In the otherwise hermaphroditic genus Licuala dioecy may occur in a few species (e.g. the Moluccan L. adscendens; Barfod and Heatubun 2009). Recently, Henderson and Bacon (2011) erected a genus to accommodate a group of dioecious species, most from Vietnam, hitherto referred to Licuala. Important fruit crops are found among the dioecious coryphoids in tribes Phoeniceae (date palm) and Borasseae (palmyra). In the date palm Phoenix dactylifera (tribe Phoeniceae), experiments have shown that female flowers can be induced to become functionally bisexual by hormonal in-vitro treatment (Masmoudi-Allouche et al. 2009). In cultivated collections of Phoenix species, hermaphroditic flowers are also sometimes seen to form in planta (Demason and Tisserat, 1980). Dioecy is also present in the tribe Chuniophoeniceae, which includes four genera among which Kerriodoxa (a monotypic genus endemic from peninsular Thailand) is strictly dioecious,

Hermaphroditism - Strictly hermaphroditic palms are most numerous in the Coryphoideae where they represent more than three quarters of the 453 species included in the subfamily in 28 of the 46 genera. Coryphoideae have hermaphroditic flowers with little variation in flower structure and flower size. The flowers of these species are either solitary or in cincinni of up to ten flowers (Corypha), Two other subfamilies also contain hermaphroditic species, to a lesser extent. Within Ceroxyloideae, Pseudophoenix, which is sister to the rest of the subfamily (Baker et al. 2009), is the only genus having hermaphroditic flowers. In this genus, the same inflorescence carries hermaphroditic flowers on the proximal part of the rachillae and male flowers with reduced gynoecia towards the apex (Dransfield et al. 2008). In Calamoideae, three genera are hermaphroditic, namely Eremospatha and Laccosperma (tribe Lepidocaryeae) and Korthalsia (tribe Calameae). In the first two genera the flowers are borne in dyads, in contrast to the latter one where flowers are solitary, although evidence from bracteoles suggests a possible reduction from dyads.

“Polygamy” - A handful of unrelated palm genera, found in Calamoideae and Coryphoideae, harbour complex combinations of bisexual and unisexual flowers, and are gathered under the vague term “polygamy”. The two polygamous genera of the subfamily Calamoideae, namely Eugeissona (tribe Eugeissoneae) and Metroxylon (tribe Calameae) from SE Asia and the Pacific region, display dyads composed of one male flower and one hermaphroditic flower, which corresponds to andromonoecy. A more complex situation has been described in two species of the tribe Trachycarpeae (Coryphoideae). Hermaphroditic flowers are found in association with male flowers in Rhapis laosensis, a species of the otherwise dioecious genus Rhapis (Giddey, Spichiger, and Stauffer, 2009). A detailed study of Trachycarpus takil (tribe Trachycarpeae) revealed an unstable sexual system with age- related changes from mainly male expression to mainly female expression (Kholia 2009). Cryptic andromonoecy/dioecy has also been reported in certain Australian and New Guinean species of Livistona and Saribus (Dowe 2001; Dowe 2009). In these species the flowers of all individuals are morphologically similar at anthesis. However, some trees never carry fruits and are therefore functionally male. Whether the fruit carrying palms are able to produce viable pollen grains remains to be demonstrated and thus the sexual system could either be functionally androdioecious or dioecious. The inflorescences are sometimes sexually dimorphic such as in L. concinna where the non-fruit carrying inflorescences are branched to one order higher than the fruit carrying inflorescences (Dowe and Barfod 2001). Chuniophoenix (two or three species distributed in Southern Asia) is occasionally andro- or gynodioecious, although most individuals bear bisexual flowers (Dransfield et al. 2008).

Plasticity in sexual expression

Little is known about gender plasticity in angiosperms in general, and palms make no exception. One study conducted on the andromonoecious palm Attalea speciosa (tribe Cocoseae, Arecoideae) showed considerable reproductive plasticity according to the environment. In pastures and groves, male reproduction started at significantly smaller heights of the palm than female reproduction, but not so in the forest (Barot, Mitja et al. 2005). Plasticity in the expression of male vs. female function was also noted in androgynomonoecious Attalea funifera (Voeks, 1988, , 2002). Although alterations in reproductive strategy by sex allocation may influence palm-pollinator interactions, they may also be regarded in some cases as a side effect of changes in resource allocation by the plant and not necessarily linked to pollination.

Changes in sexual expression have been observed in the African oil palm Elaeis guineensis, which produces female and male inflorescences in cycles (Adam et al., 2005; Adam et al., 2011). The length of these cycles are influenced by soil and light conditions and consequently the number of female inflorescences produced relative to male inflorescences is a variable feature that reflects forest dynamics, a factor that is exploited in oil palm plantations for obtaining higher yields (Freeman et al. 1981). In the dioecious species Chamaedorea tepejilote the number of inflorescences produced per plant was found to be positively correlated with height (age) in both male and female plants, but males produced significantly more inflorescences than females (Oyama and Mendoza 1990), this difference likely to be explained by resource allocation or pollination-related factors.

Sexual expression in time

Temporal separation of sexual expression operates at various spatial levels: flower level in the case of hermaphroditic flower (dichogamy sensu stricto), flower cluster level and inflorescence level in the case of monoecious taxa, plant level and population level in the case of dioecious taxa (Fig. 1). In many palm inflorescences sexual expression occurs in pulses or cycles, probably as an adaptation to the behavioural characteristics of the pollinating vector (pollination is discussed later in this review). Flower level – In palms bearing only hermaphroditic flowers, both protandry (male function matures before female function) and protogyny (the opposite) can be found, with no clear phylogenetic trend. (Barfod et al. 2003), reported a shift in sexual expression in two hermaphroditic species of Licuala distributed in Peninsular Thailand. In L. spinosa opening of the flowers along the rachillae is erratic where as in L. peltata flowering proceeds in pulses. Each pulse lasts 4-5 days. The flowers are protandrous and both the male and female phases last approximately one day. The distal tier of flowers on one 40-60 cm long rachilla initiates male anthesis on day one, and passes into the female phase on day two; the mid tier initiates male anthesis on day two and female anthesis on day three; the proximal tier initiates male anthesis on day three and female anthesis on day four. Flower cluster level – In monoecious taxa, most often there is a difference in anthesis between male and female flowers. This applies for example to Arecoideae and Caryoteae, in which the majority of species have protandrous triads. This may be due to architectural constraints of the sympodial triad, in which the female occupies the lateralmost position in the cincinnus and is therefore most likely to be the last to develop (Loo et al., 2006). In many

cases, the male and female antheses are separated by only a matter of days, but often the development of the female flower is substantially delayed. For example, in the extreme case of Howea, an entire year elapses between male and female anthesis (Savolainen et al., 2006). Nevertheless, several genera of Arecoideae are protogynous, despite the constraints of the triad. In the case of Pinanga and protogynous species of Hydriastele and Areca, this is achieved by the female flowers being congenitally open inside the inflorescence bud, the stigma being receptive as soon as the inflorescence expands (Loo et al., 2006). Female anthesis is of short duration and the male flowers, which are already fully developed, open shortly afterwards. Protogyny is also reported in Nypa, in which the female flowers, borne in a head at the apex of the main inflorescence axis, reach anthesis before the male flowers on highly branched lateral axes become exposed. The initiation of flowering along the rachillae is also quite variable. In Hyospathe elegans (tribe Euterpeae, Arecoideae) flowering is erratic in flowers of both sexes in the triad, and as a consequence male and female flowers at anthesis are interspersed along the rachillae without a clear pattern (Skov and Balslev 1989; Listabarth 2001). Opening of the flowers is also scattered throughout the rachillae even when flowers are not in triads, like in Licuala spinosa (Coryphoideae; Barfod, Burholt et al. 2003) or in Mauritia flexuosa (Calamoideae; Ervik 1993). In contrast, the initiation of flowering along the rachillae can be highly organized like for instance in Geonoma irina (Borchsenius 1997), in which a first pulse lasting 7-9 weeks is generated by the opening of the first-formed male flowers of each of the sunken triads. A second pulse of equal duration is initiated about three weeks later by opening of the second-formed male flowers. Lastly, three weeks later, the opening of the third and last formed, female flowers of each triad generates a pulse lasting 4-8 weeks.

Inflorescence level – Some palms go through gender phases as a consequence of sexual separation at the inflorescence level. This applies to hapaxanthic (i.e., flowering only once in their whole lifetime) members of the genus Arenga (tribe Caryoteae, Coryphoideae), which produce inflorescences in a basipetal sequence (Dransfield and Mogea 1984), the distal inflorescences entering anthesis before the proximal. In a few species, inflorescences bear flowers of both sexes, with triads of female and male flowers. However, towards the end of the lifecycle of the palm, inflorescences at the proximal and often naked part of the stem become male, by suppression of the female flower of the triad. For this reason, fruits are only produced in the uppermost inflorescences (Jeanson, 2011). Another example of temporal separation of sexual expression is the cyclic flowering of the African oil palm Elaeis

guineensis, and its South American congener E. oleifera (tribe Cocoseae). Male and female inflorescences are alternately produced, in cycles of varying duration, resulting in temporal dioecy. The inflorescences that open during male phases of flowering bear single functional male flowers, while the inflorescences that open during female phases carry triads composed of a female flower flanked by two abortive male flowers (Adam et al. 2005). The individual staminate flowers of the male inflorescence have been proposed to be structurally equivalent to the triad unit of the female inflorescence (Van Heel, Breure, and Menendez, 1987). The diversification of the palm family has led to an unusually high diversity in sexual expression (Fig. 1). Most combinations of the phenomena we have dealt with in the preceeding paragraphs are in fact represented in palms. However, a few never occur most likely due to low fitness and ontogenetic constraints. This applies for example to homogamous (non-dichogamous), hermaphroditic flowers which would be selected against due to risk of autogamy and resulting inbreeding.

Morphology of sexual expression

The floral groundplan

The groundplan of the palm flower (Fig. 3) is typical of the monocots and is characterized by relatively few innovations as compared to other monocots and flowering plants in general. It is considered likely that trimerous-pentacyclic flowers are plesiomorphic for the Arecaceae, along with the other commelinid lineages (Remizowa, Sokoloff, and Rudall, 2010). Palm flowers have generally an actinomorphic perianth, contrary to the highly elaborate zygomorphic flowers of other Commelinid taxa such as found in the Zingiberales and Commelinales. The perianth is present, though often inconspicuous, with usually differentiated calyx and corolla, free or fused, but no functional alteration of floral organs such as in the ginger order (Zingiberales) and the iris family (Iridaceae). All palms have superior ovaries with a single ovule per locule. The morphology of palm flowers may, however, vary in size, organ numbers and organ fusion. Thus the male flowers of Synechanthus warscewicsianus are no more than a few millimetres long, whereas the female flowers of Aphandra natalia are up to 25 cm long, which is the record in the family and among the longest flowers in the monocotyledons. Particularly the number of stamens is highly variable from sometimes just one in Dypsis lantzeana (Rudall et al., 2003) and J.

Dransfield pers com.) to over one thousand in Ammandra decasperma (Barfod 1991). From an ancestral androecium composed of six stamens like in most monocots, transitions towards more stamens have occurred repeatedly throughout the family, with a particularly high variation in the Arecoideae (Nadot et al., 2011). Organ fusion may be more or less complete and comprise either the fusion of organs within the same whorl (connation) and or the fusion of organs among whorls (adnation). Compared to other monocotyledonous taxa, the gynoecium is unusually variable, from three fused carpels (the most common situation in monocots), three free carpels, pseudomonomery (three carpels are formed in the early developmental stages but only one fully develops), to a single carpel (Rudall, Ryder, and Baker, 2011). The floral receptacle is rather uniform except in the extreme case of the tribe Phytelephanteae. In this group the floral receptacle of male flowers is enlarged to accommodate the hundreds of stamens produced.

Sexual dimorphism

If separation in space and time are two important dimensions in the description of sexual expression in palms, floral dimorphism certainly is the third factor needed to fully appreciate its huge diversity (Fig. 1). Indeed floral dimorphism can be considered in some respects to be a sub-component of spatial separation. In unisexual flowers the degree of reduction of the non-functional sexual organs is highly variable. At one extreme, male and female flowers may be morphologically identical, such as in certain Australian and New Guinean representatives of Livistona (tribe Trachycarpeae) (Dowe 2009). At the other extreme they may be strongly dimorphic such as in the dioecious tribes Phytelepheae (Barfod 1991) and Borasseae (Dransfield, Uhl et al. 2008). In the following section we give an account of the morphological differences between male and female flowers in palms broken down into size, number of floral parts, and structural attributes. Size – Although in palms female flowers tend to be slightly larger than male flowers, the difference in size seldom exceeds a factor of two, and several groups actually display male flowers that are larger than the female ones. This occurs in particular in some taxa from the predominantly monoecious subfamily Arecoideae, such as the tribe Iriarteeae and the genera Pinanga, Nenga, Hydriastele (tribe Areceae), Geonoma (tribe Geonomateae), Gaussia (tribe Chamaedoreeae) and Hyospathe (tribe Euterpeae). The most noticeable contrast of size is observed in the tribe Phytelepheae (Ceroxyloideae). In Aphandra natalia, the enormous female flowers are up to 25 cm long, narrow, with strap-shaped perianth parts and bunched

within a partly enveloping peduncular bract whereas the male flower remains relatively small in spite of the huge number of stamens densely packed on the enlarged floral receptacle (Barfod and Uhl 2001). In certain palms of the tribe Borasseae, there is also pronounced size difference between the female flower and male flowers such as in Lodoicea maldivica, which has rounded female flowers up to 5 cm across and narrow male flowers less than twice this length. Conversely, in cryptic unisexual flowers such as those described for Livistona there is no morphological difference at the time of anthesis between functional male and functional hermaphroditic flowers. It should be noted however that the inflorescences of functionally male palms are branched to one order higher and are therefore relatively distinct. In species with pollination by deceit such as suggested for four species of Calamus in peninsular Thailand (Boegh 1996) a size difference between male and female flowers may have been selected against due to the behaviour of the pollinating bees. They are attracted to inflorescences by visual cues and able to detect and remember even minor morphological differences between male and female flowers (Barfod, Hagen et al. 2011). In male and female flowers, non-functional organs of the opposite sex (pistillode in male flowers and staminodes in female flowers) vary in size and shape, between almost identical to extreme reduction or even absence (Fig. 4). There is one exception in Chamaedorea (Arecoideae), where the pistillode of the male flower is larger than the pistil of the female flower and may play an important role in interactions with pollinating insects (Askgaard, Stauffer et al. 2008).

Number of floral organs – In palms the number of parts in the perianth whorls are invariably the same in male and female flowers. The number of functional stamens in male flowers may differ however from the number of staminodes in corresponding female flowers in some lineages. This applies to several lineages of the monoecious Arecoideae where almost all western Pacific members of the tribe Areceae bear female flowers with three staminodes on one side of the gynoecium (Baker et al., 2011; Nadot et al., 2011) whereas the number of fertile stamens ranges from six to up to more than a hundred. The same applies to several members of the tribe Cocoseae characterised by the presence of a staminodial ring in their female flowers and some dioecious members of the Coryphoideae (Nadot, Sannier et al. 2011). In the tribe Phytelepheae the female flowers have fewer, but larger staminodes compared to the huge number of functional stamens in male flowers. The staminodes originate in two whorls, the first whorl surrounding the carpel primordia and a second outside the first (Uhl and Moore 1977; Barfod and Uhl 2001).

In several unrelated lineages with unisexual flowers, the pistillode is completely lacking in male flowers whereas staminodes are present in the female flowers (e.g., Chambeyronia and Howea in the subfamily Arecoideae, Phytelephas in the Ceroxyloideae, Guihaia and Caryota in the Coryphoideae, or Eleiodoxa in the Calamoideae). This likely reflects the differential expression of the floral genes that control the development of floral organs (see section “Towards understanding the genetic basis of sexual separation in palms” below). In this context it is interesting to note that the reverse situation, where staminodes are absent in the female flowers and pistillodes are present in the male flowers, is much rarer and concerns only a few lineages, e.g., Neonicholsonia or Euterpe (Arecoideae). The complete absence of non functional organs in both female and male flowers of the same species is even rarer. It is found in Pinanga (Arecoideae), in members of the tribe Caryoteae (Coryphoideae) and in Nypa (Nypoideae).

Structural attributes – Extreme morphological differences between male and female flowers can be observed in many groups in addition to size and numerical differences. Noteworthy examples are found in Borasseae, Phytelepheae, Nypa and many arecoids. In Hydriastele, for example, female flowers are typically low, rounded and symmetrical with a short, leathery perianth, whereas male flowers are at least twice as long, asymmetrical, with long, often irregular petals and a low calyx. Female petal morphology is also correlated with dichogamy in Hydriastele, the protandrous species bearing a triangular lobe at the petal apex, which remains closed over the stigma during male anthesis, the protogynous species lacking such a lobe and leaving the stigmas congenitally exposed in bud. At the perianth level, corolla aestivation varies between sexes in some tribes of the Arecoideae (e.g., Areceae and Cocoseae), where it is imbricate in female flowers vs. valvate in male flowers (Dransfield et al., 2008). Anatomical sections of the flowers of Bactris major revealed how the male petals differ from the female ones by being relatively fleshy and having a single row of bundles located near the inner surface. (Uhl and Moore 1977) interpreted their function as a protection of the stamens. After female flower anthesis, the male flowers open and quickly disperse their pollen grains. Similarly, in ten species of Chamaedorea (Askgaard, Stauffer et al. 2008) revealed small-sized, densely staining cells in the outer layers of the male petals. They pointed out that detailed studies of the pollination mechanism in these species are needed to gain insight in their putative role in the interaction with the pollinators.

A note on self-incompatibility – Palms are regarded as self-compatible REF. We are not aware of reports of gametophytic or sporophytic self-incompatibility in the family. Experience from horticulture indicates that palms readily set fruit in cultivation, even when only single individuals are present in a particular garden, although interventions, such as saving pollen and subsequent hand-pollination, may be required to overcome dichogamy. We note, however, that some hermaphroditic and monoecious species display poor fertility when cultivated in isolation, the best known example being the Mauritian palm Hyophorbe amaricaulis (Maunder et al., 2002), which is extinct in the wild, persisting as a single individual in a botanic garden where it fails to set fruit.

Evolution of sexual expression

Evolutionary pathways leading to separate sexual expression

Hermaphroditism is considered as the ancestral condition in angiosperms. Advantages include the sharing by male and female functions of costs for the production of non-sexual organs (sepals, petals, rewards), and it allows self-fertilization when pollen transfer is inefficient. Conversely unisexual flowers, especially in the case of monoecy, allow dimorphism and consequently specialization in shape, size and positioning of male and female flowers. It has been argued that monoecy could have been selected because it favours outcrossing, reduced interference between pollen and stigmas, or allows control of sex allocation. Several hypotheses have been suggested to explain the transition from hermaphroditism to monoecy. The most likely pathways is hermaphroditism to andromonoecy and then to monoecy (de Jong, Shmida, and Thuijsman, 2008). Strangely, relatively little attention has been paid to the evolution of monoecy, compared to dioecy. Various hypotheses have been proposed to account for the origin of dioecy in angiosperms, focusing on different evolutionary drivers such as pollination mechanisms (Ashman, 2000) ecological factors (Vamosi, Otto, and Barrett, 2003) Distinction has been made between two main evolutionary pathways leading to separation of genders on separate plants. One such involves monoecy and hypothesizes a gradual transition in the relative proportion of male to female flowers respectively, eventually leading to a complete separation between male and female plants (Charlesworth and Charlesworth 1978). Evidence for evolution of dioecy through monoecy has been found in Cotula (Asteraceae; Lloyd 1975), Siparunaceae (Renner and Won 2001) and Sagittaria latifolia (Alismataceae; Dorken and

Barrett, 2004) among others. The other hypothetical pathway leading to dioecy in angiosperms proceeds through gynodioecy, which involves male sterility mutations, invasion of hermaphrodite populations by female individuals and further selection of the male such as in Mercurialis (Euphorbiaceae; Harris and Pannell 2008; Pannell, Dorken et al. 2008). Interestingly there are no documented cases of androdioecy as an intermediate stage in the evolution of dioecy. Very few reports of reversal from dioecy to other sexual systems exist. A case have been described in Cotula with a transition back to monoecy (Lloyd 1975) and in Mercurialis annua in which androdioecy most probably evolved from dioecy (Pannell, Dorken et al. 2008). A phylogenetic analysis of dioecy in monocots suggested that dioecy probably evolved more often directly from hermaphroditism than from monoecy (Weiblen, Oyama, and Donoghue, 2000).

Hermaphroditic flowers: multiple gains or multiple losses?

The question whether the ancestor of all palms had unisexual or bisexual flowers is pertinent in view of the diversity of sexual systems in the family and the predominance, in terms of number, of species with unisexual flowers. It has been suggested that the ancestral palm flower is hermaphroditic. However, the diversity of sexual systems in the early- diverging subfamilies of palms challenges this hypothesis. To investigate the evolutionary pathways leading to different sexual expression in palms we used a phylogenetic approach, relying on a comprehensive genus-level phylogeny of the palm family (Baker et al., 2009) (including the novel genus Tahina, but not Lanonia). Using an exemplar approach, we conducted a survey of 183 species, one for each genus included this phylogeny, which represent all of the genera recognized (Dransfield et al., 2008; Couvreur, Forest, and baker, 2011). Descriptions of the species were obtained from the literature and recorded in the database PROTEUS (see http://eflower.myspecies.info/proteus). The species vs. genus approach avoids the problem of coding polymorphisms whenever they occur within a genus. PROTEUS allows precise and complete tracking of the source information. Mesquite (Maddison, W. P. and D.R. Maddison. 2011. Mesquite: a modular system for evolutionary analysis. Version 2.75 http://mesquiteproject.org) was used to perform maximum parsimony optimization of the character “sexual system”, presented on Fig. 5A and 5B. We coded the character as multistate, with three different states representing the three major sexual systems, namely hermaphroditism, dioecy and monoecy. Andromonoecy was defined as a fourth additional state, to represent the dominant system among the so-called “polygamous” species.

The optimization of sexual system evolution with a three-state coding led to an ambiguous state for the common ancestor of the whole palm family, as well as for the common ancestor of subfamilies Calamoideae and Ceroxyloideae. The common ancestor of palms could have been hermaphroditic or monoecious, the two hypotheses being equally parsimonious. The relationship between Nypa and the other members of the family is still poorly supported, making it difficult to ascertain whether monoecy in this subfamily is derived or ancestral. Nypa is exceptional among monoecious palms, being one of the very few species with “perfectly unisexual” flowers, completely devoid of either staminodes or a pistillode. Hermaphroditism is inferred as the ancestral state for the Coryphoideae, and has been inherited by the majority of species (see Table 1), dioecy and monoecy being clearly derived in this subfamily. Monoecy is unsurprisingly inferred as the ancestral state of the Arecoideae where it is found in the vast majority of species (see Table 1). Interestingly, when the fourth character state (andromonoecy) was taken into account in the optimization, monoecy was unambiguously inferred as the ancestral state for the whole family. From this state, dioecy and hermaphroditism evolved several times throughout the family. Andromonoecy evolved either from dioecy, hermaphroditism or monoecy. Dioecy evolved either directly from monoecy, in Arecoideae (within Chamaedoreeae), and in Calamoideae (Calameae and Lepidocaryeae), or from hermaphroditism in Coryphoideae (Borasseae and Trachycarpeae). Monoecy evolved secondarily once from hermaphroditism in Coryphoideae (Caryoteae). Within Calamoideae, the inferred ancestral state is monoecy, from which transitions towards the three other states occurred. There are two independent transitions towards hermaphroditism in Lepidocaryeae and in Calameae. Dioecy evolved twice independently in Calamoideae, once in Lepidocaryeae and once in Calameae. The placement of the andromonoecious genus Metroxylon nested within the clade of dioecious species in Calameae is intriguing, but could be accounted for by an exceptional lability in sexual system in Calamoideae, as suggested by the overall variation observed in this clade. Andromonoecy is also observed in Eugeissona, which is sister to all other Calamoideae . It should be noted that in all species with unisexual flowers, male and female flowers bear well-developed non- functional organs of the opposite sex. The inferred ancestral state is hermaphroditism in Coryphoideae, with here also transitions towards the three other states. Dioecy evolved in Borasseae and Trachycarpeae, with structurally bisexual flowers (i.e. containing non-functional organs) except in the derived

Guihaia (Trachycarpeae) where the male flowers have no pistillode. Two other independent transitions towards dioecy occurred, one in Phoenix (Phoeniceae) where evidence for sexual chromosomes has been obtained (Siljak-Yakovlev et al., 1996), and the other in Kerriodoxa (Chuniophoeniceae) which produces male flowers totally devoid of a pistillode. Monoecy evolved only once, in the common ancestor of Caryoteae, with male flowers devoid of a pistillode in Caryota, and both male and female flowers devoid of non-functional organs in Wallichia. Andromonoecy is reported in the monotypic genus Schippia, a member of the hermaphroditic tribe Cryosophileae (Dransfield et al., 2008). In Ceroxyloideae, the ancestral state is ambiguous and might be monoecy, andromonoecy or functional dioecy (male and female flowers bearing non functional organs evolved. The pistillode was secondarily lost within Phytelepheae (in Aphandra and Phytelephas). In Arecoideae, the ancestral state is clearly monoecy, with flowers of both sexes bearing non-functional organs. Dioecy evolved in two genera of the Chamaedoreeae, namely Chamaedorea and Wendlandiella. Renner and Ricklefs (1995) proposed that dioecy may evolve from monoecy through divergent adjustments of sex ratios between individuals (Fig 6). The pistillode was lost independently several times in unrelated genera of the subfamily, in Synechanthus (Chamedoreeae), in Iriartella (Iriarteeae), and in four genera of the Cocoseae. Staminodes were lost in Socratea (Iriarteeae) and in Euterpeae. The complete absence of non-fertile organs, leading to “perfectly unisexual” flowers (structural monoecy, Fig 6), is clearly derived in palms. However, the losses appear to have occurred almost randomly in terms of their phylogenetic distribution and no prior reductions of non-functional organs can be inferred from observations of the extant clades. Unisexuality in flowers can result from abortion, loss of organ initiation or replacement of organs of one sex (Mitchell and Diggle, 2005). In palms, developmental studies conducted on the dioecious Phoenix dactylifera (Coryphoideae), have shown that flower unisexuality results from the abortion of organs of the opposite sex associated with an arrest in cell division activity (Daher et al., 2010). The developmental pattern of unisexual flowers in the monoecious Nypa fruticans, in which non-functional organs of the opposite sex are lacking, suggests that sexual dimorphism is achieved in this species through the absence of organ initiation (Uhl, 1972). In Caryota mitis (Coryphoideae), male flowers bear numerous stamens and no pistillode, but a stamen develops at the apex of the floral meristem, suggesting homeotic replacement of the pistillode by a male organ (Uhl and Moore, 1980). Although data on the floral ontogeny of palms is still too scarce to provide an in-depth understanding of the developmental mechanisms involved in

flower unisexualisation, it is obvious that different mechanisms are at play in different lineages of the family.

Sex and pollination

The role of sexual expression as a driving force in the co-evolution of palm-pollinator relationships is poorly understood. Palm inflorescences are typically visited by a large variety of insects differing both in specificity and behaviour. Some insects mainly provide services to the plant in terms of transferring pollen grains, whereas others have a negative effect e.g. by damaging vital organs in the flower or predating on potential pollinators. There is no doubt that sexual expression may affect interactions between palms and their floral visitors and that the spatial and temporal separation of sexual expression may increase the fitness of the palm both in mutualistic and antagonistic relationships. (Anstett 1999) and (Dufay and Anstett 2004) demonstrated a nursery-deceit pollination mechanism in the dioecious (sometimes polygamous) species Chamaerops humilis in the Catalonia region of Spain. The main weevil pollinator, Derelomus chamaeropsis, depends completely on the palm to complete its life cycle. It oviposits in both male and female flowers, but larval development is suppressed in part of the female flowers, which therefore end up producing fruits (Anstett 1999). Thus in this well-documented case the main pollinating insect species is engaging in a relationship with the palm that can be viewed as being both mutualistic (transfer of pollen vs. oviposition site) and antagonistic (suppression of larval development vs. destruction of reproductive organ). Sexual expression varies in C. humilis from polygamous to dioecious, but it is unknown whether these differences are related to a trade-off between floral protection and attraction of pollinators. It should be borne in mind that other visiting insects may also play a role in optimizing reproductive success, and that this role may vary greatly in both time and space. In members of the dioecious tribe Phytelepheae (Ceroxyloideae), male flowers serve as oviposition sites for the visiting staphylinid and curculionid beetles, whereas the gynoecium is deeply buried within the long bunched petals outside the reach of many insects (Barfod, Henderson et al. 1987; Bernal and Ervik 1996). The identity of the highly dimorphic flowers is disguised by the similar odour emitted by flowers of both sexes, misleading beetles for which odours are the most important cue. On the other hand, bees respond mainly to visual cues and can distinguish and memorize morphological differences. In the female inflorescences of most species in the dioecious subtribes Salaccinae and Calaminae (subfamily Calamoideae), the female flowers are coupled with a sterile male flower, whereas

the male inflorescences carry only solitary (Calaminae) or paired (Salaccinae) male flowers. Boegh (1996) and Aroonrat and McKey (2012) have suggested that the sterile male flower may disguise the identity of the female inflorescence and trick the bees to visit flowers with little or no reward. A few studies provide insight into the connection between temporal separation of sexual expression and pollination mode. An association between protogyny and beetle pollination (Bertin & Newman 1993, Henderson 2002) although exceptions do exist such as Oenocarpus bataua, which is protandrous but beetle-pollinated (Kuchmeister, Silberbauer Gottsberger et al. 1997; Garcıa, 1988). These generalisations could be tested using groups in which shifts between protogyny and protandry have taken place. For example, a shift from protandry to protogyny has occurred in Pinanga in the Arecinae, a genus that is reported to be beetle-pollinated. In Hydriastele, multiple shifts between protandry and protogyny have occurred and beetle pollination has been observed in some protogynous species. These genera may hold exciting clues to the evolution of sexual expression and pollination, and the role of these factors in promoting diversification. In the dioecious species Phytelephas seemannii sexual expression is displaced within the flowering population with typically a diurnal onset of male anthesis and nocturnal onset of female anthesis. (Bernal and Ervik 1996) considered this an adaptation to minimize the competition for pollinators between male and female plants. Displacement of sexual expression has also been recorded on more extended time scales in the wind-pollinated dioecious palm Howea forsteriana. In populations of this species, endemic of Lord Howe Island, male palms were shown to initiate flowering before female palms (Savolainen, Anstett et al. 2006). This phenological difference may have arisen as a physiological response to the edaphic stress that led to sympatric speciation of H. forsteriana and H. belmoreana) (Savolainen et al., 2006). General conclusions regarding ecological correlates of sexual expression in palms (and other species) should be drawn with caution due to the limited number of studies and the complexity of plant-animal interactions. The extreme spatial separation of sexual functions in dioecious flowering plants thus cannot be explained simply as a means of achieving outbreeding in plants that lack self-incompability (Renner and Ricklefs 1995). Sexual expression in palms should instead be regarded as a result of the dynamic interplay of many selective forces during the diversification of the family. Throughout the distributional range of a single palm species selection pressures probably vary greatly depending on plant- pollinator network interactions. Some insect visitors and potential pollinators may be highly

specific for a given palm species and play a key role in the co-evolutionary relationship. Other visitors are generalists and although they theoretically may transfer large amounts of pollen grains they have little consequence for the evolution of sexual expression in the flower because their presence is too opportunistic.

Towards understanding the genetic basis of sexual separation in palms

Molecular regulation of palm flower development Much progress has been made in the last two decades in understanding the molecular mechanisms underlying flower development in plants. A major milestone was reached in the form of the ABC model published in 1991 by Coen and Meyerowitz (Coen and Meyerowitz, 1991) to explain the genetic determination of flower structure in two different eudicot species (Arabidopsis thaliana and Antirrhinum majus). This model, based on the homeotic activities of specific genes grouped into A, B and C classes, was later extended to include D and E functions (Angenent, Colombo, 1996; Pelaz et al., 2000). A large body of data has been obtained to suggest that the ABC model can also be applied, to a fairly large extent, to monocots. Initial investigations tended to focus on species of the Poaceae such as maize (Ambrose et al., 2000) and rice (Chung et al., 1995); however, other studies were reported for non-grass monocots, including members of the Asparagales (Park et al., 2003), Liliales (Kanno et al., 2003) and Commelinales (Ochiai T, 2004). As regards the palm family, data obtained with the African oil palm Elaeis guineensis provided evidence for a general conservation of the ABC model with distinct molecular identities for petals and sepals (Adam et al., 2007). Since most ABC homeotic genes encode MADS box transcription factors, much interest lies in the study of the diversity, expression and functional activities of this gene family in palms in order to understand the important role that they have probably played in the structural diversification of the flower and inflorescence. In the case of E. guineensis, a total of 24 MADS box genes were described in 2006 by (Adam et al., 2006) and (Alwee et al., 2006); other unpublished MADS box gene sequences from this species figure in the public databases. Palms present a technical challenge to researchers due to the lack of tools available to investigate gene function in this group. This problem is compounded by their phylogenetic distance from model plants, making it difficult to extrapolate data from non- palm species. Despite the apparent conservation of certain ABC functions controlling the development of the flower in palms, it seems likely that the regulatory pathways determining the structure of the inflorescence will have diverged to a greater extent, given the rich

morphological diversity of inflorescences not only in palms, but in monocotyledons as a whole. From a genetic point of view, much of this diversity is likely to have resulted from gene duplications and neo-functionalisations, as has been suggested for the family Poaceae (Cacharrón et al., 1999; Theissen et al., 1996).

Determination of flower and plant sexual dimorphism

As mentioned in the introduction, dioecy and monoecy collectively account for only a little over 10% of angiosperm species; however, the distribution of sexually dimorphic lineages within the angiosperm phylogenetic tree is very scattered. This suggests that unisexual flowers evolved from perfect flowers on a number of occasions since the separation of angiosperms from gymnosperms (Charlesworth, 2002). It also implies that the exact mechanism of sex determination will differ between different sexually dimorphic lineages (Diggle et al., 2011; Tanurdzic, Banks, 2004), even if a partially conserved angiosperm-wide framework for flower development exists. Thus it is necessary to carry out studies of each lineage in order to determine the exact genetic basis of sex determination for the clade in question. In the case of dioecious plants, systematic genetics-based approaches have led to the identification of sex-linked markers for a number of different species, examples including Actinidia chinensis (kiwi fruit; (Fraser et al., 2009)) and Bryonia dioica (Oyama et al., 2009). A structural approach based on the availability of sequenced genomes is also now possible and has been applied to the cases of Carica papaya (papaya; (Wang et al., 2012)) and, of special note here, date palm (Cherif et al., 2013). In the case of Silene latifolia, X ray-induced deletions (Lebel-Hardenack et al., 2002) and C-ion beam radiation (Koizumi et al., 2010) were used to obtain sex determination mutants, confirming the classical genetic prediction of three Y chromosome-located loci controlling carpel suppression, early stamen development and late stamen development respectively. At present, the only two species for which sex determination genes have been identified and characterised are maize and melon. In the case of the polygamous species melon (Cucumis melo), sex ratios are controlled by allelic compositions at two different loci, controlling the andromonoecious and gynoecious (gynomonoecious) characters respectively. Data obtained by (Boualem et al., 2008) revealed that the A allele present at the androdioecious locus encoded an ethylene biosynthesis enzyme, CmACS-7, that repressed stamen development in female flowers when active. (Martin et al., 2009) showed that the transition from male to female flowers in gynoecious lines resulted from the inactivation of a zinc finger transcription factor gene, CmWIP1, that was necessary

for carpel abortion in the male flower, and which indirectly inhibited expression of the A gene. In the case of maize, which produces morphologically distinct male and female inflorescences on the same plant, the characterisation of tasselseed mutants displaying feminised male flowers allowed the identification of several different sex determination genes and an associated signalling pathway (Calderon-Urrea, Dellaporta, 1999). TASSELSEED1 was found to involved in jasmonic acid biosynthesis and to regulate TASSELSEED2, encoding a steroid dehydrogenase (Acosta et al., 2009; DeLong et al., 1993). Both genes are required for the programmed death of pistil cells in the male flower, A third as yet uncharacterised gene, SILKLESS1, blocks tasselseed-induced cell death in the pistil primordia of primary ear florets. Other genetic studies have provided evidence for the involvement of epigenetic factors (Parkinson et al., 2007), microRNAs (Chuck et al., 2007) and brassinosteroid hormones (Hartwig T, 2011). The tasselseed sex determination pathway in maize is an interesting example from an evolutionary point of view, since studies were performed to assess whether a similar signalling system might be used to determine flower sex in other plant groups. Although orthologues of the TASSELSEED genes were easily identifiable in other plants, the available data suggested that there was no functional conservation in sex determination beyond the subfamily Panicoideae of the Poaceae (Malcomber, Kellogg, 2006; Zaitchik et al., 2000). In palms, the existence of multiple independent dioecious and monoecious lineages suggests that the situation might be similar, with each group of species possessing a distinct mechanism to determine unisexuality, as also suggested by the variation observed in the relative development of non-functional organs (see paragraph “Hermaphroditic flowers: multiple gains or multiple losses?” above). Although no specific genes have as yet been implicated in sex determination in palms, there is some evidence to suggest that hormones are likely to play a role in at least some species. In the case of date palm, it has been demonstrated that a specific cytokinin/auxin application can alter the developmental fate of the staminodes of female flowers when cultured in vitro so that they develop into functional stamens (Faïza Masmoudi-Allouche, 2009). In the case of oil palm, gibberellic acid treatment was shown to increase the ratio of male to female inflorescences (Corley, 1976). These data provide a mere hint of what may well be an important role for hormones in palm sex determination, a question that is being addressed in ongoing research programmes (Adam et al., 2011).

How might dichogamy be achieved in palms?

Although some data exist to demonstrate that dichogamy may be influenced by environmental factors such as light availability (Friedman, Barrett, 2011), the underlying genetic basis of this phenomenon in flowering plants is even less well understood than that of sexual dimorphism. Nevertheless, it is interesting to note that in the case of Carya illinoinensis (pecan nut), a single genetic locus appears to control dichogamy, with protogyny being dominant over protandry (Beedanagari et al., 2005). From an evolutionary point of view, dichogamy might in some instances be a facilitator of evolution towards sexual dimorphism. (Pannell, Verdú, 2006) suggested from population modelling that androdioecy in particular can evolve more easily from a heterodichogamous population than from a monomorphic hermaphroditic population. From a functional point of view, it seems probable that dichogamy, like monoecy or dioecy, will have arisen from occasional mutations within the gene network controlling inflorescence and flower development, with different mechanisms operating in different lineages. Given that dichogamy does not affect male or female fertility, it can be speculated that some of the mutations causing this condition occur in the regulatory regions of developmental genes rather than in their coding regions. Mutations of this type could result in delayed (or accelerated) development of specific floral organs through altered gene promoter activity so as to produce protandry or protogyny. No genes controlling dichogamy have as yet been identified in flowering plants, although it has been suggested that the floral symmetry gene network might play a role in some cases (Kalisz, Ree, and Sargent, 2006).

Sexual expression in palms: immediate and long term prospects

Although many long term obstacles to understanding sexual expression in palms remain, an exciting range of new tools centred around Next Generation Sequencing (NGS) technologies has become available in recent years (Varshney et al., 2009) with potential extending far beyond the scope of the traditionally studied genetic models. In the context of the Arecaceae, NGS sequencing has already allowed sequencing of much of the date palm genome (Al-Dous et al., 2011) and genome sequence comparisons between female and male genomes have led to the characterisation of Y chromosome-specific regions for this species (Cherif et al., 2013). Other palm genome sequences are expected to follow in the near future. Genome-wide association mapping and other related techniques show great potential for the

elucidation of genes that control flowering and indeed just about any plant character of interest. Given the rapid progress being made in the development of genomic techniques, it seems likely that the availability of reliable phenotypic data will quickly become a limiting factor. Exploring, cataloguing and understanding the great phenotypic diversity of palms and its ecological correlates will therefore become all the more important.

Conclusions

Sexual expression is one of the most striking characters underlying the biodiversity of the palm family and doubtless fulfils a much wider variety of purposes than simply promoting outbreeding. Indeed The plethora of sexual expression patterns seen in palms, of which an overview is given here, bears witness to the important role that this feature of the plant has probably played in the evolutionary radiation of the family. Continued research in this area will help to improve our understanding of the evolutionary processes that underlie the diversification of sexual systems, in both palms and flowering plants as a whole.

Acknowledgements

The authors are grateful to Hervé Sauquet for PROTEUS database. Jürg Schönenberger and the University of Vienna are also gratefully acknowledged for funding the eFLOWER server hosting the PROTEUS database.

References

Acosta, I. F., Laparra, H., Romero, S. P., Schmelz, E., Hamberg, M., Mottinger, J. P., Moreno, M. A. & Dellaporta, S. L. 2009. tasselseed1 is a lipoxygenase affecting jasmonic acid signaling in sex determination of maize. Science, 323, 262-265. Adam, H., Collin, M., Richaud, F., Beulé, T., Cros, D., Omore, A., Nodichao, L., Nouy, B. & Tregear, J. W. 2011. Environmental regulation of sex determination in oil palm: current knowledge and insights from other species. Annals of Botany, 108, 1529-1537. Adam, H., Jouannic, S., Escoute, J., Duval, Y., Verdeil, J. L. & Tregear, J. W. 2005. Reproductive developmental complexity in the African oil palm (Elaeis guineensis, Arecaceae). American Journal of Botany, 92, 1836-1852. Adam, H., Jouannic, S., Morcillo, F., Orieux, Y., Duval, Y. & Tregear, J. W. 2007. Functional characterization of MADS box genes involved in the determination of oil palm flower structure. Journal of Experimental Botany, 58, 1245-1259. Adam, H., Jouannic, S., Morcillo, F., Richaud, F., Duval, Y. & Tregear, J. W. 2006. MADS box genes in oil palm (Elaeis guineensis): patterns in the evolution of the SQUAMOSA, DEFICIENS, GLOBOSA, AGAMOUS and SEPALLATA subfamilies. Journal of Molecular Evolution, 62, 15-31. Al-Dous, E. K., George, B., Al-Mahmoud, M. E., Al-Jaber, M. Y., Wang, H., Salameh, Y. M., Al-Azwani, E. K., Chaluvadi, S., Pontaroli, A. C., Debarry, J., Arondel, V., Ohlrogge, J., Saie, I. J., Suliman-Elmeer, K. M., Bennetzen, J. L., Kruegger, R. R. & Malek, J. A. 2011. De novo genome sequencing and comparative genomics of date palm (Phoenix dactylifera). Nature Biotechnology, Advance online publication 29 May 2011, doi:10.1038/nbt.1860. Al-Ghazi, Y., Muller, B., Pinloche, S., Tranbarger, T. J., Nacry, P., Rossignol, M., Tardieu, F. & Doumas, P. 2003. Temporal responses of Arabidopsis root architecture to phosphate starvation: evidence for the involvement of auxin signalling. Plant Cell and Environment, 26, 1053-1066. Alwee, S. S., Linden, C. G. V. d., Schoot, J. V. d., Folter, S. d., Angenent, G. C., Cheah, S.-C. & Smulders, M. J. M. 2006. Characterization of oil palm MADS box genes in relation to the mantled flower abnormality. Plant Cell Tiss. Org. Cult., 85, 331-344. Ambrose, B. A., Lerner, D. R., Ciceri, P., Padilla, C. M., Yanofsky, M. F. & Schmidt, R. J. 2000. Molecular and genetic analyses of the Silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Molecular Cell, 5, 569-579.

Angenent, G. C. & Colombo, L. 1996. Molecular control of ovule development. Trends in Plant Science, 1, 228-232. Angiosperm Phylogeny Group. 1998. An ordinal classification for the families of flowering plants. Annals of the Missouri Botanical Garden, Â 85, Â 531â€“553. Angiosperm Phylogeny Group. 2003. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG II. Botanical Journal of the Linnean Society, 141, 399-436. Angiosperm Phylogeny Group. 2009. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Botanical Journal of the Linnean Society, 161, 105-121. Anstett, M. C. 1999. An experimental study of the interaction between the dwarf palm (Chamaerops humilis) and its floral visitor Derelomus chamaeropsis throughout the life cycle of the weevil. Acta Oecologica-International Journal of Ecology, 20, 551- 558. Ashman, T.-L. 2000. Pollinator selectivity and its implications for the evolution of dioecy and sexual dimorphism. Ecology, 81, 2577-2591. Askgaard, A., Stauffer, F., Hodel, D. F. R. & Barfod, A. S. 2008. Floral structure in the neotropical palm genus Chamaedorea (Arecoideae, Arecaceae). Anales del Jardin Botanico de Madrid, 65, 197-210. Asmussen, C. B., Dransfield, J., Deickmann, V., Barfod, A. S., Pintaud, J. C. & Baker, W. J. 2006. A new subfamily classification of the palm family (Arecaceae): Evidence from plastid DNA phylogeny. Botanical Journal of the Linnean Society, 151, 15-38. Baker, W. J., Savolainen, V., Asmussen-Lange, C. B., Chase, M. W., Dransfield, J., Forest, F., Harley, M. M., Uhl, N. W. & Wilkinson, M. 2009. Complete Generic-Level Phylogenetic Analyses of Palms (Arecaceae) with Comparisons of Supertree and Supermatrix Approaches. Systematic Biology, 58, 240-256. Barfod, A., Henderson, A. & Balslev, H. 1987. A note on the pollination of Phytelephas microcarpa (Palmae). Biotropica, 19, 191-192. Barfod, A. S. 1991. A monographic study of the subfamily Phytelephantoideae (Arecaceae). Opera Botanica, 105, 5-73. Barfod, A. S., Burholt, T. & Borchsenius, F. 2003. Contrasting pollination modes in three species of Licuala (Arecaceae: Coryphoideae). Telopea, 10, 207-223. Barfod, A. S., Hagen, M. & Borchsenius, F. Twenty-five years of progress in understanding pollination mechanisms in palms (Arecaceae). Annals of Botany, 108, 1503-1516.

Barfod, A. S. & Heatubun, C. D. 2009. Two new species of Licuala Thunb. (Arecaceae: Coryphoideae) from North Moluccas and Western New Guinea. Kew Bulletin, 64, 553-557. Barfod, A. S. & Uhl, N. W. 2001. Floral development in Aphandra (Arecaceae). American Journal of Botany, 88, 185-195. Barot, S., Mitja, D., Miranda, I., Meija, G. D. & Grimaldi, M. 2005. Reproductive plasticity in an Amazonian palm. Evolutionary Ecology Research, 7, 1051-1065. Barrett, S. Understanding plant reproductive diversity. Philosophical Transactions of the Royal Society B: Biological Sciences, 365, 99-109. Barrett, S. 2002. The evolution of plant sexual diversity. Nature Reviews Genetics, 3, 274-284. Barrett, S. 2008. Major Evolutionary Transitions in Flowering Plant Reproduction: An Overview. International Journal of Plant Sciences, 169, 1-5. Bawa, K. S. 1980. Evolution of Dioecy in Flowering Plants. Annual Review of Ecology and Systematics, 11, 15-39. Beedanagari, S. R., Dove, S. K., Wood, B. W. & Conner, P. J. 2005. A first linkage map of pecan cultivars based on RAPD and AFLP markers. Theoretical and Applied Genetics, 110, 1127-1137. Bernal, R. & Ervik, F. 1996. Floral biology and pollination of the dioecious palm Phytelephas seemannii in Colombia: An adaptation to staphylinid beetles. Biotropica, 28, 682-696. Bertin, R. 1993. Incidence of Monoecy and Dichogamy in Relation to Self-Fertilization in Angiosperms. American Journal of Botany, 80. Bertin, R. I. & Newman, C. M. 1993. Dichogamy in Angiosperms. The Botanical Review, 59, 112-152. Bhandari, N. N. & Venkataraman, R. 1968. Embryology of Drymis winteri. J. Arnold Arbor. Harv. Univ., 49, 509-524. Bhojwani, S. S. & Bhatnagar, S. P. 1974. The embryology of Angiosperms. Dehli: Vikas Publishing House. Boegh, A. 1996. The Reproductive Phenology and Pollination ecology of FourÂ CalamusÂ (Arecaceae) Species in Thailand. Principes, 40, 5-15. Borchsenius, F. 1997. Flowering biology of Geonoma irena and G-cuneata var. sodiroi (Arecaceae). Plant Systematics and Evolution, 208, 187-196. Boualem, A., Fergany, M., Fernandez, R., Troadec, C., Martin, A., Morin, H., Sari, M. A., Collin, F., Flowers, J. M., Pitrat, M., Purugganan, M. D., Dogimont, C. &

Bendahmane, A. 2008. A conserved mutation in an ethylene biosynthesis enzyme leads to andromonoecy in melons. Science, 321, 836-838. Brick, D. J., Brumlik, M. J., Buckley, J. T., Cao, J. X., Davies, P. C., Misra, S., Tranbarger, T. J. & Upton, C. 1995. A new family of lipolytic plant enzymes with members in rice, arabidopsis and maize. Febs Letters, 377, 475-480. Cacharrón, J., Saedler, H. & Theissen, G. 1999. Expression of the MADS-box genes ZMM8 and ZMM14 during inflorescence development of Zea mays discriminates between the upper and the lower floret of each spikelet. Development Genes and Evolution, 209, 411–420. Calderon-Urrea, A. & Dellaporta, S. L. 1999. Cell death and cell protection genes determine the fate of pistils in maize. Development, 126, 435-441. Case, A., Graham, S., Macfarlane, T. & Barrett, S. 2008. A Phylogenetic Study of Evolutionary Transitions in Sexual Systems in Australasian Wurmbea (Colchicaceae). International Journal of Plant Sciences, 169, 141-156. Charlesworth, D. 2002. Plant sex determination and sex chromosomes. Heredity, 88, 94-101. Charlesworth, D. 2002. Plant sex determination and sex chromosomes. Heredity, 88, 94–101. Charlesworth, D. & Charlesworth, B. 1978. Population genetics of partial male-sterility and the evolution of monoecy and dioecy. Heredity, 41, 137-153. Chase, M., Soltis, D., Olmstead, R., Morgan, D., Les, D., Mishler, B., Duvall, M., Price, R., Hills, H., Qiu, Y., Kron, K., Rettig, J., Conti, E., Palmer, J., Manhart, J., Sytsma, K., Michaels, H., Kress, J., Karol, K., Clark, D., Hedren, M., Gaut, B., Jansen, R., Kim, K., Wimpee, C., Smith, J., Furnier, G., Strauss, S., Xiang, Q., Plunkett, G., Soltis, P., Swensen, S., Williams, S., Gadek, P., Quinn, C., Eguiarte, L., Golenberg, E., Jr, Graham, S., Barrett, S., Dayanandan, S. & Albert, V. 1993. Phylogenetics of Seed Plants: An Analysis of Nucleotide Sequences from the Plastid Gene rbcL. Annals of the Missouri Botanical Garden, 80. Chatthai, M., Kaukinen, K. H., Tranbarger, T. J., Gupta, P. K. & Misra, S. 1997. The isolation of a novel metallothionein-related cDNA expressed in somatic and zygotic embryos of Douglas-fir: Regulation by ABA, osmoticum, and metal ions. Plant Molecular Biology, 34, 243-254. Chatthai, M., Kaukinen, K. H., Tranbarger, T. J., Gupta, P. K. & Misra, S. 1997. The isolation of a novel metallothionein-related cDNA expressed in somatic and zygotic embryos of Douglas-fir: Regulation by ABA, osmoticum, and metal ions. Plant Physiology, 114, 901-901.

Chen, X. S. & Li, Q. J. 2008. Sexual Systems and Ecological Correlates in an Azonal Tropical Forests, SW China. Biotropica, 40, 160-167. Cherif, E., Zehdi, S., Castillo, K., Chabrillange, N., Abdoulkader, S., Pintaud, J. C., Santoni, S., Salhi-Hannachi, A., Glemin, S. & Aberlenc-Bertossi, F. 2013. Male-specific DNA markers provide genetic evidence of an XY chromosome system, a recombination arrest and allow the tracing of paternal lineages in date palm. New Phytologist, 197, 409-415. Chuck, G., Meeley, R., Irish, E., Sakai, H. & Hake, S. 2007. The maize tasselseed4 microRNA controls sex determination and meristem cell fate by targeting Tasselseed6/indeterminate spikelet1. Nature Genetics, 39, 1517-1521. Chung, Y.-Y., Kim, S.-R., Kang, H.-G., Noh, Y.-S., Park, M.-C., Finkel, D. & An, G. 1995. Characterization of two rice MADS box genes homologous to GLOBOSA. Plant Science, 109, 45-56. Corley, R. H. V. 1976. Sex differentiation in oil palm: effects of growth regulators. Journal of Experimental Botany, 27, 553-558. Couvreur, T. L., Forest, F. & Baker, W. J. Origin and global diversification patterns of tropical rain forests: inferences from a complete genus-level phylogeny of palms. BMC Biol, 9, 44. Daher, A., Adam, H., Chabrillange, N., Collin, M., Mohamed, N., Tregear, J. W. & Aberlenc- Bertossi, F. Cell cycle arrest characterizes the transition from a bisexual floral bud to a unisexual flower in Phoenix dactylifera. Annals of Botany, 106, 255-266. Damerval, C. & Nadot, S. 2007. Evolution of perianth and stamen characteristics with respect to floral symmetry in Ranunculales. Annals of Botany, 100, 631-640. Darilek, G. & Tranbarger, O. 1978. Try a Wien-Bridge Network Instead of a Twin-T in Your Next Analog Filter Design - Advantages Begin with a Filter You Can Design in 5 Fast Steps. Electronic Design, 26, 80-81. Darwin, C. R. 1877. The different forms of flowers on plants of the same species.Â London: John Murray. de Jong, T. J., Shmida, A. & Thuijsman, F. 2008. Sex allocation in plants and the evolution of monoecy. Evolutionary Ecology Research, 10, 1087-1109. Dellaporta, S. L. & Calderon-Urrea, A. 1993. Sex Determination in Flowering Plants. Plant Cell, 5, 1241-1251.

DeLong, A., Claderon-Urrea, A. & Dellaporta, S. 1993. Sex determination gene TASSELSEED2 of maize encodes a short-chain alcohol dehydrogenase required for stage-specific floral organ abortion. Cell, 74, 757-768. Devey, D. S., Leitch, I., Rudall, P. J., Pires, J. C., Pillon, Y. & Chase, M. W. 2006. Systematics of Xanthorrhoeaceae sensu lato, with an emphasis on Bulbine. In: Monocots: Comparative Biology and Evolution (Ed. by Columbus, J. T., Friar, E. A., Porter, J. M., Prince, L. M. & Simpson, M. G.), pp. 345-351: RSABG. Diggle, P. K., Stilio, V. S. D., Gschwend, A. R., Golenberg, E. M., Moore, R. C., Russell, J. R. & Sinclair, J. P. 2011. Multiple developmental processes underlie sex differentiation in angiosperms. Trends in Genetics, 27, 368-376. Dinis, A. M. & Mesquita, J. F. 1993. The F-actin distribution during microsporogenesis in Magnolia soulangeana Soul. (Magnoliaceae). Sexual Plant Reproduction, 6, 57-63. Dorken, M. E. & Barrett, S. C. H. 2004. Sex determination and the evolution of dioecy from monoecy in Sagittaria latifolia (Alismataceae). Proceedings of the Royal Society of London Series B-Biological Sciences, 271, 213-219. Dowe, J. L. 2001. Studies in the Genus Livistona (Coryphoideae: Arecaceae). Â James Cook University, Townsville. Dowe, J. L. 2009. A taxonomic account of Livistona R. Br. (Arecaceae). The Garden Bulletin Singapore, 60, 185-344. Doyle, J. A. & Hotton, C. L. 1991. Diversification of early angiosperms pollen in a cladistic context. In: Pollen and spores, patterns of diversification (Ed. by Blackmore, S. & Barnes, S. H.), pp. 69-195. Oxford: Clarendon Press. Dransfield, J. & Mogea, J. P. 1984. The flowering behaviour of Arenga (Palmae, Caryotoideae). Botanical Journal of the Linnean Society, 88, 1-10. Dransfield, J., Uhl, N. W., Asmussen, C. B., Baker, W. J., Harley, M. M. & Lewis, C. E. 2008. Genera Palmarum - The evolution and classification of palms. Royal Botanic Gardens Kew: Kew Publishing. Dufay, M. & Anstett, M. C. 2004. Cheating is not always punished: killer female plants and pollination by deceit in the dwarf palm Chamaerops humilis. Journal of Evolutionary Biology, 17, 862-868. Edwards, P. J., Kollmann, J. & Fleischmann, K. 2002. Life history evolution in Lodoicea maldivica (Arecaceae). Nordic Journal of Botany, 22, 227-237. Endress, P. K. & Doyle, J. A. 2009. Reconstructing the ancestral angiosperm flower and its initial specializations. Am J Bot, 96, 22-66.

Erdtmann, G. 1952. Pollen morphology and plant taxonomy-angiosperms. Stockholm: Almqvist & Wiksell. Ervik, F. 1993. Pollination of the dioecious palms Mauritia flexuosa, Aphandra natalia, Phytelephas aequatorialis and Phytelephas macrocarpa in Ecuador. Department of Biological Sciences, University of Aarhus. Faïza Masmoudi-Allouche, A. C.-R., Walid Kriaâ, Radhia Gargouri-Bouzid, Shri Mohan Jain and Noureddine Drira. 2009. In vitro hermaphrodism induction in date palm female flower. Plant Cell Reports, 28, 1-10. Forward, B. S., Tranbarger, T. J. & Misra, S. 1997. Subcellular fractionation and characterization of the proteolytic activity in Douglas-fir seeds following stratification and germination. Plant Physiology, 114, 1522-1522. Forward, B. S., Tranbarger, T. J. & Misra, S. 2001. Characterization of proteinase activity in stratified Douglas-fir seeds. Tree Physiology, 21, 625-629. Fraser, L., Tsang, G., Datson, P., De Silva, H., Harvey, C., Gill, G., Crowhurst, R. & McNeilage, M. 2009. A gene-rich linkage map in the dioecious species Actinidia chinensis (kiwifruit) reveals putative X/Y sex-determining chromosomes. BMC Genomics, 10, 102. Freeman, D. C., McArthur, E. D., Harper, K. T. & Blauer, A. C. 1981. Influence of environment on the floral sex-ratio of monoecious plants. Evolution, 35, 194-197. Friedman, J. & Barrett, S. C. 2011. Genetic and environmental control of temporal and size- dependent sex allocation in a wind-pollinated plant. Evolution, 65, 2061-2074. Grimes, H. D., Tranbarger, T. J. & Franceschi, V. R. 1993. Expression and Accumulation Patterns of Nitrogen-Responsive Lipoxygenase in Soybeans. Plant Physiology, 103, 457-466. Gueye, B., Morcillo, F., Collin, M., Gargani, D., Overvoorde, P., Aberlenc-Bertossi, F., Tranbarger, T. J., Sane, D., Tregear, J. W., Borgel, A. & Verdeil, J. L. 2009. Acquisition of callogenic capacity in date palm leaf tissues in response to 2,4-D treatment. Plant Cell Tissue and Organ Culture, 99, 35-45. Harris, M. S. & Pannell, J. R. 2008. Roots, shoots and reproduction: sexual dimorphism in size and costs of reproductive allocation in an annual herb. Proceedings of the Royal Society B-Biological Sciences, 275, 2595-2602. Hartwig T, C. G., Fujioka S, Klempien A, Weizbauer R, Potluri DP, Choe S, Johal GS, Schulz B. 2011. Brassinosteroid control of sex determination in maize. Proc Natl Acad Sci USA. , 108, 19814-19819.

Henderson, A. 2002. Evolution and Ecology of Palms. New York, USA: NYBG Press. Henderson, A., Lixiu, G. & Barfod, A. S. 2007. A new, dioecious, dimorphic species of Licuala (Palmae) from Hainan, China. Systematic Botany, 32, 718-721. Kalisz, S., Ree, R. & Sargent, R. 2006. Linking floral symmetry genes to breeding system evolution. Trends in Plant Science, 11, 568-573. Kanno, A., Seaki, H., Kameya, T., Saedler, H. & Theissen, G. 2003. Heteropic expression of class B floral homeotic genes supports a modified ABC model for tulip (Tulipa gesneriana). Plant Molecular Biology, 52, 831 – 841. Kaukinen, K. H., Tranbarger, T. J. & Misra, S. 1995. The Molecular Characterization of 2 Cdnas Encoding Low-Molecular-Weight Heat-Shock Proteins during Douglas-Fir Seed-Germination and Stress Treatment. Plant Physiology, 108, 20-20. Kaukinen, K. H., Tranbarger, T. J. & Misra, S. 1996. Post-germination-induced and hormonally dependent expression of low-molecular-weight heat shock protein genes in Douglas fir. Plant Molecular Biology, 30, 1115-1128. Kholia, B. S. 2009. Gender variation in a threatened and endemic palmÂ Trachycarpus takilÂ Becc. Current Science, 96, 144-148. Koizumi, A., Yamanaka, K., Nishihara, K., Kazama, Y., Abe, T. & Kawano, S. 2010. Two separate pathways including SlCLV1, SlSTM and SlCUC that control carpel development in a bisexual mutant of Silene latifolia. Plant and Cell Physiology, 51, 282-293. Korpelainen, H. 1998. Labile sex expression in plants. Biological Reviews, 73, 157-180. Kuchmeister, H., SilberbauerGottsberger, I. & Gottsberger, G. 1997. Flowering, pollination, nectar standing crop, and nectaries of Euterpe precatoria (Arecaceae), an Amazonian rain forest palm. Plant Systematics and Evolution, 206, 71-97. Lebel-Hardenack, S., Hauser, E., Law, T. F., Schmid, J. & Grant, S. R. 2002. Mapping of sex determination loci on the white campion (Silene latifolia) Y chromosome using amplified fragment length polymorphism. Genetics, 160, 717-725. Lin, H. C., Morcillo, F., Dussert, S., Tranchant-Dubreuil, C., Tregear, J. W. & Tranbarger, T. J. 2009. Transcriptome analysis during somatic embryogenesis of the tropical monocot Elaeis guineensis: evidence for conserved gene functions in early development. Plant Molecular Biology, 70, 173-192. Listabarth, C. 2001. Palm pollination by bees, beetles and flies: why pollinator taxonomy does not matter. The case of Hyospathe elegans (Arecaceae, Arecoideae, Areceae, Euterpeinae). Plant Species Biology, 16, 165-181.

Lloyd, D. 1972. Breeding Systems in Cotula L. (Compositae, Anthemideae). I. The Array of Monoclinous and Diclinous Systems. New Phytologist, 71. Lloyd, D. 1975. Breeding Systems in Cotula. III. Dioecious Populations. New Phytologist, 74. Lloyd, D. 1980. The Distributions of Gender in Four Angiosperm Species Illustrating Two Evolutionary Pathways to Dioecy. Evolution, 34. Loo, A. H. B., Dransfield, J., Chase, M. W. & Baker, W. J. 2006. Low-copy nuclear DNA, phylogeny and the evolution of dichogamy in the betel nut palms and their relatives (Arecinae; Arecaceae). Molecular Phylogenetics and Evolution, 39, 598-618. Maddison, W. P. & Maddison, D. R. 2006. Mesquite: a modular system for evolutionary analysis. Malcomber, S. T. & Kellogg, E. A. 2006. Evolution of unisexual flowers in grasses (Poaceae) and the putative sex-determination gene, TASSELSEED2 (TS2). New Phytologist, 170, 885-899. Mantelin, S., Desbrosses, G., Larcher, M., Tranbarger, T. J., Cleyet-Marel, J. C. & Touraine, B. 2006. Nitrate-dependent control of root architecture and N nutrition are altered by a plant growth-promoting Phyllobacterium sp. Planta, 223, 591-603. Martin, A., Troadec, C., Boualem, A., Rajab, M., Fernandez, R., Morin, H., Pitrat, M., Dogimont, C. & Bendahmane, A. 2009. A transposon-induced epigenetic change leads to sex determination in melon. Nature, 461, 1135-8113. Masmoudi-Allouche, F., Chaari-Rkhis, A., Kriaa, W., Gargouri-Bouzid, R., Jain, S. M. & Drira, N. 2009. In vitro hermaphrodism induction in date palm female flower. Plant Cell Reports, 28, 1-10. Matzkanin, G. A., Fountain, L. S. & Tranbarger, O. 1984. Nondestructive Evaluation of Infrastructure Conditions. Annals of the New York Academy of Sciences, 431, 268-303. Nadot, S., Sannier, J., Barfod, A. S. & Baker, W. J. Evolution of the palm androecium as revealed by character mapping on a supertree. In: Flowers on the tree of life (Ed. by L, W. L. a. R. d. C.), pp. 156-180: Cambridge University Press. Nazoa, P., Vidmar, J. J., Tranbarger, T. J., Mouline, K., Damiani, I., Tillard, P., Zhuo, D. G., Glass, A. D. M. & Touraine, B. 2003. Regulation of the nitrate transporter gene AtNRT2.1 in Arabidopsis thaliana: responses to nitrate, amino acids and developmental stage. Plant Molecular Biology, 52, 689-703. Ochiai T, N. T., Mashiko Y, Fukuda T, Yokoyama J, Kanno A. 2004. The differentiation of sepal and petal morphologies in Commelinaceae. Gene, 343, 253–262.

Ortega-Chavez, N. & Stauffer, F. W. Ontogeny and structure of the acervulate partial inflorescence in Hyophorbe lagenicaulis (Arecaceae; Arecoideae). Annals of Botany, 108, 1517-1527. Oyama, K. & Mendoza, A. 1990. Effects of defoliation on growth, reproduction, and survival of a neotropical palm, Chamaedorea tepejilote. Biotropica, 22, 119-123. Oyama, R., Volz, S. & Renner, S. 2009. A sex-linked SCAR marker in Bryonia dioica (Cucurbitaceae), a dioecious species with XY sex-determination and homomorphic sex chromosomes. Journal of Evolutionary Biology, 22, 214-224. Pannell, J. R., Dorken, M. E., Pujol, B. & Berjano, R. 2008. Gender variation and transitions between sexual systems in Mercurialis annua (Euphorbiaceae). International Journal of Plant Sciences, 169, 129-139. Pannell, J. R. & Verdú, M. 2006. The evolution of gender specialization from dimorphic hermaphroditism: paths from heterodichogamy to gynodioecy and androdioecy. Evolution, 60, 660-673. Park, J. H., Ishikawa, Y., Yoshida, R., Kanno, A. & Kameya, T. 2003. Expression of AODEF, a B-functional MADS-box gene, in stamens and inner tepals of the dioecious species Asparagus officinalis L. Plant Molecular Biology, 51, 867–875. Parkinson, S. E., Gross, S. M. & Hollick, J. B. 2007. Maize sex determination and abaxial leaf fates are canalized by a factor that maintains repressed epigenetic states. Developmental Biology, 308, 462-473. Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. & Yanofsky, M. F. 2000. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature, 405, 200-203. Peters, H. A., Pauw, A., Silman, M. R. & Terborgh, J. W. 2004. Falling palm fronds structure amazonian rainforest sapling communities. Proc Biol Sci, 271 Suppl 5, S367-9. Remizowa, M. V., Sokoloff, D. D. & Rudall, P. J. 2010. Evolutionary History of the Monocot Flower. Annals of the Missouri Botanical Garden, 97, 617-645. Renner, S. S. & Ricklefs, R. E. 1995. Dioecy and its correlations in the flowering plants. American Journal of Botany, 82, 596-606. Renner, S. S. & Won, H. S. 2001. Repeated evolution of dioecy from monoecy in Siparunaceae (Laurales). Systematic Biology, 50, 700-712. Ronce de Craene, L. P. 2010. Floral diagrams, an aid to understanding flower morphology and evolution. Cambridge University Press. Roongsattham, P., Morcillo, F., Jantasuriyarat, C., Pizot, M., Moussu, S., Jayaweera, D., Collin, M., Gonzalez-Carranza, Z. H., Amblard, P., Tregear, J. W., Tragoonrung, S.,

Verdeil, J. L. & Tranbarger, T. J. 2012. Temporal and spatial expression of polygalacturonase gene family members reveals divergent regulation during fleshy fruit ripening and abscission in the monocot species oil palm. Bmc Plant Biology, 12. Savolainen, V., Anstett, M. C., Lexer, C., Hutton, I., Clarkson, J. J., Norup, M. V., Powell, M. P., Springate, D., Salamin, N. & Baker, W. J. 2006. Sympatric speciation in palms on an oceanic island. Nature, 441, 210-213. Scariot, A. O., Lleras, E. & Hay, J. D. 1991. Reproductive biology of the palm Acrocomia aculeata in Central Brazil. Biotropica, 23, 12-22. Schoenberg, F. P. & Tranbarger, K. E. 2008. Description of earthquake aftershock sequences using prototype point patterns. Environmetrics, 19, 271-286. Skov, F. & Balslev, H. 1989. A revision of Hyospathe (Arecaceae). Nordic Journal of Botany, 9, 189-202. Stevens, P. F. 2001. Angiosperm Phylogeny Website. Version 9, June 2008. Tanurdzic, M. & Banks, J. A. 2004. Sex-Determining Mechanisms in Land Plants. The Plant Cell, 16, S61–S71. Theissen, G., Kim, J. T. & Saedler, H. 1996. Classification and phylogeny of the MADS-box gene families in the morphological evolution of eukaryotes. Journal of Molecular Evolution, 43, 484-516. Tomlinson, P. B. 1982. Â Anatomy of the monocotyledons. VII. Helobiae (Alismatidae) (including the seagrasses). Oxford: Clarendon Press. Tomlinson, P. B. 2006. The uniqueness of palms. Botanical Journal of the Linnean Society, 151, 5-14. Tranbarger, O. 1983. A High-Resolution Temperature Logging Probe for Salt Brine Cavities. Geophysics, 48, 458-458. Tranbarger, O. 1985. Fm Radar for Inspecting Brick and Concrete Tunnels. Materials Evaluation, 43, 1254-&. Tranbarger, R. E. 1980. Current Perspectives in Nursing Management - Marriner,A. American Journal of Nursing, 80, 74-74. Tranbarger, R. E. 1980. Leadership in Nursing - Beyers,M. American Journal of Nursing, 80, 74-74. Tranbarger, R. E. 1980. Maintaining Cost-Effectiveness - Schmied,E. American Journal of Nursing, 80, 74-74. Tranbarger, R. E. 1980. Mcgraw-Hill Handbook of Clinical Nursing - Armstrong,Me, Dickason,Ej, Howe,J, Jones,Da, Snider,Mj. American Journal of Nursing, 80, 74-74.

Tranbarger, R. E. 1980. Understanding Hospital Financial Management - Herkimer,Ag. American Journal of Nursing, 80, 74-74. Tranbarger, R. E. 1994. More on Men. Nursing Outlook, 42, 246-246. Tranbarger, T. J., Al-Ghazi, Y., Muller, B., de la Serve, B. T., Doumas, P. & Touraine, B. 2003. A macro-array-based screening approach to identify transcriptional factors involved in the nitrogen-related root plasticity response of Arabidopsis thaliana. Agronomie, 23, 519-528. Tranbarger, T. J., Al-Ghazi, Y., Muller, B., De la Serve, B. T., Doumas, P. & Touraine, B. 2003. Transcription factor genes with expression correlated to nitrate-related root plasticity of Arabidopsis thaliana. Plant Cell and Environment, 26, 459-469. Tranbarger, T. J., Dussert, S., Joet, T., Argout, X., Summo, M., Champion, A., Cros, D., Omore, A., Nouy, B. & Morcillo, F. 2011. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism. Plant Physiology, 156, 564-584. Tranbarger, T. J., Forward, B. S. & Misra, S. 2000. Regulation of NADPH-cytochrome P450 reductase expressed during Douglas-fir germination and seedling development. Plant Molecular Biology, 44, 141-153. Tranbarger, T. J., Franceschi, V. R., Hildebrand, D. F. & Grimes, H. D. 1991. The Soybean 94-Kilodalton Vegetative Storage Protein Is a Lipoxygenase That Is Localized in Paravenous Mesophyll Cell Vacuoles. Plant Cell, 3, 973-987. Tranbarger, T. J., Kluabmongkol, W., Sangsrakru, D., Morcillo, F., Tregear, J. W., Tragoonrung, S. & Billotte, N. 2012. SSR markers in transcripts of genes linked to post-transcriptional and transcriptional regulatory functions during vegetative and reproductive development of Elaeis guineensis. Bmc Plant Biology, 12. Tranbarger, T. J. & Misra, S. 1995. The molecular characterization of a set of cDNAs differentially expressed during Douglas-fir germination and early seedling development. Physiologia Plantarum, 95, 456-464. Tranbarger, T. J. & Misra, S. 1996. The isolation, regulation and expression of a cDNA encoding a NADPH-cytochrome P-450 reductase from Douglas-fir seedlings. Plant Physiology, 111, 60-60. Tranbarger, T. J. & Misra, S. 1996. Structure and expression of a developmentally regulated cDNA encoding a cysteine protease (pseudotzain) from Douglas fir. Gene, 172, 221- 226.

Uhl, N. W. & Moore, H. E. 1977. Centrifugal stamen initiation in Phytelephantoid palms. American Journal of Botany, 64, 1152-1161. Uhl, N. W. & Moore, H. E. 1978. Structure of acervulus, flower cluster of Chamaedoreoid palms. American Journal of Botany, 65, 197-204. Vamosi, J., Otto, S. & Barrett, S. 2003. Phylogenetic analysis of the ecological correlates of dioecy in angiosperms. Journal of Evolutionary Biology, 16, 1006–1018. Van Heel, W. A., Breure, C. J. & Menendez, T. 1987. The early development of inflorescences and flowers of oil palm (Elaeis guineensis Jacq.) seen through the scanning electron microscope. Blumea, 32, 67-78. Varshney, R., Nayak, S., May, G. & Jackson, S. 2009. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends in Biotechnology, 27 522-530. Verdeil, J. L., Alemanno, L., Niemenak, N. & Tranbarger, T. J. 2007. Pluripotent versus totipotent plant stem cells: dependence versus autonomy? Trends in Plant Science, 12, 245-252. Wang, J., Na, J., Yu, Q., Gschwend, A., Han, J., Zeng, F., Aryal, R., Vanburen, R., Murray, J., Zhang, W., Navajas-Pérez, R., Feltus, F., Lemke, C., Tong, E., Chen, C., Wai, C. M., Singh, R., Wang, M., Min, X., Alam, M., Charlesworth, D., Moore, P., Jiang, J., Paterson, A. & Ming, R. 2012. Sequencing papaya X and Yh chromosomes reveals molecular basis of incipient sex chromosome evolution. Proc Natl Acad Sci USA, 109, 13710-13715. Weiblen, G. D., Oyama, R. K. & Donoghue, M. J. 2000. Phylogenetic Analysis of Dioecy in Monocotyledons. The American naturalist, 155, 46-58. Zaitchik, B. F., LeRoux, L. G. & Kellogg, E. A. 2000. Development of male flowers in Zizania aquatica (North American wild-rice; Gramineae). International Journal of Plant Sciences, 161, 345-351.

Tables and Figures

Table 1 – Genus and species-level survey of sexual system in palms. The first column indicates the total number of genera (in bold) and species (in italics). The other columns show the occurrences of the four designated types of sexual system. Subfamilies are assigned according to (Dransfield et al., 2008). Within the Coryphoideae some genera are polymorphic; the different sexual systems are taken into account in the percentages shown in brackets.

Fig 1 Overview of sexual expression in palms ; illustration of the diversity in flowers distribution, top to bottom, left to right Sabal palmetto (solitary hermaphroditic flowers),

Nypa fructicans (heads of pistillate and stamintate flowers), Synechanthus warscewiczianus

(monoecious flowers in acervulus), Ponapea ledermanniana (monoecious flowers in triads) and Oncocalamus macrospathus (monoecious flowers in cluster); Drawings from Dransfield et al. (2008).

Fig 2 Summary tree showing relationships among subfamilies and tribes of the Arecaceae

(Dransfiel et al. 2008)

Fig 3 Palm flower ground plan; floral diagrams of two different species (modified from Ronce de Craene 2010(Ronce de Craene, 2010)). (A) Corypha sp. (Coryphoideae) hermaphroditic flower. (B) Ptychosperma gracile (Areceae) unisexual flowers, female on the left and male on the right.

Fig 4 Non-functional sexual organs in palms; illustration of the morphological diversity. (A) staminodes, left to right stamen like (Acrocomia sp.), slightly modified (Pholidostachys pulchra) and highly modified (Actinorhytis calapparia); (B) pistillode, left slightly reduced

(Elaeis oleifera), right highly reduced (Asterogyne spicata).

100

Fig 5 Supertree from the analysis of Baker et al. (2009) showing the evolution of sexual system in palms optimized using Maximum Parsimony. (A) all subfamilies except Arecoideae. (B) Arecoideae (continuation of (A)). Boxes at the tip of branches are coloured according to the actual character state: White = hermaphroditism, Light Grey = monoecy, Dark Grey = dioecy, Black = andromonoecy. Branches colours correspond to the inferred ancestral sate. Several colours on the same branch denote ambiguity in the ancestral state. ♂ indicates that a pistillode is lacking in this species and ♀ that staminodes are lacking. The sexual system of each species used in the optimization is typical of the sexual system of its genus; exceptions (polymorphism within the genera and/or within the species) are highlighted by stars. Phylogenetic relationships and tribe names are as indicated by Baker et al. (2009).

101

102

103

Fig 6 The evolutionary pathways from functional monoecy (pistillode are present in the male flowers and staminodes are present in the female flowers, thus all the flowers are structurally bisexual) to structural monoecy (pistillode and staminodes are lacking, thus the flowers are functionally and structurally unisexual) and to functional dioecy (pistillode and staminodes are present, thus the flowers are structurally bisexual) in Arecoideae. In monoecious species flowers of both sex occurred on same individual (one ring) whereas in dioecious species, flowers occured on different individuals (two rings). Black = functional gynoecium; white = functional stamens; grey = vestigial organs. Potential mechanism underlying transitions 1 = loss of organ initiation or replacement of organs (Mitchell and Diggle, 2005); 2 = sex ratio adjustments (Renner and Ricklefs, 1995).

FUNCTIONAL MONOECY

1 2

STRUCTURAL MONOECY FUNCTIONAL DIOECY

104

105

106

Chapitre 2 : Evolution du nombre d’étamines chez les palmiers

107

108

Contexte et objectifs de l’étude

Les étamines sont les organes de la fleur portant les anthères, lieu de production des gamétophytes mâles : les grains de pollen. Le nombre de ces organes est très variable à l’échelle des angiospermes, allant de un à plusieurs milliers chez certains groupes. Lorsque les espèces présentent un nombre élevé d’étamines, elles sont qualifiées de « polyandres ». Au contraire lorsque le nombre est plus faible, les espèces sont qualifiées d’« oligandres ». La limite entre oligandrie et polyandrie est parfois délicate à déterminer. Elle peut ainsi varier selon les groupes taxonomiques, suivant la mérosité et les mécanismes de développement. Ainsi certaines eudicotylédones présentant une mérosité de cinq (le nombre de pièces du périanthe), la limite entre oligandrie et polyandrie est fixée à dix (c’est-à-dire plus de fois le nombre de pièces du périanthe ; Jabbour et al. 2008). Les fleurs présentant une phyllotaxie spiralée possèdent souvent un grand nombre d’étamines et sont donc considérées comme polyandres (Ronse de Craene et Smet 1998). Les mécanismes de développement permettant la mise en place des nombreuses étamines chez les espèces polyandres ont été étudiés dans différents groupes. Ces études ont révélé que l’insertion des étamines nombreuses était permise par l’expansion du réceptacle floral ou par la diminution du diamètre de filets (Endress 2011). En revanche l’action de la sélection et les bases du contrôle génétique sont encore mal connues.

Les palmiers constituent un groupe particulièrement intéressant pour l’étude du nombre d’étamines puisque celui-ci varie de un à mille au sein de la famille (Fig. 9). Les fleurs de palmiers sont généralement petites, souvent de forme arrondie lorsqu’elles sont en boutons. Il existe néanmoins une diversité de formes, de tailles et de couleurs selon les groupes. Les pièces du périanthe et du gynécée varient peu en nombre. Le périanthe est trimère : trois sépales et trois pétales. Chez certaines espèces, leur morphologie ne permet pas de les distinguer. Ils sont alors considérés comme des tépales. Le gynécée est également trimère chez la majorité des espèces. Chaque carpelle contient un ovule. Dans certains cas, seul un ovule sur les trois se développe. Chez certaines espèces, des espaces entre les carpelles peuvent abriter des nectaires (Schmid 1983). Au contraire le nombre d’étamines est extrêmement variable et cela dans la majorité des sous-familles. Dans ce groupe la limite entre l’oligandrie et la polyandrie a également été déterminée en fonction de la mérosité. Les espèces sont considérées comme polyandres lorsqu’elles

109

possèdent plus de six étamines (c’est-à-dire plus de deux fois le nombre de pièces du périanthe). Il a été montré que l’oligandrie à six étamines constitue l’état ancestral du caractère et qu’à partir de celui-ci de nombreuses transitions vers la polyandrie ont eu lieu durant l’histoire évolutive de la famille (Nadot et al. 2011). En revanche l’ampleur des transitions entre les taxons oligandres et polyandres (pouvant posséder de sept à mille étamines) et entre les taxons polyandres est encore mal connue.

Fig. 9 : Illustration de la diversité morphologique de l’androcée des palmiers et notamment du nombre d’étamines ; de gauche à droite et de bas en haut : Aphandra natalia, Dictyosperma album, Arenga brevipes, Hedyscepe canterburyana, Calamus spectatissimus, Orania ravaka, Lodoicea maldivica, Ptychosperma sp., Nypa fruticans, Veitchia sp., Welfia regia, Dypsis baronii, Aiphanes chiribogensis, Heterospathe delicatula, Ptychococcus paradoxus, Pinanga aristata, Burretiokentia grandiflora, Phytelephas macrocarpa, Bismarckia sp., Jubaeopsis caffra, Wodyetia sp., Daemonorops verticillaris,, Caryota rumphiana, Eugeissona utilis (photographies Sophie Nadot ; Julie Sannier et Palmweb)

110

La polyandrie a été étudiée chez les palmiers en ce qui concerne le développement (notamment Uhl & Moore 1980) mais les éventuelles pressions de sélection ayant pu influer sur ce caractère ainsi que le contrôle génétique du nombre des organes sont encore inconnus. Il a été suggéré que les espèces présentant un grand nombre d’étamines pourraient être pollinisées par les insectes, notamment des coléoptères et des abeilles (Uhl et Moore 1977). L’augmentation du nombre d’étamines dans de nombreux groupes de palmiers pourrait donc constituer une adaptation aux pollinisateurs. Les étamines nombreuses seraient ainsi plus attractives pour les pollinisateurs fournissant plus de ressources. Cependant cette hypothèse reste à tester. Nous proposons notamment d’étudier si l’augmentation du nombre d’étamines est corrélée avec une augmentation de la production de grains de pollen.

Cette étude constitue un article de recherche dont les objectifs sont : (1) d’étudier l’évolution du nombre d’étamines à l’échelle de la famille des palmiers, en se focalisant sur les transitions vers la polyandrie et entre les taxons polyandres ; (2) de tester un lien potentiel entre le nombre d’étamines et la production de pollen.

Synthèse des résultats

Le caractère « nombre d’étamines » a été codé sous la forme d’un caractère discret son évolution a été étudié en se basant sur la phylogénie de l’ensemble des genres de palmiers. L’état ancestral du caractère est « six étamines » et la détermination de celui-ci est confortée par le signal phylogénétique fort présent dans le caractère. A partir de cet état ancestral, de nombreuses transitions vers des nombres élevés d’étamines ont eu lieu. La reconstruction de l’évolution du caractère montre que l’augmentation du nombre d’étamines est rarement progressive. Certaines transitions vers une forte polyandrie se font directement à partir d’un état oligandre et impliquent probablement des changements importants dans les processus de développement des étamines. La production de pollen, estimée chez 82 individus de palmiers, représentant 82 espèces et 59 genres, se révèle très variable. Elle varie entre une centaine de grains et plus de deux millions de grains par fleur. Il existe une corrélation entre le nombre d’étamines et la production de pollen, mais cette relation n’est pas linéaire. Tous les individus appartenant aux Coryphoideae testés dans cette étude possèdent six étamines. Aucune corrélation ne peut donc être identifiée dans ce groupe. Cependant on remarque que même si le nombre d’étamines est constant, la

111

production de pollen varie. La variation dans la production de pollen est plus grande chez les Calamoideae que chez les Arecoideae qui pourtant présentent une plus grande variation dans le nombre d’étamines. Dans les deux cas, néanmoins la production de pollen a tendance à être plus importante quand le nombre d’étamines augmente. Des expériences complémentaires sont nécessaires pour comprendre si les augmentations répétées du nombre d’étamines chez les palmiers sont le résultat de la sélection ou d’un relâchement de contraintes phylogénétiques. Dans le premier cas la polyandrie constituerait une convergence résultant d’une adaptation à un environnement similaire (par exemple un type de pollinisateur). Des expériences dans des populations naturelles permettraient d’estimer si des étamines nombreuses associées ou non à une production de pollen élevée, confèrent un avantage sélectif aux individus. Nous proposons notamment de comparer la fitness d’individus présentant des phénotypes différents au niveau du nombre d’étamines et de la production de pollen. Notre étude a mis en évidence des groupes taxonomiques pour lesquels cette variabilité est naturelle et qui constituent donc de bons groupes d’étude. Pour le nombre d’étamines, la variabilité pourrait être accentuée expérimentalement en enlevant des étamines. Les fleurs de palmiers étant regroupées en grande inflorescences, il est possible que l’unité de pollinisation ne soit pas la fleur mais l’inflorescence. L’évolution du nombre d’étamines et de la production de pollen pourrait être étudiée également à l’échelle de l’inflorescence.

Cet article est encore une ébauche. Pour cette étude j’ai conçu et mis en place un protocole d’extraction du pollen adapté aux fleurs de palmiers et à notre problématique. Mon choix s’est porté sur une extraction mécanique et non pas chimique pour limiter les pertes de pollen (les protocoles sont présentés en Annexe 2 du manuscrit). Cette technique présente l’avantage de ne pas être toxique pour l’expérimentateur. Les expériences ont été réalisées en partie avec l’aide des stagiaires M1 et M2, Stéphanie Vallée, Vanessa Vilard et Gérard Imani.

112

Article 2

113

114

Variation of stamen number in palms: evolutionary history and glimpse into pollen production

Elodie Alapetite1, Gérard Imani1, Stéphanie Vallée1, Vanessa Vilard1, Hervé Sauquet1, Anders Barfod2, Sophie Nadot1,3

1Univ Paris-Sud, Laboratoire Ecologie, Systématique et Evolution, UMR 9079, Orsay, F-

91405, France

2Department of Biological Sciences, Aarhus University, Ny Munkegade 114, DK-8000

Aarhus C, Denmark

3Author for correspondence: [email protected]

Abstract

The androecium of palms (Arecaceae) exhibits a large diversity in stamen number. From an ancestral state with 6 stamens, both reduction and increase have occurred. Eighty-three genera belonging to all subfamilies (except Nypoideae) include species displaying more than 6 stamens (polyandry). The number of stamens in polyandrous species ranges from dozens to hundreds units. Understanding this huge variation in stamen number has implications for our knowledge of the evolution of flower and pollination mechanisms in palms.

In this study we surveyed the literature to obtain data on stamen number for the 183 genera of the family, using an exemplar approach. We also observed flowers from living and spirit collection. We further used these data to optimize the character on the generic-level phylogeny, focusing on transitions towards polyandry and between polyandrous species. In order to initiate a research on a possible functional significance of increase in stamen number, we investigate the relationship between stamen number and pollen production. We extracted

115

the total pollen content from flowers of 82 species, representative of the various palm tribes and compared it to stamen number.

A strong phylogenetic signal was found in stamen number allowing us to make optimization of this character on the generic-level palm supertree. Many transitions towards polyandry occurred from an ancestral state of six stamens during the evolutionary history of the family.

Stamen number seems to have increase in abrupt and repeated way. Transitions between six stamens and a high number of stamens are frequent. Pollen production in palms is highly variable and ranges from hundreds to millions grains. We showed that a relationship between stamen number and pollen production exist in our sampling. There is a tendency towards higher pollen production when the number of stamen increases in Coryphoideae and

Arecoideae. However it is still difficult to understand the evolutionary processes underlying the evolution of these two characters. Based on our results, we proposed some improvements of the experiment and some hypotheses that could be further tested to investigate evolutionary history of stamen number in palms.

116

Introduction

Stamens are floral organs that bear fertile pollen-producing structures, the anthers. These structures are analogous in flowering plants to male sex organs in animals. They play a fundamental role in sexual reproduction and were thus considered by botanists as an important character in classifying plants (e.g. Linné 1753). The set of stamens (androecium) is one of the four categories of the largely conserved ground plan of angiosperm flower (sepals, petals, stamens and carpels, from outside to inside). It exhibits a large diversity in organ number, arrangement, shape and synorganization (D’Arcy 1996; Soltis et al. 2009; Endress

2011). The number of stamens increased and decreased repeatedly during the evolutionary history of the flowering plants (reviewed in Endress 2011). Flowers bearing many stamens are traditionally called “polyandrous”, vs. “oligandrous” when they have few stamens (Ronse

Decraene and Smets 1998). The ancestral stamen number for angiosperms is controversial and strongly dependent to the accuracy of phylogenetic reconstruction among basal angiosperms

(Ronse Decraene and Smets 1998; Endress and Doyle 2009; Goremykin et al. 2013). Stamen number is highly variable in most basal lineages. For example, it varies from one stamen in

Hydatellaceae (Williamson and Schneider 1993), to 12-21 in Amborellaceae (Endress and

Igersheim 2000) and up to 200 in Nympheaceae (Schneider and Williamson 1993). In magnoliids, stamen number varies from very low values in Piperaceae (2-3; Endress 2011) to huge values in Monimiaceae (around 1800; Lorence 1985). Most monocot flowers have six stamens, however increases occurred in Alismatales (up to more than 30; Salisbury 1926),

Pandanales (up to many hundreds; Huynh 1991), Poales (up to 120; Soderstrom and Londono

1988) and Arecales (up to more than 900; Dransfield et al. 2008). There is also a wide range of variation in the eudicots. In Ranunculales (basal eudicots), numerous stamens are found in

Papaveraceae, Menispermaceae, Berberidaceae and Ranunculaceae with up to more than 2000 in the latter family (Tamura 1995; Damerval and Nadot 2007). Many rosids have high

117

numbers of stamens, particularly in Malpighiales (up to 750; Prance 1976) and Malvales (up to 1000; Janka et al. 2008). In asterids, flowers with a huge number of stamens are found in

Caryophyllales (up to 4000 in Cactaceae, Barthlott and Hunt 1993) and Ericales (up to 1200;

Prance and Mori 2004).

The variation in stamen number has been thoroughly studied from a morphological and developmental point of view (Ronse Decraene and Smets 1987; Ronse Decraene and Smets

1998), but little is known about the potential functional significance of such variation.

Polyandry characterizes the so-called brush flowers which are pollinated by large animals

(sphingids, birds, bats; Endress 2011) and the beetle-pollinated systems (Bernhardt 2000).

Pollen and stamen tissues are a potential source of food for insects and were probably critical rewards in the development of the plant-pollinator mutualism, like nectar (Barrera and Nobel

2004). Crepet and Nixon (1996) suggested that increase in stamen number could be the prelude to the transformation of stamens into attractive or reward-providing structures.

Supernumerary stamens could provide attractants and rewards for pollinators that consume flower tissues and pollen. They can also represent a protection against herbivores. This strategy could have promoted reproduction under these conditions (pollen-eating pollinators and/or herbivores attacks) and thus could have been selected many times in angiosperms.

The palms (Arecaceae) are an emblematic family of monocotyledonous species that play a crucial ecological role in species-rich tropical ecosystems, mainly rain forests (Peters et al.

2004). They comprise 183 genera and around 2400 species distributed worldwide in tropical and subtropical areas. These genera are divided into five subfamilies, Calamoideae,

Nypoideae, Coryphoideae, Ceroxyloideae and Arecoideae (Dransfield et al. 2008). Palm flowers are usually small (generally less than 1 cm across) and have the typical trimerous ground plan of most monocot flowers, with three sepals, three petals and one or three carpels

118

(Dransfield et al., 2008). The androecium however exhibits a large diversity in stamen number, among genera. From an ancestral state with six stamens, both reduction and increase have occurred (Nadot et al. 2011). Ten of the 183 genera include species in which the androecium is reduced to three stamens. Flowers with a single stamen have even been observed in Dypsis lantzeana (Rudall et al. 2003). Eighty-three genera belonging to all subfamilies (except Nypoideae) include species displaying more than 6 stamens. The number of stamens ranges from seven, eight and nine to many (Dransfield et al. 2008). The largest number of stamens is found in the tribe Phytelepheae where almost a thousand stamens have been recorded in Phytelephas (Barfod 1991). If the transitions towards polyandry from the ancestral state with six stamens are now identified among genera, the patterns of transitions within polyandrous genera are still almost unknown. Like in many other angiosperm groups, the link between stamen number and pollination is still poorly understood. A relationship between numerous stamens and pollination by beetles and bees in palms has been showed in some species (e.g. Ptychosperma; Uhl and Moore 1977b). This suggests that the repeated increase in stamen number throughout the family could be the result of a selection for an increased pollen production, used as reward for pollinators. However the relationship between stamen number and pollen production in palms has never been tested so far.

The aims of our study were (1) to examine the evolution of stamen number within the palm family at the species level, focusing on transitions from oligandry towards polyandry and among polyandrous species, and (2) to investigate the link between stamen number and pollen production in palms. We conducted a survey of the diversity of stamen numbers in the family, using an exemplar approach, based on data obtained from the literature and from direct observation of flowers from living and spirit collections. The number of stamens was optimised on a phylogeny of the family to identify evolutionary patterns in the variation of

119

this character. We quantified pollen production for a total 82 species, and further compared this pollen production with stamen number. This constitutes a first step in identifying whether there might be a link between stamen number and pollination, and investigating the potential functional significance of stamen number variation in palms.

Material and methods

Stamen number optimization

Taxonomic sampling, stamen number data and phylogenetic background

Using an exemplar approach, we recorded stamen number for 183 species representing all of the genera recognized in Arecaceae (Dransfield et al. 2008), and six species of commelinid monocots chosen as outgroups. The species vs. genus approach avoids the problem of coding polymorphism whenever it occurs within a genus. This approach is particularly useful in our case, since stamen number can be highly variable within genera. Data were mostly obtained from taxonomic treatments available in the literature. Information on stamen number was also obtained from direct observation of flowers from spirit collections (Aarhus University; Royal

Botanic Gardens, Kew; Supplementary Tables 1 and 2). Flowers were dissected under a Zeiss

Stemi SV6 stereomicroscope (Carl Zeiss AG, Göttingen, Germany) to count the stamens. The optimization of the character ‘stamen number’ was performed on the complete generic-level supertree of the family (Baker et al. 2009). This tree was slightly modified (Couvreur et al.

2011) by considering only accepted genera according to Dransfield et al. (2008) and adding the recently discovered genus Tahina. This latter version of the supertree was used in this study. The original supertree included 13 outgroup species of commelinid monocots from which we selected the following six: Anigozanthos flavidus (Haemodoraceae), Hanguana malayana (Hanguanaceae), Kingia australis (Dasypogonaceae), Musa acuminata (Musaceae),

120

Tradescantia ohiensis (Commelinaceae), and Typha latifolia (Typhaceae). Whenever possible, we chose to record stamen number for the species included in the study of Couvreur et al (2011) (Supplementary Table 2). This approach avoids misleading information due to potential non-monophyletic genera.

Character coding and character optimization

Stamen number ranges between 1 and approximately 1000 in palms. The exact range in stamen number per species was recorded in the database PROTEUS (Sauquet 2013).

PROTEUS allows precise and complete tracking of the source information. Data recorded and references used are presented in Supplementary Table 2. Defining character states for stamen number proved problematic due to the high inter- and intra-specific variability. Converting continuous data into discrete classes makes information easier to analyse in a phylogenetic context, provided that classes are judiciously chosen. In order to define meaningful classes, we used the agglomerative hierarchical clustering, a statistical tool implemented in the R software (R Development Core Team 2007). The first step consisted in calculating distances between pairs of values with the function dist and the method euclidian. The function hclust included in the package ade4 was used to group the resulting distances in dendrograms that allow determining the classes that best fit the data. Five classes (or character states) emerged for the character ‘stamen number’: (0) less than 6 stamens (corresponding to a reduction in stamen number from the ancestral state), (1) 6 stamens (the known ancestral state of the family; states 0 and 1 correspond to oligandrous species as defined by Nadot et al. (2011)); (2)

7 to 22 stamens (we called it low polyandry); (3) 23 to 114 stamens (called moderate polyandry); (4) more than 114 stamens (called high polyandry).

121

The character was optimised using the MP (Maximum Parsimony) method implemented in

Mesquite 2.75 (Maddison and Maddison, 2011), with the default settings. Character states were treated as unordered, allowing any transition among states.

Correlation between stamen number and pollen production

Taxonomic sampling

We sampled flower buds from 82 species of palms, representing 59 genera of the family.

Three of the five subfamilies are represented, with 10 species (8 genera) from the

Calamoideae, 14 species (14 genera) from the Coryphoideae and 58 species (37 genera) from the Arecoideae (Supplementary Table 1). We were unable to find plant material representing

Ceroxyloideae and Nypoideae, but nevertheless our sampling is representative of the and diversity in stamen number at the scale of the family, and mostly represents the taxonomic diversity since the two unrepresented subfamilies are the smallest of palms (Nypoideae is monotypic anc Ceroxyloideae includes 47 species). Flower buds were obtained from spirit collections (Aarhus University; Royal Botanic Gardens, Kew) and from living collection

(Jardin Botanique de la Ville de Paris; Botanischer Garten Berlin-Dahlem; Supplementary

Table 1). Pollen production was estimated from well-preserved and closed hermaphroditic or male flower buds (for monoecious and dioecious species). We selected flower buds in which the anthers had not yet dehisced, so that the pollen content was intact. These constraints considerably limited the amount of material from which the number of pollen grains could be evaluated with confidence. In most cases, we found only one individual per species whose flowers matched all these criteria. In the following we will use the term ‘individual’ to refer to both the individual and the corresponding species.

122

Pollen grains extraction and counting

Three flowers per individual were sampled (rarely two; see Supplementary Table1). Flowers were dissected under a Zeiss Stemi SV6 stereomicroscope (Carl Zeiss AG, Göttingen,

Germany). The exact number of stamens was determined for each flower bud dissected. Six anthers per flowers were taken, dried overnight at 30°C and grinded in a MM300 mixer mill

(Retsh, Germany). Pollen grains were resuspended in 300L of Alexander’stain (Alexander

1980). Three aliquots of the solution (3 x 5 L) were sampled to count pollen grains under an

Olympus BH-2 microscope (Olympus, USA). When flowers had 6 or less stamens, these stamens were all used to count pollen grains. When flowers had more than six stamens, in order to avoid counting an excessive number of pollen grains we chose to sample 6 stamens.

In this case, we selected stamens along a transect from outer part of the androecium to the inner part, in order to overcome the potential problem of differences in pollen production according to stamen position. The mean number of pollen grains counted in the 3*5L aliquots was used as an approximation of the overall production of each flower. In the case of flowers with more than six stamens, this mean number was divided by six and multiplied by the number of stamens.

Statistical analyses

We calculated the average pollen production per individual (mean of the values for the three flowers and for the three counts per flower). We checked if calculating a mean value had a sense in our experiment by comparing between-individuals variability and within-individuals variability. We also calculated the average stamen number per individual (mean of the values for the three flowers). Four datasets were constructed, one per subfamily (Calamoideae dataset, Coryphoideae dataset, Arecoideae dataset) and one including all the data (total dataset). We tested the correlation between our two variables, the average pollen production

123

and the average stamen number, using the Spearman's rho test (Hollander and Wolfe 1973;

Best and Roberts 1975). Spearman's rho is a nonparametric, rank-based measure of statistical dependence. This test was used because our data do not fit a bivariate normal distribution

(even after a log-transformation). Our datasets also have strong outliers that are in the tails of both samples, and the Spearman correlation is known to be less sensitive to this phenomenon than other correlation tests. We used the R software (R Development Core Team 2007) for all the analyses.

Phylogenetic signal in stamen number and pollen production

Because observations on stamen number and pollen production were made on phylogenetically related species, our data may be statistically non-independent due to common ancestry (Felsenstein 1985; Harvey and Pagel 1991). We tested the presence of a phylogenetic signal (Blomberg et al. 2003) in the two characters, in order to investigate a tendency of related species to resemble each other more than expected randomly. Estimating the presence of a phylogenetic signal is a prerequisite in phylogenetic comparative analyses.

We chose an approach that expresses the topological properties of the phylogenetic tree via an orthonormal basis, which is further used to decompose the character variance. This decomposition provides a structure function, called “orthogram”, which leads to characterize the dependence of character values on the topology of the tree (Ollier et al. 2006). Three different characters were tested: (1) stamen number at the level of the palm family (183 palms species, one per genera, plus the outgroups), (2) stamen number and (3) pollen production from the correlation experiment (59 values, one per genus). When data were generated for several species within a genus (correlation experiment), mean values were calculated in order to match with the generic-level supertree. The tree from Couvreur et al. (2011) with branch lengths was modified to include only taxa for which data were available. Taxa with missing

124

data were removed. We found data on pollen production for one outgroup species, Zea mays

(Emberlin et al. 1999).

Analyses were conducted using the R software (R Development Core Team 2007).

Complementary test statistics were generated to diagnose the intensity and the nature of phylogenetic signal: R2Max (significant change in character appeared at one or several nodes), D max (Kolmogorov-Smirnov statistic on uniform distribution of variance), SkR2k

(variance distribution across the tree is rather skewed to the root or to the tips) and SCE

(average local variation of the orthogram values; Ollier et al. 2006). These tests were performed with 999 Monte Carlo permutations of tips values.

Results

Stamen number optimization

Figure 1 shows the MP optimization of the character ‘stamen number’ on the palm supertree.

The majority of species have six stamens (oligandry) and it is the most common character state in Calamoideae and part of Coryphoideae (Trachycarpeae). The ancestral state in the palm family is six stamens and it is also the ancestral state in all subfamilies, except

Nypoideae where the single species Nypa fructicans has three stamens (also oligandry).

According to the optimization, transitions toward polyandry occurred several times independently in all subfamilies (except Nypoideae). The most common transitions are from six stamens to low polyandry and from six stamens to moderate polyandry. Transitions toward high polyandry are only found in the tribes Phytelepheae and Areceae. Transitions toward moderate and high polyandry occurred often directly from oligandry with an exceptions in tribe Areceae, where moderate polyandry evolved from low polyandry in

Howea belmoreana, and high polyandry evolved from moderate polyandry in Brassiophoenix schumanni.

125

Correlation between stamen number and pollen production

Stamen number and pollen production (number of pollen grains) for each flower of the 82 individuals included in our sampling are presented in Supplementary Table 1. The average pollen production per individual ranged from ~ 100 grains in Sabal bermudana

(Coryphoideae) to ~ 2 600 000 grains in Caryota urens (Coryphoideae). The average pollen production for all the individuals was ~ 170 000 pollen grains (standard deviation around

355 000). The average stamen number per individual ranges from 3 in Areca triandra, Dypsis mirabilis and Dypsis ambilaensis (Arecoideae) to 190 in Ptychococcus sp. (Arecoideae).

Among the 82 individuals, 47 had 6 stamens, 4 had less than 6 and 31 had more than 6.

The inter-individual variability (standard deviation of mean amount of pollen grains per flower per individual) was 354943.9 pollen grains per flower per individual and the intra- individual variability (mean of standard deviation per flower per individual) was 37201.14 pollen grains per flower per individual for the total dataset. Differences of the same order were observed for each subfamily dataset. The significantly lower value of intra- vs. inter- individual variability allowed us to use the mean value of pollen production per individual in the rest of our analyses.

The graphical relationship between stamen number and pollen is presented in Figure 2. There was no apparent linear relationship. All individuals of the subfamily Calamoideae (blue dots) that were included in our dataset had 6 stamens and pollen production in this subfamily was moderate (between ~ 2000 and ~ 400 000 grains). The greatest range of variation in stamen number was found in the subfamily Arecoideae (from 3 to 190 stamens) where pollen production ranged between ~ 190 and ~ 900 000 grains. The greatest range of variation in pollen production was found in the subfamily Coryphoideae (between ~ 100 and ~ 2 600 000 grains) where stamen number ranged from 6 to 47 stamens.

126

Results of correlation test are presented in Table 1. A correlation was found between stamen number and pollen production within Arecoideae, Coryphoideae, and at the family level, but not within Calamoideae where only species with six stamens were sampled. The stronger relationship was found in Arecoideae, with a Spearman’rho of 0.71 (P-value = 3.849e-10) which is a good value for this kind of test. The correlation was weaker in Coryphoideae with a

Spearman’rho of 0.65 (P-value = 0.0127).

Phylogenetic signal in stamen number and pollen production

A phylogenetic signal was detected for the character ‘stamen number’ when the 183 species

(one per genera) were considered. This character can be considered as shaped by phylogenetic history because the four test statistics were significant (Table 2) and the cumulative orthogram had most of its values outside the confidence envelopes (Figure 3A). The R2Max statistics shows that significant changes in the character state appeared at several nodes of the trees.

The SkR2k statistics shows changes in stamen number seem to have occurred relatively recently since variance distribution across the tree is rather skewed to the tips. When the tree including only the 59 species for which both stamen number and pollen production were recorded was considered, the test behaved in the same way (even if the first test statistics was not significant; Table 2), confirming the existence of a phylogenetic signal in stamen number.

No phylogenetic signal was detected in pollen production. None of the four tests rejected the null hypothesis of a uniform distribution of orthogram values (Table 2) and values of the cumulated orthogram remained within the confidence envelopes (Figure 3B).

For this reason, phylogenetic comparative analyses were not further conducted.

127

Discussion

Stamen number evolution

Our study at the species level confirms what had been shown before: six stamens is the ancestral state of palms (Nadot et al. 2011). The presence of a phylogenetic signal (Figure 3A) in the character ‘stamen number’ at the level of the family gives even more support to this inferred ancestral state (Laurin 2004). From this ancestral state repeated transitions towards polyandry occurred (Figure 1). Interestingly, transitions towards moderate and high polyandry occurred quite often from the ancestral state, showing that the evolution of stamen number is not a gradual phenomenon with progressive increase from the ancestral state.

This phenomenon may be linked to the developmental pathways of stamen initiation. Within

Angiosperms, not all polyandrous forms are homologous since they are associated with different floral organizations, but also result from different developmental pathways (e.g., spiral vs. whorled phyllotaxis or centripetal vs. centrifugal stamen inception). In monocots, stamens are commonly arranged in one or two whorls (Endress 2011). In this clade, increase in stamen number can take place by the insertion of more primordia coinciding with an expansion of the receptacle, or by secondary divisions of primordia (Ronse Decraene and

Smets 1987). Polyandry thus results from the addition of stamens within a whorl and/or addition of whorls of stamens. This situation is described as numerous stamens in whorls or polycycly (Ronse Decraene and Smets 1998), whereas numerous and spirally arranged stamens is considered by some authors as “true polyandry” (Ronse Decraene and Smets

1987). However, in polycycly like in spiral polyandry, arrangement patterns can be irregular and lead to “chaotic” polyandry at anthesis (Ronse Decraene and Smets 1998; Endress 2011).

These two kinds of polyandry (polycycly and spiral) are found in palms and arose from an ancestral state of six stamens in two whorls, an outer whorl of three stamens opposite the sepals and an inner whorl of stamens opposite the petals (Uhl and Moore 1980). All

128

polyandrous taxa studied for androecial development, except Phytelepheae, exhibit basic trimery in the androecium. Most of the time increase in stamen number occurred by the addition of whorls and/or addition of stamens within a whorl, thus leading to polycycly.

Enlarged primordia producing more than one stamen, as well as the addition of whorls are linked to apex expansion. After petal inception, the floral apex expands in diameter and/or height to accommodate the large number of stamens. The variability in stamen number thus depends on apex expansion which will allow increase in whorl number or increase in primordia size and division (number of stamens within a whorl). In all cases, stamens develop in different arrangements but always in antesepalous (AS) and antepetalous (AP) positions.

For example, in Lodoicea, Caryota (Coryphoideae) and Ptychosperma (Arecoideae), the first

AS whorl has always three stamens whereas the first AP whorl can have more than three stamens. When more inner whorls are present, they have mostly three stamens and alternate

AS and AP positions (Uhl 1976; Uhl and Moore 1980). There is a slight difference in the developmental pathway in Socratea, Wettinia and Welfia (Arecoideae), where several stamens appear opposite each sepal (Uhl and Moore 1980). In Eugeissona (Calamoideae) and

Ceroxylon (Ceroxyloideae), there are no additional whorls. In the first genus, the AP whorl has enlarged primordia that produce each several stamens (Uhl and Dransfield 1984). In the second genus, both AS and AP primordia produce several stamens (Uhl and Moore 1980). In

Phytelepheae, stamens arise in a spirally arrangement¸ with a centrifugal initiation (Uhl and

Moore 1977a; Barfod and Uhl 2001). This transition between six stamens in two whorls and spiral polyandry is unique in palms.

Studying the genetic control underlying these different developmental pathways will be useful to understand stamen number evolution. Genes controlling apex expansion as well as the number and size of primordia need to be identified and their evolution studied. Orthologues of genes already identified in Arabidopsis thaliana could be good candidates. For example, it has

129

been shown that SUPERMAN (Bowman et al. 1992) and FON1 (Huang and Ma 1997) play a role in controlling floral meristem activity and organ number. Our study on stamen number evolution could help selecting taxa on which conduct developmental and genetic analysis. The comparison between sister groups with contrasted character states for stamen number could help understanding how transitions from oligandry to polyandry or among the different polyandrous states may have taken place.. In particular, it would be of great interest to unravel the genetic control of stamen initiation in Phytelepheae, with their intriguing highly polyandrous androcium, unique among palm from a morphological and a developmental point of view,

Inflorescence and floral structure can constrain the development of stamens. Endress (2001) linked the two kinds of floral phyllotaxis (spiral vs. whorled) with floral organization. When the organs are spirally arranged, the number is not fixed and leads to an “open” organization.

When the organs are whorled, the organization is “closed” and allows a higher level of synorganization (Soltis et al. 2009). Both “open” and “closed” floral organizations allow increase in stamen number. However, complex synorganization, like zygomorphy is known to possibly limit stamen number (Jabbour et al. 2008). Lack of space due to interactions with the female organs, the functional gynoecium in hermaphroditic flowers or the pistillode in staminate unisexual flower, could limit the number of stamens (Ronse Decraene and Smets

1995). Zygomorphy is absent in palms (although some species have slightly asymmetric flowers prior anthesis) and several polyandrous species have a more or less developed pistillode. The mode of apical expansion and the form of the primordia appear to depend on pressure imposed on the floral apices, suggesting that modification of inflorescence bracts and perianth could have preceded the evolution of polyandry (Uhl and Moore 1980). This hypothesis remains to be tested by developmental studies at family level and within a phylogenetic framework.

130

Estimation of pollen production

Our results suggest that pollen production in palm flowers is highly variable, with a number of pollen grains ranging between a few hundreds and several millions per flower. Retrieving the total amount of pollen grains produced within an anther without any loss is a delicate process. Pollen grains are usually extracted by a chemical treatment, called acetolysis

(Erdtman 1943). With this method, anther tissues are digested by a mixture of acetic anhydride and concentrated sulphuric acid. Pollen grains need to be washed before observation, and during this step part of them are often lost (personal observation). This is not a problem if the purpose of the experiment is simply morphological observation; however it could false the results if the purpose is to retrieve the total amount of pollen grains present in the anthers. In order to reduce losses of pollen grains as much as possible, we used a simple protocol in which the anthers were dried, powdered, and the pollen grains were directly resuspended afterwards. The only disadvantage of this technique is the presence of numerous anther fragments with the pollen grains. That forces the observer to discriminate and count visually the pollen grains under a microscope. However a particle counter could easily be used with our extraction technique.

Another issue in estimating the pollen production of a flower is to discriminate viable grains.

Some methods exist but can only be used on fresh flowers. Most of our sampling was flowers in alcohol; we were thus unable to estimate the percentage of viable pollen grains.

Complementary experiment on fresh flower will be a useful improvement to our results.

Correlation between stamen number and pollen production

We evidence for the first time in the palm family a correlation between the number of stamens and the number of pollen grains produced per flower. However, this relationship is not linear.

Within two subfamilies, Coryphoideae and Arecoideae, the number of pollen grains produced

131

per individual tends to be higher when the number of stamens increases). It is notably the case in the Arecoideae (see Figure 2, red dots), especially in the tribe Areceae. However when the number of stamen is six, the ancestral state of the family, pollen production can be also variable. It is the case in the three subfamilies examined. In palms, increase in pollen production seems therefore to be achieved in two different ways: increase in stamen number and/or increase in pollen grains production within an anther.

We identified a strong phylogenetic signal in the character stamen number but not in pollen production. This suggested that stamen number could be evolutionarily conserved whereas pollen production could be a more labile character. However, these interpretations must be taken with caution. Evolutionary conservatism could imply either strong stabilizing selection or a low rate of evolutionary change. Moreover rapid evolutionary change (lability) could occur under different process as genetic drift or natural selection (Revell et al. 2008).

The work presented here is a first step in the understanding of the link between stamen number and pollen production. One drawback of our study is that we quantified pollen production for only one individual per species. This value represents the production at the time and location of sampling, which means that the potential variability of pollen production among individuals of the same species and according to different environmental conditions was not taken into account. Moreover the position of the sampled flowers along the inflorescence is unknown. This may be of importance since the position of the flower on the inflorescence is thought to influence pollen production, as resources available decline distally

(Cao et al. 2011). Population-level studies on pollen production could provide useful information on the respective part of environment (resources) and phylogeny in the variability of this character.

132

Future prospects for the study of stamen number evolution

Our study revealed the existence of a link between stamen number and pollen production in some groups of palms. In these cases, a high stamen number could have been selected because of the greatest quantity of pollen produced. Whether a high pollen production has a positive impact on fitness needs to be tested. Modification in pollen production may reflect a modification of the investment in reproduction (production of pollen grains and ovules) and/or in male function only. This could be evaluated by comparing pollen/ovule (P/O) ratios, but the diversity in sexual system found in palms (Nadot et al. in prep) makes this type of approach relatively difficult. Traditionally, the P/O ratio is used with hermaphroditic species

(Cruden 1977) and is calculated within a flower. In this case it reflects pollination efficiency, i.e. the likelihood of a pollen grain to reach a stigma, and it is correlated with the breeding system (the P/O ratio is generally lower in autogamous vs. allogamous species; Cruden 1977;

Cruden 2000). However most palm species are monoecious (see Supplementary Figure 1) and bear unisexual male and female flowers grouped in clusters or on different inflorescences. For monoecious species, the investment in reproduction and P/O ratio should be estimated at the level of the flower cluster or the inflorescence. The number of male and female flowers has to be taken into account, as well as pollen and ovule production. In dioecious species, the investment in male and female functions is allocated between individuals. Pollen production therefore reflects the investment in reproduction of male individuals.

A higher investment in male function could have been selected if it promotes pollination efficiency. For example, both beetles and bees, which are the predominant pollinators of palms (Barfod et al. 2011), are attracted by flowers producing copious amount of pollen.

Individuals that produce more pollen could be better competitors than other individuals within a species, but also than individuals of co-flowering species (Mitchell et al. 2009). Palm flowers are usually small and grouped in huge inflorescences. Henderson (2002) observed a

133

high level of correlation between inflorescence architecture (size, proximity of flowers) and types of pollinators. Considering the high level of compaction of the inflorescences in many palm species, it is possible that inflorescences act as the main pollination unit instead of flowers, as observed in Araceae (Chouteau et al. 2006). Pollen production should be therefore investigated at the inflorescence level and related to the type of pollen vector.

The evolution of stamen number may also be independent of a potential selection on pollen production. The link between stamen number and pollen production observed in our experiment could also be due to constraints on pollen development. If the production of pollen grains per anther is constrained (genetically or architecturally, by the size of anthers in the latter case), more stamens lead mechanically to more pollen grains. Whether numerous stamens (considering or not pollen production) is a floral trait under selection remains to be tested. Repeated increases in stamen number from an ancestral state of six during the evolutionary history of the family may be due to local relaxation of phylogenetic constraints.

The potential adaptive value of numerous stamens could be tested by experimental study of phenotype modification (Harder and Johnson 2009), by removing stamens from flowers on individuals in natural population and investigating the effect on performance in reproduction, as well as the effect on the behaviour of visitors (pollinators and predators) to determine if numerous stamens could be an attractive and/or a defence trait.

Acknowledgements

The authors are grateful to Lauren Gardiner and Elizabeth Woodgyer (Kew Gardens, “Palm section” and Collection Management Unit), Vincent Lipa (Serres d’Auteuil – Mairie de

Paris), Aarhus University herbarium and Botanischer Garten Berlin-Dahlem which provided the plant material. Jürg Schönenberger and the University of Vienna are also gratefully

134

acknowledged for funding the eFLOWER server hosting the PROTEUS database. SN received a research grant from Aarhus University to conduct part of this research. EA received a financing from Centre de Recherche sur la Paléobiodiversité et les

Paléoenvironnements (UMR 7207 CNRS - MNHN - UPMC) to sample material in Kew.

135

References

Alexander, M. P. 1980. A versatile stain for pollen fungi, yeast and bacteria. Stain Technology, 55, 13-18. Baker, W. J., Savolainen, V., Asmussen-Lange, C. B., Chase, M. W., Dransfield, J., Forest, F., Harley, M. M., Uhl, N. W. & Wilkinson, M. 2009. Complete generic- level phylogenetic analyses of palms (Arecaceae) with comparisons of supertree and supermatrix approaches. Systematic Biology, 58, 240–256. Barfod, A. S. 1991. A monographic study of the subfamily Phytelephantoideae (Arecaceae). Opera Botanica, 105, 1-73. Barfod, A. S., Hagen, M. & Borchsenius, F. 2011. Twenty-five years of progress in understanding pollination mechanims in palms (Arecaceae). Annals of Botany, 108, 1503-1516. Barfod, A. S. & Uhl, N. W. 2001. Floral development in Aphandra (Arecaceae). American Journal of Botany, 88. Barrera, E. & Nobel, P. S. 2004. Nectar: properties, floral aspects, and speculation on origin. TRENDS in plant Sciences, 9, 65-69. Barthlott, W. & Hunt, D. R. 1993. Cactaceae. In: The families and genera of vascular plants (Ed. by Kubitzki, K., Rohwer, J. G. & Bittrich, V.), pp. vol. 2, 161 – 197. Berlin, Germany: Springer. Bernhardt, P. 2000. Convergent evolution and adaptive radiation of beetle-pollinated angiosperms. Plant Systematics and Evolution, 222, 293-320. Best, D. J. & Roberts, D. E. 1975. Algorithm AS 89: The Upper Tail Probabilities of Spearman's rho. Applied Statistics, 24, 377–379. Blomberg, S. P., Garland, T. & Ives, A. R. 2003. Testing for phylogenetic signal in comparative data: behavioral traits are more labile. Evolution, 57, 717-745. Bowman, J. L., Sakai, H., Jack, T., Weigel, D., Mayer, U. & Meyerowitz, E. M. 1992. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development, 114, 599-615. Cao, G., Xue, L., LI, Y. & Pan, K. 2011. The relative importance of architecture and resource competition in allocation to pollen and ovule number within inflorescences of Hosta ventricosa varies with the resource pools. Annals of Botany, 107, 1413-1419.

136

Chouteau, M., Barab&, D. & Gibernau, M. 2006. A comparative study of inflorescence characters and pollen-ovule ratios among the genera Philodendron and Anthurium (Araceae). International Journal of Plant Sciences, 167, 817-829. Couvreur, T. L. P., Forest, F. & baker, W. J. 2011. Origin and global diversification patterns of tropical rain forests: inferences from a complete genus-level phylogeny of palms. BMC Biology, 9, doi:10.1186/1741-7007-9-44. Crepet, W. L. & Nixon, K. C. 1996. The fossil history of stamens. In: The anther form, function and phylogeny (Ed. by D’Arcy, W. G. & Keating, R. C.): Cambridge University Press. Cruden, R. W. 1977. Pollen-ovule ratios: a conservative indicator of breeding systems in flowering plants. Evolution, 31, 32-46. Cruden, R. W. 2000. Pollen grains: Why so many? Plant Systematics and Evolution, 222, 143-165. D’Arcy, W. G. 1996. Anthers and stamens and what they do. In: The anther form, function and phylogeny (Ed. by D’Arcy, W. G. & Keating, R. C.): Cambridge University Press. Damerval, C. & Nadot, S. 2007. Evolution of perianth and stamen characteristics with respect to floral symmetry in Ranunculales. Annals of Botany, 100, 631-640. Dransfield, J., Uhl, N. W., Asmussen, C. B., Baker, W. J., Harley, M. M. & Lewis, C. E. 2008. Genera palmarum: the evolution and classification of palms. Royal Botanic Gardens, Kew: Kew Publishing. Emberlin, J., Adams-Groom, B. & Tidmarsh, J. 1999. A Report on the Dispersal of Maize Pollen. National Pollen Research Unit University College Worcester WR2 6 AJ Endress, P. K. 2001. Origins of flower morphology. Journal of experimental zoology, 291, 105-115. Endress, P. K. 2011. Evolutionary diversification of the flowers in angiosperms. American Journal of Botany, 98, 370-396. Endress, P. K. & Doyle, J. A. 2009. Reconstructing the ancestral angiosperm flower and its initial specilization. American Journal of Botany, 91, 22-66. Endress, P. K. & Igersheim, A. 2000. The reproductive structures of the basal angiosperm Amborella trichopoda (Amborellaceae). International Journal of Plant Sciences, 161, S237 – S248.

137

Erdtman, G. 1943. An introduction to pollen analysis. Waltham, Mass., USA: Chronica Botanica Company. Felsenstein, J. 1985. Phylogenies and the comparative method. American Naturalist, 125, 1-15. Goremykin, V. V., Nikiforova, S. V., Biggs, P. J., Zhong, B., Delange, P., Martin, W. & etal. 2013. The evolutionary root of flowerinf plants. Systematic Biology, 62, 50-61. Harder, L. D. & Johnson, S. D. 2009. Darwin's beautiful contrivances: evolutionary and functional evidence for floral adaptation. New Phytologist, 183, 530-545. Harvey, P. H. & Pagel, M. D. 1991. The comparative method in evolutionary biology. Oxford, UK: Oxford University Press. Henderson, A. 2002. Evolution and ecology of palms. Bronx, New York: The New York Botanical Garden Press. Hollander, M. & Wolfe, D. A. 1973. Nonparametric statistical inference. New York: John Wiley & Sons. Huang, H. & Ma, H. 1997. FON1, an Arabidopsis gene that terminates floral meristem activity and controls flower organ number. The Plant Cell, 9, 115-134. Huynh, K.-L. 1991. The fl ower structure in the genus Freycinetia , Pandanaceae (part 1) — Potential bisexuality in the genus Freycinetia. Botanische Jahrbücher für Systematik, 112, 295 – 328. Jabbour, F., Damerval, C. & Nadot, S. 2008. Evolutionary trens in the flowers of Asteridae: is polyandry an alternative to zygomorphy? Annals of Botany, 102, 153-165. Janka, H., vonBalthazar, M., Alverson, W. S., Baum, D. A., Semir, J. & Bayer, C. 2008. Structure, development and evolution of the androecium in Adansonieae (core Bombacoideae, Malvaceae s.l.). Plant Systematics and Evolution, 275, 69 – 91. Laurin, M. 2004. The evolution of body size, Cope's rule and the origin of Amniotes. Systematic Biology, 53, 594-622. Linné, C. v. 1753. Species Plantarum. http://www.biodiversitylibrary.org/item/13829 Lorence, D. H. 1985. A monograph of the Monimiaceae (Lauraceae) in the Malagasy region (Southwest Indian Ocean). Annals of the Missouri Botanical Garden, 72, 1 – 165.

138

Maddison, W. P. & Maddison, D. R. 2011. Mesquite: a modular system for evolutionary analysis. Version 2.75 http://mesquiteproject.org. Mitchell, R. J., Flanagan, R. J., Brown, B. J., Waser, N. M. & Karron, J. D. 2009. New frontiers in competition for pollination. Annals of Botany, 103. Nadot, S., Sannier, J., Barfod, A. S. & Baker, W. J. 2011. Evolution of the palm androecium as revealed by character mapping on a supertree. In: Flowers on the tree of life (Ed. by Wanntorp, L. & RoncedeCraene, L. P.): Cambridge University Press. Ollier, S., Couteron, P. & Chessel, D. 2006. Orthonormal transform to decompose the variance of a life-history trait across a phylogenetic tree. Biometrics, 62, 471- 477. Peters, H. A., Pauw, A., Silman, M. R. & Terborgh, J. W. 2004. Falling palm fronds structure amazonian rainforest sapling communities. Proc Biol Sci, 271 Suppl 5, S367-9. Prance, G. T. 1976. Family 120. Caryocaraceae (Flora of Panama). Annals of the Missouri Botanical Garden, 63, 541 – 546. Prance, G. T. & Mori, S. A. 2004. Lecythidaceae. In: The families and genera of vascular plants (Ed. by Kubitzki, K.), pp. vol. 6, 221 – 232. Berlin, Germany: Springer. RDevelopmentCoreTeam. 2007. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3- 900051-07-0, URL http://www.R-project.org. Revell, L. J., Harmon, L. J. & Collar, D. C. 2008. Phylogenetic signal, evolutionary process and rate. Systematic Biology, 57, 591-601. RoncedeCraene, L. P. & Smets, E. 1987. The distribution and the systematic relevance of the androecial characters oligomery and polymery in the Magnoliophytina. Nordic Journal of Botany, 7, 239-253. RoncedeCraene, L. P. & Smets, E. 1995. The distribution and systematic relevance of the androecial character oligomery. Botanical Journal of the Linnean Society, 118, 193-247. RoncedeCraene, L. P. & Smets, E. F. 1998. Notes on the evolution of androecial organisation inthe Magnoliophytina (angiosperms). Botanica Acta, 111, 77-86.

139

Rudall, P. J., Abranson, K., Dransfield, J. & Baker, W. J. 2003. Floral anatomy in Dypsis (Arecaceae-Areceae): a case of complex synorganisation and stamen reduction. Botanical Journal of the Linnean Society, 143, 115-133. Salisbury, E. J. 1926. Floral construction in the Helobiales. Annals of Botany, 40, 419 – 445. Sauquet, H. 2013. PROTEUS: A database for recording morphological data and creating NEXUS matrices. Version 1.17. http://eflower.myspecies.info/proteus. Schneider, E. L. & Williamson, P. S. 1993. Nymphaeaceae. In: The families and genera of vascular plants (Ed. by Kubitzki, K., Rohwer, J. G. & Bittrich, V.), pp. vol. 2; 487 – 493. Berlin, Germany: Springer. Soderstrom, T. R. & Londoño, X. 1988. A morphological study of Alvimia (Poaceae: Bambuseae), a new Brazilian bamboo genus with fleshy fruits. American Journal of Botany, 75, 819 – 839. Soltis, P. S., Brockington, S. F., Yoo, M.-J., Piedrahita, A., Latvis, M., Moore, M. J., Chanderbali, A. S. & Soltis, D. E. 2009. Floral variation and floral genetics in basal angiosperms. American Journal of Botany, 91, 110-128. Tamura., M. 1995. Ranunculaceae. In: Die natürlichen Pflanzenfamilien (Ed. by Engler, A. & Prantl, K.), pp. vol. 17a, part IV. Berlin, Germany: Ducker & Humblot. Uhl, N. & Moore, H. E. 1980. Androecial development in six polyandrous genera representing five major groups of palms. Annals of Botany, 45, 57-75. Uhl, N. W. 1976. Developmental studies in Ptychosmerpa (Palmae). II. The Staminate and Pistillate Flowers. American Journal of Botany, 63, 97-109. Uhl, N. W. & Dransfield, J. 1984. Development of the inflorescence, androecium and gynoecium with reference to palms. In: Contemporary problems in plant anatomy (Ed. by White, R. A. & Dickinson, W. C.). New York: Academic Press. Uhl, N. W. & Moore, H. E. 1977a. Centrifugal stamen initiation in Phytelephantoid palms. American Journal of Botany, 64, 1152-1161. Uhl, N. W. & Moore, H. E. 1977b. Correlation of inflorescence, flower structure, and floral anatomy with pollination in some palms. Biotropica, 9, 170-190. Williamson, P. S. & Schneider, E. L. 1993. Cabombaceae. In: The families and genera of vascular plants (Ed. by Kubitzki, K., Rohwer, J. G. & Bittrich, V.), pp. vol. 3; 157 – 161. Berlin, Germany: Springer.

140

Tables and Figures Table 1 Correlation test between stamen number and pollen production within subfamilies Arecoideae, Calamoideae and Coryphoideae, and at the level of the family.

Table 2 Observed values and P-values for the four test statistics (999 Monte Carlo permutations of tips values): R2Max (significant change in character appeared at one or several nodes), D max (Kolmogorov-Smirnov statistic on uniform distribution of variance), SkR2k (variance distribution across the tree is rather skewed to the root or to the tips) and SCE (average local variation of the orthogram values; Ollier et al. 2006). Three different characters were tested: stamen number at the level of the palm family (183 palms species, one per genera, plus the outgroups), stamen number and pollen production from the correlation experiment (59 values, one per genus).

141

Fig 1 Supertree from the analysis of Baker et al. (2009) showing the evolution of stamen number in palms optimized using Maximum Parsimony. (A) All subfamilies except

Arecoideae. (B) Arecoideae (continuation of (A)). Boxes at the tip of branches are coloured according to the character state: White = less than 6 stamens, Blue = 6 stamens, Yellow = low polyandry (7-22 stamens), Red = moderate polyandry (23-114 stamens) and Black = high polyandry (more than 114 stamens). Branch colours correspond to the inferred ancestral sate.

Several colours on the same branch denote ambiguity in the ancestral state. Genera included, phylogenetic relationships and tribe names are according to Baker et al. (2009) and Couvreur et al (2011).

142

143

144

Fig 2 Relationship between stamen number and pollen production (number of pollen grains);

(A): untransformed data showing ranges and strong outliers; (B): log-transformed data. Blue dots correspond to individuals belonging to subfamily Calamoideae, green dots to subfamily

Coryphoideae and red dots to subfamily Arecoideae.

(A)

(B)

145

Fig 3 (A) analysis of stamen number for 183 species (one per genera) of palms. (B) Analysis of pollen production for 59 species (one per genus). Top: variance decomposition orthogram plots; bottom: cumulative decomposition orthogram plots. In the orthogram plots bars are proportional to the squared coefficients (white and gray bars stand for positive and negative coefficients, respectively); the dashed line is the upper confidence limit at 5%, deduced from

999 Monte Carlo permutations (mean value indicated by the horizontal solid line). In the cumulative orthogram plots circles represent observed values of cumulated squared coefficients, expected values under H0 are along the straight line, and dashed lines stand for the bilateral confidence interval.

(A) (B)

146

Supplementary material

Table 1 Taxonomic sampling for the correlation test between stamen number and pollen production. Sexual expression is specified. Stamen number and pollen production (number of pollen grains) for each flower of the 82 individual/species are presented. The last two columns give the mean value and standard-deviation for pollen production within an individual/species. AAU: Aarhus University herbarium; KEW: Royal Botanic Gardens Kew herbarium and spirit collection; Auteuil: Jardin Botanique de la Ville de Paris; Berlin:

Botanischer Garten Berlin-Dahlem.

147

148

149

150

151

152

Table 2 Proteus file (voir Annexe 3 du manuscrit)

153

Figure 1: Mirror trees showing the MP optimisation of the evolution of stamen number (left) and sexual system (right) (A) All subfamilies except Arecoideae. (B) Subfamily Arecoideae.

154

155

156

Chapitre 3 : Evolution du nombre d’étamines chez les Ptychospermatinae

157

158

Contexte et objectifs de l’étude

Notre étude sur le nombre d’étamines à l’échelle de la famille des palmiers (présentée dans le chapitre 2), a mis en évidence des groupes de taxons dans lesquels le caractère évolue de manière intéressante à étudier. C’est le cas notamment pour une partie de la tribu des Areceae (Arecoideae), la sous-tribu des Ptychospermatinae, originaires de la région Sud-Ouest de l’océan pacifique (Fig. 10).

Brassiophoenix and Ptychococcus 2 and 2 Adonidia 2 Ponapea 4

Drymophloeus 3 Solfia 1

Carpentaria Balaka 1 12

Ptychosperma Veitchia 30 11 Wodyetia and Normanbya 1 and 1

Fig. 10 : Distribution de la sous-tribu des Ptychospermatinae dans la région Sud-Ouest de l’océan pacifique (modifié à partir de Dransfield et al. 2008)

Elle regroupe douze genres et environ soixante espèces qui sont toutes polyandres. Pour reconstruire l’évolution du nombre d’étamines au sein de cette sous-tribu un cadre phylogénétique était nécessaire. Une phylogénie moléculaire incluant 60% des espèces a précédé notre étude (Zona et al. 2011). Néanmoins certaines relations phylogénétiques n’étaient pas encore bien résolues. Nous avons donc réalisé une phylogénie moléculaire de cette sous-tribu, basée sur différents marqueurs nucléaires et chloroplastiques.

159

Cette étude constitue un article de recherche dont les objectifs sont : (1) d’améliorer la résolution des relations phylogénétiques entre les espèces et les genres de la sous-tribu des Ptychospermatinae ; (2) d’utiliser le cadre phylogénétique ainsi obtenu pour reconstruire l’histoire évolutive du caractère « nombre d’étamines » à l’échelle de la sous-tribu.

Choix des marqueurs moléculaires

Le choix des marqueurs moléculaires est une étape cruciale des analyses phylogénétiques. Suivant leur niveau de variabilité ils fournissent les informations nécessaires pour réaliser des phylogénies à différent niveaux taxonomiques, ordres, familles, genres ou espèces. Il est donc important de choisir des marqueurs adaptés à la phylogénie que l’on veut réaliser, dans notre cas une phylogénie au niveau espèce incluant douze genres.

Les marqueurs chloroplastiques : chez les palmiers, les séquences d’ADN semblent évoluer relativement lentement par rapport à d’autres familles. Un certain nombre de marqueurs qui sont informatifs chez d’autres groupes d’Angiospermes, se révèlent insuffisants pour réaliser des phylogénies résolues au niveau des espèces. C’est notamment le cas des marqueurs issus du génome chloroplastique. Plusieurs études ont montré que les séquences d’ADN chloroplastique évoluent plus lentement chez les palmiers que chez les autres groupes de monocotylédones (Gaut et al. 1992). Ces études basées sur le gène rbcl ont montré notamment que le taux de substitutions moyen était environ cinq fois plus important chez les Poaceae que chez les palmiers (huit fois plus s’il on considère la troisième position des codons). Ceci pourrait s’expliquer par la très grande différence de temps de génération entre les Poaceae et les Arecaceae. Ces études ne se basant que sur un seul gène, n’ont pas dissuadé les chercheurs de trouver d’autres gènes ou des séquences non codantes chloroplastiques pouvant être suffisamment variables. Les premières phylogénies à l’échelle de la famille des palmiers ont ainsi utilisé des marqueurs chloroplastiques tels que l’intron rps16, les régions trnL-trnF (Asmussen et Chase 2001) ou matK (Asmussen et al. 2006), en plus du gène rbcl. Ces études ont montré que si en moyenne les séquences chloroplastiques codantes et non codantes présentaient le même nombre de sites informatifs, les dernières étaient caractérisées par un taux d’homoplasie plus faible et devaient donc être préférées aux premières. Elles ont aussi démontré que ces marqueurs sont peu informatifs, produisant des phylogénies au niveau genre avec de nombreuses polytomies, notamment au sein de la sous-famille des Arecoideae. Cependant une étude de la tribu des Chamaedoreeae (Cuenca et Asmussen-Lange 2007) a

160

obtenu une même qualité de résolution avec des marqueurs chloroplastiques non-codant (matK, l’intron rps16, ndhF et trnD-trnT) qu’une autre étude avec des marqueurs nucléaires (Thomas et al. 2006). En 2009, les marqueurs matK et rbcl ont été choisi comme marqueurs de base pour le barcode chez les plantes (CBOL 2009). Récemment une étude à l’échelle des monocotylédones a visé à sélectionner de nouveaux marqueurs chloroplastiques potentiellement intéressants pour renouveler le petit nombre de marqueurs communément utilisé (Scarcelli et al. 2011). Ils ont ainsi développé 100 paires de primers utilisables chez la plupart des monocotylédones et explorant les différentes parties du génome chloroplastique. Ces nouveaux marqueurs offrent la possibilité d’améliorer la résolution des phylogénies en apportant l’information de nouveaux sites variables.

Les marqueurs nucléaires : les premiers marqueurs nucléaires largement utilisés chez les plantes sont issus des gènes codant pour les sous-unités des ribosomes et des séquences avoisinantes (région 18S-5.8S-26S). Si les séquences codant pour les séquences d’ARN fonctionnel ont été modérément utilisées, les séquences codant pour l’ARN non-fonctionnel (internal transcribed spacer ou ITS) sont à l’origine de très nombreuses études phylogénétiques (Hughes et al. 2006). Chez les palmiers la région 18S a été le support d’une des premières études à l’échelle de la famille (Hahn 2002) sans apporter une résolution suffisante pour une phylogénie au niveau espèce. La région ITS se divise en deux parties suivant sa position de part et d’autre de la séquence du 5.8S : 18S-ITS1-5.8S-ITS2-26S. Le séquençage des deux régions ITS est parfois difficile (Hollingsworth 2011) ; il est alors possible de ne séquencer que la partie ITS2 qui semble la plus informative pour discriminer les relations phylogénétiques entre espèces (Chen et al. 2010). Cette séquence est ainsi de plus en plus proposée pour compléter matK et rbcl, les deux marqueurs de base du barcode, et cela notamment chez les palmiers (Chen et al. 2010 ; Jeanson et al. 2011b). Chez ces derniers, les séquences ITS ont été utilisées dans trois sous-familles, les Calamoideae (Baker et al. 2000), les Coryphoideae (Jeanson et al. 2011b) et les Arecoideae (Eiserhardt et al. 2011). Chez les Calamoideae un fort taux de polymorphisme intra-individuel a été identifié, rendant le clonage de différentes versions de la séquence nécessaire. En effet, la région codant pour les ARN ribosomaux est présente en plusieurs centaines ou milliers de copies qui sont répétées en tandem sur une ou plusieurs régions chromosomiques. Ces différentes copies évoluent en générale de façon identique (« concerted evolution ») par des mécanismes tels que des crossing-over inégaux et un fort taux de conversion génique qui aboutissent à la réduction ou la disparition des variations entre les séquences d’une même famille multigénique. Mais

161

parfois lorsque l’homogénéisation n’est pas terminée des copies divergentes peuvent constituer des orthologues et des paralogues. Ce réseau de paralogues peut alors poser des problèmes de séquençage et de reconstruction phylogénétique (Alvarez et Wendel 2003 ; Bailey et al. 2003). Chez les Coryphoideae, l’absence d’un double signal sur les résultats de séquençage, laisse penser qu’il n’existe pas dans ce groupe de paralogue divergent (Jeanson et al. 2011b). Ces incertitudes concernant la fiabilité des informations fournies par la région ITS, ont poussé les scientifiques à concentrer leurs recherches vers des gènes nucléaires possédant une ou un faible nombre de copies (single copy or low-copy nuclear genes ; Alvarez et Wendel 2003, Hughes et al. 2006). Puisqu’ils sont présent en faible nombre de copies ces gènes sont parfois plus difficile à amplifier mais plus fiable concernant l’interprétation de leur évolution. Très tôt dans l’histoire des phylogénies des palmiers, les gènes nucléaires à faible nombre de copies ont été considérés comme la source la plus importante et la plus intéressante de marqueurs moléculaires (Lewis et Doyle 2001). Lewis et Doyle (2001, 2002) ont caractérisé deux marqueurs, une portion du gène de la malate synthase (MS) et du gène de la phosphoribulokinase (PRK). Ce dernier à été le plus utilisé, souvent en association avec une portion de la séquence codant pour la deuxième sous-unité de l’ARN polymérase II (RPB2). Ils ont particulièrement contribué à améliorer des connaissances des relations phyogénétiques au sein de la famille (Roncal et al. 2005, Loo et al. 2006, Savolainen et al. 2006, Norup et al. 2006, Thomas et al. 2006, Trénel et al. 2007, Cuenca et al. 2008, Roncal et al. 2008, Baker et al. 2011, Zona et al. 2011). Récemment, de nouveaux marqueurs ont été caractérisés chez les palmiers pour leurs fonctions liées à la morphogénèse et à la réponse à un stimulus environnemental, respectivement AGAMOUS (AG1) et PHYTOCHTOME B (PHYB ; Ludena et al. 2011). Leur histoire évolutive pourrait refléter l’existence de réponses adaptatives particulières, testés chez les Cocoseae. De nouvelles approches ont été développées pour identifier des séquences non codantes du génome nucléaire pouvant être d’intéressants marqueurs phylogénétiques et notamment une méthode dans laquelle des génomes entiers d’organismes modèles sont comparés pour identifier des régions conservées (« CATS » pour « comparative anchor tagged sequences »). Des primers sont dessinés à partir de ces séquences et testés sur des représentants du groupe d’intérêt pour estimer le niveau de variabilité de ces séquences (Hughes et al. 2006). Cette méthode a été utilisée chez les palmiers avec des primers dessinés à partir de génomes de monocotylédones (Bacon et al. 2007). Elle a permis d’identifier sept marqueurs permettant de reconstruire des phylogénies à l’échelle des sous-familles et quatre marqueurs à l’échelle de

162

genres apparentés. D’autres méthodes existent, décrites par Hughes et al. (2006), mais n’ont pas, à notre connaissance, été mises en œuvre chez les palmiers.

Choix des marqueurs pour la phylogénie des Ptychospermatinae : lorsque nous avons commencé notre étude, une phylogénie des Ptychospermatinae avait déjà été réalisée à partir de deux marqueurs nucléaires PRK et RPB2 (Zona et al. 2011). Celle-ci était assez bien résolue au niveau genre, mais de nombreux clades n’étaient pas soutenus, notamment au niveau de relation entre espèces. Il était donc nécessaire d’ajouter des marqueurs pour améliorer la résolution. Il nous semblait intéressant de tester des marqueurs chloroplastiques, ce qui n’avait jamais été fait sur un large échantillon de la sous-tribu. En outre le génome chloroplastique étant transmis d’un seul tenant et uniquement par la graine, il ne subit pas de recombinaison et peut ainsi révéler une histoire évolutive un peu différente de celle des séquences nucléaires. Il est ainsi intéressant de les comparer et de combiner les informations qu’ils apportent. Nous avons donc choisi les deux marqueurs qui s’étaient révélé les plus informatifs dans l’étude des Chamaedoreeae (Cuenca et Asmussen-Lange 2007), matK et ndhF. Après une analyse préliminaire sur 14 espèces, ndhF a été abandonné en raison de son très faible taux de sites variables (4 sites variables sur 615) étaient variables. Nous avons donc décidé de le remplacer par deux marqueurs récemment identifiés, l’intron de ndhA et l’intron de rps15-ycf1 (Scarcelli et al. 2011). La plupart des marqueurs chloroplatiques auparavant sélectionnés, dont matK et ndhF, sont situés dans une région du génome appelée « Large Single Copy » (LSC) alors que ces nouveaux marqueurs sont situés dans la région « Small Single Copy » (SSC) et semblent plus variables. L’intérêt des marqueurs nucléaires ayant été largement démontré dans le passé, nous les avons logiquement inclus dans notre étude. Nous avons tout d’abord décidé de compléter le jeu de donner de Zona et al. (2011), en séquençant PRK et RPB2 pour les nouvelles espèces de notre étude. Cependant l’important taux d’échec pour l’amplification de RPB2 nous a contraints à abandonner ce marqueur. Un autre gène nucléaire à faible nombre de copies, a été sélectionné parmi les nouveaux identifiés, AGAMOUS (AG1 ; Ludena et al. 2011). Nous l’avons choisi pour son taux de variabilité chez les Bactridinae (6.1% de sites informatifs).

163

Synthèse des résultats

La combinaison de l’information de quatre marqueurs nucléaires (AGAMOUS 1, BRSC10, nrITS2 et PRK) et de trois marqueurs chloroplastiques (matK, ndhA, rps15-ycf1) a permis d’améliorer la résolution des relations phylogénétiques entre les espèces des Ptychospermatinae. Les marqueurs chloroplastiques se révèlent néanmoins beucoup moins informatifs que les marqueurs nucléaires dans cette sous-tribu. Notre étude a confirmé la monophylie des Ptychospermatinae et a permis de distinguer sept grands clades. En revanche, certaines relations phylogénétiques ne sont pas encore résolues, notamment entre les espèces du genre Ptychosperma. L’utilisation de marqueurs de type microsatellites dans une approche de génétique des populations pourrait peut-être permettre de comprendre la très faibles variation des séquences étudiés entre ces espèces. La phylogénie obtenue a été utilisé pour reconstruire l’évolution du caractère « nombre d’étamines » dans cette sous-tribu. Les données sur le nombre d’étamines des différentes espèces, disponibles dans la littérature, ont été rassemblées. Des observations ont été également réalisées sur des fleurs provenant d’herbiers. La reconstruction du caractère révèle une grande variabilité inter-spécifique. A partir d’un ancestral modérément polyandre (entre 20 et 60 étamines), plusieurs augmentations vers un nombre plus important d’étamines (autour d’une centaine) ont eu lieu durant l’histoire évolutive de la sous-tribu. Ce travail constitue un cadre phylogénétique pour de futures études sur le développement, le contrôle génétique des étamines nombreuses, mais aussi sur l’écologie et notamment la pollinisation de ces espèces.

L’article de recherche présenté dans ce chapitre sera soumis très prochainement au journal « Pespectives in Plant Ecology, Evolution and Systematics ». Une étude similaire a été effectuée chez une autre sous-tribu des Areceae : les Archontophoenicinae. Les résultats de ce travail font l’objet d’un autre article qui est présenté en Annexe 4 du manuscrit.

164

Article 3

165

166

Evolution of stamen number in Ptychospermatinae (Arecaceae): insights from a new molecular phylogeny of the subtribe.

Elodie Alapetite1, William J. Baker2, Sophie Nadot1,3

1Univ Paris-Sud, Laboratoire Ecologie, Systématique et Evolution, UMR 9079, Orsay, F-

91405, France

2Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK,

3Author for correspondence: [email protected]

Abstract

The subtribe Ptychospermatinae (palm family) is naturally distributed in the South West

Pacific area and contains 12 genera and around 60 species, including numerous popular ornamentals. Like many palms, Ptychospermatinae flowers are small, trimerous, unisexual and always grouped into inflorescences of various sizes. However they exhibit a wide diversity in stamen number (a few units to several dozens or even hundreds of units) that is poorly understood from an evolutionary point of view. Although advances have been made in elucidating phylogenetic relationships within Ptychospermatinae, some relationships among and within genera still remain to be clarified. Here we used a combination of four nuclear markers (nrITS2, the conserved nuclear intron BRSC10 and two low copy genes, PRK and

AGAMOUS) and three chloroplast markers (matK, ndhA and rps15-ycf1) to propose a new phylogenetic hypothesis for the subtribe. The combination of all these markers improved the resolution and robustness of phylogenetic relationships within the subtribe, allowing us to identify seven major clades. This phylogenetic framework was used to examine the evolution of stamen number in the clade. The optimisation of stamen number on the phylogeny

167

highlighted the high level of inter-specific variability, showing that the character is highly labile and raising questions about the evolutionary and functional significance of this lability.

Keywords: androecium, Arecaceae, Areceae, phylogeny, palms, Palmae, Ptychospermatinae, stamen number, AGAMOUS, PRK, low-copy nuclear DNA

168

Introduction

Over the last few decades, thanks to easy access to molecular characters, our knowledge of phylogenetic relationships between species has increased, providing useful frameworks to study evolutionary trends in morphological and ecological traits. In particular, the evolution of floral morphology has provoked great interest (e.g., Endress, 2011) since the flower is considered to be the key to the evolutionary success of Angiosperms.

In Palms (Arecaceae) flowers are usually small (generally less than 1 cm across) and have the typical trimerous groundplan of most monocot flowers, with three sepals, three petals and one or three carpels (Dransfield et al., 2008). There is a wide variation in androecium features and especially in stamen number. A recent study optimized the character “stamen number” on the genus-level phylogeny of the palm family (Nadot et al., 2011). From an ancestral state with six stamens (twice the perianth merism), both reduction and increase have occurred. Ten genera (of 183) include species with the number reduced to 3 stamens, and 84 genera include species displaying more than 6 stamens. Polyandry (more than 6 stamens) is thus quite common in palms and stamen number can reach large values (several dozen to several hundreds). If the transitions towards polyandry from the ancestral state with 6 stamens are now identified among genera, the patterns of transitions among polyandrous species are still poorly understood. Within Arecoideae (the largest subfamily of palms), the subtribe

Ptychospermatinae (tribe Areceae) includes exclusively genera that produce polyandrous flowers (Supplementary Table 1), with a number of stamens varying between 12 and 320.

This subtribe represents a good candidate to examine the patterns of variation in stamen number among polyandrous species and to test whether particular trends can be detected.

The subtribe Ptychospermatinae (Arecaceae: Arecoideae: Areceae; Hooker, 1883) comprises

12 genera and around 60 species (Dransfield et al., 2008; PalmWeb, 2013). They are naturally widespread in East Malesia (Moluccas, New Guinea, Salomon Islands, Vanuatu) extending to

169

Fiji, Tonga, Samoa and Northern Australia. Two genera, Adonidia and Ponapea, are more distant from the main distribution area. The one species of Adonidia are found west of

Wallace’s Line, on the island of Palawan and its offshore islands (Philippines) and on the coast of Sabah (Borneo), and three species of Ponapea species are found in the Caroline

Islands (Pohnpei and Palau). Ptychospermatinae palms are rarely used as primary resources by local populations, but the stems are sometimes used as timber (e.g. Ptychoccocus), or as food (e.g. Veitchia heart). However many species of the subtribe make elegant ornamentals widely planted throughout the tropics and subtropics (e.g. Adonidia merrillii, Balaka seemannii, Carpentaria acuminata, Normanbya normanbyi or Wodyetia bifurcata; Dransfield et al. 2008). The IUCN Red List of Threatened Species (http://www.iucnredlist.org/) classifies two species as critically endangered in their natural habitat, Balaka macrocarpa and

Solfia samoensis (formerly Drymophloeus samoensis). The habitat of Balaka macrocarpa has been severely reduced due to the conversion of land to agriculture and forestry plantations

(Fuller 1998; Hodel 2010). Solfia samoensis is a rare palm of montane cloud forests, threatened mostly by natural disasters (Whistler & Johnson 1998). The recently discovered species Ptychosperma halmaherensis, although not yet included in the Red List, is also considered as critically endangered due to the small size of the population (Heatubun 2011).

Two other species are endangered due to rapid and extensive deforestation for plantation agriculture, Ptychosperma gracile and Drymophloeus hentyi (formerly Ptychosperma hentyi;

Essig 1978). Wodyetia bifurcata is protected within the Cape Melville National Park

(Australia; Dowl 1998) and Adonidia maturbongsii in the North Biak Nature Reserve

(Indonesia, Papua; Baker and Heatubun, 2012).

In the past decades, there has been an important effort in delimiting genera and species of the subtribe, resulting in numerous taxonomic revisions (Essig 1978; Irvine 1983; Zona & Essig

1999; Zona & Fuller 1999; Zona 1999b, 2005; Hodel 2010). The monophyly of the subtribe is

170

strongly supported by morphology (Zona 1999a). Synapomorphies include black scales at the apex of the leaf sheath, leaf segment tip erose, peduncular bract that pierces the tip of prophyll, lag time between peduncular bract fall and anthesis, bullet-shape staminate buds

(more or less perpendicular to rachilla), numerous stamens and a pistillode usually bottle shaped. Within the subtribe, the limited variation in morphological characters makes synapomorphies difficult to identify, resulting in low morphological support for genera (Zona,

1999a). The latter study supported however the reinstatement of two monotypic genera,

Adonidia (previously included in Veitchia) and Solfia (previously included in Drymophloeus).

In the first molecular phylogenies of palms including several members of the subtribe, the monophyly of Ptychospermatinae was not retrieved (Asmussen and Chase, 2001; Hahn,

2002). In 2006, two studies based respectively on plastid and nuclear markers (Asmussen et al., 2006; Norup et al., 2006) increased the taxonomic sampling and identified

Ptychospermatinae as potentially monophyletic (with moderate support). In the complete generic-level phylogenetic analysis of palms published by Baker et al. (2009), the subtribe was resolved as monophyletic with 100% bootstrap support. In a large survey of phylogenetic relationship among arecoid palms (Baker et al., 2011) based on sequences of the two low- copy nuclear genes PRK and RPB2 and including 16 species of Ptychospermatinae, the subtribe was resolved as monophyletic with good support (82% maximum parsimony bootstrap support and 88% maximum likelihood bootstrap support). Zona et al. (2011) recently produced the first molecular phylogeny focused on the subtribe, based also on PRK and RPB2 and including 37 species from 12 genera. The results confirmed the monophyly of

Ptychospermatinae with strong support, and identified six major clades. They also found that the genera Drymophloeus, Ponapea and Veitchia were non-monophyletic. They proposed consequently to rearrange species among these genera. Although this study provided notable

171

improvement in our knowledge of the evolutionary history of the subtribe, there were several polytomies in the tree and some nodes were poorly supported.

Choosing DNA regions with the appropriate rate of variation to address issues on phylogenetic relationships among taxa is crucial and depends on the taxonomic level of the study. Rapidly evolving DNA sequences are required for studying closely related species.

Until recently, the majority of species-level phylogenies in plants relied on a limited set of non-coding plastid DNA loci (Hughes et al. 2006) because they are potentially variable at low taxonomic levels and easy to amplify using universal (for plants) primers. It has been demonstrated that plastid DNA sequences evolve slowly in palms compared to other monocot groups (Wilson et al., 1990; Gaut et al., 1996; Asmussen and Chase 2001). However Cuenca and Asmussen-Lange (2007) challenged this statement and suggested that the evolution of plastid sequences in palms is complex and may vary among groups within the family. As a consequence we chose to use a combination of seven markers from both the nuclear and plastid genomes. Four markers were nuclear sequences: the AGAMOUS 1 (AG1) gene, the beta-carotene hydroxylase gene partial sequence (BRSC10), the nuclear ribosomal internal transcribed spacer (nrITS2) and intron 4 of the phosphoribulokinase (PRK) gene. Three plastid markers were added: the matK pseudogene, and the introns of ndhA and rps15-ycf1.

Some of these DNA sequences have been widely used in phylogenetic analyses of palms, like

PRK (e.g. Lewis & Doyle 2002; Zona et al. 2011) and matK (e.g. Asmussen et al. 2006). The other markers were chosen because there were considered to be potentially variable enough to be useful for infra-generic reconstruction in palms (see Ludena et al. (2011) for AG1, Bacon et al. (2007) for BRSC10, Jeanson et al. (2011) for nrITS2, and Scarcelli et al. (2011) for the introns of ndhA and rps15-ycf1). Phylogenetic reconstruction was carried out using each marker separately and in combination. It is now widely admitted that adding taxa and markers is beneficial (even if characters are missing for some taxa), in order to increase the accuracy

172

of phylogenetic inference (Zwickl and Hillis, 2002; Wiens and Morrill, 2011). The aims of our study were (1) to improve the resolution of the phylogenetic relationships among genera and species of Ptychospermatinae, (2) to use the resulting historical framework to reconstruct the evolution history of stamen number.

Material and methods

Taxonomic sampling

Taxa sampled, voucher and accession number information, and GenBank accessions are given in Appendix A. We obtained specimens from 46 of the 60 species recognized in

Ptychospermatinae, representing all of the 12 genera of the subtribe (Dransfield et al. 2008).

The ingroup included all species of Adonidia, Brassiophoenix and Ptychococcus (2 species in each genus). We sampled 17/30 species of Ptychosperma, 2/3 species of Drymophloeus, 6/9 species of Balaka (following Hodel 2010), 9/11 species of Veitchia and 1/4 species of

Ponapea. The delimitation of genera follows the suggestions of Zona et al. (2011). The sampling includes an unpublished taxon that originates from Indonesia, in a locality named

Gag Island (called ‘New taxon Gag Island’ in this study). Based on recent phylogenies (Baker et al., 2009; Baker et al., 2011), 13 outgroup species were chosen among various subtribes of the tribe Areceae, in order to root the trees. Plant material or DNA samples were obtained from DNA banks or living collections of botanical gardens around the world (see acknowledgements).

DNA extraction, amplification and sequencing

Total genomic DNA was extracted from silica-gel dried leaf material using the NucleoSpin®

Plant II (Machery-Nagel, Düren, Germany) extraction kit, following the manufacturer’s instructions. Primers used to amplify each DNA region are given in Supplementary Table 1.

173

PCR reactions (50L) were performed using the following conditions: 1x PCR buffer (MP biomedicals), 1.5 mM MgCl2, 200M each dNTP, 1M each primer, 1U Taq polymerase

(Taq CORE Kit 10; MP biomedicals, Illkirch, France) and 1 or 2 L of DNA template.

Reactions were run using MJ-Research (PTC-100) and Applied Biosystems (Veriti 96 Well) thermal cyclers programmed with the temperature profiles shown in Supplementary Table 2.

PCR products were purified and sequenced by Beckman Coulter Genomics (Essex, UK) or at the Genoscope (www.genoscope.cns.fr). Forward and reverse sequences were assembled and edited into contigs using CodonCode Aligner 4.0.3 (CodonCode Corporation, Dedham, MA,

USA). Whenever possible, we used DNA from the same specimen to amplify all selected markers, in order to obtain a homogeneous dataset.. We combined the sequences obtained from two different specimens for four species only. Some sequences were retrieved from

GenBank (specified in Appendix A).

Alignment and phylogenetic analyses

Sequences were aligned with ClustalW implemented in MEGA4 (Tamura et al. 2007) with manual adjustments. A highly variable dinucleotide microsatellite (TC/GA)n is present in intron 7 of AG1 (Ludena et al 2011), and a region of nine nucleotides within the rps15-ycf1 sequence also displayed a high variability. These regions were too difficult to align with confidence and were therefore excluded from all analyses. Unambiguously aligned gaps were coded according to the modified complex indel coding (MCIC, Simmons et al. 2007) using the software SeqState (Müller 2005).

Phylogenetic analyses were conducted on each marker separately (single regions analyses), on plastid markers combined (plastid analysis), on nuclear markers combined (nuclear analysis), and finally on all markers combined (total evidence analysis; Kluge 1989).

174

Maximum parsimony analysis

Maximum parsimony (MP) analyses were conducted using PAUP* version 4.0b10 (Swofford

2002). All characters were unordered and had equal weight (Fitch 1971). Most parsimonious trees were found with a heuristic search with 1000 replicates using random stepwise addition of sequence. The tree-bisection-reconnection (TBR) branch swapping option was chosen and multiple trees (MULTREES) were saved at each replicate. The maximum number of trees that can be saved was fixed to 150,000 trees for all searches. The analyses were performed under the DELTRAN option. When the analyses yielded 150,000 before completion of the heuristic search (BRSC10, nrITS2, ndhA and combined data sets) a two-step heuristic search was applied: 1000 random replicates searches were conducted using TBR branch-swapping and only 10 trees per replicates were saved. A round of TBR swapping (to completion) was performed on this set of trees. When the maximum number of trees was reached before completion (BRSC10 and combined matrices) the parsimony ratchet method (Nixon 1999) was used. This method allows performing heuristic search with fewer trees in memory.

Twenty independent replicates of 200 iterations (with 15% of characters reweighted each iteration) were generated using the software PAUPRat (Sikes & Lewis 2001). Strict and trees were calculated from all most parsimonious trees using PAUP. Support values for clades were calculated by conducting 1000 bootstraps replicates with one search per replicate under TBR branch swapping, starting trees built random addition sequence and 20 trees saved at each replicate.

Maximum likelihood and Bayesian inference analyses

Model parameters for each data set and for coding vs non-coding regions within data sets were determined using jModelTest 2.1.1 (Darriba et al. 2012). More models were tested for the ML analysis (40) than for the BI analysis (24), to deal with the models implemented in the

175

softwares used for phylogenetic inference (PhyML and MrBayes). The Akaike information criterion was chosen to select the most appropriate model of DNA substitution. The models used are presented in Supplementary Table 3. Maximum likelihood (ML) analyses were performed using the PhyML 3.0 online server (Guidon et al. 2005). Indels were not included because PhyML 3.0 does not treat coded gaps. Tree searching was made with five random

BIONJ starting trees and SPR tree improvement. Branch support was assessed by calculating

200 bootstrap pseudo-replicates.

Bayesian inference analyses (BI) were run using MrBayes 3.2 (Ronquist et al. 2011). Data sets were partitioned in order to implement the best model of evolution for each part (see

Supplementary Table 3). Indels were treated as additional datatype (like a morphological present/absent character). Two independent Markov chain Monte Carlo (MCMC) runs, each comprising four linked chains (one cold and three heated; as default settings), were performed for 1 000 000 generations, sampling every 100 generations. The convergence of the two runs

(the two tree samples becoming similar) was assessed by stopping the analysis when the average standard deviation was below 0.01 (stoprule=yes and stopval=0.01 in the mcmc command). For ndhA, rps15-ycf1 and the plastid-DNA combined dataset, 1 000 000 generations were not enough to reach adequate average standard deviation (<0.01). The analysis had to be run again for respectively 1 510 000, 2 000 000 and 1 787 000 generations.

The first 25% trees were discarded as burn-in.

Stamen number optimization

All the species included in this study are polyandrous (more than six stamens). Data on stamen number at species level were mostly obtained from taxonomic treatments available in the literature. Information on stamen number was also obtained from direct observation on flowers from spirit collections (Aarhus University; Royal Botanic Gardens, Kew). Flowers

176

were dissected under a Zeiss Stemi SV6 stereomicroscope (Carl Zeiss AG, Göttingen,

Germany) to count the stamens. Range values, references and accession numbers are indicated in Table 2. We were unable to find data on stamen number for two taxa,

Brassiophoenix drymophloeoides and Ptychosperma nicolai (the last was classified as dubious by Essig (1978) due to incomplete specimen).

For character optimization, stamen number was coded as a discrete character. Three states were defined, namely (0) 6 or 12 stamens, (1) between 15 and 60 stamens, corresponding to moderately polyandrous species and (3) between 61 and 300 stamens, corresponding to highly polyandrous species. All Ptychospermatinae have flowers with 15 or more stamens, only outgroups had less stamens (6 or 12). We chose to combine 6 and 12 stamens in order to limit the number of character states. The Bayesian 50% majority rule consensus tree resulting from

AG1 analysis (results not shown) and total evidence analysis were used to optimize the character with the MP method implemented in Mesquite 2.75 (Maddison and Maddison,

2011). Character states were treated as unordered, allowing any transition among states.

Results

DNA amplification and alignments

The average lengths of the DNA regions amplified were approximately 450 bp for AG1, 320 bp for BRSC10, 400 bp for nrITS2, 663 bp for PRK, 1700 bp for matK, 1090 bp for ndhA and 600 bp for rps15-ycf1. The number of characters in single gene and combined regions alignments, including nucleotides and coded gaps, is presented in Table 1. Amplification failed for a few samples resulting in datasets of different sizes (see Table 1). We were unable to obtain amplification for the full sequence of nrITS2 in some specimens because the sequence of the reverse primer appeared within the sequence. We chose to keep the specimens

177

with missing data in our analyses, in order to maximize the amount of information used for phylogenetic inference.

Phylogenetic analyses

Maximum parsimony statistics (number of parsimony informative characters, number of most parsimonious trees, tree lengths and consistency (CI) and retention (RI) indices) for each individual marker and for the combined datasets are given in Table 1. There was little homoplasy in most datasets (CI >0.80) except for nrITS2 and the combined matrices

(respectively CI=0.69, CI=0.76, CI=0.79 and CI=0.76). Trees were rooted with Carpoxylon as potential sister group to all other species, according to recent phylogenies of the family

(Baker et al., 2009) and of the tribe Areceae (Baker et al., 2011). The trees resulting from the

MP, ML and BI analyses conducted on single regions alignments showed nearly identical topologies. Bayesian trees however tend to be slightly more resolved than the trees obtained with the two other methods.

Nuclear data: All nuclear single regions analyses but one retrieved the monophyly of the subtribe with good supports (Figures S1-S4). The best support values are found for nrITS2

(Figure S1), with PBS (parsimony bootstrap support) = 98%, LBS (likelihood bootstrap support) = 86% and PP (posterior probabilities from Bayesian analysis) = 1.00 (clade credibility of 100%). The monophyly was less strongly supported with BRSC10 and PRK

(Figures S2-S3): with BRSC10, PBS= 90%, LBS=61% and PP=1.00, and for PRK,

PBS=67%, LBS=57% and PP=1.00. The subtribe was not monophyletic with the AG1 marker but most nodes were poorly supported (Figure S4). Since topological incongruences were not supported, we combined the data for further analyses.

178

The nuclear DNA-combined alignment included 1879 characters (1835 nucleotides positions and 44 coded indels) of which 238 (13%) were parsimony-informative. In the combined nuclear analysis (Figure 1), Ptychospermatinae appeared monophyletic with strong support

(PBS=100%, LBS=96%, PP=0.99). Seven main clades emerged from this nuclear analysis, of which three were strongly supported (PBS and LBS >80% and PP>0.95). Only four genera,

Veitchia, Drymophloeus, Ptychococcus and Brassiophoenix, were resolved as monophyletic with good support. Balaka and Solfia form a strongly supported clade.

Plastid data: The three single plastid regions alignments displayed very few variable sites

(Table 1), and resulted in poorly resolved trees [Supplementary Figures S5-S7]. The monophyly of Ptychospermatinae was poorly to moderately supported. The best support values were found with rps15-ycf1 (PBS=61%, LBS=58%, PP=0.82; Supplementary Figure

S5). The plastid DNA-combined alignment included 3494 characters (3469 nucleotides positions and 25 coded indels) of which 47 (1.4%) were parsimony-informative. The 50% majority-rule consensus tree resulting from the Bayesian Inference analysis, with clade supports, is shown in Figure 2. The subtribe was resolved as monophyletic with low supports

(PBS=66%, LBS=74%, PP=0.68). Only four of the seven clades emerging from the nuclear

DNA-combined analysis were retrieved in this analysis. These markers provided little information, as shown by the lack of resolution in the resulting tree, but some of the terminal groupings observed in the nuclear tree were also found in this plastid analysis (e.g. Solfia samoensis sister group to Balaka brachychlamys or Ptychosperma salomonense sister group to P. gracile, P. elegans and P. caryotoides).

Total evidence analyses based on the global nuclear-plastid alignment: Since we detected no well supported conflicts (>80% bootstrap support) between the nuclear and plastid analyses,

179

we combined the nuclear and plastid data in a total evidence dataset (Kluge and Wolf, 1993;

Nixon and Carpenter, 1996; Wiens, 1998).

The nuclear-plastid-combined alignment included 5373 characters (5304 nucleotides positions and 69 coded indels) of which 285 (5.3%) were parsimony-informative. The 50% majority- rule consensus tree resulting from the BI analysis, with support values from all three analyses, is shown in Figure 3. The monophyly of the subtribe was very strongly supported

(PBS=100%, LBS=100%, PP=0.98). This analysis allowed us to identify seven major clades that were similar to those obtained in the nuclear DNA-combined analysis. Three clades are strongly supported by all three phylogenetic methods (Figure 3). The ‘Veitchia clade’ includes all the species of Veitchia (PBS=99%, LBS=100%, PP=1.00). Balaka and Solfia form the ‘Balaka clade’ (PBS=90%, LBS=100%, PP=1.00), and Carpentaria and Wodyetia form the ‘Carpentaria clade’ (PBS=100%, LBS=100%, PP=1.00). Ptychococcus and

Brassiophoenix are sister groups with full support (PBS=100%, LBS=100%, PP=1.00).

Together with the two species of Drymophloeus they form the ‘Drymophloeus clade’ with low support in the MP and ML analyses but strong support in the BI analysis (PP=1.00).

(PBS=90%, LBS=92%, PP=1.00). Normanbya normanbyi is included with Ponapea ledermanniana in the moderately supported ‘Normanbya clade’ (PBS=72%, LBS=70%,

PP=1.00). The ‘Ptychosperma clade’ includes all the species of the genus (except P. halmaherense) and is fully supported in the ML and BI analyses (LBS=100%, PP=1.00), although moderately in the ML analysis (PBS=60%). The BI analysis suggests that the

‘Ptychosperma clade’ is sister to the ‘Normanbya clade’ (PP=1.00). The ‘Veitchia clade’ and the ‘Balaka clade’ are sister groups with almost full support (PBS=99%, LBS=100%,

PP=1.00). One difference between the nuclear-DNA analysis and the total evidence analysis is the relationships between the species of Adonidia, the newly discovered species

Ptychosperma halmaherense and the new taxon from Gag Island. maturbongsii. In the first

180

one the two species of Adonidia and P. halmaherense formed a monophyletic group whereas in the second one Adonidia maturbongsii is sister to P. halmaherense and Adonidia merrillii is sister to the new taxon from Gag Island. However these relationships are supported only in the BI analysis (PP=1.00) and supports in the MP and ML analysis are low (<50%) or moderate.

Stamen number optimization

The optimization of stamen number evolution on the total evidence analysis Bayesian tree

(50% majority-rule consensus tree) is shown on Figure 4. All the species included in the study are polyandrous (more than 6 stamens). However some are moderately polyandrous (between

15 and 60 stamens; in grey on Figure 4) and some are highly polyandrous (between 61 and

300 stamens; in black on Figure 4). The character optimisation suggests that the common ancestor of the subtribe was probably moderately polyandrous, and that transitions towards a higher number of stamens occurred several times independently during the evolutionary history of the subtribe. One transition occurred in the branch leading to Ponapea ledermanniana, one in Wodyetia bifurcata and one in the common ancestor of Ptychococcus and Brassiophoenix. Transitions between a moderate and a high number of stamens also occurred within the ‘Veitchia clade’. The ancestral state in this clade is ambiguous, because two scenarios are equally parsimonious (with three steps) to account for the observed distribution of character states. The first one implies two independent transitions towards a high number of stamens, one in Drymophloeus and one in the common ancestor of [Veitchia arecina + V. metiti + V. winin + V. joannis + V. spiralis] and one reversal in Veitchia winin.

The second involves only one transition in the common ancestor of the whole clade and two reversals in Veitchia winin and in the ancestor of [Veitchia filifera + Veitchia vitiensis].

181

Discussion

Nuclear vs. plastid markers

Phylogenetic relationships within subtribe Ptychospermatinae have been explored recently using two nuclear markers, PRK and RPB2 (Zona et al. 2011), including a sampling of 37 species (among the 60 recognized in the subtribe) and 1640 molecular characters (plus 46 coded gaps). In spite of this effort, the phylogeny of Zona et al. (2011) remained partly unresolved, in particular concerning relationships within the genera Ptychosperma and

Veitchia. In our study, all selected regions had expected high variation rates. The chosen noncoding plastid markers showed very little informative variation, with less than 2% parsimony informative sites overall (Table 1). Only one node was strongly supported (PBS and LBS

>80% and PP >0.95) in the tree based on matK (Supplementary Fig 6). The plastid DNA of

Ptychospermatinae is consistent with that of other palms in that it appears to evolve slowly

(Asmussen and Chase 2001). The level of informative variation in the chosen nuclear regions varied between 6.3% (AG1) and 24.3% (ITS2) and was therefore much higher than the one observed in plastid alignments. It can be noted that the variation rate of AG1 observed for

Ptychospermatinae was similar to the one found previously in Bactridinae (Arecoideae;

Ludena et al. 2011). The number of well-supported nodes in trees based on individual nuclear markers varied between two and seven, showing that nuclear markers bring useful information for phylogenetic reconstruction in the case of Ptychospermatinae. The use of ITS marker can be challenging due to possible amplification difficulty and paralogous copies

(Baker et al. 2000; Hollingsworth 2011). In our experiment, most of the time the amplification of ITS2 was successful, except when a sequence similar to the reverse primer appeared in the third part of the sequence, leading to an aborted amplicon and raising the question of universality of primers at a scale as large as seed plants (Chen et al. 2010). The presence of ITS paralogues is an important issue (Alvarez and Wendel, 2003) and can make

182

phylogenetic reconstruction difficult in palm (Baker et al. 2000; Lewis and Doyle 2001).

However ITS sequences recently attracted new interest and proved to be useful in some groups of palms (Eiserhardt et al. 2011; Jeanson et al. 2011). In Ptychospermatinae, we detected on electropherograms only one sequence per specimen, although double nucleotide peaks occurred for few sites. No well-supported incongruence between phylogenetic reconstructions based on ITS2 vs. other markers was detected, so we included ITS2 data in our combined analysis. However, if the use of the ITS region is planned at large scale within the palm family further detailed investigations will be needed, as suggested by Feliner and

Rossello (2007).

In spite of the little potential informativeness of plastid markers, we chose to include them in our analyses, because the plastid genome is inherited uniparentally and is not subject to recombination. It can be thus interesting to compare the evolutionary history of plastid vs. nuclear markers, in order to identify possible effect of recombination on the accuracy of species tree estimation (Posada and Crandall 2002). In our case however, there were no major incongruences among trees based on individual markers. The tree resulting from the total evidence analysis of our seven markers is the best resolved one, with 17 strongly supported nodes (Fig 3), stressing the utility of combining various sources of molecular characters for phylogenetic reconstruction.

Phylogenetic reconstruction

In almost all individual and combined analyses (nuclear, plastid and total evidence), the subtribe Ptychospermatinae was resolved as monophyletic with good support. This confirms the conclusions of previous studies, based on morphological and molecular data (Zona 1999b;

Asmussen et al. 2006; Norup et al. 2006; Baker et al., 2009; Baker et al. 2011; Zona et al.

2011). It should be noted that phylogenetic relationships among the outgroups (all belonging

183

to the tribe Areceae) were not fully resolved. We rooted the tree according to the supertree topology of Baker et al (2009). Compared to previous studies, our phylogenetic hypothesis based on the total evidence analysis provides improved resolution of the relationships among and within genera, allowing us to identify seven clades within the subtribe (Fig 3): the

‘Veitchia clade’, the ‘Balaka clade’, the ‘Adonidia clade’, the ‘Drymphloeus clade’, the

‘Carpentaria clade’, the ‘Normanbya clade’ and the ‘Ptychosperma clade’. The names were chosen as to match as closely as possible those used in Zona et al. (2011) in order to allow easy comparison. Each clade is discussed below in light of the morphological characteristics and geographical range of the species included.

The Veitchia clade

This well-supported clade comprises the nine Veitchia species of our sampling (out of eleven recognised in the genus). These species are characterized by an endocarp bearing a single flattened ridge on one side (Zona 1999b, Zona and Fuller, 1999). Within Veitchia, three well- supported clades emerge. One includes the four endemic species Vanuatu (V. spiralis, V. winin, V. metiti, V. arecina) and one species from Fiji and Tonga (V. joannis). The second includes two species to Fiji (V. filifera and V. vitiensis). Considering the distribution areas of these two clades, Fiji seems to be the ancestral area of the genus, as previously suggested in

Zona et al. (2011), with subsequent overwater dispersal to Vanuatu. The distribution of V. joannis, sister group of V. metiti, could be explained by secondary dispersal to Fiji and Tonga.

The third includes two species both formerly classified in the genus Drymophloeus (and before in the genus Rhederophoenix), V. subdisticha and V. pachyclada. Although the monophyly of Veitchia is strongly supported in the MP, ML and BI analyses, there are marked morphological differences between the species. For example, leaf segments are linear, the prophyll splitting is on the adaxial side and the pistillode is longer than the stamens in

184

most Veitchia species whereas leaf segments are cuneate, the prophyll splitting is on the abaxial side and the pistillode is shorter than the stamens in V. subdisticha and V. pachyclada.

Our analyses confirm that Drymophloeus is not monophyletic, as recently showed by (Zona

2011). The species can be separated in two groups, the understory species of Indonesia and

New Guinea, D. litigiosus and D. oliviformis, related in our analysis to the

Ptychococcus/Brassiophoenix clade, and the emergent species of the Solomon Islands

V. subdistichus and V. pachycladus. This is consistent with the differences in morphological traits and ecological conditions between these two groups (Zona 1999b Blumea). For example persistent prophyll and pedoncular bract are characteristic of D. litigiosus and D. oliviformis.

These species also have smaller pollen grains. The Solomon Islands are closer to the geographical range of Veitchia (Vanuatu and Fiji). Unfortunately we were not able to include

D. lepidotus in our analysis; we cannot know its position within the subtribe. However the geographical range and the ecology of this species are in favour of its relationship with D. subdistichus and D. pachycladus.

The Balaka clade

This clade is resolved as sister to the Veitchia clade with full support. These two clades comprise species with the easternmost distribution within Ptychospermatinae.

Our analysis confirmed that Solfia samoensis is related to Balaka, as found by Zona et al.

(2011), and suggests furthermore that the species is embedded with the latter genus. The

Bayesian Inference analysis strongly supported a sister group relationship between the monotypic genus Solfia and Balaka tahitensis, which is congruent with the distribution of these two endemic taxa in the Samoa Islands. Balaka and Solfia are usually distinguished by the endocarp shape, angular with a rostrum for Balaka vs. terete and rounded for Solfia (Zona

1999a; Dransfield et al. 2008). However, in Balaka tahitensis ridges on the endocarp are only

185

slightly angled and rostrum is absent (Hodel 2010), making it more similar to the endocarp of

Solfia samoensis and supporting the close relationship between both species. The other species of Balaka, all from the Fiji Islands (Viti Levu or Vanua Levu), form a well-supported clade. Balaka diffusa was formerly considered as a subspecies of Balaka macrocarpa (Moore

1979; Fuller 1997; Watling 2005) but Hodel (2010) instated the species on the basis of differences in geographical range (Balaka diffusa is from Viti Levu and Balaka macrocarpa is from Vanua Levu) and length of inflorescence (Balaka macrocarpa has smaller and more compact inflorescences).

The Adonidia clade

Adonidia was reinstated as a separate genus (from Veitchia) by Zona 1999a and this was confirmed by Zona et al. (2011). The total evidence analysis suggests that Adonidia is paraphyletic, due to the placement of A. maturbongsii as sister to Ptychosperma halmaherense, but the relationship is moderately supported. The newly discovered taxon from

Gag Island (Indonesia) appears related to A. merrillii but also with little support. Interestingly,

Adonidia (including P. halmaherense) is monophyletic in the nuclear DNA-combined analysis, but with low support. Adonidia merrillii is the only species of Ptychospermatinae occurring to the west of Wallace’s Line, an important biogeographic interface (Baker and

Couvreur, 2012). Adonidia maturbongsii and the new Gag Island taxon are geographically close to each other, occurring on islands at the western end of New Guinea. Both species of

Adonidia were related in the study of Zona et al. (2011). They display strong similarities in their inflorescences and infructescences (white inflorescences branched up to four orders and red fruits; Baker and Heatubun 2012). Further analyses are obviously needed to address the issue of the monophyly of Adonidia.

186

The Drymophloeus clade

The two remaining species of Drymophloeus, D. oliviformis and D. litigiosus, are grouped together in the total evidence tree with strong support. They are distributed in New Guinea and the Moluccas (Zona 1999b). They share several morphological features like stilt roots, persistent prophyll and peduncular bract (Zona 1999b).

Previous molecular studies had suggested a relationship (although moderately supported) between Ptychococcus and Brassiophoenix (Asmussen et al, 2006; Norup et al., 2006; Baker et al. 2011; Zona et al., 2011). Our study confirms that these two genera are monophyletic and closely related with strong support. After taxonomic revision, the number of species in

Ptychococcus was reduced to two and the geographical range restricted to New Guinea including the Bismarck Archipelagos (Zona 2005). Brassiophoenix includes two species also endemic to New Guinea (Zona and Essig 1999). Both genera share a strongly ridged endocarp

(they differ by the colour, black or brown for Ptychococcus, straw-coloured for

Brassiophoenix) and have the same distribution area.

Our analysis suggests with moderate support that Drymophloeus is related to Ptychococcus and Brassiophoenix (the relationship is however fully supported in the Bayesian analysis). All these species share a common geographical range (New Guinea and surrounding islands).

They are understorey palms of moderate to small size. Brassiophoenix and Drymophloeus have similar leaf forms (Dransfield et al. 2008). It should be noted that plastid markers support an alternative hypothesis, with Brassiophoenix and Ptychococcus forming a clade with Adonidia merrillii and the new taxon from Gag. Further investigations are needed to assess the robustness of the Drymophloeus clade.

187

The Carpentaria clade

Our analysis confirms with strong support the sister group relationship between the two monotypic genera Carpentaria and Wodyetia suggested by Zona et al. (2011). Both genera are endemic to Northern Australia (Northern Territory and north-east Queensland respectively; Dowe 2010). They have flat strongly forking fibrovascular bundles in the endocarp, and a ring of fibrovascular bundles in the mesocarp (Irvine 1983), and both have greenish inflorescence axes (Zona 1999a), contrary to the white colour found in all other members of the subtribe. In other morphological features, Wodyetia is more similar to

Normanbya, another monotypic genera endemic to north-east Queensland, but in Normanbya the bundles of the fruit are purely fibrous (Irvine 1983), unlike the fruit of Wodyetia and

Carpenteria.

The Ptychosperma clade

The largest genus of Ptychospermatinae is resolved as monophyletic (except

P. halmaherense) with strong support in the ML and Bayesian analysis (LBS=100% and

PP=1.00) but low support in the MP analysis (PBS=60%). Historically the genus was divided in four subgenera: Ponapea, Korora (both included in the reinstated genus Ponapea;

Dransfield 2008), Ptychosperma and Actinophloeus. This latter subgenus had been first considered as a subgenus of Drymophloeus in 1877 by Odoardo Beccari, later as a separate genus, named Actinophloeus and finally as a subgenus of Ptychosperma in 1935 by the same author (Essig 1978). The genus Ptychosperma is mostly distributed in Papua New Guinea, although there are several species distributed elsewhere, like P. salomonense, found in the

Solomon Islands, P. elegans and P. macarthurii occurring in northern Australia, P. gracile from the Bismarck Archipelago, and P. propinquum distributed in the Moluccas (Essig 1978).

Our results are in agreement with the two subgenera defined by Essig (1978). Ptychosperma

188

salomonense, P. gracile, P. elegans and P. caryotoides, the four members of the subgenus

Ptychosperma form a well supported clade. The remaining species are grouped in another clade (but with low support) corresponding to the subgenus Actinophloeus. These two subgenera are morphologically differentiated by a number of subtle characters in fruit and seed (Essig 1978). For example, the subgenus Ptychosperma has seeds with ruminate endosperm, angular or broadly rounded seed lobes, and fruits with tanniniferous mesocarp whereas the subgenus Actinophloeus has homogeneous endosperm, squarish seed lobes and nontanniniferous mesocarp. The subgenus Actinophloeus was divided by Essig (1978) into two sections, Actinophloeus (stems always solitary) and Caespitosa (stems usually caespitose). Our results do not support this division, suggesting that the caespitose vs. solitary habit may be homoplasic.

P. halmaherense is distributed in the Halmahera Island, in North Moluccas. Heatubun 2011 included this new species from Halmahera in the genus Ptychosperma (subgenus

Ptychosperma) based on floral characters, such as the pistillode equalling or exceeding stamens in length, small fruit, seed with ruminate endosperm, solitary stem and inflorescence with upper peduncular bract. However this species differs from all other species of the genus

Ptychosperma by its seeds rounded in cross-section (vs. angular in the rest of Ptychosperma), lacking grooves or angles. Based on our molecular phylogeny and the fact that this new species is geographically distant from any other species of Ptychosperma, specimens must probably be re-examined and affiliation to Ptychosperma tested again.

The Normanbya clade

Normanbya is a monotypic genus endemic to North Australia. Ponapea ledermanniana belongs to the reinstated genus Ponapea (Dransfield et al. 2008, Zona et al. 2011), which includes four species formerly considered as belonging to Ptychosperma and Drymophloeus.

189

These species are originated from the Caroline Islands and the Bismarck Archipelago. In our tree, Ponapea ledermanniana is related to Normanbya with moderate support. This

‘Normanbya clade’ is sister group to the ‘Ptychosperma clade’ with good support in the

Bayesian analysis. Our results favour the reinstatement of Ponapea as a genus separate from

Ptychosperma as already found by Zona et al. (2011).

Future prospects for the phylogeny of Ptychospermatinae

In spite of the improved resolution of phylogenetic relationships within Ptychospermatinae in our study, some relationships remain unresolved. It is notably the case within the genus

Ptychosperma. The 50% majority-rule tree resulting from the total evidence Bayesian analysis

(Figure 5) shows that within this genus, branches are very short, revealing a very low rate of variation. Species and generic limits in subtribe Ptychospermatinae are often problematic as evidenced by the frequent taxonomic changes that have occurred in the past (see Dransfield et al. 2008 for an overview). This raises the question of how species should be delimited within some genera, Ptychosperma in particular. The pattern observed within the genus could be due to different factors, like recent and rapid speciation events, or very slow evolution (generation time, evolutionary history, selection; Felsenstein 2004), strong hybridization that led to homogenous sequences or confusion between populations and species. Population genetics approaches could bring new insights into phylogenetic relationships, species limits and congruence between markers (Linder and Rieseberg 2004) within the different clades identified in Ptychospermatinae (in Ptychosperma in particular). Microsatellite loci could be isolated and characterized as was done for the cultivated palm Bactris gasipaes and its wild relatives (Martinez et al. 2004; Rodrigues et al. 2004; Couvreur et al. 2007) or for Phoenix atlantica (Henderson et al. 2006).

190

Stamen number optimization

Within Ptychospermatinae, intra-specific variation in stamen number is very high (Table 2) and this variation occurs at both inter- and intra-individual levels. This makes stamen number optimization a challenge. We chose to use discrete optimization in order to avoid calculating a mean, needed in continuous optimization, and thus losing information on variation range.

Moreover we chose categories that minimize overlapping. According to our coding, the ancestor of the subtribe was probably a moderately polyandrous species and several transitions toward a higher number of stamens occurred independently within the subtribe

(Fig 4). Transitions from moderate polyandry towards high polyandry occurred at least four times. In two cases, within the ‘Veitchia clade’ and the ‘Drymophloeus clade’, high polyandry is a synapomorphy that supports the monophyly of groups.

Androecium development was studied in details in Ptychosperma gracile (Uhl 1976). Like in most polyandrous palms species, the androecium is basically trimerous (Uhl et Moore 1980).

When stamens initiation starts, the apex is divided in six primary primordia, three opposite each sepal and three opposite each petal. Stamens arise as secondary primordia in alternating antesepalous and antepetalous whorls. The number of secondary primordia is always one in antesepalous whorls but can vary between one and three (or more) in antepetalous whorls.

Variation in stamen number between flowers of the same species occurs in two ways. The lower antepetalous whorls may have more stamens opposite one petal or more frequently, the number of primordia in uppermost whorls is slightly irregular. The ancestral state for the palm flower is six stamens, three in an antesepalous whorl and three in an antepetalous whorl. Thus in Ptychospermatinae, polyandry results from the increase of whorl number and the increase of primordia number within each antepetalous whorl. In palms polyandry mostly coincides with unisexual flowers (Nadot et al., 2011) and all Ptychospermatinae species have unisexual

191

flowers. Transition to unisexuality, with reduced female organs (pistillode), could have allowed space for increasing the number of stamen whorls and thus the number of stamens.

The reason why the number of stamens progressively increased within the subtribe is unclear.

Like many other flower features, for example symmetry (Citerne et al. 2010) or nectar

(Barrera and Nobel 2004), stamen number may have evolved in a plant-pollinator interaction context. At the Angiosperm level, polyandry is often observed in beetle-pollinated species

(Bernhardt, 2000). Pollination biology has been well studied in some members of the palm family (see Barfod et al. 2011 for a review), but in Ptychospermatinae pollination data are scarce. Ptychosperma is believed to be visited by various insects, flies, syrphids (Diptera) and bees (Hymenoptera; Essig 1973) and Normanbya normanbyi visited by thrips (Thysanoptera), flies and weevils (Coleoptera; Kitching et al. 2007). Polyandrous species in palms are thus not only visited by beetles but by many other insects. It has been suggested that more stamens is a way to produce more pollen in response to the feeding of the pollinators (Uhl and Moore

1977). A potential correlation between stamen number and pollen production has been demonstrated within the Arecoideae, and especially within Areceae (Alapetite et al. in prep).

Whether the evolutionary pattern observed for stamen number results from adaptation to pollination mode or results from a simple relaxation of developmental constraints remains to be tested.

Conclusion

We investigated the evolution of stamen number within the subtribe Ptychospermatinae using a new molecular phylogeny of the subtribe. The combined use of seven nuclear and plastid markers improved the resolution of phylogenetic relationships between genera and species compared to previous studies. Further phylogenetic or population genetics studies that incorporate additional more variable molecular markers (e.g. microsatellite loci) are needed to

192

clarify the circumscription of taxonomic subdivisions, notably species. Nevertheless, our work provides a useful framework for future studies on floral development, floral adaptation and pollination biology. We identified several transitions between moderate and high polyandry that could be investigated in details. One issue is whether the developmental pathway of stamen inception is the same in species with contrasted stamen numbers. Another issue is the adaptive significance of polyandry. Fitness of individuals with different number of stamens (naturally or experimentally altered) could be compared. Studies of visitors and pollinators should provide information on a possible correlation between stamen number and a specific kind of insects (taxonomic or functional group). Studying the evolutionary history of stamen number within palms could help us to investigate if the co-evolution with insect pollinators could have driven the modification of this character at a larger scale.

Acknowledgements

The authors are grateful to Lauren Gardiner, Felix Forest, Edith Kapinos and Laszlo Csiba

(Royal Botanic Gardens, Kew); Carl E. Lewis and Hillary Burgess (Fairchild Tropical

Botanic Garden); Anders Barfod (Aarhus university herbarium); Eric Joly and Denis Larpin

(MNHN Paris); Larry Noblick (MBC); Nura Abdul Karim (Singapore Botanic Gardens);

Dick Watling (Fiji) who provided the plant material. SN received a research grant from

Aarhus University to conduct part of this research. EA received a financing from Centre de

Recherche sur la Paléobiodiversité et les Paléoenvironnements (UMR 7207 CNRS - MNHN -

UPMC) to sample material in Kew.

Appendix A Taxa sampled, voucher and accession number information and GenBank accessions Appendix B Supplementary data Supplementary data associated with this article can be found, in the online version, at

193

References Alvarez, I. & Wendel, J. F. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution, 29, 417-434. Asmussen, C. B. & Chase, M. W. 2001. Coding and noncoding plastid DNA in palm systematics. American Journal of Botany, 88, 1103–1117. Asmussen, C. B., Dransfield, J., Deickmann, V., Barfod, A. S., Pintaud, J.-C. & Baker, W. J. 2006. A new subfamily classification of the palm family (Arecaceae): evidence from plastid DNA phylogeny. Botanical Journal of the Linnean Society, 151, 15–38. Bacon, C. D., Feltus, F. A., Paterson, A. H. & Bailey, C. D. 2007. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology. Molecular Ecology Notes, 8, 211-214. Baker, W. J. & Couvreur, T. L. P. 2012b. Global biogeography and diversification of palms sheds light on the evolution of tropical lineages. II. Diversification history and origin of regional assemblages. Journal of Biogeography, 40, 286– 298. Baker, W. J. & Heatubun, C. D. 2012. New palms from Biak and Supiori, Western New Guinea. Palms, 56, 131-150. Baker, W. J., Hedderson, T. A. & Dransfield, J. 2000. Molecular phylogenetics of subfamily Calamoideae (Palmae) based on nrDNA ITS and cpDNA rps16 intron sequence data. Molecular Phylogenetics and Evolution, 14, 195–217. Baker, W. J., Norup, M. V., Clarkson, J. J., Couvreur, T. L. P., Dowe, J. L., Lewis, C. E., Pintaud, J.-C., Savolainen, V., Wilmot, T. & Chase, M. W. 2011. Phylogenetic relationships among arecoid palms (Arecaceae: Arecoideae). Annals of Botany, 108, 1417-1432. Baker, W. J., Savolainen, V., Asmussen-Lange, C. B., Chase, M. W., Dransfield, J., Forest, F., Harley, M. M., Uhl, N. W. & Wilkinson, M. 2009. Complete generic- level phylogenetic analyses of palms (Arecaceae) with comparisons of supertree and supermatrix approaches. Systematic Biology, 58, 240–256. Barfod, A. S., Hagen, M. & Borchsenius, F. 2011. Twenty-five years of progress in understanding pollination mechanims in palms (Arecaceae). Annals of Botany, 108, 1503-1516.

194

Barrera, E. & Nobel, P. S. 2004. Nectar: properties, floral aspects, and speculation on origin. TRENDS in plant Sciences, 9, 65-69. Bernhardt, P. 2000. Convergent evolution and adaptive radiation of beetle-pollinated angiosperms. Plant Systematics and Evolution, 222, 293-320. Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L. & Etal. 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE, 5, e8613. Citerne, H., Jabbour, F., Nadot, S. & Damerval, C. 2010. Theevolution of floral symmetry. Advances in Botanical Research, 54, 85-137. Couvreur, T. L. P., Billote, N., Risterucci, A.-M., Lara, C. & etal. 2006. Close genetic proximity between cultivated and wild Bactris gasipaes Kunth revealed by microsatellite markers in Western Ecuador. Genetic Resources and Crop Evolution, 53, 1361-1373. Cuenca, A. & Asmussen-Lange, C. B. 2007. Phylogeny of the palm tribe Chamaedoreeae (Arecaceae) based on plastid DNA sequences. Systematic Botany, 32, 250–263. Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, 9, 772. Dowe, J. L. 2010. Australian Palms: Biogeography, Ecology and Systematics. CSIRO PUBLISHING. Dowl, J. L. 1998. Wodyetia bifurcata. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Dransfield, J., Uhl, N. W., Asmussen, C. B., Baker, W. J., Harley, M. M. & Lewis, C. E. 2008. Genera palmarum: the evolution and classification of palms. Royal Botanic Gardens, Kew: Kew Publishing. Endress, P. K. 2011. Evolutionary diversification of the flowers in angiosperms. American Journal of Botany, 98, 370-396. Essig, F. B. 1973. Pollination of some New Guinea palms. Principes, 17, 75-83. Essig, F. B. 1978. A revision of the genus Ptychosperma Labill. (Arecaceae). Allertonia, 1, 415-478. Feliner, G. N. & Rosselló, J. 2007. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Molecular Phylogenetics and Evolution, 44, 911-9. Felsenstein, J. 2004. Inferring Phylogenies. Sunderland, Mass.: Sinauer Associates.

195

Fitch, W. M. 1971. Toward defining the course of evolution: Minimum change for a specific topology. Systematic Zoology, 20, 406-416. Fuller, D. 1998. Balaka macrocarpa. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2.

196

Lewis, C. E. & Doyle, J. J. 2002. A phylogenetic analysis of tribe Areceae (Arecaceae) using two low-copy nuclear genes. Plant Systematics and Evolution, 236, 1-17. Linder, C. R. & Rieseberg, L. H. 2004. Reconstructing patterns of reticulate evolution of plants. American Journal of Botany, 91, 1700-1708. Ludena, B., Chabrillange, N., Aberlenc-Bertossi, F., Adam, H., Tregear, J. W. & Pintaud, J.-C. 2011. Phylogenetic utility of the nuclear genes AGAMOUS 1 and PHYTOCHROME B in palms (Arecaceae): an example within Bactridinae. Annals of Botany, 108, 1433-1444. Maddison, W. P. & Maddison, D. R. 2011. Mesquite: a modular system for evolutionary analysis. Version 2.75 http://mesquiteproject.org. Martinez, A. K., Gaitan-Solis, E., Duque, M. C., Bernal, R. & Tohme, J. 2002. Microsatellite loci in Batris gasipaes (Arecaceae): their isolation and Characterization. Molecular Ecology Notes, 2, 408-410. Müller, K. 2005. SeqState - primer design and sequence statistics for phylogenetic DNA data sets. Applied Bioinformatics, 4, 65-69. Nadot, S., Sannier, J., Barfod, A. S. & Baker, W. J. 2011. Evolution of the palm androecium as revealed by character mapping on a supertree. In: Flowers on the tree of life (Ed. by Wanntorp, L. & RoncedeCraene, L. P.): Cambridge University Press. Nixon, K. C. 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics, 15, 407-414. Nixon, K. C. & Carpenter, J. M. 1996. On simultaneous analysis. Cladistics, 12, 221- 241. Norup, M. V., Dransfield, J., Chase, M. W., Barfod, A. S., Fernando, E. S. & Baker, W. B. 2006. Homoplasious character combinations and generic delimitations: a case study from the Indo-Pacific arecoid palms (Arecaceae: Areceae). American Journal of Botany, 93, 1065-1080. Palmweb. 2013. Palmweb: Palms of the World Online. Published on the internet http://www.palmweb.org/. Posada, D. & Crandall, K. A. 2002. The effect of recombination on the accuracy of phylogeny estimation. Journal of Molecular Evolution, 54, 396–402.

197

Rodrigues, D. P., Vinson, C., Ciampi, A. Y., Farias, I. P., Lemes, M. R. & etal. 2004. Novel microsatellite markers for Bactris gasipaes (Palmae). Molecular Ecology Notes, 4, 575-576. Ronquist, F. & Huelsenbeck, J. P. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572-1574. Scarcelli, N., Barnaud, A., Eiserhardt, W., Treier, U. A., Seveno, M., d'Anfray, A., Vigouroux, Y. & Pintaud, J.-C. 2011. A set of 100 chloroplast DNA primer pairs to study population genetics and phyogeny in Monocotyledons. PLoS ONE, 6, e19954. Sikes, D. S. & Lewis, P. O. 2001. PAUPRat: PAUP implementation of the parsimony ratchet. In: (Ed. by Beta software, v., distributed by the authors). Department of Ecology and Evolutionary Biology, University of Connecticut, Storrs, USA. Simmons, M. P., Müller, K. & Norton, A. P. 2007. The relative performance of indel- coding methods in simulations. Molecular Phylogenetics and Evolution, 44, 724-740. Swofford, D. L. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), beta version 4.0. (Ed. by Sinauer). Sunderland, MA, USA. Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24, 1596-1599. Uhl, N. & Moore, H. E. 1980. Androecial development in six polyandrous genera representing five major groups of palms. Annals of Botany, 45, 57-75. Uhl, N. W. 1976. Developmental studies in Ptychosmerpa (Palmae). II. The Staminate and Pistillate Flowers. American Journal of Botany, 63, 97-109. Uhl, N. W. & Moore, H. E. 1977. Correlation of inflorescence, flower structure, and floral anatomy with pollination in some palms. Biotropica, 9, 170-190. Whistler, A. & Johnson, D. 1998. Drymophloeus samoensis. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Wiens, J. & Morrill, M. 2011. Missing data in phylogenetic analysis: reconciling results from simulations and empirical data. Systematic biology, 60, 719–731. Wiens, J. J. 1998. Combining data sets with different phylogenetic histories. Systematic Biology, 47, 568-581. Zona, S. 1999a. New perspective on generic imits and relationships in the Ptychospermatinae (Palmae: Arecoideae). In: Evolution, variation and

198

classification of palms (Ed. by Henderson, A. & Borchsenius, F.), pp. 255-263. Bronx New York: The New York Botanical Garden Press. Zona, S. 1999b. Revision of Drymophloeus (Arecaceae: Arecoideae). Blumea, 44, 1- 24. Zona, S. 2005. A revision of Ptychococcus (Arecaceae). Systematic Botany, 30, 520- 529. Zona, S. & Essig, F. B. 1999. How many species of Brassiophoenix? Palms, 43, 45- 48. Zona, S., Francisco-Ortega, J., Jestrow, B., Baker, W. J. & Lewis, C. E. 2011. Molecular phylogenetics of the palm subtribe Ptychospermatinae (Arecaceae). American Journal of Botany, 98, 1-11. Zona, S. & Fuller, D. 1999. A revision of Veitchia (Arecaceae-Arecoideae). Harvard Papers in Botany, 4, 543-560. Zwickl, D. J. & Hillis, D. M. 2002. Increased taxon sampling greatly reduces phyligenetic error. Systematic Biology, 51, 588-598.

199

Tables and Figures

Table 1: Datasets characteristics and maximum parsimony analysis statistics

CI and RI are respectively the consistency index and the retention index Numbers in square brackets represent the numbers of characters resulting from indel-coding * number of most parsimonious trees generated by parsimony ratchet analyses

Table 2: Stamen number for the species included in the phylogenetic study; data are from literature and observation of herbarium specimens; (K) Kew herbarium and spirit collection, (AAU) Aarhus University herbarium and spirit collection; character state (0) 6-12 stamens, (1) 15-60 stamens = moderately polyandrous species, (2) 61-300 stamens = highly polyandrous species.

200

201

Fig. 1. 50% majority-rule consensus tree resulting from the Bayesian analysis of the nuclear DNA-combined alignment; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

202

Fig. 2. 50% majority-rule consensus tree resulting from the Bayesian analysis of plastid DNA-combined alignment; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches.

203

Fig. 3. 50% majority-rule consensus tree resulting from the Bayesian analysis of the total evidence dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

204

Fig. 4. 50% majority-rule consensus tree resulting from the Bayesian analysis of the total evidence dataset showing the evolution of stamen number optimized using Maximum

Parsimony. Boxes at the tip of branches are coloured according to the character state: White =

6 or 12 stamens, Grey = 15-60 stamens; moderately polyandrous species, Black = 61-300 stamens; highly polyandrous species. Branches colours correspond to the inferred ancestral sate. Several colours on the same branch denote ambiguity in the ancestral state.

205

Fig. 5. Maximum-likelihood topology obtained from total evidence analysis showing branch lengths.

206

Supplementary data

Table S1: Primers sequences used to amplify each DNA region

Table S2: temperature profiles used for PCR reactions; for some specimens annealing temperature has been modified; these temperatures are specified in brackets.

207

Table S3: Data and models used in analysis

208

Fig. S1. 50% majority-rule consensus tree resulting from the Bayesian analysis of the nrITS2 dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

209

Fig. S2. 50% majority-rule consensus tree resulting from the Bayesian analysis of the BRSC10 dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

210

Fig. S3. 50% majority-rule consensus tree resulting from the Bayesian analysis of the PRK dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

211

Fig. S4. 50% majority-rule consensus tree resulting from the Bayesian analysis of the AG1 dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

212

Fig. S5. 50% majority-rule consensus tree resulting from the Bayesian analysis of the rps15- ycf1 dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

213

Fig. S6. 50% majority-rule consensus tree resulting from the Bayesian analysis of the matK dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

214

Fig. S7. 50% majority-rule consensus tree resulting from the Bayesian analysis of the ndhA dataset; bootstrap supports are indicated above branches (parsimony bootstrap support / likelihood bootstrap support) and posterior probabilities below branches. Thick lines represent well-supported clades (PBS and LBS >80% and PP >0.95).

215

216

Conclusion générale

217

218

Synthèse des résultats

L’objectif de ma thèse était d’étudier deux caractères liés à la morphologie de l’appareil reproducteur et particulièrement variables au sein de la famille des palmiers. J’ai ainsi reconstruit l’évolution du système sexuel et celle du nombre d’étamines sur l’arbre phylogénétique de tous les genres de palmiers. Mes études montrent que l’ancêtre commun à tous les palmiers était probablement monoïque et possédait des fleurs à six étamines. A partir de ces états ancestraux, de nombreuses transitions ont eu lieu pendant l’histoire évolutive de la famille. Des transitions vers l’hermaphrodisme et la dioécie, ainsi que vers des systèmes associant des fleurs hermaphrodites et unisexuées tels que l’andromonoécie ont été mis en évidence. De nombreuses modifications du nombre ancestral d’étamines ont eu lieu. Quelques réductions à une ou trois étamines, mais surtout des augmentations vers un nombre plus élevé. A l’échelle de la famille, l’évolution du nombre d’étamines ne se fait pas de manière progressive. Les transitions directes entre six et plusieurs dizaines (voire centaines) d’étamines sont fréquentes. Mon travail a contribué à amorcer une réflexion sur les mécanismes évolutifs qui sous-tendent l’évolution du nombre d’étamines, en montrant qu’il existe une corrélation entre leur nombre et la production de pollen dans deux sous-familles, les Coryphoideae et les Arecoideae. Néanmoins des expériences complémentaires sont nécessaires pour comprendre si les augmentations répétées du nombre d’étamines chez les palmiers sont le résultat de la sélection ou d’un relâchement de contraintes phylogénétiques. L’observation de l’évolution du nombre d’étamines à l’échelle de la famille m’a conduite à m’intéresser plus précisément à une sous-tribu présentant une variation importante au niveau de ce caractère : les Ptychospermatinae. Cette étude montre que chez ce groupe contenant uniquement des espèces polyandres, la variation du nombre d’étamines est très importante tant au niveau inter-spécifique qu’intra-spécifique. Afin de reconstruire l’histoire évolutive du nombre d’étamines à l’échelle des espèces, j’ai construit une phylogénie moléculaire de la sous-tribu. J’ai ainsi participé au développement des connaissances sur les relations phylogénétiques au niveau inter-spécifique au sein de la famille des palmiers. La reconstruction du nombre d’étamines sur cette phylogénie révèle de nouveau des transitions multiples vers une augmentation du nombre d’étamines.

219

Perspectives

L’évolution du système sexuel

La grande diversité des systèmes sexuels chez les palmiers est connue depuis longtemps et les données sur l’organisation des sexes au niveau des fleurs et des inflorescences sont disponibles dans la littérature pour un grand nombre d’espèces. Notre étude s’est attachée à présenter une vue d’ensemble de cette diversité, ce qui n’avait encore jamais été fait. Nous avons ainsi pu montrer que les Arecaceae se distinguent de la plupart des angiospermes par leur nombre important d’espèces monoïques et dioïques et donc par conséquent, par leur faible nombre d’espèces hermaphrodites. Pour l’ensemble des angiospermes, le pourcentage d’espèces dioïques est estimé à 6% (Renner & Ricklefs 1995), celui d’espèces monoiques entre 3 et 19% (de Jong et al. 2008). L’estimation du nombre d’espèces hermaphrodites oscille donc entre 75 et 91%. Les palmiers, avec 52% d’espèces monoïques, 30% d’espèces dioïques et seulement 17% d’espèces hermaphrodites, présentent ainsi un biais fort en faveur de systèmes sexuels à fleurs unisexuées. La grande majorité des espèces hermaphrodites et monoïques présentent un décalage de maturité des organes ou des fleurs des deux sexes (protandrie notamment). Il semble donc exister, chez les palmiers, une tendance forte à la séparation des sexes, tant au niveau spatial que temporel.

Il serait intéressant d’étudier si cette séparation des sexes est le résultat d’une adaptation à l’évitement de l’autofécondation et/ou à une répartition plus complexe des ressources allouées aux deux sexes (de Jong et al. 2008). La présence de mécanismes d’auto-incompatibilité chez les espèces hermaphrodites et monoïques n’est pas connue, mais, par exemple, certains individus isolés semblent ne pas pouvoir donner de fruits. L’organisation des fleurs chez les espèces monoïques peut être très différente suivant les groupes mais elle conduit souvent à des sex-ratios variables et biaisés en faveur des fleurs mâles. Ainsi lorsque les fleurs sont organisées en triades, organisation la plus commune chez les espèces monoïques, le sex-ratio est de deux fleurs mâles pour une fleur femelle. En outre, les rachillae portent des fleurs mâles en paires ou solitaires dans leur partie distale, ce qui entraîne une variation du sex-ratio (également en faveur de la fonction mâle). Il serait intéressant d’étudier si la monoécie et la dioécie, ainsi que les différentes organisations des fleurs sont le résultat de la sélection de mécanismes permettant une régulation fine du sex-ratio à l’échelle de l’inflorescence, de l’individu et de la population.

220

Les mécanismes développementaux et génétiques qui sous-tendent la formation des fleurs unisexuées restent encore à explorer. Deux principaux modes ont été proposés (Mitchell & Diggle). Le premier consiste en l’avortement des organes d’un sexe à un stade plus ou moins avancé du développement. Si l’avortement est tardif, des organes stériles (staminodes et pistillode) seront présents. En revanche si l’avortement est précoce, les fleurs apparaîtront structurellement unisexuées. Sur une simple description morphologique, elles ne pourront alors pas être distinguées des fleurs unisexuées produites selon le deuxième mode. Celui-ci implique un remplacement des organes d’un sexe par les organes de l’autre sexe. Les fleurs sont alors structurellement unisexuées non plus uniquement d’un point de vue morphologique mais également développemental. Il serait intéressant de comparer le développement de plusieurs espèces monoïques et de plusieurs espèces dioïques pour identifier les différents modes de développement des fleurs unisexuées. Les staminodes et/ou pistillode étant fréquents chez les palmiers, cela suggère que le premier mode est le plus représenté dans la famille. Cependant, chez Caryota mitis, une étamine se développe à l’apex de la fleur, suggérant un remplacement des organes femelles par des organes mâles, ce qui correspond au deuxième mode (Uhl & Moore 1980). Ces études développementales pourraient s’accompagner d’études sur la détermination du sexe, tant au niveau de la fleur, de l’inflorescence que de l’individu. Il semble que cette détermination puisse être réalisée via un contrôle hormonal et/ou génétique. Des études d’expression des gènes liés à la mise en place des organes floraux pourraient être menées chez des taxons apparentés présentant des fleurs unisexuées et des fleurs hermaphrodites.

L’étude de l’évolution des processus de développement et du contrôle génétique des fleurs unisexuées pourrait permettre de progresser dans la compréhension du système sexuel ancestral des palmiers et des nombreuses transitions qui ont lieu dans la famille. Ainsi la doiécie et l’hermaphrodisme ont évolué à partir de la monoécie ; l’andromonoécie à partir de la dioécie, de la monoécie et de l’hermaphrodisme. Les palmiers constituent donc un groupe particulièrement intéressant pour étudier les processus évolutifs qui sous-tendent les transitions entre différents systèmes sexuels.

221

L’évolution du nombre d’étamines

Notre étude sur l’évolution du nombre d’étamines s’inscrit dans une démarche globale de compréhension de la très grande diversité de ce trait floral chez les palmiers. Une précédente étude avait permis de mettre en évidence chez les Arecaceae l’évolution multiple de la polyandrie (plus de six étamines) à partir d’un état ancestral oligandre (six étamines ; Nadot et al. 2011). Nous avons confirmé et complété ces conclusions en détaillant différentes catégories de polyandrie. En effet le nombre d’étamines chez différentes espèces polyandres varie entre sept et mille. Plusieurs catégories de polyandrie ont été définies suivant le degré de variation dans le nombre d’étamines par rapport à l’état ancestral de six étamines : une polyandrie faible (allant de sept à une vingtaine d’étamines), une polyandrie modérée (allant d’une vingtaine à une centaine d’étamines) et une polyandrie forte (à partir d’une centaine d’étamines). Les transitions entre six étamines et des centaines d’étamines sont parfois directes comme chez les Phytelepheae ou plus progressives comme chez les Ptychospermatinae.

Le mode de développement des étamines nombreuses a été étudié pour certaines espèces (Uhl 1976 ; Uhl & Moore 1977 ; Uhl & Moore 1980 ; Uhl & Dransfield 1984 ; Barfod & Uhl 2001). En revanche, l’hypothèse que les modifications du nombre d’étamines seraient liées à une modification des contraintes de développement n’a pas encore été testée. L’étude de la corrélation entre la forme et le nombre des autres pièces florales (périanthe et gynécée) et le nombre d’étamines serait intéressante. Uhl et Moore (1980) ont montré que le développement des étamines chez six espèces de palmier polyandres dépend de pressions exercées par la bractée de l’inflorescence et les pièces du périanthe. La forme du périanthe, et notamment la forme de la corolle au niveau du bouton floral, pourrait avoir un impact sur le nombre d’étamines. Certaines formes permettraient le développement de plus d’étamines. Pour tester cette hypothèse il serait nécessaire de générer des données sur la forme du bouton floral et non simplement des mesures de la taille du périanthe. Les méthodes de morphométrie géométrique permettent d’étudier les variations de formes et leurs co-variations avec d’autres variables (Adams et al. 2004). Des programmes ont été développés pour prendre des points- repères (landmarks) sur des images scannées 2D puis pour les transformer en données numériques pouvant être traitées statistiquement. Des données sur la forme pourraient être générées à partir de dessins de boutons floraux présents dans la littérature puis traitées par des analyses statistiques multivariées.

222

Le contrôle génétique du nombre d’étamines est encore inconnu chez le palmier. L’identification d’orthologues de gènes impliqués dans la détermination des pièces florales et des frontières entre les organes chez les organismes modèles permettrait d’amorcer les études. Par exemple, il a été montré que SUPERMAN (Bowman et al. 1992) et FON1 (Huang and Ma 1997) jouent un rôle dans le contrôle du nombre d’organes chez Arabodipsis. L’expression de ces gènes candidats pourrait par la suite être étudiée, à différents stades de développement, chez des taxons apparentés présentant un contraste pour le nombre d’étamines. L’hybridation in-situ est une technique pour l’étude de l’expression déjà utilisée chez le palmier. L’approche par gènes candidats a notamment permis de mettre en évidence l’intervention de gènes MADS-box dans l’identité des organes floraux au cours du développement de la fleur de palmier (Elaeis guineensis ; Adam et al. 2007).

La différence de nombres d’étamines entre deux taxons apparentés est fréquente et parfois très grande. Les étamines étant les organes reproducteurs mâles de la fleur, il est envisageable que la variation observée soit le résultat d’une adaptation à des environnements différents et notamment à des modes de pollinisation différents. Une corrélation entre un nombre d’étamines élevé et une pollinisation par les coléoptères et les abeilles a été mise en évidence chez Ptychosperma (Uhl & Moore 1977), suggérant que l’augmentation du nombre d’étamines pourrait avoir été sélectionnée dans le cadre de la coévolution avec les pollinisateurs. Les coléoptères sont les pollinisateurs les plus importants des palmiers, ainsi que les abeilles dans une moindre mesure (Barfod et al. 2011). Ces pollinisateurs sont connus pour visiter des fleurs qui produisent une grande quantité de pollen. Notre étude sur la production de pollen montre que les fleurs possédant plus d’étamines ont tendance à produire plus de grains de pollen. Des expériences dans des populations naturelles, sur la valeur sélective conférée par différents phénotypes et les interactions avec les pollinisateurs permettraient d’estimer si des étamines nombreuses associées ou non à une production de pollen élevée se révèle être le résultat d’une sélection. Les palmiers constituent un groupe intéressant pour l’étude du nombre d’étamines et notamment de la polyandrie. Celle-ci, que l’on retrouve de nombreuses fois chez les angiospermes, pourrait avoir joué un rôle fondamental de la diversification de ce groupe (Jabbour et al. 2008).

223

La relation entre système sexuel et nombre d’étamines

La comparaison de l’évolution du système sexuel et du nombre d’étamines (Annexe 4) révèle que la majorité des espèces polyandres présentent également des fleurs unisexuées. Ces deux caractères ne sont néanmoins pas parfaitement corrélés puisque de nombreuses espèces présentent des fleurs unisexuées à six étamines ou moins (par exemple Nypa). L’absence de gynécée fonctionnel dans les fleurs mâles pourrait entraîner un relâchement de contraintes développementales, permettant une expansion de l’androcée. L’unisexualité constituerait ainsi une condition préalable à l’augmentation du nombre des étamines. Dans certains cas, les gènes impliqués dans la disparition des organes d’un sexe pourraient également être en relation avec la modification du nombre d’étamines. Par exemple, chez Arabidopsis, il a été montré que lorsque SUPERMAN est muté, les étamines se développent vers le centre de la fleur au détriment des carpelles (Bowman et al. 1992). L’étude de ce gène se révèle donc potentiellement intéressante pour l’étude de l’évolution du nombre d’étamines et le déterminisme du sexe des fleurs. Une exception notable intervient chez les Cryosophileae où certaines espèces présentent des fleurs hermaphrodites et polyandres. Le nombre d’étamines est supérieur à six mais reste cependant assez réduit. L’étude du développement des différents organes reproducteurs de ces espèces serait particulièrement intéressante.

Nous avons observé une tendance à la séparation des sexes mâles et femelles que ce soit sur le même individu ou sur des individus différents. Nous avons également observé une variation importante du nombre d’étamines qui est potentiellement corrélée à la production de pollen. Cela pourrait laisser penser que les palmiers présentent une capacité importante de modulation du sex-ratio et des investissements dans les fonctions mâles et femelles tant au niveau de la fleur que de l’inflorescence. Il serait intéressant d’étudier le sex-ratio dans des populations naturelles, pour estimer sa variation au sein d’une espèce ou entre des espèces différentes en fonction des conditions de ressources et des stratégies de reproduction et de pollinisation. Les perspectives d'expérimentation permettant d’étudier l’évolution de la morphologie de l’appareil reproducteur dans un contexte écologique sont nombreuses et prometteuses.

224

Références

225

226

Adam, H., Jouannic, S., Morcillo, F., Verdeil, J. L., Duval, Y. & Tregear, J. W. 2007. Determination of flower structure in Elaeis guineensis: do palms use the same homeotic genes as other species? Annals of Botany, 100, 1-12. Adams, D. C., Rohlf, F. J. & Slice, D. E. 2004. Geometric morphometrics: ten years of progress following the "revolution". Italian Journal of Zoology 71, 5-16. Alvarez, I. & Wendel, J. F. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution, 29, 417-434. Angiosperm Phylogeny Group. 2009. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plant: APG III. Botanical Journal of the Linnean Society, 161, 105-121. Armbruster, W. S., Debevec, E. M. & Willson, M. F. 2002. Evolution of syncarpy in angiosperms: theoretical and phylogenetic analyses of the effects of carpel fusion on offspring quantity and quality. Journal of Evolutionary Biology 15, 657-672 Asmussen, C. B., Baker, W. J. & Dransfield, J. 2000. Phylogeny of the palm family (Arecaceae) based on rps16 intron and trnL-trnF plastid DNA sequences. In: Monocots: systematics and evolution (Ed. by Wilson, K. L. & Morrison, D. A.). Melbourne: CSIRO. Asmussen, C. B. & Chase, M. W. 2001. Coding and noncoding plastid DNA in palm systematics. American Journal of Botany, 88, 1103–1117. Asmussen, C. B., Dransfield, J., Deickmann, V., Barfod, A. S., Pintaud, J.-C. & Baker, W. J. 2006. A new subfamily classification of the palm family (Arecaceae): evidence from plastid DNA phylogeny. Botanical Journal of the Linnean Society, 151, 15–38. Bacon, C. D., Feltus, F. A., Paterson, A. H. & Bailey, C. D. 2007. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology. Molecular Ecology Notes, 8, 211-214. Bailey, C. D., Carr, T. G., Harris, S. A. & Hughes, C. E. 2003. Characterization of angiosperm nrDNA polymorphism, paralogy and pseudogenes. Molecular Phylogenetics and Evolution, 29, 435-455. Baker, W. J., Asmussen, C. B., Barrow, S. C., Dransfield, J. & Hedderson, T. A. 1999. A phylogenetic study of the palm family (Palmae)based on chloroplast DNA sequences from the trnL-trnF region. Plant Systematics and Evolution, 219, 111-126.

227

Baker, W. J. & Couvreur, T. L. P. 2012a. Global biogeography and diversification of palms sheds light on the evolution of tropical lineages. I. Historical biogeography. Journal of Biogeography, 40, 274–285. Baker, W. J. & Couvreur, T. L. P. 2012b. Global biogeography and diversification of palms sheds light on the evolution of tropical lineages. II. Diversification history and origin of regional assemblages. Journal of Biogeography, 40, 286– 298. Baker, W. J. & Heatubun, C. D. 2012. New palms from Biak and Supiori, Western New Guinea. Palms, 56, 131-150. Baker, W. J., Hedderson, T. A. & Dransfield, J. 2000. Molecular phylogenetics of subfamily Calamoideae (Palmae) based on nrDNA ITS and cpDNA rps16 intron sequence data. Molecular Phylogenetics and Evolution, 14, 195–217. Baker, W. J., Norup, M. V., Clarkson, J. J., Couvreur, T. L. P., Dowe, J. L., Lewis, C. E., Pintaud, J.-C., Savolainen, V., Wilmot, T. & Chase, M. W. 2011. Phylogenetic relationships among arecoid palms (Arecaceae: Arecoideae). Annals of Botany, 108, 1417-1432. Baker, W. J., Savolainen, V., Asmussen-Lange, C. B., Chase, M. W., Dransfield, J., Forest, F., Harley, M. M., Uhl, N. W. & Wilkinson, M. 2009. Complete generic- level phylogenetic analyses of palms (Arecaceae) with comparisons of supertree and supermatrix approaches. Systematic Biology, 58, 240–256. Baker, W. J., Zona, S., Heatubun, C. D., Lewis, C. E., Maturbongs, R. A. & Norup, M. V. 2006. Dransfieldia (Arecaceae)—A New Palm Genus from Western New Guinea. Systematic Botany, 31, 61-69. Barfod, A. S. 1991. A monographic study of the subfamily Phytelephantoideae (Arecaceae). Opera Botanica, 105, 1-73. Barfod, A. S., Hagen, M. & Borchsenius, F. 2011. Twenty-five years of progress in understanding pollination mechanims in palms (Arecaceae). Annals of Botany, 108, 1503-1516. Barret, S. C. H. 2002. The evolution of plant sexual diversity. Nature Reviews Genetics, 3, 274-284. Becker, A. & Theissen, G. 2003. The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Molecular Phylogenetics and Evolution 29, 464-489.

228

Becker, A., Winter, K.-U., Meyer, B., Saedler, H. & Theissen, G. 2000. MADS-Box gene diversity in seed plants 300 million years ago. Molecular Biology and Evolution, 17, 1425–1434. Bentham, G. & Hooker, J. D. 1862-1883 Genera Plantarum. http://www.biodiversitylibrary.org/bibliography/747 Berendse, F. & Scheffer, M. 2009. The angiosperm radiation revisited, an ecological explanation for Darwin's "abominable mystery". Ecology Letters, 12, 865–872. Bjorholm, S., Svenning, J. C., Skov, F. & Balslev, H. 2005. Environmental and spatial controls of palm (Arecaceae) species richness accross the Americas. Global Ecology and Biogeography, 14, 423-429. Bock, W. J. & vonWahlert, G. 1965. Adaptation and the form-function complex. Evolution, 19, 269-299 Bowe, L. M., leCoat, G. & dePamphilis, C. W. 2000. Phylogeny of seed plants based on all three genomic compartments: Extant gymnosperms are monophyletic and Gnetales’ closest relatives are conifers. Proceedings of the National Academy of Sciences USA, 97, 4092–4097. Bowman, J. L. 1997. Evolutionary conservation of angiosperm flower development at the molecular and genetic levels. Journal of Biosciences, 22, 515–527. Bowman, J. L., Sakai, H., Jack, T., Weigel, D., Mayer, U. & Meyerowitz, E. M. 1992. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development, 114, 599-615. BuffonLeclerc, C. 1756. Histoire naturelle, générale et particulière, avec la description du cabinet du roi. Tome Sixième: Les Animaux sauvages. http://www.buffon.cnrs.fr/. Busch, A. & Zachgo, S. 2009. Flower symmetry evolution: towards understanding the abominable mystery of angiosperm radiation. BioEssays, 31, 1181-1190. Campbell, C. R. 2009. Using phenotypic manipulations to stydy multivariate selection of floral trait associations. Annals of Botany, 103, 1557-1566. Castillejo, C., Romera-Branchat, M. & Pelaz, S. 2005. A new role of the Arabidopsis SEPALLATA3 gene revealed by its constitutive expression. The Plant Journal, 43, 586-596. CBOLPlantWorkingGroup. 2009. A DNA barcode for land plants. Proceedings of the National Academy of Sciences USA, 106, 12794-12797.

229

Chaw, S.-M., Parkinson, C. L., Cheng, Y., Vincent, T. M. & Palmer, J. D. 2000. Seed plant phylogeny inferred from all three plant genomes: Monophyly of extant gymnosperms and origin of Gnetales from conifers. Proceedings of the National Academy of Sciences USA, 97, 4086–4091. Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L. & Etal. 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE, 5, e8613. Citerne, H., Jabbour, F., Nadot, S. & Damerval, C. 2010. Theevolution of floral symmetry. Advances in Botanical Research, 54, 85-137. Clarke, J. T., Warnock, R. C. M. & Donoghue, P. C. J. 2011. Establishing a time- scale for plant evolution. New Phytologist, 192, 266–301. Coen, E. S. & Meyerowitz, E. M. 1991. The war of the whorls: genetic interactions controlling flower development. Nature, 353, 31-37. Corsi, P. 2001. Lamarck: genèse et enjeux du transformisme. Paris: CNRS éditions Couvreur, T. L. P., Forest, F. & baker, W. J. 2011. Origin and global diversification patterns of tropical rain forests: inferences from a complete genus-level phylogeny of palms. BMC Biology, 9, doi:10.1186/1741-7007-9-44. Crepet, W. L. & Niklas, K. J. 2009. Darwin's second "abominable mystery": why are there so many angiosperm species? American Journal of Botany, 96, 366-381. Cronquist, A. 1981. An integrated system of classification of flowering plants. New York: Columbia University Press Cubas, P., Vincent, C. & Coen, E. 1999. An epigenetic mutation responsible for natural variation in floral symmetry. Nature, 401, 157-161. Cuenca, A. & Asmussen-Lange, C. B. 2007. Phylogeny of the palm tribe Chamaedoreeae (Arecaceae) based on plastid DNA sequences. Systematic Botany, 32, 250–263. Cuenca, A., Asmussen-Lange, C. B. & Borchsenius, F. 2008. A dated phylogeny of the palm tribe Chamaedoreeae supports Eocene dispersal between Africa, North and South America. Molecular Phylogenetics and Evolution, 46, 760– 775. Culley, T. M., Weller, S. G. & Sakai, A. K. 2002. The evolution of wind pollination in angiosperms. TRENDS in Ecology and Evolution, 17, 361-369.

230

D’Arcy, W. 1996. Anthers and stamens and what they do. In: The anther form, function and phylogeny (Ed. by D’Arcy, W. & Keating, R.): Cambridge University Press. Damerval, C. & Nadot, S. 2007. Evolution of perianth and stamen characteristics with respect to floral symmetry in Ranunculales. Annals of Botany, 100, 631-640. Darwin, C. 1859. L’origine des espèces (traduction Edmond Barbier 2009). Paris: Flammarion. de Jong, T. J., Shmida, A. & Thuijsman, F. 2008. Sex allocation in plants and the evolution of monoecy. Evolutionary Ecology Research, 10, 1087-1109. DeBodt, S., Maere, S. & VandePeer, Y. 2005. Genome duplication and the origin of angiosperms. TRENDS in Ecology and Evolution, 20, 591-597. Dowl, J. L. 1998. Livistona alfredii. IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. www.iucnredlist.org. Doyle, J. A. 2012. Molecular and fossil evidence on the origin of angiosperms. Annual Review of Earth and Planetary Sciences, 40, 301–326. Dransfield, J., Uhl, N. W., Asmussen, C. B., Baker, W. J., Harley, M. M. & Lewis, C. E. 2005. A new phylogenetic classification of the palm family. Kew Bulletin, 60, 559-569. Dransfield, J., Uhl, N. W., Asmussen, C. B., Baker, W. J., Harley, M. M. & Lewis, C. E. 2008. Genera palmarum: the evolution and classification of palms. Royal Botanic Gardens, Kew: Kew Publishing. Dyer, A. G., Boyd-Gerny, S., McLoughlin, S., Rosa, M. G. P., Simonov, V. & Wong, B. B. M. 2012. Parallel evolution of angiosperm colour signals: common evolutionary pressures linked to hymenopteran vision. Proceedings of the Royal Society B, 279, 3606-3615. Eiserhardt, W. L., Bjorholm, S., Svenning, J.-C., Rangel, T. F. & Balslev, H. 2011. Testing the water–energy theory on american palms (Arecaceae) using geographically weighted regression. PLoS ONE, 6, e27027. Endress, P. K. 1990. Patterns of floral construction in ontogeny and phylogeny. Botanical Journal of the Linnean Society, 39, 153–175. Endress, P. K. 2006. Angiosperm fl oral evolution: Morphological developmental framework. Advances in Botanical Research, 44, 1 – 61. Endress, P. K. 2011. Evolutionary diversification of the flowers in angiosperms. American Journal of Botany, 98, 370-396.

231

Endress, P. K. & Lorence, D. H. 1983. Diversity and evolutionary trends in the floral structure of Tambourissa ( Monimiaceae ). Plant Systematics and Evolution, 143, 53-81. Evans, R. 1998. Cryosophila williamsii. IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. www.iucnredlist.org. Feliner, G. N. & Rosselló, J. 2007. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Molecular Phylogenetics and Evolution, 44, 911-9. Fleming, T. H., Geiselman, C. & Kress, W. J. 2009. The evolution of bat pollination: a phylogenetic perspective. Annals of Botany, 104, 1017-1043. Friedman, J. & Barrett, S. C. H. 2008. A phylogenetic analysis of the evolution of wind pollination in the angiosperms. International Journal of Plant Sciences, 169, 49-58. Friedman, J. & Barrett, S. C. H. 2009. Wind of change: new insights on the ecology and evolution of pollination and mating in wind-pollinated plants. Annals of Botany, 103, 1515–1527. Friedman, W. E. 2009. The meaning of Darwin's "abominable mystery". American Journal of Botany, 91, 5-21. Friesen, M. L., Porter, S. S., Stark, S. C., vonWettberg, E. J., Sachs, J. L. & Martinez- Romero, E. 2011. Microbially mediated plant functional traits. Annual Review of Ecology, Evolution, and Systematics, 42, 23-46. Frohlich, M. W. & Chase, M. W. 2007. After a dozen years of progress the origin of angiosperms is still a great mystery. Nature, 450, 1184-1189. Galletti, M., Donatti, C. I., Pires, A. S., Guimaraes, P. R. & Jordano, P. 2006. Seed survival and dispersal of an endemic Atlantic forest palm: the combined effects of defaunation and forest fragmentation. Botanical Journal of the Linnean Society, 151, 141-149. Gaut, B. S., Morton, B. R., McCaig, B. C. & Clegg, M. T. 1996. Substitution rate comparisons between grasses and palms: synonymous rate differences at the nuclear gene Adh parallel rate differences at the plastid gene rbcL. Proceedings of the National Academy of Sciences USA, 93, 10274–10279. Gaut, B. S., Muse, S. V., Clark, W. D. & Clegg, M. T. 1992. Relative rates of nucleotide substitution at the rbcL locus of monocotyledonous plants. Journal of Molecular Evolution, 35, 292-303.

232

GeoffroySaint-Hilaire, E. 1829. Cours de l'histoire naturelle des mammifères. http://archive.org/details/coursdelhistoir00saingoog Goodman, C. S. & Coughlin, B. C. 2000. The evolution of evo-devo biology. Proceedings of the National Academy of Sciences USA, 97, 4424–4425. Graham, L. E., Cook, M. E. & Busse, J. S. 2000. The origin of plants: body plan changes contributing to a major evolutionary radiation. Proceedings of the National Academy of Sciences USA, 97, 4535–4540. Grant, V. 1950. The protection of the ovules in flowering plants. Evolution, 4, 179-201

Grant, V. 1995. Sexual selection in plants: pros and cons. Proceedings of the National Academy of Sciences USA, 92, 1247-1250. Hahn, W. J. 2002. A molecular phylogenetic study of the palmae (Arecaceae) based on atpB, rbcL, and 18S nrDNA sequences. Systematic Biology, 51, 92-112. Harder, L. D. & Johnson, S. D. 2009. Darwin's beautiful contrivances: evolutionary and functional evidence for floral adaptation. New Phytologist, 183, 530-545. Haynes, J. & McLaughlin, J. 2000. Edible palms and their uses. University of Florida : Institute of Food and Agriculture Sciences

Henderson, A. 1986. A review of pollination studies in the Palmae. The Botanical Review, 52, 221-259. Henderson, A. 1990. Arecaceae. Part I. Introduction and the Iriarteinae. Flora Neotropica,, 53, 1-100. Henderson, A. 2002. Evolution and ecology of palms. Bronx, New York: The New York Botanical Garden Press. Henderson, A. J. & Bacon, C. D. 2011. Lanonia (Arecaceae: Palmae), a new genus from Asia, with a revision of the species. Systematic Botany, 36, 883-895. Herrera, C. 2002. Seed dispersal by vertebrates In: Plant-Animal interactions an evolutionary approach (Ed. by Herrera, C. & Pellmyr, O.): Blackwell publishing Hodges, S. A. & Arnold, M. L. 1995. Spurring plant diversification: are floral nectar spurs a key innovation? Proceedings of the Royal Society B, 262, 343-348. Hollingsworth, P. M. 2011. Refining the DNA barcode for land plants. Proceedings of the National Academy of Sciences USA, 108, 19451-19452. Honma, T. & Goto, K. 2001. Complexes of MADS-box proteins are sufficient to convert leaves into floral organs. Nature, 409, 525-529.

233

Huang, H. & Ma, H. 1997. FON1, an Arabidopsis gene that terminates floral meristem activity and controls flower organ number. The Plant Cell, 9, 115- 134. Hughes, C. E., Eastwood, R. J. & Bailey, C. D. 2006. From famine to feast? Selecting nuclear DNA sequence loci for plant species-level phylogeny reconstruction. Philosophical Transactions of the Royal Society B 361, 211-225. Husband, B. C. & Barrett, S. C. H. 1992. Effective population size and genetic drift in tristylous Eichhornia paniculata (Pontederiaceae). Evolution, 46, 1875-1890. IUCN. 2012. IUCN Red List of Threatened Species. Version 2012.2. www.iucnredlist.org. Jabbour, F., Damerval, C. & Nadot, S. 2008. Evolutionary trens in the flowers of Asteridae: is polyandry an alternative to zygomorphy? Annals of Botany, 102, 153-165. Jeanson, M. L. 2011a. Systématique de la tribu des Caryoteae (Arecaceae). Paris: Museum National d'Histoire Naturelle. Jeanson, M. L., Labat, J.-N. & Little, D. P. 2011b. DNA barcoding: a new tool for palm taxonomists? Annals of Botany, 108, 1445-1451. Joppa, L. N., Roberts, D. L. & Pimm, S. L. 2011. How many species of flowering plants are there? Proceedings of the Royal Society B, 278, 554-559. Jordan, C. Y. & Harder, L. D. 2006. Manipulation of bee behavior by inflorescence architecture and its consequences for plant mating. The American Naturalist, 167, 496-509. Kenrick, P. & Crane, P. R. 1997. The origin and early evolution of plants on land. Nature, 389, 33-39. Kimura, M. 1968. Evolutionary rate at the molecular level. Nature, 217, 624-626. Kreft, H., Sommer, J. H. & Barthlott, W. 2006. The significance of geographic range size for spatial diversity patterns in Neotropical palms. Ecography, 29, 21-30. Larousse. 2013. Dictionnaire. http://www.larousse.fr/dictionnaires. Levin, D. A. 1971. The origin of reproductive isolating mechanisms in flowering plants. Taxon, 20, 91-113. Lewis, C. E. & Doyle, J. J. 2001. Phylogenetic utility of the nuclear gene malate synthase in the palm family (Arecaceae). Molecular Phylogenetics and Evolution, 19, 409-420.

234

Lewis, C. E. & Doyle, J. J. 2002. A phylogenetic analysis of tribe Areceae (Arecaceae) using two low-copy nuclear genes. Plant Systematics and Evolution, 236, 1-17. Lewis, E. B. 1978. A gene complex controlling segmentation in Drosophila. Nature, 276, 565-570 Linder, H. P. 1998. Morphology and the evolution of wind pollination. In: Reproductive Biology (Ed. by Owens, S. J. & Rudall, P. J.), pp. 123-135. Kew: Royal Botanic Gardens. Loo, A. H. B., Dransfield, J., Chase, M. W. & Baker, W. B. 2006. Low copy nuclear DNA, phylogeny and the evolution of the dichogamy in the betel nut palms and their relative (Arecinae, Arecaceae). Molecular Phylogenetics and Evolution, 39, 598-618. Lorence, D. H. 1985. A monograph of the Monimiaceae (Lauraceae) in the Malagasy region (Southwest Indian Ocean). Annals of the Missouri Botanical Garden, 72, 1 – 165. Ludena, B., Chabrillange, N., Aberlenc-Bertossi, F., Adam, H., Tregear, J. W. & Pintaud, J.-C. 2011. Phylogenetic utility of the nuclear genes AGAMOUS 1 and PHYTOCHROME B in palms (Arecaceae): an example within Bactridinae. Annals of Botany, 108, 1433-1444. Maddison, D. R., Schulz, K.-S. & Maddison, W. P. 2007. The Tree of Life Web Project. Zootaxa, 1668, 19-40. Maynard-Smith, J., Burian, R., Kauffman, S., Alberch, P., Campbell, J., Goodwin, B., Lande, R., Raup, D. & Wolpert, L. 1985. Developmental constraints and evolution: a perspective from the mountain lake conference on development and evolution. The Quarterly Review of Biology, 60, 265-287. Mathews, S. 2009. Phylogenetic relationships among seed plants: persistent questions and the limits of molecular data. American Journal of Botany, 96, 228-236. Mitchell, C. H. & Diggle, P. K. 2005. The evolution of unisexual flowers: morphological and functional convergence results from diverse developmental transitions. American Journal of Botany, 92, 1068-1076. Moore, H. E. 1973. The major groups of palms and their distribution. Gentes Herbarum, 11, 27-140.

235

Morjan, C. L. & Rieseberg, L. H. 2004. How species evolve collectively: implications of gene flow and selection for the spread of advantageous alleles. Molecular Ecology, 13, 1341-1356. Myers, N., Mittermeier, A. R., Mittermeier, C. G., daFonseca, G. A. B. & Kent, J. 2000. Biodiversity hotspots for conservation priorities. Nature, 403, 853-858 Nadot, S., Sannier, J., Barfod, A. S. & Baker, W. J. 2011. Evolution of the palm androecium as revealed by character mapping on a supertree. In: Flowers on the tree of life (Ed. by Wanntorp, L. & RoncedeCraene, L. P.): Cambridge University Press. Norup, M. V., Dransfield, J., Chase, M. W., Barfod, A. S., Fernando, E. S. & Baker, W. B. 2006. Homoplasious character combinations and generic delimitations: a case study from the Indo-Pacific arecoid palms (Arecaceae: Areceae). American Journal of Botany, 93, 1065-1080. Page, W. 1998. Hyophorbe lagenicaulis. IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. www.iucnredlist.org. Palmweb. 2013. Palmweb: Palms of the World Online. Published on the internet http://www.palmweb.org/. Paton, A. J., Brummitt, N., Govaerts, R., Harman, K., Hinchcliffe, S., Allkin, B. & Lughadha, E. N. 2008. Towards target 1 of the global strategy for plant conservation: a working list of all known plant species—progress and prospects. Taxon, 57, 602–611. Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. & Yanofsky, M. F. 2000. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature, 405, 200-203. Pellmyr, O. 2002. Pollination by animals In: Plant-Animal interactions an evolutionary approach (Ed. by Herrera, C. & Pellmyr, O.): Blackwell publishing Prenner, G., Vergara-Silva, F. & Rudall, P. J. 2009. The key role of morphology in modelling inflorescence architecture. Trends in Plant Sciences, 14, 302-309. Preston, J. C., Martinez, C. C. & Hileman, L. C. 2011. Gradual disintegration of the floral symmetry gene network is implicated in the evolution of a wind- pollination syndrome. Proceedings of the National Academy of Sciences USA, 108, 2343-2348. Prusinkiewicz, P., Erasmus, Y., Lane, B., Harder, L. D. & Coen, E. 2007. Evolution and development of inflorescence architectures. Science, 316.

236

Purugganan, M. D., Rounsley, S. D., Schmidt, R. J. & Yanofsky, M. F. 1995. Molecular evolution of flower development: diversification of the plant MADS- box regulatory gene family. Genetics, 140, 345-356. Rakotoarinivo, M. & Dransfield, J. 2012. Tahina spectabilis. IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. www.iucnredlist.org. Regal, P. J. 1977. Ecology and evolution of flowering plant dominance. Science, 196, 622-629 Reich, P. B., Walters, M. B. & Ellsworth, D. S. 1997. From tropics to tundra: global convergence in plant functioning. Proceedings of the National Academy of Sciences USA, 94, 13730–13734. Ren, M.-X. & Tang, Y.-Y. 2010. Anther fusion enhances pollen removal in Campsis grandiflora, a hermaphroditic flower with didynamous stamens. International Journal of Plant Sciences, 171, 275-282. Renner, S. S. & Ricklefs, R. E. 1995. Dioecy and its correlations in the flowering plants. American Journal of Botany, 82, 596-606. Rieseberg, L. H., Ellstrand, N. C. & Arnold, M. 1993. What can molecular and morphological markers tell us about plant hybridization? Critical Reviews in Plant Sciences, 12, 213-241. Rieseberg, L. H. & Wendel, J. 1993. Introgression and its consequences in plants. In: Hybrid zones and the evolutionary process (Ed. by Harrison, R.). New-York, NY, USA: Oxford University Press. Roncal, J., Francisco-Ortega, J., Asmussen, C. B. & Lewis, C. E. 2005. Molecular phylogenetics of tribe Geonomeae (Arecaceae) using nuclear DNA sequences of Phosphoribulokinase and RNA Polymerase II. Systematic Botany, 30, 275– 283. Roncal, J., Zona, S. & Lewis, C. E. 2008. Molecular phylogenetic studies of caribbean palms (Arecaceae) and their relationships to biogeography and conservation. Botanical Reviews, 74, 78-102. Ronce de Craene, L. P. & Smets, E. 1987. The distribution and the systematic relevance of the androecial characters oligomery and polymery in the Magnoliophytina. Nordic Journal of Botany, 7, 239-253. Ronce de Craene, L. P. & Smets, E. F. 1998. Notes on the evolution of androecial organisation in the Magnoliophytina (angiosperms). Botanica Acta, 111, 77-86.

237

Ronce de Craene, L. P. & Smets, E. F. 2001. Staminodes: their morphological and evolutionary significance. The Botanical Review, 67, 351-402. Ronse de Craene, L. P., Soltis, P. S. & Soltis, D. E. 2003. Evolution of floral structures in basal angiosperms. International Journal of Plant Sciences, 164, 329-363. Sargent, R. D. 2004. Floral symmetry affects speciation rates in angiosperms. Proceedings of the Royal Society B, 271, 603-608. Sauquet, H., Ho, S. Y. W., Gandolfo, M. A., Jordans, G. J., Wilf, P. & etal. 2012. Testing the impact of calibration on molecular divergence times using a fossil- rich group: the case of Nothofagus (Fagales). Systematic Biology, 61, 289– 313. Sauquet, H. & Nadot, S. 2013. La botanique contemporaine. In: La Science au Présent 2013, pp. 192-203: Encyclopaedia Universalis. Savolainen, V., Anstett, M.-C., Lexer, C., Hutton, I., Clarkson, J. J., Norup, M. V., Powell, M. P., Springate, D., Salamin, N. & Baker, W. J. 2006. Sympatric speciation in palms on an oceanic island. Nature, 441. Scarcelli, N., Barnaud, A., Eiserhardt, W., Treier, U. A., Seveno, M., d'Anfray, A., Vigouroux, Y. & Pintaud, J.-C. 2011. A set of 100 chloroplast DNA primer pairs to study population genetics and phyogeny in Monocotyledons. PLoS ONE, 6, e19954. Schmid, R. 1983. Septal nectaries of Asterogyne martiana and other Palmae. Principes, 27, 168-174. Schoen, D. J. & Dubuc, M. 1990. The evolution of inflorescence size and number: a gamete-packaging strategy in plants. American Naturalist, 135, 841-857. Schwarz-Sommer, Z., Huijser, P., Nacken, W., Saedler, H. & Sommer, H. 1990. Genetic control of flower development by homeotic genes in Antirrhinum majus. Science, 250, 931-936. Scotland, R. W. & Wortley, A. H. 2003. How many species of seed plants are there? Taxon, 52, 101–104. Selosse, M.-A., Richard, F., He, X. & Simard, S. W. 2006. Mycorrhizal networks: des liaisons dangereuses? Science, 21, 621-628. Singer, S. D., Krogan, N. T. & Ashton, N. W. 2007. Clues about the ancestral roles of plant MADS-box genes from a functional analysis of moss homologues. Plant Cell Reports, 26, 1155-1169.

238

Skogsmyr, I. & Lankinen, A. 2002. Sexual selection: an evolutionary force in plants? Biological Reviews, 77, 537-562. Smaczniak, C., Immink, R. G. H., Angenent, G. C. & Kaufmann, K. 2012. Developmental and evolutionary diversity of plant MADSdomain factors: insights from recent studies. Development, 139, 3081-3098. Soltis, P. S., Brockington, S. F., Yoo, M.-J., Piedrahita, A., Latvis, M., Moore, M. J., Chanderbali, A. S. & Soltis, D. E. 2009. Floral variation and floral genetics in basal angiosperms. American Journal of Botany, 91, 110-128. Stevens, P. F. 2001. Angiosperm Phylogeny Website. Version 12, July 2012 http://www.mobot.org/MOBOT/research/APweb/. Strauss, S. Y. & Whittall, J. B. 2006. Non-pollinator agents of selection on floral traits. In: Ecology and evolution of flowers (Ed. by Harder, L. D. & Barrett, S. C. H.), pp. 120-138. Oxford: Oxford University Press. Sunderland, T. C. H. 2012. A taxonomic revision of the rattans of Africa (Arecaceae: Calamoideae). Phytotaxa 51, 1–76 Theissen, G., Becker, A., DiRosa, A., Kanno, A., Kim, J. T., Münster, T., Winter, K.-U. & Saedler, H. 2000. A short history of MADS-box genes in plants. Plant Molecular Biology, 42, 115–149. Theissen, G. & Melzer, R. 2007. Molecular mechanisms underlying origin and diversification of the angiosperm flower. Annals of Botany, 100, 603–619. Thien, L. B., Azuma, H. & Kawano, S. 2000. New perspectives on the pollination biology of basal angiosperms. International Journal of Plant Sciences, 161, S225-S235. Thomas, M. M., Garwood, N. C., Baker, W. B., Henderson, S. A., Russell, S. J., Hodel, D. R. & Bateman, R. M. 2005. Molecular phylogeny of the palms genus Chamaedorea, based on the low-copy nuclear genes PRK and RPB2. Molecular Phylogenetics and Evolution, 38, 398-415. Thomas, R. & DeFranceschi, D. 2012. First evidence of fossil Cryosophileae (Arecaceae) outside Americas (early Oligocene and late Miocene of France): Anatomy, palaeobiogeography and evolutionary implications. Review of Palaeobotany and Palynology, 171, 27– 39. Thomson, J. D. & Wilson, P. 2008. Explaining evolutionary shifts between bee and hummingbird pollination: convergence, divergence and directionality. International Journal of Plant Sciences, 169, 23-38.

239

Tomlinson, P. B. 2006. The uniqueness of palms. Botanical Journal of the Linnean Society, 151, 5-14. Tomlinson, P. B., Horn, J. W. & Fisher, J. B. 2011. The anatomy of palms (Arecaceae - Palmae). Oxford: Oxford University Press. Tomlinson, P. B. & Huggett, B. A. 2012. Cell longevity and sustained primary growth in palm stems. American Journal of Botany, 99, 1891-1902. Trénel, P., Gustafsson, M. H. G., Baker, W. J., Asmussen-Lange, C. B., Dransfield, J. & Borchsenius, F. 2007. Mid-Tertiary dispersal, not Gondwanan vicariance explains distribution patterns inthe wax palm subfamily (Ceroxyloideae: Arecaceae). Molecular Phylogenetics and Evolution, 45, 272-288. Uhl, N. & Moore, H. E. 1980. Androecial development in six polyandrous genera representing five major groups of palms. Annals of Botany, 45, 57-75. Uhl, N. W. & Dransfield, J. 1984. Development of the inflorescence, androecium and gynoecium with reference to palms. In: Contemporary problems in plant anatomy (Ed. by White, R. A. & Dickinson, W. C.). New York: Academic Press. Uhl, N. W. & Dransfield, J. 1987. Genera Palmarum, a classification of palms based on the work of Harold E. Moore Jr. L.H. Bailey Hortorium and the International Palm Society, Lawrence, Kansas. Uhl, N. W., Dransfield, J., Davis, J. I., Luckow, M. A., Hansen, K. S. & Doyle, J. J. 1995. Phylogenetic relationships among palms: cladistic analysis of morphological and chloroplast DNA restriction site variation. In: Monocotyledons: systematics and evolution (Ed. by Rudall, P. J., Cribb, P. J., Cutler, D. F. & Humphries, C. J.), pp. 623-661: Royal Botanic Gardens, Kew. Uhl, N. W. & Moore, H. E. 1977. Correlation of inflorescence, flower structure, and floral anatomy with pollination in some palms. Biotropica, 9, 170-190. Vamosi, J. C. & Vamosi, S. M. 2010. Key innovations within a geographical context in flowering plants: towards resolving Darwin's abominable mystery. Ecology Letters, 13, 1270–1279. Von Linné, C. 1753. Species Plantarum. http://www.biodiversitylibrary.org/item/13829 Walker-Larsen, J. & Harder, L. D. 2000. The evolutionof staminodes in angiosperms: patterns of stamen reduction, loss and functional re-invention. American Journal of Botany, 87, 1367-1384.

240

Walther, G. R., Gritti, E. S., Berger, S., Hickler, T., Tang, Z. & Sykes, M. T. 2007. Palms tracking climate change. Global Ecology and Biogeography, 16, 801– 809. Whittall, J. B. & Hodges, S. A. 2007. Pollinator shifts drive increasingly long nectar spurs in columbine flowers. Nature, 447, 706-709. Wikström, N., Savolainen, V. & Chase, M. W. 2001. Evolution of the angiosperms: Calibrating the family tree. Proceedings of the Royal Society B, 268, 2211- 2220. Wilcock, C. & Neiland, R. 2002. Pollination failure in plants:why it happens and when it matters. Trends in Plant Sciences, 7, 270-277. Wing, S. L. & Boucher, L. D. 1998. Ecological aspects of the cretaceous flowering plant radiation. Annual Review of Earth and Planetary Sciences, 26, 379-421. Zona, S. 1999. New perspective on generic imits and relationships in the Ptychospermatinae (Palmae: Arecoideae). In: Evolution, variation and classification of palms (Ed. by Henderson, A. & Borchsenius, F.), pp. 255-263. Bronx New York: The New York Botanical Garden Press. Zona, S., Francisco-Ortega, J., Jestrow, B., Baker, W. J. & Lewis, C. E. 2011. Molecular phylogenetics of the palm subtribe Ptychospermatinae (Arecaceae). American Journal of Botany, 98, 1-11. Zona, S. & Henderson, A. 1989. A review of animal-mediated seed dispersal of palms. Selbyana, 11, 6-21.

241

242

Annexes

243

244

Annexe 1 : Reconstruction de l’évolution de l’organisation des fleurs sur l’inflorescence

245

246

Annexe 2 : protocoles utilisés pour la dissection des fleurs de palmier, l’extraction et le comptage des grains de pollen.

Protocole de dissection

Les différentes étapes sont réalisées sous une loupe binoculaire et les observations sont notées dans un tableau (fichier joint).

1. Avant d’ouvrir le bouton floral, prendre une photo (appareil photo ajusté sur la loupe binoculaire) pour garder une trace de la forme générale, mesurer la longueur et la largeur (à l’aide du papier millimétré).

2. Ouvrir le bouton floral, en enlevant délicatement les pièces du périanthe pour ne pas endommager les étamines ; compter les sépales et les pétales, noter une éventuelle fusion des pièces.

3. Compter les étamines en les prélevant une à une, en faisant attention à ne pas percer les anthères pour que le pollen ne s’échappe pas. Vérifier que les anthères sont bien fermées (éventuellement qu’elles contiennent bien du pollen mature en écrasant une anthère entre lame et lamelle et en observant le contenu au microscope).

4. Mesurer la taille de l’anthère, préciser le type d’attache et de déhiscence, la présence d’un gynécée ou d’un pistillode, mesurer sa taille.

5. Prélever 6 anthères (soit l’ensemble des anthères pour les espèces à 6 étamines ou réaliser un transect de l’extérieur vers l’intérieur de l’androcée pour les espèces qui possèdent plus de 6 étamines). Le transect permet de prendre en compte une éventuelle différence de production de pollen entre les étamines externes et les internes.

6. Placer les 6 anthères dans un tube Eppendorf.

247

Protocole d’extraction et de comptage du pollen

1. Placer le tube eppendorf contenant les anthères, ouvert, dans l’étuve. Laisser une nuit à 30°C pour permettre la déshydratation progressive des tissus de l’anthère.

2. Ajouter deux billes en métal dans le tube.

3. Le tube est placé dans un agitateur (Retsh MM300, Germany) pour le broyage mécanique des tissus de l’anthère. Afin de ne pas endommager les grains de pollen le broyage ne doit pas être trop fort, ni trop long : fréquence de 10 mouvements par seconde pendant 10 à 30 seconde. Le temps doit être ajusté en fonction de la taille et du caractère coriace des tissus de l’anthère. Le mieux est de commencer par dix secondes et de regarder l’aspect de l’échantillon. Si les anthères ne sont plus distinguables, arrêter ; sinon recommencer 10 secondes et ainsi de suite. (attention à bien équilibrer les tubes dans l’agitateur)

4. Ajouter 300L de solution d’Alexander (composition ci-dessous). Cette solution colore l’exine du grain de pollen en vert et l’intérieur en rose.

5. Mélanger puis laisser reposer au minimum 1h afin que les grains de pollen se répartissent dans la solution.

6. Vortexer le tube pendant 1min minimum afin d’homogénéiser la solution de grains de pollen.

7. Prélever 5L de la solution de grains de pollen ; les placer entre lame et lamelle (préférer une carré) ; compter l’ensemble des grains de pollen présents sous le microscope (grossissement x10 ou x20 suivant la taille des grains de pollen).

8. Recommencer l’étape 6 deux fois pour avoir trois comptages par fleur (3 x 5L).

Composition de la solution d’Alexander : pour 100 ml

1- 43 à 49 ml d’eau 2- 30 ml de glycérol 3- 5g d’hydate de choral 4- 10 ml d’Ethanol 95° avec Parahydroxybenzoate de méthyle 150 mg 5- 2 ml de vert de malachite 0.5% (m/v) dans l’éthanol 50° 6- 1 ml d’orange G 0.5% (m/v) dans l’éthanol 50° 7- 2 à 5 ml de fuchsine acide 1% (m/v) dans l’éthanol 50° 8- 1 à 4 ml d’acide acétique

248

Annexe 3 : ficher de données PROTEUS

Il contient l’ensemble des données rassemblées pour étudier l’évolution de la morphologie de l’appareil reproducteur ; les caractères et leurs différents états sont également présentés D : caractère discret ; C : caractère continu ; 1 : caractère primaire ; 2 : caractère secondaire défini à partir d’un caractère primaire discret ou continu

Number Class Character 100 D1 Sex 100a D2d Sex (functional) 100b D2d Sex Arecaceae 103 C1 Flower length 6130 D2c Hermaphrodotic flower length 6000 C1 Pistillate flower length 6000a D2c Pistillate flower length 6001 C1 Staminate flower length 6001a D2c Staminate flower length 6002 D1 Floral dimorphism 6002b D1 Floral dimorphism 1,5x 6002a D2d Floral dimorphism 6002c D2d Floral dimorphism 1,5x 6025 C1 Flower bud length 6026 C1 Pistillate bud length 6027 C1 Staminate bud length 301 C1 Number of fertile stamens 301b D2c Number of stamens (Arecaceae) 301c D2c Polyandry (Arecaceae) 6035 C1 Gynoecium length 6035a D2c Gynoecium length 6036 C1 Total number of ovules 6036a D2c number of ovules 6037 C1 Number of fertile ovules 6038 D1 Staminodes presence 6039 C1 Number of staminodes 6039b D2c Number of staminodes 6039c D1 Staminode number vs stamen number 6040 C1 Staminode length 6040a D2c Staminode length 6095 D1 Staminodes 6131 D1 staminode modification 6041 C1 Stamen length 6041b D2c Stamen length 6043 C1 Anther length 6043a D2c anther length 6048 D1 Pistillode presence 6049 C1 Pistillode length 6049a D2c pitillode length 6132 C1 ratio pistillode length / gynoecium length 6132a D2c ratio pistillode length / gynoecium length 6094 C1 Sex ratio 6094a D2c Sex ratio 6094b D1 sex ratio (monoecious) 6097 C1 Fruit length 6097b D2c Fruit length 6102 D1 order of sex

249

500 D1 Chronology of sex 6023 D1 Organization of flowers 6134 D1 flower cluster 6133 D1 sexual expression in space

Présentation des états des caractères primaires :

Character Symbol CharacterState 100. Sex (D1) 0 bisexual (structurally and functionally) 100. Sex (D1) 3 functionally unisexual dioecious, structurally bisexual 100. Sex (D1) 4 functionally unisexual dioecious, structurally androdioecious 100. Sex (D1) 5 functionally unisexual monoecious, structurally gynomonoecious 100. Sex (D1) A functionally unisexual monoecious, structurally bisexual 100. Sex (D1) B functionally unisexual monoecious, structurally andromonoecious 100. Sex (D1) C unisexual dioecious (structurally or functionally) 100. Sex (D1) D unisexual monoecious (structurally or functionally) 500. Chronology of sex (D1) 1 protandrous 6002. Floral dimorphism (D1) 0 absent 6002. Floral dimorphism (D1) 1 male flowers larger 6002. Floral dimorphism (D1) 2 female flowers larger 6002. Floral dimorphism (D1) 3 bisexual flower 6002b. Floral dimorphism 1,5x (D1) 0 absent 6002b. Floral dimorphism 1,5x (D1) 1 male flowers larger 6002b. Floral dimorphism 1,5x (D1) 2 female flowers larger 6002b. Floral dimorphism 1,5x (D1) 3 bisexual flower 6023. Organization of flowers (D1) 0 triad 6023. Organization of flowers (D1) 1 pair 6023. Organization of flowers (D1) 2 solitary 6023. Organization of flowers (D1) 3 acervulus 6023. Organization of flowers (D1) 4 tetrad 6023. Organization of flowers (D1) 5 grouped 6038. Staminodes presence (D1) 0 yes 6038. Staminodes presence (D1) 1 no 6038. Staminodes presence (D1) 3 irrelevant 6039c. Staminode number vs stamen number (D1) 0 same number 6039c. Staminode number vs stamen number (D1) 1 more stamens 6039c. Staminode number vs stamen number (D1) 2 more staminodes 6039c. Staminode number vs stamen number (D1) 3 bisexual flower 6048. Pistillode presence (D1) 0 yes 6048. Pistillode presence (D1) 1 no 6048. Pistillode presence (D1) 2 sometimes 6048. Pistillode presence (D1) 3 irrelevant 6094b. sex ratio (monoecious) (D1) 0 irrelevant 6094b. sex ratio (monoecious) (D1) 1 triades 6094b. sex ratio (monoecious) (D1) 2 less than 4 6094b. sex ratio (monoecious) (D1) 3 less than 6 6094b. sex ratio (monoecious) (D1) 4 more than 6 6095. Staminodes (D1) 0 one side of gynoecium 6095. Staminodes (D1) 1 cup-ring 6095. Staminodes (D1) 2 as stamens 6095. Staminodes (D1) 3 tongue like 6102. order of sex (D1) 0 protandry 6102. order of sex (D1) 1 protogyny 6102. order of sex (D1) 2 irrelevant 6131. staminode modification (D1) 0 stamen like 6131. staminode modification (D1) 1 slightly modified

250

6131. staminode modification (D1) 2 highly modified 6131. staminode modification (D1) 3 lacking 6131. staminode modification (D1) 4 irrelevant 6133. sexual expression in space (D1) 0 within flower 6133. sexual expression in space (D1) 1 within rachillae 6133. sexual expression in space (D1) 2 within inflorescence 6133. sexual expression in space (D1) 3 within individual 6133. sexual expression in space (D1) 4 between individuals 6134. flower cluster (D1) 0 solitary 6134. flower cluster (D1) 1 dyad 6134. flower cluster (D1) 2 triad 6134. flower cluster (D1) 3 triad + solitary male flowers 6134. flower cluster (D1) 4 cincinnus 6134. flower cluster (D1) 5 acervulus 6134. flower cluster (D1) 6 monopodial cluster 6134. flower cluster (D1) 7 other cluster

Présentation des états des caractères secondaires :

Character Symbol CharacterState Start End Notes 100a. Sex (functional) (D2d) 0 bisexual 100a. Sex (functional) (D2d) 1 unisexual 100b. Sex Arecaceae (D2d) 0 bisexual 100b. Sex Arecaceae (D2d) 1 unisexual monoecious 100b. Sex Arecaceae (D2d) 2 unisexual dioecious 301b. Number of stamens (Arecaceae) (D2c) 0 0 5 0 to 5 301b. Number of stamens (Arecaceae) (D2c) 1 6 6 6 to 6 301b. Number of stamens (Arecaceae) (D2c) 2 7 22 7 to 22 301b. Number of stamens (Arecaceae) (D2c) 3 23 114 23 to 114 301b. Number of stamens (Arecaceae) (D2c) 4 115 524 115 to 524 525 to 301b. Number of stamens (Arecaceae) (D2c) 5 525 1E+07 9999999 301c. Polyandry (Arecaceae) (D2c) 0 Oligandry 0 6 0 to 6 7 to 301c. Polyandry (Arecaceae) (D2c) 1 Polyandry 7 1E+07 9999999 6000a. Pistillate flower length (D2c) 0 tiny 0 0,89 0 to 1 6000a. Pistillate flower length (D2c) 1 small 0,9 3,99 1 to 4 6000a. Pistillate flower length (D2c) 2 medium 4 17,49 4 to 17 18 to 6000a. Pistillate flower length (D2c) 3 large 17,5 99999 99999 6001a. Staminate flower length (D2c) 0 tiny 0 0,57 0 to 1 6001a. Staminate flower length (D2c) 1 small 0,58 1,19 1 to 1 6001a. Staminate flower length (D2c) 2 medium 1,2 5,29 1 to 5 6001a. Staminate flower length (D2c) 3 large 5,3 9999 5 to 9999 6002a. Floral dimorphism (D2d) 0 absent 6002a. Floral dimorphism (D2d) 1 present 6002c. Floral dimorphism 1,5x (D2d) 0 absent 6002c. Floral dimorphism 1,5x (D2d) 1 present 6035a. Gynoecium length (D2c) 0 0 4,7 0 to 5 6035a. Gynoecium length (D2c) 1 4,8 26,9 5 to 27 6035a. Gynoecium length (D2c) 2 27 125,9 27 to 126 126 to 6035a. Gynoecium length (D2c) 3 126 1E+08 99999999 6036a. number of ovules (D2c) 0 1 ovule 0 1 0 to 1 6036a. number of ovules (D2c) 1 3 ovules 2 3 2 to 3 6036a. number of ovules (D2c) 2 more than 3 ovules 4 999 4 to 999

251

6039b. Number of staminodes (D2c) 0 0 5 0 to 5 6039b. Number of staminodes (D2c) 1 6 6 6 to 6 6039b. Number of staminodes (D2c) 2 7 22 7 to 22 6039b. Number of staminodes (D2c) 3 23 114 23 to 114 6040a. Staminode length (D2c) 0 absent 0 0,001 0 to 0 6040a. Staminode length (D2c) 1 minute 0,001 3,9 0 to 4 6040a. Staminode length (D2c) 2 small 4 10,4 4 to 10 6040a. Staminode length (D2c) 3 medium 10,5 35,9 11 to 36 36 to 6040a. Staminode length (D2c) 4 large 36 99999 99999 6041b. Stamen length (D2c) 0 0 4,85 0 to 5 6041b. Stamen length (D2c) 1 4,9 8,2 5 to 8 6041b. Stamen length (D2c) 2 8,25 23,45 8 to 23 6041b. Stamen length (D2c) 3 23,5 9999 24 to 9999 6043a. anther length (D2c) 0 tiny 0 2,7 0 to 3 6043a. anther length (D2c) 1 small 2,75 4,99 3 to 5 6043a. anther length (D2c) 2 medium 5 22,49 5 to 22 23 to 6043a. anther length (D2c) 3 large 22,5 99999 99999 6049a. pitillode length (D2c) 0 absent 0 0,0001 0 to 0 6049a. pitillode length (D2c) 1 minute 0,0001 1,7 0 to 2 6049a. pitillode length (D2c) 2 small 1,8 3,4 2 to 3 6049a. pitillode length (D2c) 3 medium 3,5 7,4 4 to 7 6049a. pitillode length (D2c) 4 large 7,5 9999 8 to 9999 6094a. Sex ratio (D2c) 0 hermaphroditic 0 1 0 to 1 6094a. Sex ratio (D2c) 1 triades 1,1 2 1 to 2 6094a. Sex ratio (D2c) 2 less than 4 2,1 3,9 2 to 4 6094a. Sex ratio (D2c) 3 less than 6 4 5,9 4 to 6 6094a. Sex ratio (D2c) 4 more than 6 6 9999 6 to 9999 6097b. Fruit length (D2c) 0 0 14,2 0 to 14 6097b. Fruit length (D2c) 1 14,3 31,9 14 to 32 6097b. Fruit length (D2c) 2 32 99,9 32 to 100 6097b. Fruit length (D2c) 3 100 455 100 to 455 456 to 6097b. Fruit length (D2c) 4 456 999999 999999 6130. Hermaphrodotic flower length (D2c) 0 small 0 0,74 0 to 1 6130. Hermaphrodotic flower length (D2c) 1 medium 0,75 3,74 1 to 4 6130. Hermaphrodotic flower length (D2c) 2 large 3,75 12,62 4 to 13 13 to 6130. Hermaphrodotic flower length (D2c) 3 gigantic 12,63 1E+07 9999999 6132a. ratio pistillode length / gynoecium length (D2c) 0 irrelevant 0 0 0 to 0 6132a. ratio pistillode length / gynoecium length (D2c) 1 highly reduced 0,0001 0,49 0 to 0 6132a. ratio pistillode length / gynoecium length (D2c) 2 slightly reduced 0,5 0,8 1 to 1 6132a. ratio pistillode length / gynoecium length (D2c) 3 same size 0,81 1,2 1 to 1 6132a. ratio pistillode length / gynoecium length (D2c) 4 bigger 1,21 99 1 to 99

252

Fichier de données :

Taxon 100 100a 100b 103 6130 6000 6000a 6001 6001a 6002 6002b 6002a 6002c Acanthophoenix rubra (A) (1) (1) 0,66 (0) 0,88 (1) (0) (0) (0) (0) Acoelorrhaphe wrightii (0) (0) (0) 0,25 (0) (3) (3) (0) (0) Acrocomia aculeata (A) (1) (1) Actinokentia divaricata (A) (1) (1) 0,73 (0) 0,64 (01) (0) (0) (0) (0) Actinorhytis calapparia (A) (1) (1) 1,00 (1) 0,50 (0) (2) (2) (1) (1) Adonidia merrillii (AD) (1) (1) 1,13 (1) 1,08 (1) (0) (0) (0) (0) Aiphanes horrida (AD) (1) (1) 0,38 (0) 0,38 (0) (0) (0) (0) (0) Allagoptera arenaria (A) (1) (1) 1,00 (1) 0,75 (0) 0,91 (1) (0) (0) (0) (0) Ammandra decasperma (3) (1) (2) 12,63 (03) 18,80 (23) 1,53 (012) (2) (2) (1) (1) Anigozanthos flavidus (0) (0) (0) 0,38 (0) (3) (3) (0) (0) Aphandra natalia (4) (1) (2) 27,00 (3) 2,50 (2) (2) (2) (1) (1) Archontophoenix alexandrae (A) (1) (1) 0,50 (0) 0,62 (1) (0) (0) (0) (0) Areca catechu (5A) (1) (1) 0,75 (01) 1,25 (1) 0,46 (01) (2) (2) (1) (1) Arenga pinnata (B) (1) (1) 1,15 (1) 2,25 (2) (0) (1) (0) (1) Asterogyne martiana (A) (1) (1) 0,70 (0) 0,75 (1) (0) (0) (0) (0) Astrocaryum gynacanthum (A) (1) (1) 1,57 (1) Attalea allenii (A) (1) (1) 0,26 (0) 1,30 (12) (1) (1) (1) (1) Bactris gasipaes (B) (1) (1) 0,58 (0) 0,50 (01) (0) (0) (0) (0) Balaka microcarpa (A) (1) (1) 0,55 (0) 0,72 (1) (0) (0) (0) (0) Balaka seemannii (A) (1) (1) Barcella odora (A) (1) (1) 1,50 (1) 0,32 (0) (2) (2) (1) (1) Basselinia velutina (A) (1) (1) 0,50 (0) 0,50 (0) (0) (0) (0) (0) Beccariophoenix madagascariensis (B) (1) (1) 1,30 (1) 1,50 (2) (0) (0) (0) (0) Bentinckia nicobarica (A) (1) (1) 0,53 (0) 0,38 (0) (0) (0) (0) (0) Bismarckia nobilis (3) (1) (2) 0,65 (0) 0,58 (1) (0) (0) (0) (0) Borassodendron machadonis (3) (1) (2) 0,96 (1) 1,83 (2) (0) (1) (0) (1) Borassus flabellifer (3) (1) (2) 1,71 (01) 3,00 (1) 0,42 (01) (2) (2) (1) (1) Brahea aculeata (0) (0) (0) 0,36 (0) (3) (3) (0) (0) Brassiophoenix schumannii (A) (1) (1) 0,80 (01) 0,60 (0) 0,80 (1) (0) (0) (0) (0) Burretiokentia hapala (A) (1) (1) 0,56 (0) 0,60 (0) 0,53 (0) (0) (0) (0) (0) Butia capitata (A) (1) (1) 0,65 (01) 0,35 (0) 0,65 (01) (0) (1) (0) (1) Calamus aruensis (3) (1) (2) 0,27 (0) 0,27 (0) 0,31 (0) (0) (0) (0) (0) Calyptrocalyx albertisianus (A) (1) (1) 1,00 (1) Calyptrogyne ghiesbreghtiana (A) (1) (1) 0,68 (0) 0,55 (0) (0) (0) (0) (0) Calyptronoma occidentalis (A) (1) (1) 0,56 (0) 0,69 (0) 0,72 (01) (0) (0) (0) (0) Carpentaria acuminata (D) (1) (1) 0,55 (0) 1,00 (1) (0) (1) (0) (1) Carpoxylon macrospermum (A) (1) (1) 0,32 (0) 0,27 (0) (0) (0) (0) (0) Caryota mitis (B) (1) (1) 0,45 (0) 0,83 (1) (0) (1) (0) (1) Ceratolobus concolor (3) (1) (2) 0,46 (0) 0,45 (0) 0,48 (0) (0) (0) (0) (0) Ceroxylon quindiuense (3) (1) (2) 0,58 (0) 0,55 (01) (0) (0) (0) (0) Chamaedorea seifrizii (3C) (1) (2) 0,26 (0) 0,23 (0) 0,30 (0) (0) (0) (0) (0) Chamaerops humilis (3) (1) (2) 0,46 (0) 0,50 (0) (0) (0) (0) (0) Chambeyronia macrocarpa (B) (1) (1) 1,05 (1) 1,20 (12) (0) (0) (0) (0) Chelyocarpus repens (0) (0) (0) 0,40 (0) (3) (3) (0) (0) Chelyocarpus ulei (0) (0) (0) 0,50 (0) (3) (3) (0) (0) Chuniophoenix hainanensis (0) (0) (0) 0,75 (1) (3) (3) (0) (0) Clinosperma bracteale (A) (1) (1) 0,27 (0) 0,13 (0) (2) (2) (1) (1) Clinostigma savoryanum (A) (1) (1) 0,41 (0) 0,40 (0) 0,43 (0) (0) (0) (0) (0) Coccothrinax argentata (0) (0) (0) 0,52 (0) (3) (3) (0) (0) Cocos nucifera (A) (1) (1) 2,33 (012) 4,00 (12) 1,08 (012) (2) (2) (1) (1) Colpothrinax wrightii (0) (0) (0) 0,58 (0) (3) (3) (0) (0) Copernicia prunifera (0) (0) (0) (3) (3) (0) (0) Copernicia yarey (0) (0) (0) 0,42 (0) (3) (3) (0) (0) Corypha utan (0) (0) (0) 0,13 (0) (3) (3) (0) (0) Cryosophila warscewiczii (0) (0) (0) 0,41 (0) (3) (3) (0) (0) Cyphokentia cerifera (A) (1) (1) 0,41 (0) 0,32 (0) (0) (0) (0) (0)

253

Cyphokentia macrostachya (A) (1) (1) 0,30 (0) 0,30 (0) (0) (0) (0) (0) Cyphophoenix nucele (A) (1) (1) 0,55 (0) 0,45 (0) (0) (0) (0) (0) Cyphosperma balansae (A) (1) (1) 0,43 (0) 0,35 (0) (0) (0) (0) (0) Cyrtostachys renda (A) (1) (1) 0,50 (0) 0,30 (0) (0) (2) (0) (1) Daemonorops grandis (C) (1) (2) 0,53 (0) Deckenia nobilis (A) (1) (1) 0,16 (0) 0,20 (0) (0) (0) (0) (0) Desmoncus orthacanthos (A) (1) (1) Dictyocaryum lamarckianum (A) (1) (1) 0,18 (0) 0,25 (0) 0,10 (0) (2) (2) (1) (1) Dictyosperma album (A) (1) (1) 0,52 (0) 0,62 (1) (0) (0) (0) (0) Dransfieldia micrantha (A) (1) (1) 0,48 (0) 0,30 (0) (0) (2) (0) (1) Drymophloeus litigiosus (A) (1) (1) 0,46 (0) 0,40 (0) 0,52 (01) (0) (0) (0) (0) Dypsis lastelliana (A) (1) (1) 0,28 (0) 0,27 (0) (0) (0) (0) (0) Elaeis oleifera (A) (1) (1) 1,63 (1) 0,53 (0) (2) (2) (1) (1) Eleiodoxa conferta (4) (1) (2) 0,61 (0) 0,64 (1) (0) (0) (0) (0) Eremospatha macrocarpa (0) (0) (0) 1,06 (1) (3) (3) (0) (0) Eugeissona tristis (0A) (01) (01) 6,60 (2) 5,30 (3) (3) (3) (0) (0) Euterpe oleracea (5) (1) (1) 0,38 (0) 0,36 (0) 0,41 (0) (0) (0) (0) (0) Gaussia maya (A) (1) (1) 0,27 (0) 0,20 (0) (0) (0) (0) (0) Geonoma interrupta (A) (1) (1) 0,33 (0) 0,68 (1) (1) (1) (1) (1) Guihaia argyrata (4) (1) (2) 0,15 (0) 0,15 (0) 0,20 (0) (0) (0) (0) (0) Hanguana malayana (C) (1) (2) 0,28 (0) 0,28 (0) (0) (0) (0) (0) Hedyscepe canterburyana (A) (1) (1) 0,69 (0) 0,99 (12) (0) (0) (0) (0) Hemithrinax ekmaniana (0) (0) (0) 0,30 (0) (3) (3) (0) (0) Heterospathe elata (D) (1) (1) Heterospathe elegans (A) (1) (1) 0,25 (0) 0,22 (0) 0,28 (0) (0) (0) (0) (0) Howea belmoreana (B) (1) (1) 1,00 (1) 1,20 (12) (0) (0) (0) (0) Hydriastele wendlandiana (B) (1) (1) 0,30 (0) 0,90 (1) (1) (1) (1) (1) Hyophorbe verschaffeltii (A) (1) (1) 0,25 (0) 0,26 (0) (0) (0) (0) (0) Hyospathe macrorhachis (AD) (1) (1) 0,28 (0) 0,20 (0) (0) (0) (0) (0) Hyphaene coriacea (3) (1) (2) 0,20 (0) 0,33 (0) 0,80 (1) (1) (1) (1) (1) Iguanura wallichiana (AD) (1) (1) 0,55 (0) 0,35 (0) (0) (2) (0) (1) Iriartea deltoidea (AD) (1) (1) 0,55 (0) 0,45 (0) 0,60 (01) (0) (0) (0) (0) Iriartella stenocarpa (B) (1) (1) 0,16 (0) 0,33 (0) (1) (1) (1) (1) Itaya amicorum (0) (0) (0) 0,58 (0) (3) (3) (0) (0) Johannesteijsmannia altifrons (0) (0) (0) 0,50 (0) (3) (3) (0) (0) Juania australis (3) (1) (2) 0,45 (0) 0,58 (1) (0) (0) (0) (0) Jubaea chilensis (A) (1) (1) 0,80 (0) 1,60 (2) (1) (1) (1) (1) Jubaeopsis caffra (A) (1) (1) 1,10 (1) 1,20 (2) (0) (0) (0) (0) Kentiopsis oliviformis (A) (1) (1) 0,63 (0) 0,63 (0) 0,60 (01) (0) (0) (0) (0) Kerriodoxa elegans (4) (1) (2) 0,57 (0) 0,28 (0) (2) (2) (1) (1) Kingia australis (0) (0) (0) 0,31 (0) (3) (3) (0) (0) Korthalsia cheb (0) (0) (0) (3) (3) (0) (0) Korthalsia zippelii (0) (0) (0) 0,40 (0) (3) (3) (0) (0) Laccospadix australasicus (A) (1) (1) 0,48 (0) 0,68 (01) (0) (0) (0) (0) Laccosperma acutiflorum (0) (0) (0) (3) (3) (0) (0) Latania verschaffeltii (3) (1) (2) 1,50 (1) 1,02 (12) (0) (0) (0) (0) Lemurophoenix halleuxii (A) (1) (1) 1,40 (1) 0,35 (0) 0,80 (1) (1) (1) (1) (1) Leopoldinia pulchra (A) (1) (1) 0,10 (0) 0,10 (0) (0) (0) (0) (0) Lepidocaryum tenue (3) (1) (2) 0,80 (0) 0,90 (1) (0) (0) (0) (0) Lepidorrhachis mooreana (A) (1) (1) 0,51 (0) 0,39 (01) (0) (0) (0) (0) Leucothrinax morrisii (0) (0) (0) 0,40 (0) (3) (3) (0) (0) Licuala grandis (0) (0) (0) 0,50 (0) (3) (3) (0) (0) Linospadix monostachyos (B) (1) (1) 0,55 (0) 0,95 (12) (0) (1) (0) (1) Livistona speciosa (0) (0) (0) 0,32 (0) (3) (3) (0) (0) Lodoicea maldivica (3) (1) (2) 5,40 (2) 2,16 (2) (2) (2) (1) (1) Loxococcus rupicola (A) (1) (1) 0,38 (0) 0,76 (1) (1) (1) (1) (1) Lytocaryum hoehnei (A) (1) (1) 0,75 (0) 0,65 (1) (0) (0) (0) (0) Manicaria saccifera (B) (1) (1) 0,93 (1) 0,68 (1) (0) (0) (0) (0) Marojejya darianii (A) (1) (1) 0,35 (0) 0,73 (0) 0,35 (0) (2) (2) (1) (1)

254

Marojejya insignis (A) (1) (1) 0,43 (0) 0,58 (1) (0) (0) (0) (0) Masoala madagascariensis (A) (1) (1) 0,58 (0) 0,33 (0) (0) (2) (0) (1) Mauritia flexuosa (3) (1) (2) 0,80 (0) Mauritiella armata (3) (1) (2) 1,10 (1) 0,46 (0) (2) (2) (1) (1) Maxburretia rupicola (0) (0) (0) 0,33 (0) (3) (3) (0) (0) Medemia argun (C) (1) (2) 0,69 (1) Metroxylon salomonense (0A) (01) (01) (3) (3) (0) (0) Musa acuminata (A) (1) (1) 3,75 (2) Myrialepis paradoxa (3) (1) (2) 0,40 (0) 0,28 (0) (0) (0) (0) (0) Nannorrhops ritchiana (0) (0) (0) 0,55 (0) (3) (3) (0) (0) Nenga gajah (BD) (1) (1) 0,70 (0) 0,48 (0) (0) (0) (0) (0) Nenga pumila (BD) (1) (1) Neonicholsonia watsonii (5) (1) (1) 0,60 (0) 0,72 (1) (0) (0) (0) (0) Neoveitchia storckii (A) (1) (1) 0,86 (0) 0,40 (0) (2) (2) (1) (1) Nephrosperma van-houtteanum (A) (1) (1) 0,50 (0) 0,60 (1) (0) (0) (0) (0) Normanbya normanbyi (A) (1) (1) 1,35 (1) 1,50 (2) (0) (0) (0) (0) Nypa fruticans (D) (1) (1) 1,18 (1) 0,50 (0) (2) (2) (1) (1) Oenocarpus bataua (5) (1) (1) 0,50 (0) 0,60 (01) (0) (0) (0) (0) Oncocalamus macrospathus (A) (1) (1) 0,43 (0) 0,51 (0) (0) (0) (0) (0) Oncocalamus mannii (D) (1) (1) 0,55 (0) Oncosperma tigillarium (A) (1) (1) 0,38 (0) 0,68 (1) (0) (1) (0) (1) Orania trispatha (B) (1) (1) 0,25 (0) 0,90 (1) (1) (1) (1) (1) Oraniopsis appendiculata (3) (1) (2) 0,72 (0) 0,76 (1) (0) (0) (0) (0) Parajubaea torallyi (A) (1) (1) 1,03 (01) 1,10 (12) (0) (0) (0) (0) Pelagodoxa henryana (A) (1) (1) 0,52 (0) 0,32 (0) (0) (2) (0) (1) Phoenicophorium borsigianum (B) (1) (1) 0,37 (0) 0,34 (0) (0) (0) (0) (0) Phoenix dactylifera (C) (1) (2) 0,45 (0) 0,85 (1) (0) (1) (0) (1) Pholidocarpus macrocarpus (0) (0) (0) (3) (3) (0) (0) Pholidocarpus sumatranus (0) (0) (0) 0,60 (0) (3) (3) (0) (0) Pholidostachys pulchra (A) (1) (1) 0,66 (0) 0,72 (1) (0) (0) (0) (0) Physokentia petiolata (A) (1) (1) 0,48 (0) 0,50 (0) (0) (0) (0) (0) Phytelephas aequatorialis (4) (1) (2) 17,50 (23) 1,00 (1) (2) (2) (1) (1) Pigafetta elata (3) (1) (2) 0,42 (0) 0,31 (0) (0) (0) (0) (0) Pinanga coronata (D) (1) (1) 0,50 (0) 0,70 (1) (0) (0) (0) (0) Plectocomia mulleri (C) (1) (2) 2,46 (1) 0,49 (0) (2) (2) (1) (1) Plectocomiopsis geminiflora (3C) (1) (2) 0,73 (0) 0,63 (1) (0) (0) (0) (0) Podococcus barteri (5) (1) (1) 0,47 (0) 0,33 (0) (0) (0) (0) (0) Pogonotium ursinum (3) (1) (2) 0,60 (0) 0,37 (0) (0) (2) (0) (1) Ponapea ledermanniana (A) (1) (1) 0,58 (0) 1,00 (1) (0) (1) (0) (1) Prestoea pubens (A) (1) (1) 0,26 (0) 0,20 (0) 0,26 (0) (0) (0) (0) (0) Pritchardia thurstonii (0) (0) (0) 0,82 (1) (3) (3) (0) (0) Pseudophoenix vinifera (0) (0) (0) 0,25 (0) (3) (3) (0) (0) Ptychococcus paradoxus (A) (1) (1) 0,76 (0) 1,40 (12) (0) (1) (0) (1) Ptychosperma burretianum (A) (1) (1) 0,35 (0) 0,65 (1) (0) (1) (0) (1) Ptychosperma elegans (AD) (1) (1) 0,43 (0) 0,53 (01) (0) (0) (0) (0) Raphia farinifera (D) (1) (1) 0,80 (0) 1,13 (1) (0) (0) (0) (0) Ravenea hildebrandtii (3) (1) (2) 0,26 (0) 0,40 (0) (0) (1) (0) (1) Reinhardtia simplex (B) (1) (1) 0,51 (0) 0,34 (0) (0) (2) (0) (1) Retispatha dumetosa (3) (1) (2) 1,40 (1) 0,26 (0) (2) (2) (1) (1) Rhapidophyllum hystrix (3) (1) (2) 0,36 (0) 0,38 (0) (0) (0) (0) (0) Rhapis excelsa (3) (1) (2) 0,44 (0) 0,38 (0) 0,54 (0) (0) (0) (0) (0) Rhopaloblaste augusta (A) (1) (1) 0,41 (0) 0,64 (1) (0) (1) (0) (1) Rhopalostylis baueri (A) (1) (1) 0,61 (0) 0,64 (01) (0) (0) (0) (0) Roscheria melanochaetes (A) (1) (1) 0,19 (0) 0,14 (0) (0) (0) (0) (0) Roystonea oleracea (A) (1) (1) 0,30 (0) 0,39 (0) (0) (0) (0) (0) Sabal palmetto (0) (0) (0) 0,60 (0) (3) (3) (0) (0) Salacca ramosiana (C) (1) (2) 0,90 (1) 0,58 (01) (0) (2) (0) (1) Saribus jeanneneyi (0) (0) (0) 0,47 (0) (3) (3) (0) (0) Satakentia liukiuensis (A) (1) (1) 0,60 (0) 0,53 (0) (0) (0) (0) (0)

255

Satranala decussilvae (C) (1) (2) 0,76 (0) Schippia concolor (0B) (01) (01) 0,46 (0) 0,46 (0) 0,43 (0) (0) (0) (0) (0) Sclerosperma mannii (D) (1) (1) 0,70 (1) Serenoa repens (0) (0) (0) 0,56 (0) (3) (3) (0) (0) Socratea exorrhiza (5D) (1) (1) 0,60 (0) 1,05 (12) (0) (1) (0) (1) Solfia samoensis (A) (1) (1) 0,45 (0) 0,75 (1) (0) (1) (0) (1) Sommieria leucophylla (A) (1) (1) 0,28 (0) 0,28 (0) 0,20 (0) (0) (0) (0) (0) Syagrus schizophylla (A) (1) (1) 0,83 (0) 0,54 (0) (0) (2) (0) (1) Synechanthus warscewiczianus (B) (1) (1) 0,16 (0) 0,10 (0) (0) (2) (0) (1) Tahina spectabilis (0) (0) (0) 0,92 (1) (3) (3) (0) (0) Tectiphiala ferox (A) (1) (1) 0,60 (0) 0,75 (1) (0) (0) (0) (0) Thrinax radiata (0) (0) (0) (3) (3) (0) (0) Trachycarpus geminisectus (3) (1) (2) 0,28 (0) 0,25 (0) 0,30 (0) (0) (0) (0) (0) Tradescantia ohiensis (0) (0) (0) 1,40 (1) (3) (3) (0) (0) Trithrinax brasiliensis (0) (0) (0) 0,58 (0) (3) (3) (0) (0) Typha latifolia (D) (1) (1) Veitchia arecina (A) (1) (1) 1,02 (01) 1,53 (2) (0) (1) (0) (1) Verschaffeltia splendida (A) (1) (1) 0,35 (0) 0,33 (0) (0) (0) (0) (0) Voanioala gerardii (B) (1) (1) 1,10 (1) 1,20 (1) 1,10 (12) (0) (0) (0) (0) Wallichia disticha (D) (1) (1) 0,60 (01) 0,24 (0) 0,88 (01) (1) (1) (1) (1) Washingtonia robusta (0) (0) (0) 0,88 (1) (3) (3) (0) (0) Welfia regia (A) (1) (1) 1,90 (1) 2,20 (2) (0) (0) (0) (0) Wendlandiella gracilis (3) (1) (2) 0,20 (0) 0,12 (0) (0) (2) (0) (1) Wettinia panamensis (D) (1) (1) 0,90 (01) 0,75 (1) (0) (0) (0) (0) Wodyetia bifurcata (A) (1) (1) 0,50 (0) 1,00 (1) (1) (1) (1) (1) Zombia antillarum (0) (0) (0) 0,50 (0) (3) (3) (0) (0)

Taxon 6026 6027 301 301b 301c 6035 6035a 6036 6036a 6037 6038 6039b Acanthophoenix rubra 13 (2) (1) 5,0 (1) 1 (0) (0) (2) Acoelorrhaphe wrightii 6 (1) (0) 1,4 (0) 3 (1) (3) Acrocomia aculeata 6 (1) (0) 3 (1) (0) (1) Actinokentia divaricata 4,8 26 (23) (1) 8,3 (1) 1 (0) 1 (0) (0) Actinorhytis calapparia 4,5 29 (3) (1) 8,3 (1) 1 (0) (0) (0) Adonidia merrillii 9,6 48 (3) (1) 10,0 (1) 1 (0) (0) (1) Aiphanes horrida 3,7 6 (1) (0) 2,8 (0) 3 (1) (0) (1) Allagoptera arenaria 15 (2) (1) 3,5 (0) 3 (1) (0) (1) Ammandra decasperma 811 (45) (1) 126,0 (3) 8 (2) (0) (3) Anigozanthos flavidus 6 (1) (0) (3) Aphandra natalia 525 (45) (1) 27,5 (12) 7 (2) (0) (3) Archontophoenix alexandrae 6,0 15 (2) (1) 4,5 (0) 1 (0) (0) (0) Areca catechu 9 (12) (01) 10,0 (1) 1 (0) 1 (0) Arenga pinnata 80 (3) (1) 5,5 (01) 3 (1) (0) (0) Asterogyne martiana 6 (1) (0) 9,5 (1) 3 (1) 1 (0) (1) Astrocaryum gynacanthum 6 (1) (0) 1,0 (0) 3 (1) (0) (1) Attalea allenii 6 (1) (0) 20,0 (1) 3 (1) (0) Bactris gasipaes 6 (1) (0) 3 (1) (0) (1) Balaka microcarpa 30 (3) (1) 4,8 (1) 1 (0) (0) (1) Balaka seemannii 25 (23) (1) 1 (0) (0) Barcella odora 6 (1) (0) 13,3 (1) 3 (1) (0) (1) Basselinia velutina 5,0 5,0 6 (1) (0) 1 (0) 1 (0) (0) Beccariophoenix madagascariensis 20 (2) (1) 10,6 (1) 3 (1) (0) Bentinckia nicobarica 6 (1) (0) 3,5 (0) 1 (0) (0) (01) Bismarckia nobilis 6 (1) (0) 4,2 (0) 3 (1) 1 (0) (1) Borassodendron machadonis 10 (2) (1) 6,6 (1) 3 (1) (0) (2) Borassus flabellifer 6 (1) (0) 30,0 (2) 3 (1) (0) (1) Brahea aculeata 6 (1) (0) 1,3 (0) 3 (1) (3) Brassiophoenix schumannii 165 (4) (1) 1 (0) 1 (0) (0) Burretiokentia hapala 6 (1) (0) 1 (0) 1 (0) (0) Butia capitata 6 (1) (0) 9,3 (1) 3 (1) (0)

256

Calamus aruensis 6 (1) (0) 2,4 (0) 3 (1) (0) (1) Calyptrocalyx albertisianus 41 (23) (1) 1 (0) (0) (2) Calyptrogyne ghiesbreghtiana 6 (1) (0) 5,8 (1) 3 (1) (0) (1) Calyptronoma occidentalis 6 (1) (0) 6,7 (1) 3 (1) (0) (1) Carpentaria acuminata 7,8 36 (3) (1) 7,0 (1) 1 (0) (0) (0) Carpoxylon macrospermum 6 (1) (0) 2,0 (0) 1 (0) 1 (0) (0) Caryota mitis 18 (23) (1) 2,0 (0) 2 (01) (0) (0) Ceratolobus concolor 6 (1) (0) 3,5 (0) 3 (1) (0) (1) Ceroxylon quindiuense 13 (2) (1) 2,5 (0) 3 (1) 1 (0) (2) Chamaedorea seifrizii 3,2 6 (1) (0) 2,0 (0) 3 (1) (0) (1) Chamaerops humilis 6 (1) (0) 2,5 (0) 3 (1) (0) (1) Chambeyronia macrocarpa 11,0 46 (3) (1) 11,6 (1) 1 (0) (0) (0) Chelyocarpus repens 6 (012) (01) 1,5 (0) 4 (012) (3) Chelyocarpus ulei 8 (2) (1) 1,6 (0) (3) Chuniophoenix hainanensis 6 (1) (0) 4,3 (0) 3 (1) (3) Clinosperma bracteale 6 (1) (0) 2,3 (0) 1 (0) (0) (0) Clinostigma savoryanum 6 (1) (0) 3,0 (0) 1 (0) 1 (0) Coccothrinax argentata 9 (2) (1) 4,2 (0) 1 (0) (3) Cocos nucifera 9,0 6 (1) (0) 27,0 (2) 3 (1) (0) Colpothrinax wrightii 6 (1) (0) 4,2 (01) (3) Copernicia prunifera 6 (1) (0) 3 (1) 1 (3) Copernicia yarey 6 (1) (0) 1,8 (0) 3 (1) 1 (3) Corypha utan 6 (1) (0) 2,9 (0) 3 (1) (3) Cryosophila warscewiczii 6 (1) (0) 3,2 (0) 3 (1) 1 (3) Cyphokentia cerifera 6 (1) (0) 3,5 (0) 1 (0) (0) (0) Cyphokentia macrostachya 12 (2) (1) 1 (0) (0) (01) Cyphophoenix nucele 6 (1) (0) 1 (0) (0) (0) Cyphosperma balansae 6 (1) (0) 4,4 (0) 1 (0) (0) (0) Cyrtostachys renda 14 (2) (1) 4,3 (0) 1 (0) 1 (0) Daemonorops grandis 6 (1) (0) Deckenia nobilis 8 (12) (01) 2,0 (0) 1 (0) (0) (1) Desmoncus orthacanthos 8 (12) (01) 3 (1) (0) (1) Dictyocaryum lamarckianum 6 (1) (0) 3 (1) 1 (0) (1) Dictyosperma album 6,5 6 (1) (0) 4,3 (0) 1 (0) (0) (0) Dransfieldia micrantha 17 (2) (1) 3,0 (0) 1 (0) 1 (0) (0) Drymophloeus litigiosus 28 (3) (1) 2,9 (0) 1 (0) 1 (0) (0) Dypsis lastelliana 6 (1) (0) 2,5 (0) 1 (0) (0) (01) Elaeis oleifera 6 (1) (0) 15,3 (1) 3 (1) (0) (1) Eleiodoxa conferta 6 (1) (0) 5,0 (1) 3 (1) (0) (1) Eremospatha macrocarpa 6 (1) (0) 5,1 (1) 3 (1) (3) Eugeissona tristis 33 (3) (1) 31,3 (2) 3 (1) (3) Euterpe oleracea 6 (1) (0) 3,5 (0) 1 (0) 1 (1) Gaussia maya 6 (1) (0) 1,4 (0) 3 (1) (0) (1) Geonoma interrupta 6 (1) (0) 3,3 (0) 1 (0) (0) (1) Guihaia argyrata 6 (1) (0) 0,6 (0) 3 (1) (0) (1) Hanguana malayana 6 (1) (0) 2 (01) (0) Hedyscepe canterburyana 11 (2) (1) 6,2 (1) 1 (0) (0) (0) Hemithrinax ekmaniana 6 (1) (0) 2,4 (0) 1 (0) (3) Heterospathe elata 1 (0) (0) (0) Heterospathe elegans 6 (1) (0) 1,5 (0) 1 (0) 1 (0) (0) Howea belmoreana 9,3 48 (3) (1) 1 (0) (0) (01) Hydriastele wendlandiana 15 (123) (01) 1 (0) (0) (01) Hyophorbe verschaffeltii 6 (1) (0) 1,4 (0) 3 (1) (0) (1) Hyospathe macrorhachis 2,5 6 (1) (0) 2,8 (0) 1 (0) (0) (1) Hyphaene coriacea 3,7 6 (1) (0) 3,4 (0) 3 (1) 1 (0) (1) Iguanura wallichiana 5,5 6 (1) (0) 4,6 (0) 1 (0) (0) (1) Iriartea deltoidea 6,5 15 (2) (1) 4,3 (0) 3 (1) 1 (0) (2) Iriartella stenocarpa 6 (1) (0) 3 (1) 1 (0) (1) Itaya amicorum 21 (23) (1) 4,5 (0) 1 (0) (3)

257

Johannesteijsmannia altifrons 6 (1) (0) 1,7 (0) 3 (1) (3) Juania australis 6 (1) (0) 2,6 (0) 3 (1) 1 (0) (1) Jubaea chilensis 18 (2) (1) 6,5 (1) 3 (1) (0) Jubaeopsis caffra 12 (2) (1) 9,6 (1) 3 (1) (0) Kentiopsis oliviformis 6,0 36 (3) (1) 4,8 (1) 1 (0) 1 (0) (0) Kerriodoxa elegans 6 (1) (0) 3,3 (0) 3 (1) (0) (1) Kingia australis 6 (1) (0) 3 (1) (3) Korthalsia cheb 3 (1) (3) Korthalsia zippelii 3,3 (0) 3 (1) (3) Laccospadix australasicus 11 (2) (1) 4,1 (0) 1 (0) (0) (01) Laccosperma acutiflorum 6 (1) (0) 6,3 (1) 3 (1) (3) Latania verschaffeltii 25 (3) (1) 9,0 (1) 3 (1) (0) Lemurophoenix halleuxii 56 (3) (1) 2,5 (0) 1 (0) (0) (2) Leopoldinia pulchra 6 (1) (0) 0,6 (0) 3 (1) (0) (1) Lepidocaryum tenue 6 (1) (0) 3,6 (0) 3 (1) (0) (1) Lepidorrhachis mooreana 6 (1) (0) 3,5 (0) 1 (0) (0) (0) Leucothrinax morrisii 6 (1) (0) 2,4 (0) 1 (0) (3) Licuala grandis 6 (1) (0) 2,8 (0) 3 (1) (3) Linospadix monostachyos 10 (2) (1) 4,0 (0) 1 (0) (0) (01) Livistona speciosa 6 (1) (0) 3 (1) (3) Lodoicea maldivica 20 (2) (1) 38,0 (2) 3 (1) (0) (2) Loxococcus rupicola 12 (2) (1) 2,4 (0) 1 (0) (0) (2) Lytocaryum hoehnei 6 (1) (0) 6,8 (1) 3 (1) (0) (1) Manicaria saccifera 33 (3) (1) 6,6 (1) 3 (1) (0) (2) Marojejya darianii 6 (1) (0) 1 (0) 1 (0) (1) Marojejya insignis 6 (1) (0) 4,3 (0) 1 (0) (0) (1) Masoala madagascariensis 6 (1) (0) 14,5 (1) 1 (0) (0) (1) Mauritia flexuosa 6 (1) (0) 4,0 (0) 3 (1) (0) (1) Mauritiella armata 6 (1) (0) 8,6 (1) 3 (1) (0) (1) Maxburretia rupicola 6 (1) (0) 2,1 (0) 3 (1) (3) Medemia argun 6 (1) (0) Metroxylon salomonense 6 (1) (0) 3 (1) (3) Musa acuminata 5 (0) (0) (0) Myrialepis paradoxa 6 (1) (0) 2,4 (0) 3 (1) (0) (1) Nannorrhops ritchiana 6 (1) (0) 2,8 (0) 3 (1) (3) Nenga gajah 6 (1) (0) 1 (0) 1 (0) (1) Nenga pumila 8,0 6 (1) (0) 9,0 (1) 1 (0) (0) Neonicholsonia watsonii 6 (1) (0) 6,1 (1) 1 (0) (1) Neoveitchia storckii 6 (1) (0) 7,6 (1) 1 (0) (0) (0) Nephrosperma van-houtteanum 45 (3) (1) 4,3 (0) 1 (0) (0) (1) Normanbya normanbyi 32 (3) (1) 10,0 (1) 1 (0) (0) (0) Nypa fruticans 3 (0) (0) 7,1 (1) 3 (1) (1) Oenocarpus bataua 11 (2) (1) 1 (0) (1) Oncocalamus macrospathus 6 (1) (0) 3,5 (0) 3 (1) (0) (2) Oncocalamus mannii 5,5 6 (1) (0) 3 (1) Oncosperma tigillarium 6 (1) (0) 3,2 (0) 1 (0) (0) (1) Orania trispatha 29 (3) (1) 5,0 (1) 3 (1) (0) (2) Oraniopsis appendiculata 6 (1) (0) 2,8 (0) 3 (1) (0) (1) Parajubaea torallyi 14 (2) (1) 9,0 (1) 3 (1) (0) (0) Pelagodoxa henryana 6 (1) (0) 5,0 (1) 2 (01) (0) (01) Phoenicophorium borsigianum 4,2 17 (2) (1) 2,8 (0) 1 (0) (0) (1) Phoenix dactylifera 6 (1) (0) 3 (1) (0) (1) Pholidocarpus macrocarpus 6 (1) (0) 3 (1) 1 (3) Pholidocarpus sumatranus 6 (1) (0) 5,0 (1) 3 (1) (3) Pholidostachys pulchra 6 (1) (0) 6,1 (1) 3 (1) (0) (12) Physokentia petiolata 6 (1) (0) 4,0 (0) 1 (0) (0) (0) Phytelephas aequatorialis 600 (45) (1) 12,5 (1) 6 (2) (0) (23) Pigafetta elata 6 (1) (0) 3,7 (0) 3 (1) (0) (1) Pinanga coronata 7,7 20 (23) (1) 3,8 (0) 1 (0) (1)

258

Plectocomia mulleri 6 (1) (0) 18,6 (1) 3 (1) (0) (1) Plectocomiopsis geminiflora 6,0 6 (1) (0) 5,6 (1) 3 (1) (0) (1) Podococcus barteri 6 (1) (0) 3,0 (0) 2 (01) (1) Pogonotium ursinum 6 (1) (0) 5,5 (1) 3 (1) (0) (1) Ponapea ledermanniana 9,2 115 (34) (1) 4,0 (0) 1 (0) (0) (0) Prestoea pubens 6 (1) (0) 1 (0) 1 (0) (1) Pritchardia thurstonii 6 (1) (0) 4,0 (0) 3 (1) (3) Pseudophoenix vinifera 6 (1) (0) 5,3 (01) 3 (1) (3) Ptychococcus paradoxus 157 (34) (1) 4,4 (01) 1 (0) (0) (0) Ptychosperma burretianum 33 (3) (1) 3 (1) 1 (0) (01) Ptychosperma elegans 4,3 23 (23) (1) 1 (0) (0) (1) Raphia farinifera 6 (1) (0) 5,5 (1) 3 (1) 1 (1) Ravenea hildebrandtii 6 (1) (0) 3,0 (0) 3 (1) 3 (0) (1) Reinhardtia simplex 20 (2) (1) 4,6 (0) 3 (1) (0) (2) Retispatha dumetosa 6 (1) (0) 10,2 (1) 3 (1) (0) (1) Rhapidophyllum hystrix 6 (1) (0) 3,2 (0) 3 (1) (0) (1) Rhapis excelsa 6,2 6 (1) (0) 1,2 (0) 3 (1) (0) (1) Rhopaloblaste augusta 6 (1) (0) 3,0 (0) 1 (0) (0) (0) Rhopalostylis baueri 7,5 6 (1) (0) 6,7 (1) 1 (0) (0) (01) Roscheria melanochaetes 1,3 6 (1) (0) 1,8 (0) 1 (0) (0) (1) Roystonea oleracea 7 (12) (01) 2,4 (0) 3 (1) 1 (0) (1) Sabal palmetto 6 (1) (0) 4,3 (0) 3 (1) (3) Salacca ramosiana 6 (1) (0) 7,0 (1) 3 (1) (0) (1) Saribus jeanneneyi 6 (1) (0) 1,8 (0) 3 (1) (3) Satakentia liukiuensis 6 (1) (0) 6,0 (1) 1 (0) (0) (0) Satranala decussilvae 5,0 (1) Schippia concolor 6 (1) (0) 2,3 (0) 1 (0) (0) (1) Sclerosperma mannii 60 (3) (1) 1 (0) 1 Serenoa repens 6 (1) (0) 5,0 (1) 3 (1) (3) Socratea exorrhiza 12,5 38 (3) (1) 7,0 (1) 3 (1) (1) Solfia samoensis 6,8 36 (3) (1) 2,3 (0) 1 (0) (0) (0) Sommieria leucophylla 2,0 6 (1) (0) 1 (0) 1 (0) Syagrus schizophylla 6 (1) (0) 5,8 (1) 3 (1) (0) (1) Synechanthus warscewiczianus 6 (0) (0) 2,2 (0) 3 (1) 3 (0) (1) Tahina spectabilis 6 (1) (0) 3,0 (0) 3 (1) (3) Tectiphiala ferox 7 (12) (01) 6,4 (1) 1 (0) (0) (12) Thrinax radiata 7 (12) (01) 1 (0) (3) Trachycarpus geminisectus 6 (1) (0) 3 (1) (0) (1) Tradescantia ohiensis 6 (1) (0) 6 (2) (3) Trithrinax brasiliensis 6 (1) (0) 1,6 (0) 3 (1) (3) Typha latifolia 2 (0) (0) 7,9 (1) 1 (0) (1) Veitchia arecina 106 (34) (1) 6,7 (01) 1 (0) (0) (0) Verschaffeltia splendida 6 (1) (0) 2,5 (0) 1 (0) (0) (1) Voanioala gerardii 13 (2) (1) 4,0 (0) 3 (1) (0) (2) Wallichia disticha 12 (2) (1) 2,4 (0) 3 (1) (1) Washingtonia robusta 6 (1) (0) 7,5 (1) 3 (1) (3) Welfia regia 35 (3) (1) 16,0 (1) 3 (1) (0) (2) Wendlandiella gracilis 6 (1) (0) 2,0 (0) 3 (1) (0) (0) Wettinia panamensis 10 (2) (1) 9,0 (1) Wodyetia bifurcata 66 (3) (1) 2,7 (0) 1 (0) 1 (0) (1) Zombia antillarum 11 (2) (1) 5,0 (1) 1 (0) (3)

Taxon 6040 6040a 6095 6131 6041 6041b 6043 6043a 6048 6049 6049a Acanthophoenix rubra 0,6 (1) (1) (2) 5,30 (1) 3,50 (1) (0) 0,6 (1) Acoelorrhaphe wrightii 0,0 (0) (4) 1,00 (0) 0,40 (0) (3) 0,0 (0) Acrocomia aculeata (12) (0) (0) Actinokentia divaricata 1,0 (1) (0) (2) 3,00 (0) 1,50 (0) (0) 3,3 (2) Actinorhytis calapparia 1,3 (1) (0) (2) 2,20 (0) 1,90 (0) (0) 2,5 (2) Adonidia merrillii 4,0 (2) (3) (1) 6,50 (1) 3,50 (1) (0) 3,7 (23)

259

Aiphanes horrida 3,0 (12) (1) (1) 3,70 (01) 1,85 (01) (01) 0,8 (1) Allagoptera arenaria 1,5 (1) (1) (2) 2,50 (0) 2,80 (1) (0) 1,2 (1) Ammandra decasperma 1,6 (1) (2) (0) 13,30 (0123) 1,10 (0) (02) 2,0 (2) Anigozanthos flavidus 0,0 (0) (4) 3,00 (01) (3) 0,0 (0) Aphandra natalia 10,5 (23) (2) (0) 6,00 (1) 3,25 (1) (1) 0,0 (0) Archontophoenix alexandrae 0,6 (1) (0) (2) 4,30 (0) 3,78 (1) (0) 4,0 (3) Areca catechu (1) (2) 2,50 (0) 1,50 (0) (0) 3,0 (2) Arenga pinnata 7,5 (2) (2) (0) 15,50 (2) 11,50 (2) (1) 0,0 (0) Asterogyne martiana 4,5 (12) (23) (1) 9,80 (2) 0,90 (0) (0) 3,5 (23) Astrocaryum gynacanthum 1,0 (1) (1) (2) 2,65 (0) 1,75 (0) (0) Attalea allenii 7,0 (2) (1) (1) 6,00 (2) Bactris gasipaes (3) (2) (1) 0,0 (0) Balaka microcarpa 0,5 (1) (3) (2) 3,60 (0) 3,30 (1) (0) 5,3 (3) Balaka seemannii Barcella odora 2,0 (1) (1) (2) 1,80 (0) 1,40 (0) (0) 0,6 (1) Basselinia velutina (0) (1) 2,50 (0) (0) 2,5 (2) Beccariophoenix madagascariensis 1,0 (1) (1) (2) 10,75 (2) 9,00 (2) (1) 0,0 (0) Bentinckia nicobarica 0,6 (1) (3) (2) 2,10 (0) 1,00 (0) (0) 2,3 (2) Bismarckia nobilis 1,6 (1) (12) (0) 2,50 (0) 2,00 (0) (0) 1,0 (1) Borassodendron machadonis 1,3 (1) (1) (2) 18,00 (2) 5,83 (2) (0) 0,3 (1) Borassus flabellifer 6,0 (2) (3) (2) 2,50 (0) 0,50 (0) (0) Brahea aculeata 0,0 (0) (4) 2,60 (0) 0,50 (0) (3) 0,0 (0) Brassiophoenix schumannii (1) (2) (0) Burretiokentia hapala (0) (2) 2,50 (0) (0) Butia capitata 1,0 (1) (1) (2) 5,00 (1) 4,20 (1) (0) 1,6 (1) Calamus aruensis 1,2 (1) (2) (0) 1,90 (0) 1,40 (0) (0) 0,2 (1) Calyptrocalyx albertisianus 1,0 (1) (3) (2) 9,50 (12) 2,50 (01) (0) 1,0 (1) Calyptrogyne ghiesbreghtiana 6,6 (2) (12) (1) 5,50 (1) 2,00 (0) (0) 0,6 (1) Calyptronoma occidentalis 8,0 (2) (12) (1) 9,00 (2) 2,20 (0) (0) 0,3 (1) Carpentaria acuminata 1,0 (1) (3) (2) 6,50 (1) 3,50 (1) (0) 7,5 (34) Carpoxylon macrospermum 0,5 (1) (1) (2) 3,50 (0) 2,00 (0) (0) 2,0 (2) Caryota mitis 1,5 (1) (3) (2) 4,25 (01) 3,25 (01) (1) 0,0 (0) Ceratolobus concolor 1,5 (1) (2) (0) 2,50 (0) (0) Ceroxylon quindiuense 4,2 (2) (2) (0) 4,95 (01) 2,20 (0) (0) 0,6 (1) Chamaedorea seifrizii (3) (2) 2,00 (0) 1,33 (0) (0) 3,0 (2) Chamaerops humilis 3,2 (1) (2) (0) 3,30 (0) 2,20 (0) (0) 0,3 (1) Chambeyronia macrocarpa 1,0 (1) (0) (2) 3,00 (0) 4,00 (1) (1) 0,0 (0) Chelyocarpus repens 0,0 (0) (4) (3) 0,0 (0) Chelyocarpus ulei 0,0 (0) (4) 3,30 (0) 2,10 (0) (3) 0,0 (0) Chuniophoenix hainanensis 0,0 (0) (4) 4,20 (0) 1,30 (0) (3) 0,0 (0) Clinosperma bracteale 0,3 (1) (0) (2) 0,70 (0) 0,50 (0) (0) 0,6 (1) Clinostigma savoryanum (3) (1) 2,90 (0) 1,60 (0) (0) 1,2 (1) Coccothrinax argentata 0,0 (0) (4) 2,60 (0) 2,40 (0) (3) 0,0 (0) Cocos nucifera 4,6 (2) (1) (2) 12,00 (2) 5,03 (12) (0) 3,1 (123) Colpothrinax wrightii 0,0 (0) (4) 6,90 (12) 3,05 (01) (3) 0,0 (0) Copernicia prunifera 0,0 (0) (4) (3) 0,0 (0) Copernicia yarey 0,0 (0) (4) 2,00 (0) 0,60 (0) (3) 0,0 (0) Corypha utan 0,0 (0) (4) 2,90 (0) 1,00 (0) (3) 0,0 (0) Cryosophila warscewiczii 0,0 (0) (4) 5,10 (01) 1,80 (0) (3) 0,0 (0) Cyphokentia cerifera 0,5 (1) (0) (2) 2,25 (0) 2,00 (0) (0) 2,1 (2) Cyphokentia macrostachya (0) Cyphophoenix nucele 1,0 (1) (0) (2) (0) Cyphosperma balansae 1,0 (1) (0) (2) 1,90 (0) 1,60 (0) (0) 2,0 (2) Cyrtostachys renda 0,8 (1) (1) (2) 1,55 (0) 1,20 (0) (0) 0,9 (1) Daemonorops grandis 3,20 (0) 2,08 (0) (1) 0,0 (0) Deckenia nobilis 0,2 (1) (1) (2) 1,10 (0) 0,80 (0) (0) 2,0 (2) Desmoncus orthacanthos (3) (2) (0) Dictyocaryum lamarckianum 0,5 (1) (3) (2) 7,00 (1) 5,50 (2) (0) Dictyosperma album 0,6 (1) (0) (2) 4,60 (0) 3,93 (12) (0) 3,8 (23)

260

Dransfieldia micrantha 0,4 (1) 3,45 (0) 1,15 (0) (0) 0,5 (1) Drymophloeus litigiosus 1,0 (1) (1) (2) 3,55 (0) 1,80 (0) (0) 2,7 (123) Dypsis lastelliana 0,6 (1) (0) (2) 2,00 (0) 1,45 (0) (0) 2,2 (2) Elaeis oleifera 1,6 (1) (1) (2) 4,20 (0) 2,00 (0) (0) 2,0 (2) Eleiodoxa conferta 2,3 (1) (2) (0) 3,25 (0) 2,55 (01) (1) 0,0 (0) Eremospatha macrocarpa 0,0 (0) (4) 3,30 (0) 1,10 (0) (3) 0,0 (0) Eugeissona tristis 0,0 (0) (4) 28,00 (3) 23,00 (3) (0) 2,6 (2) Euterpe oleracea 0,0 (0) (3) 5,00 (01) 2,25 (0) (0) 2,5 (2) Gaussia maya (3) (2) 1,00 (0) (0) 1,0 (1) Geonoma interrupta 2,8 (1) (1) (1) 6,30 (1) 2,00 (0) (0) 0,8 (1) Guihaia argyrata 0,2 (1) (2) (0) 0,40 (0) 0,40 (0) (1) 0,0 (0) Hanguana malayana Hedyscepe canterburyana 1,1 (1) (0) (2) 7,00 (1) 5,00 (2) (0) 5,7 (3) Hemithrinax ekmaniana 0,0 (0) (4) 2,50 (0) 2,00 (0) (3) 0,0 (0) Heterospathe elata (3) (2) (0) Heterospathe elegans (3) (2) 2,85 (0) 1,50 (0) (0) 1,3 (12) Howea belmoreana 7,00 (1) 5,38 (012) (1) 0,0 (0) Hydriastele wendlandiana (3) (2) 7,00 (1) 3,50 (1) (1) 0,0 (0) Hyophorbe verschaffeltii 0,6 (1) (1) (1) 1,60 (0) 1,30 (0) (0) 1,0 (1) Hyospathe macrorhachis (3) (2) 0,35 (0) (0) 0,9 (1) Hyphaene coriacea 1,8 (1) (12) (1) 2,70 (0) 1,45 (0) (1) 0,0 (0) Iguanura wallichiana 1,2 (1) (3) (1) 2,20 (0) 1,88 (0) (01) 2,0 (2) Iriartea deltoidea 1,8 (1) (3) (2) 5,00 (01) 5,00 (12) (12) 0,0 (0) Iriartella stenocarpa (3) (2) (1) 0,0 (0) Itaya amicorum 0,0 (0) (4) 4,30 (0) 2,40 (0) (3) 0,0 (0) Johannesteijsmannia altifrons 0,0 (0) (4) 1,16 (0) 0,23 (0) (3) 0,0 (0) Juania australis 1,0 (1) (3) (1) 4,60 (0) 4,30 (1) (0) 1,2 (1) Jubaea chilensis 0,8 (1) (1) (2) 5,20 (1) 3,80 (1) (0) 1,6 (1) Jubaeopsis caffra 1,5 (1) (1) (2) 9,60 (2) 8,00 (2) (0) 2,2 (2) Kentiopsis oliviformis (0) (2) 4,90 (01) 2,90 (1) (0) Kerriodoxa elegans 1,3 (1) (2) (0) 1,30 (0) 1,00 (0) (1) 0,0 (0) Kingia australis 0,0 (0) (4) 30,50 (3) (3) 0,0 (0) Korthalsia cheb 0,0 (0) (4) (3) 0,0 (0) Korthalsia zippelii 0,0 (0) (4) 2,80 (0) 1,60 (0) (3) 0,0 (0) Laccospadix australasicus 0,5 (1) (3) (2) 6,50 (1) 3,00 (01) (0) Laccosperma acutiflorum 0,0 (0) (4) (3) 0,0 (0) Latania verschaffeltii (1) (1) 6,65 (1) 2,75 (01) (0) 3,3 (23) Lemurophoenix halleuxii 0,4 (1) (3) (2) 5,00 (01) 2,00 (0) (0) 1,5 (1) Leopoldinia pulchra 0,1 (1) (3) (2) 0,62 (0) 0,42 (0) (0) 0,3 (1) Lepidocaryum tenue 5,1 (2) (2) (0) 5,65 (1) 2,20 (0) (0) Lepidorrhachis mooreana 1,0 (1) (0) (2) 2,30 (0) 1,50 (0) (0) 1,9 (2) Leucothrinax morrisii 0,0 (0) (4) 4,00 (0) 2,50 (0) (3) 0,0 (0) Licuala grandis 0,0 (0) (4) 3,16 (0) 0,66 (0) (3) 0,0 (0) Linospadix monostachyos 0,3 (1) (3) (2) 3,00 (0) 2,00 (0) (1) 0,0 (0) Livistona speciosa 0,0 (0) (4) (3) 0,0 (0) Lodoicea maldivica 14,0 (3) (1) (2) 7,30 (1) 6,20 (2) (0) 3,3 (2) Loxococcus rupicola 0,3 (1) (1) (2) 4,30 (0) 3,80 (1) (0) 1,1 (1) Lytocaryum hoehnei 1,0 (1) (1) (2) 4,00 (0) 2,90 (1) (0) 1,0 (1) Manicaria saccifera 2,8 (1) (3) (1) 3,50 (0) 3,40 (1) (1) 0,0 (0) Marojejya darianii (3) (2) 4,75 (01) 2,50 (0) (0) 0,8 (1) Marojejya insignis 0,5 (1) (3) (2) 3,10 (0) 2,50 (0) (0) 1,0 (1) Masoala madagascariensis 0,3 (1) (3) (2) 2,90 (01) (0) 2,9 (23) Mauritia flexuosa 4,6 (2) (2) (0) (0) Mauritiella armata 7,5 (2) (2) (0) 4,00 (0) 2,40 (0) (0) 0,3 (1) Maxburretia rupicola 0,0 (0) (4) 1,30 (0) 0,70 (0) (3) 0,0 (0) Medemia argun 3,70 (0) 1,50 (0) (0) 0,8 (1) Metroxylon salomonense 0,0 (0) (4) (0) Musa acuminata (0) Myrialepis paradoxa 3,1 (1) (2) (0) 3,00 (0) 1,60 (0) (0)

261

Nannorrhops ritchiana 0,0 (0) (4) 2,50 (0) 1,55 (0) (3) 0,0 (0) Nenga gajah 0,5 (1) 23,50 (3) 22,50 (3) Nenga pumila (3) (2) 1,50 (0) (1) 0,0 (0) Neonicholsonia watsonii 0,0 (0) (3) 6,00 (1) 3,30 (1) (0) 2,0 (2) Neoveitchia storckii 1,0 (1) (3) (2) 2,00 (0) 1,50 (0) (0) 2,0 (2) Nephrosperma van-houtteanum 0,6 (1) (3) (2) 2,20 (0) 1,20 (0) (0) 1,5 (1) Normanbya normanbyi 1,0 (1) (3) (2) 9,50 (12) 9,00 (2) (0) 20,0 (4) Nypa fruticans 0,0 (0) (3) 5,20 (1) 2,20 (0) (1) 0,0 (0) Oenocarpus bataua 0,0 (0) (3) 5,50 (1) (0) Oncocalamus macrospathus 3,0 (1) (2) (0) 2,46 (0) 0,55 (0) (0) 2,7 (2) Oncocalamus mannii 0,95 (0) (0) 1,8 (12) Oncosperma tigillarium 0,5 (1) (1) (2) 4,00 (0) 3,30 (1) (0) 2,2 (2) Orania trispatha 2,0 (1) (3) (2) 6,00 (2) (1) 0,0 (0) Oraniopsis appendiculata 4,5 (2) (2) (0) 8,25 (12) 5,00 (2) (0) 1,0 (1) Parajubaea torallyi 2,0 (1) (1) (1) 6,00 (1) 4,00 (1) (0) 2,0 (2) Pelagodoxa henryana 1,0 (1) (3) (1) 1,90 (0) 1,20 (0) (0) 0,4 (1) Phoenicophorium borsigianum 0,5 (1) (1) (2) 1,90 (0) 1,75 (0) (1) 0,0 (0) Phoenix dactylifera 5,00 (1) Pholidocarpus macrocarpus 0,0 (0) (4) (3) 0,0 (0) Pholidocarpus sumatranus 0,0 (0) (4) 3,80 (0) 0,50 (0) (3) 0,0 (0) Pholidostachys pulchra 6,0 (2) (1) (1) 7,20 (1) 2,00 (0) (0) 0,6 (1) Physokentia petiolata 1,3 (1) (0) (2) 4,50 (01) (0) 3,0 (2) Phytelephas aequatorialis 36,0 (4) (2) (0) 10,00 (2) 4,00 (12) (1) 0,0 (0) Pigafetta elata 1,3 (1) (1) (1) 2,20 (0) 2,00 (0) (0) 0,3 (1) Pinanga coronata 0,0 (0) (3) 3,00 (0) 2,98 (01) (1) 0,0 (0) Plectocomia mulleri (2) (0) 2,60 (0) 1,25 (0) Plectocomiopsis geminiflora 1,0 (1) (2) (0) 5,60 (1) 1,15 (0) (0) 1,0 (1) Podococcus barteri 0,0 (0) (3) 1,70 (0) 0,80 (0) (0) 0,8 (1) Pogonotium ursinum 1,5 (1) (2) (0) 2,20 (0) 1,90 (0) (0) 0,6 (1) Ponapea ledermanniana (3) 5,50 (1) 3,08 (01) (0) 1,8 (12) Prestoea pubens (3) (2) 2,00 (0) 1,00 (0) (0) Pritchardia thurstonii 0,0 (0) (4) 5,00 (1) 2,30 (0) (3) 0,0 (0) Pseudophoenix vinifera 0,0 (0) (4) 10,25 (2) 5,60 (2) (0) Ptychococcus paradoxus 1,2 (1) (1) (2) 8,90 (012) 4,25 (012) (0) 11,3 (34) Ptychosperma burretianum (0) Ptychosperma elegans (13) (2) 6,00 (1) 1,63 (0) (0) 5,4 (234) Raphia farinifera 0,0 (0) (3) 5,80 (1) 3,40 (1) (1) 0,0 (0) Ravenea hildebrandtii (2) (0) 2,13 (0) (0) 1,5 (1) Reinhardtia simplex 1,3 (1) (3) (1) 2,00 (0) 1,40 (0) (1) 0,0 (0) Retispatha dumetosa 4,6 (2) (2) (0) 2,00 (0) 0,80 (0) (0) 0,8 (1) Rhapidophyllum hystrix 2,5 (1) (2) (0) 3,10 (0) 2,00 (0) (0) 1,3 (1) Rhapis excelsa 1,3 (1) (2) (0) 2,50 (0) 0,60 (0) (12) 0,0 (0) Rhopaloblaste augusta 0,9 (1) (1) (2) 3,35 (0) 3,10 (1) (0) 4,4 (3) Rhopalostylis baueri 0,6 (1) (1) (2) 4,30 (0) 3,65 (1) (0) 4,9 (3) Roscheria melanochaetes 0,8 (1) (1) (1) 0,80 (0) 0,35 (0) (0) 0,5 (1) Roystonea oleracea 2,2 (1) (1) (1) 6,60 (012) 4,10 (1) (0) Sabal palmetto 0,0 (0) (4) 4,20 (0) 1,50 (0) (3) 0,0 (0) Salacca ramosiana (2) (0) Saribus jeanneneyi 0,0 (0) (4) 2,00 (0) 0,30 (0) (3) 0,0 (0) Satakentia liukiuensis 1,0 (1) (0) (2) 4,00 (0) 3,00 (1) (0) 4,0 (3) Satranala decussilvae Schippia concolor 1,5 (1) (2) (0) 2,40 (0) 1,40 (0) (1) 0,0 (0) Sclerosperma mannii (1) 0,0 (0) Serenoa repens 0,0 (0) (4) 3,00 (0) 1,00 (0) (3) 0,0 (0) Socratea exorrhiza 0,0 (0) (3) 7,20 (1) 6,00 (2) (0) 1,3 (12) Solfia samoensis 0,7 (1) (0) (2) 5,00 (1) 3,15 (01) (12) 0,0 (0) Sommieria leucophylla 0,6 (1) (3) (2) 2,63 (0) 0,99 (0) (0) 0,6 (1) Syagrus schizophylla 1,8 (1) (1) (1) 3,60 (0) 2,90 (1) (0) 1,4 (1) Synechanthus warscewiczianus 0,3 (1) (1) (2) 1,00 (0) 0,30 (0) (1) 0,0 (0)

262

Tahina spectabilis 0,0 (0) (4) 5,00 (1) 3,00 (1) (3) 0,0 (0) Tectiphiala ferox 1,4 (1) (3) (2) 7,50 (1) 3,10 (1) (0) 2,7 (2) Thrinax radiata 0,0 (0) (4) 2,85 (01) (3) 0,0 (0) Trachycarpus geminisectus (2) (0) (0) Tradescantia ohiensis 0,0 (0) (4) (3) 0,0 (0) Trithrinax brasiliensis 0,0 (0) (4) 4,30 (0) 2,00 (0) (3) 0,0 (0) Typha latifolia 0,0 (0) (3) (1) 0,0 (0) Veitchia arecina (3) (2) 10,75 (12) 5,00 (12) (0) 13,8 (4) Verschaffeltia splendida 0,8 (1) (3) (1) 1,25 (0) 0,80 (0) (0) 1,3 (1) Voanioala gerardii 1,2 (1) (1) (2) 10,50 (2) 9,00 (2) (1) 0,0 (0) Wallichia disticha 0,0 (0) (3) 3,40 (0) 2,40 (01) (1) 0,0 (0) Washingtonia robusta 0,0 (0) (4) 6,00 (1) 4,00 (1) (3) 0,0 (0) Welfia regia 18,3 (3) (3) (1) 15,00 (2) 10,00 (2) (0) Wendlandiella gracilis 0,2 (1) (3) (2) 1,00 (0) 0,50 (0) (0) 0,7 (1) Wettinia panamensis 7,00 (1) 5,50 (2) Wodyetia bifurcata (3) (2) 7,00 (1) 5,75 (2) (0) 8,0 (4) Zombia antillarum 0,0 (0) (4) 5,50 (1) 4,50 (12) (3) 0,0 (0)

Taxon 6132a 6094 6094b 6097 6097b 6102 500 6023 6134 6133 Acanthophoenix rubra (1) 2,0 (1) 10,3 (0) (0) (012) (3) (1) Acoelorrhaphe wrightii (0) 1,0 (0) 10,0 (0) (2) (5) (4) (0) Acrocomia aculeata 43,0 (2) (0) (012) (3) (1) Actinokentia divaricata (1) 3,0 (2) 25,0 (1) (0) (012) (3) (1) Actinorhytis calapparia (1) 3,4 (2) 5,9 (0) (0) (012) (3) (1) Adonidia merrillii (1) 4,0 (3) 34,0 (2) (012) (3) (1) Aiphanes horrida (1) 3,0 (2) 18,6 (1) (0) (1) (01) (3) (1) Allagoptera arenaria (1) 4,0 (3) 19,5 (01) (0) (1) (01) (3) (1) Ammandra decasperma (1) (0) 70,0 (2) (2) (5) (6) (4) Anigozanthos flavidus (0) 1,0 (0) (2) (2) (0) (0) Aphandra natalia (0) (0) 9,5 (0) (2) (5) (6) (4) Archontophoenix alexandrae (3) 13,2 (01) (0) (012) (3) (1) Areca catechu (1) 52,5 (2) (01) (012) (3) (1) Arenga pinnata (0) 37,5 (12) (1) (01) (3) (1) Asterogyne martiana (1) 2,0 (1) 10,0 (0) (0) (1) (0) (2) (1) Astrocaryum gynacanthum 35,0 (12) (0) (3) (5) (1) Attalea allenii (2) (0) (3) Bactris gasipaes (0) 38,5 (012) (1) (012) (3) (1) Balaka microcarpa (3) 2,0 (1) 18,3 (1) (02) (3) (1) Balaka seemannii (0) (2) (1) Barcella odora (1) 43,0 (2) (0) (012) (3) (1) Basselinia velutina 3,0 (2) 11,0 (0) (012) (3) (1) Beccariophoenix madagascariensis (0) 35,0 (2) (0124) (3) (1) Bentinckia nicobarica (2) 2,0 (1) 16,0 (1) (012) (3) (1) Bismarckia nobilis (1) (0) 44,0 (2) (2) (25) (04) (4) Borassodendron machadonis (1) (0) (2) (25) (04) (4) Borassus flabellifer (0) 120,0 (3) (2) (25) (04) (4) Brahea aculeata (0) 1,0 (0) 29,3 (1) (2) (2) (0) (0) Brassiophoenix schumannii (01) (3) (1) Burretiokentia hapala 3,4 (2) (0) (012) (3) (1) Butia capitata (1) 33,3 (2) (0) (012) (3) (1) Calamus aruensis (1) (0) 11,0 (0) (2) (12) (01) (4) Calyptrocalyx albertisianus 28,5 (12) (0) (012) (3) (1) Calyptrogyne ghiesbreghtiana (1) 15,3 (1) (0) (2) (1) Calyptronoma occidentalis (1) 15,0 (1) (0) (0) (2) (1) Carpentaria acuminata (3) 20,0 (1) (0) (012) (3) (1) Carpoxylon macrospermum (3) 8,0 (4) 46,0 (2) (012) (3) (1) Caryota mitis (0) 2,0 (1) 11,5 (01) (0) (0) (2) (1) Ceratolobus concolor (0) 20,0 (1) (2) (12) (01) (4) Ceroxylon quindiuense (1) (0) 18,0 (1) (2) (2) (0) (4)

263

Chamaedorea seifrizii (4) (0) 8,0 (0) (2) (0) (4) Chamaerops humilis (1) (0) 18,0 (1) (2) (2) (0) (4) Chambeyronia macrocarpa (0) 50,0 (2) (0) (012) (3) (1) Chelyocarpus repens (0) 1,0 (0) 25,0 (1) (2) (2) (0) (0) Chelyocarpus ulei (0) 1,0 (0) 26,6 (1) (2) (2) (0) (0) Chuniophoenix hainanensis (0) 1,0 (0) 23,3 (1) (2) (5) (4) (0) Clinosperma bracteale (1) 6,0 (4) 15,0 (01) (012) (3) (1) Clinostigma savoryanum (1) 12,0 (0) (01) (3) (1) Coccothrinax argentata (0) 1,0 (0) 9,6 (0) (2) (2) (0) (0) Cocos nucifera (1) 22,5 (012) (0) (012) (3) (1) Colpothrinax wrightii (0) 1,0 (0) 20,0 (1) (2) (2) (0) (0) Copernicia prunifera (0) 1,0 (0) (2) (5) (4) (0) Copernicia yarey (0) 1,0 (0) 18,0 (1) (2) (5) (4) (0) Corypha utan (0) 1,0 (0) 22,5 (1) (2) (5) (4) (0) Cryosophila warscewiczii (0) 1,0 (0) 23,0 (1) (2) (2) (0) (0) Cyphokentia cerifera (2) 14,3 (1) (0) (012) (3) (1) Cyphokentia macrostachya 2,0 (1) 12,5 (01) (0) (0) (2) (1) Cyphophoenix nucele 4,8 (3) 20,0 (1) (0) (012) (3) (1) Cyphosperma balansae (1) 8,0 (4) 12,0 (0) (0) (012) (3) (1) Cyrtostachys renda (1) 2,0 (1) 10,0 (0) (0) (0) (2) (1) Daemonorops grandis (0) (0) (2) (2) (01) (4) Deckenia nobilis (3) 10,6 (0) (0) (012) (3) (1) Desmoncus orthacanthos (0) (012) (3) (1) Dictyocaryum lamarckianum 26,5 (1) (0) (012) (3) (1) Dictyosperma album (3) 3,1 (2) 16,0 (1) (0) (01) (3) (1) Dransfieldia micrantha (1) 15,0 (1) (0) (0) (2) (1) Drymophloeus litigiosus (3) 18,5 (01) (0) (012) (3) (1) Dypsis lastelliana (3) 2,0 (1) 21,0 (1) (0) (0) (2) (1) Elaeis oleifera (1) 23,3 (1) (2) (0) (2) Eleiodoxa conferta (0) (0) 50,0 (2) (2) (1) (1) (4) Eremospatha macrocarpa (0) 1,0 (0) 39,0 (2) (2) (2) (0) (0) Eugeissona tristis (1) 2,0 (1) (1) (1) (01) Euterpe oleracea (2) 16,6 (1) (012) (3) (1) Gaussia maya (2) 12,5 (01) (012) (3) (1) Geonoma interrupta (1) 2,0 (1) 6,0 (0) (0) (0) (2) (1) Guihaia argyrata (0) (0) 6,0 (0) (2) (2) (0) (4) Hanguana malayana (0) Hedyscepe canterburyana (3) 2,0 (1) 40,0 (2) (0) (012) (3) (1) Hemithrinax ekmaniana (0) 1,0 (0) (2) (2) (0) (0) Heterospathe elata (012) (3) (1) Heterospathe elegans (3) 2,6 (2) 12,5 (01) (012) (3) (1) Howea belmoreana (0) 2,0 (1) 3,5 (0) (0) (0) (2) (1) Hydriastele wendlandiana (0) 9,0 (0) (1) (012) (3) (1) Hyophorbe verschaffeltii (2) 18,3 (1) (0) (5) (5) (1) Hyospathe macrorhachis (1) 11,0 (0) (0) (01) (3) (1) Hyphaene coriacea (0) (0) 55,0 (2) (2) (25) (04) (4) Iguanura wallichiana (1) 11,1 (0) (0) (012) (3) (1) Iriartea deltoidea (0) 24,6 (1) (0) (012) (3) (1) Iriartella stenocarpa (0) (01) (012) (3) (1) Itaya amicorum (0) 1,0 (0) 20,0 (1) (2) (2) (0) (0) Johannesteijsmannia altifrons (0) 1,0 (0) 19,3 (1) (2) (5) (4) (0) Juania australis (1) (0) 16,0 (1) (2) (2) (0) (4) Jubaea chilensis (1) 4,4 (3) 38,0 (2) (0) (012) (3) (1) Jubaeopsis caffra (1) 39,0 (2) (0) (012) (3) (1) Kentiopsis oliviformis 2,0 (1) 18,5 (01) (0) (0) (2) (1) Kerriodoxa elegans (0) (0) 36,0 (2) (2) (1) (1) (4) Kingia australis (0) 1,0 (0) (2) Korthalsia cheb (0) 1,0 (0) 15,0 (1) (2) (2) (0) (0) Korthalsia zippelii (0) 1,0 (0) (2) (2) (0) (0)

264

Laccospadix australasicus 13,5 (01) (0) (012) (3) (1) Laccosperma acutiflorum (0) 1,0 (0) (2) (1) (1) (0) Latania verschaffeltii (1) (0) 40,0 (2) (2) (2) (0) (4) Lemurophoenix halleuxii (2) 3,0 (2) 50,0 (2) (0) (01) (3) (1) Leopoldinia pulchra (2) 24,0 (1) (012) (3) (1) Lepidocaryum tenue (0) 30,6 (1) (2) (12) (0) (4) Lepidorrhachis mooreana (2) 2,0 (1) 13,5 (01) (0) (2) (1) Leucothrinax morrisii (0) 1,0 (0) 7,2 (0) (2) (2) (0) (0) Licuala grandis (0) 1,0 (0) 12,5 (01) (2) (2) (0) (0) Linospadix monostachyos (0) 12,0 (01) (0) (012) (3) (1) Livistona speciosa (0) 1,0 (0) 30,0 (12) (2) (5) (4) (0) Lodoicea maldivica (1) (0) 456,0 (4) (2) (25) (04) (4) Loxococcus rupicola (1) 3,2 (2) 25,3 (1) (0) (012) (3) (1) Lytocaryum hoehnei (1) 27,3 (1) (0) (012) (3) (1) Manicaria saccifera (0) 70,0 (2) (0) (012) (3) (1) Marojejya darianii 22,5 (1) (012) (012) (3) Marojejya insignis (1) 23,1 (1) (12) (012) (3) Masoala madagascariensis (1) 24,5 (1) (012) (3) (1) Mauritia flexuosa (0) 53,0 (2) (2) (12) (01) (4) Mauritiella armata (1) (0) 32,0 (2) (2) (2) (0) (4) Maxburretia rupicola (0) 1,0 (0) 5,8 (0) (2) (2) (0) (0) Medemia argun (0) 42,0 (2) (2) (25) (04) (4) Metroxylon salomonense 65,0 (2) (1) (1) (01) Musa acuminata Myrialepis paradoxa (0) 26,0 (1) (2) (5) (4) (4) Nannorrhops ritchiana (0) 1,0 (0) 13,3 (0) (2) (5) (4) (0) Nenga gajah (0123) (3) (1) Nenga pumila (0) 3,0 (2) 28,0 (1) (0) (012) (3) (1) Neonicholsonia watsonii (1) 11,3 (0) (0) (012) (3) (1) Neoveitchia storckii (1) 11,0 (4) 50,0 (2) (0) (01) (3) (1) Nephrosperma van-houtteanum (1) 6,0 (0) (0) (012) (3) (1) Normanbya normanbyi (4) 42,5 (2) (0) (012) (3) (1) Nypa fruticans (0) 106,0 (3) (1) (2) (0) (2) Oenocarpus bataua 4,0 (3) 32,5 (12) (0) (012) (3) (1) Oncocalamus macrospathus (2) 16,8 (1) (5) (7) (1) Oncocalamus mannii (5) (7) (1) Oncosperma tigillarium (2) 12,6 (0) (0) (012) (3) (1) Orania trispatha (0) 2,0 (1) 52,5 (2) (0) (0) (2) (1) Oraniopsis appendiculata (1) (0) 34,0 (2) (2) (2) (0) (4) Parajubaea torallyi (1) 66,6 (2) (0) (012) (3) (1) Pelagodoxa henryana (1) 6,8 (4) 62,6 (2) (0) (012) (3) (1) Phoenicophorium borsigianum (0) 12,0 (0) (0) (012) (3) (1) Phoenix dactylifera (0) 55,0 (2) (2) (2) (0) (4) Pholidocarpus macrocarpus (0) 1,0 (0) 100,0 (3) (2) (2) (0) (0) Pholidocarpus sumatranus (0) 1,0 (0) (2) (2) (0) (0) Pholidostachys pulchra (1) 2,0 (1) 24,2 (1) (0) (0) (2) (1) Physokentia petiolata (2) 4,0 (3) 2,0 (0) (0) (012) (3) (1) Phytelephas aequatorialis (0) (0) 125,0 (3) (2) (5) (6) (4) Pigafetta elata (1) (0) (2) (12) (01) (4) Pinanga coronata (0) 2,0 (1) 13,0 (01) (1) (0) (2) (1) Plectocomia mulleri (0) 25,0 (1) (2) (12) (01) (4) Plectocomiopsis geminiflora (1) (0) 25,0 (1) (2) (5) Podococcus barteri (1) 30,0 (1) (0) (012) (3) (1) Pogonotium ursinum (1) (0) 17,0 (1) (2) (12) (01) (4) Ponapea ledermanniana (1) 3,0 (2) 39,3 (2) (012) (3) (1) Prestoea pubens 10,0 (0) (0) (2) (1) Pritchardia thurstonii (0) 1,0 (0) 10,6 (0) (2) (2) (0) (0) Pseudophoenix vinifera 20,0 (1) (2) (2) (0) (0) Ptychococcus paradoxus (4) 49,5 (2) (012) (3) (1)

265

Ptychosperma burretianum (0) (012) (3) (1) Ptychosperma elegans 12,0 (01) (012) (3) (1) Raphia farinifera (0) 55,0 (2) (2) (0) (1) Ravenea hildebrandtii (2) (0) 9,5 (0) (2) (2) (0) (4) Reinhardtia simplex (0) (0) (012) (3) (1) Retispatha dumetosa (1) (0) 26,0 (12) (2) (2) (0) (4) Rhapidophyllum hystrix (1) (0) 22,0 (1) (2) (5) (4) (4) Rhapis excelsa (0) (0) 9,0 (0) (2) (2) (0) (4) Rhopaloblaste augusta (4) (012) (3) (1) Rhopalostylis baueri (2) 2,4 (2) 17,3 (1) (0) (012) (3) (1) Roscheria melanochaetes (1) 6,8 (0) (012) (3) (1) Roystonea oleracea (0) (012) (3) (1) Sabal palmetto (0) 1,0 (0) 11,0 (0) (2) (2) (0) (0) Salacca ramosiana (0) 60,0 (2) (2) (2) (0) (4) Saribus jeanneneyi (0) 1,0 (0) 40,0 (2) (2) (5) (4) (0) Satakentia liukiuensis (2) 6,8 (4) 14,3 (1) (012) (3) (1) Satranala decussilvae (0) 43,0 (12) (2) (2) (0) (4) Schippia concolor (0) 26,6 (1) (2) (0) (01) Sclerosperma mannii (0) 27,5 (1) (02) (3) (1) Serenoa repens (0) 1,0 (0) 18,0 (1) (2) (12) (01) (0) Socratea exorrhiza (1) 2,0 (1) 26,0 (1) (1) (0) (2) (1) Solfia samoensis (0) 18,8 (1) (0) (012) (3) (1) Sommieria leucophylla 10,0 (0) (0) (0) (2) (1) Syagrus schizophylla (1) 29,3 (1) (0) (012) (3) (1) Synechanthus warscewiczianus (0) 9,0 (4) 25,3 (1) (3) (5) (1) Tahina spectabilis (0) 1,0 (0) 26,0 (1) (2) (5) (4) (0) Tectiphiala ferox (1) 11,8 (0) (0) (012) (3) (1) Thrinax radiata (0) 1,0 (0) 7,6 (0) (2) (2) (0) (0) Trachycarpus geminisectus (0) (2) (2) (0) (4) Tradescantia ohiensis (0) 1,0 (0) (2) Trithrinax brasiliensis (0) 1,0 (0) 20,0 (1) (2) (2) (0) (0) Typha latifolia (0) (0) Veitchia arecina (4) 40,0 (2) (0) (012) (3) (1) Verschaffeltia splendida (2) 24,6 (1) (0) (012) (3) (1) Voanioala gerardii (0) 7,5 (0) (0) (012) (3) (1) Wallichia disticha (0) 16,5 (01) (12) (01) (34) Washingtonia robusta (0) 1,0 (0) 12,0 (0) (2) (2) (0) (0) Welfia regia 2,0 (1) 34,0 (2) (0) (0) (2) (1) Wendlandiella gracilis (1) (0) 8,3 (0) (2) (123) (01) (4) Wettinia panamensis 30,0 (12) (2) (0) (3) Wodyetia bifurcata (4) 55,0 (2) (012) (3) (1) Zombia antillarum (0) 1,0 (0) 35,0 (2) (2) (2) (0) (0)

266

Annexe 4 : article présentant la phylogénie moléculaire des Archontophoenicinae

A phylogeny of subtribe Archontophoenicinae (Arecaceae) based on 14 DNA regions

Authors

Boris Domenech1, Conny B. Asmussen-Lange2, William J. Baker3, Elodie Alapetite1, Jean

Christophe Pintaud4 and Sophie Nadot1

Author affiliations

1Univ Paris-Sud, Laboratoire Ecologie, Systématique et Evolution, UMR8079, Orsay, F-

91405, France

2Department of Plant and Environmental Sciences, University of Copenhagen, Rolighedsvej

21, DK-1958 Frederiksberg C, Denmark

3Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, UK

4Jean-Christophe Pintaud, UMR 1097, Institut de recherche pour le Développement, BP

64501, 911 avenue Agropolis, F-34394 Montpellier, France

267

Introduction

The subtribe Archontophoenicinae belongs to the tribe Areceae, which is one of the 11 tribes now recognized within Arecoideae (Dransfield et al., 2008), by far the largest of all five palm subfamilies. Archontophoenicinae includes 15 species distributed among five genera:

Actinorhytis H.Wendl. & Drude, Archontophoenix H.Wendl. & Drude, Actinokentia Dammer,

Chambeyronia Vieill., Kentiopsis Brongn. (Dransfield et al., 2005). All members of the subtribe are distributed in the Pacific Ocean, with Archontophoenix (six species) in Eastern of

Australia, the monotypic Actinorhytis in New Guinea and the Solomon Island, and the remaining genera (eight species) in New Caledonia (Dransfield et al., 2008; Pintaud and

Baker, 2008; Dowe, 2010; Baker et al., 2011; Baker and Couvreur, 2012). The vegetative morphology of Archontophoenicinae is relatively homogeneous and makes some species difficult to distinguish (Pintaud, 1999; Dransfield et al., 2008): they are unarmed palms with a crownshaft, a prophyll completely sheathing (similar to a peduncular bract) and acute leaflet tips.

The circumscription of Archontophoenicinae was revised recently in the new classification of palms published by Dransfield et al. (2005), resulting in the inclusion of Actinorhytis in the subtribe, the removal of Hedyscepe and Rhopalostylis (moved to subtribe Rhopalostylidinae) and the inclusion of Mackeea within Kentiopsis, as suggested by Pintaud (1999). Pintaud

(1999) conducted a cladistic analysis on the seven genera then included in

Archontophoenicinae in the prevailing palm classification at that time (Uhl and Dransfield,

1987); Archontophoenix, Actinokentia, Chambeyronia, Kentiopsis, Hedyscepe H.Wendl. &

Drude, Rhopalostylis H.Wendl. & Drude and Mackeea H.E. Moore, based on 47 morpho- anatomical characters. Pintaud (1999) found that Archontophoenix was the sister group to all other genera in the subtribe, that Chambeyronia was paraphyletic whereas Actinokentia and

Kentiopsis (including Mackeea) were both monophyletic. Recent studies have used molecular

268

markers to reconstruct large scale phylogenies of the palm family (Lewis and Doyle, 2002;

Baker et al., 2009, 2011) including representatives of Archontophoenicinae. However, while generic sampling may have been complete in later studies, only a few species of the subtribe are represented in these phylogenies, leaving phylogenetic relationships within this subtribe still inadequately resolved.

The aim of the present study was to produce a comprehensive molecular phylogeny of

Archontophoenicinae at the species level, with a sampling representing all of the 15 species included in the subtribe, and a dataset comprising a high number of chloroplast and nuclear markers. These markers include the DNA barcoding markers matK and rbcL which have been shown to result in good species discrimination in the palm tribe Caryoteae when used in combination with the nuclear marker ITS2 (Jeanson et al. 2011). We compared the phylogenetic hypotheses resulting from the chloroplast vs. the nuclear dataset, and combined both datasets in order to retrieve as much phylogenetic information as possible.

Material and Methods

Taxonomic sampling

Leaf samples of specimens from all species representing the taxonomic diversity of

Archontophoenicinae were obtained from various herbaria and living collection: Royal

Botanic Garden, Kew, Department of Plant and Environmental Sciences, University of

Copenhagen, Fairchild Tropical Botanic Garden, Museum National d’Histoire Naturelle,

Paris. (Table 1). Sequences were also retrieved from GenBank for some species, when they were available for the selected markers. Specimens from the following species were used as outgroups to root the phylogenetic trees: Carpentaria acuminata (H.Wendl. & Drude) Becc,

Cyphosperma balansae (Brongn.) H.Wendl. ex Salomon, Linospadix monostachyos (Mart.)

H.Wendl. and Rhopalostylis baueri (Hook.f.) H.Wendl. & Drude. These were selected from

269

the western Pacific clade of tribe Areceae, to which Archontophoenicinae belongs (Baker et al. 2011).

DNA extraction, amplification and sequencing

Total genomic DNA was extracted from fresh or silica gel dried plant material using the

NucleoSpin® Plant II extraction kit (Macherey-Nagel), the 2× CTAB method of Doyle &

Doyle (1987) or the DNeasy™ Plant Mini Kit (Qiagen). Five nuclear DNA regions and nine plastid DNA regions were selected for amplification and sequencing. The nuclear DNA regions were AG1 (a region of the oil palm gene Eg-AG1, homologous to AGAMOUS which is involved in organ identity during floral development (Ludena et al., 2011)), BRSC (a nuclear DNA region of unknown function), ITS2 (nrDNA), PRK (coding region for the phosphoribulokinase, sequences retrieved from GenBank) and RPB2 (RNA polymerase II, sequences retrieved from GenBank). These five nuclear regions were useful to reconstruct the phylogeny of the Bactridinae palm subtribe (Ludeña et al., 2011), to discriminate some close related palm species in the barcoding context (Jeanson et al., 2011), to identify large scale relationship within the palm family (Bacon et al., 2008) and to infer the phylogeny of the palm genus Chamaedorea (Thomas et al., 2006). The plastid DNA regions included were the coding regions rbcL, matK, ndhF, rps16 and rpoC, and the noncoding regions atpF-atpH, psbK-psbI, trnL-F, and trnQ

PCR amplification was conducted in a final reaction volume of 40 µL, including 1 µL of

DNA, 1 M of each primer, 200 M dNTP, 1 x Taq polymerase buffer and 1 U Taq polymerase (MP Biomedicals).

PCR amplification of AG1 was performed with the following primers: AG1-Forward

CAGGAATTTGATGGGAGAGTC and AG1-Reverse GCTGATTGCTTTGCATGAG, and the following conditions: initial denaturation at 94°C for 3 mn, followed by 35 cycles of 30 sec at 94°C, 1 mn at 58°C, 45 sec at 72°C and ended by a final extension at 72°C for 3 mn

270

(see Ludena et al., (2011) for more details). PCR amplification of BRSC was performed with the following primers: BRSC-Forward TTCGAGCTCAACGACGTCTT and BRSC-Reverse

CATCCCGAACAGCGTAATCC, and the following conditions: initial denaturation at 94°C for 3 mn, followed by 35 cycles of 30 sec at 94°C, 30 sec at 55°C, 1 mn at 72°C and ended by a final extension at 72°C for 7 mn (see also Bacon et al., (2008) for more details). PCR amplification of ITS2 was performed with the following primers: ITS2-Forward

ATGCGATACTTGGTGTGAAT and ITS2-Reverse GACGCTTCTCCAGACTACAAT, and the following conditions: initial denaturation at 94°C for 3 mn, followed by 35 cycles of 30 sec at 95°C, 30 sec at 56°C, 30 sec at 72°C and ended by a final extension at 72°C for 7 mn

(see Jeanson et al., (2011) for more details). PCR products were purified and sequenced at the

Genoscope (www.genoscope.cnrs.fr). Sequence resulting from forward and reverse primers for each sample were corrected and assembled into contigs using CodonCode Aligner

(www.codoncode.com).

Sequence alignments and phylogenetic analyses

Sequences were aligned with MAFFT (Katoh and Toh, 2008), and the alignments were further refined manually when necessary using BioEdit (Hall, 1999). A microsatellite region in AG1 was deleted, as suggested in Ludeña et al. (2001). The correct identity of the nuclear sequences was verified by submitting the sequences to a BLAST search in GenBank

(http://www.ncbi.nlm.nih.gov/genbank/). All DNA regions were assembled and aligned individually, and then concatenated into a combined matrix of nuclear DNA regions, a matrix of combined plastid DNA regions, and a combined matrix of all nuclear and plastid DNA regions using SequenceMatrix (Vaidya et al., 2011) (see table 1). Phylogenetic analyses were conducted using maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI). For MP analyses, heuristic searches with 1000 replicates of random addition sequence and tree bisection and reconnection branch swapping were performed using PAUP*

271

version 4.0b10 (Swofford, 2003). Bootstrap analyses were performed using heuristic searches with 1000 replicates with branch swapping and 10 random addition sequences per replicate.

No bootstrap could be performed on the nuclear dataset due to technical limits in computation. ML analyses were performed using PhyML (Guindon et al., 2010) with the

GTR model of evolution (using default values for the associated parameters), starting with a

BioNJ tree and using the NNI and SPR methods to find the trees with the best likelihood.

Node support was estimated by performing 1000 non parametric bootstrap replicates on the datasets. The other parameters were left unchanged. Bayesian inference analyses were conducted with MrBayes (Ronquist and Huelsenbeck, 2003), with the following models of evolution: GTR+I for psbK-psbI, RPB2 and ITS2; HKY+I for rbcL, PRK and BRSC; HKY for atpF-atpH, rpoC, trnQ and AG1; GTR for matK, ndhF and rps16; and last, F81+I for trnL-F. The models were selected using MrModelTest (Nylander, 2004) using the Akaike

Information Criterion. 10,000,000 generations were calculated in MrBayes, discarding the first 25% as burnin.

All trees were calculated with the inclusion of four outgroups belonging to other subtribes of the tribe Areceae. Linospadix monostachyos was selected as the outgroup to compute trees.

Results

PCR and sequencing

For ITS2, single band PCR products were obtained, avoiding a cloning step. In some specimens the BRSC DNA region could be sequenced only with the forward primer. For these specimens the single strand sequences were edited carefully before inclusion in the alignments.

All nine plastid DNA regions were obtained for all species, except for Chambeyronia lepidota and Kentiopsis piersoniorum, for which trnQ sequences were missing. All three nuclear DNA

272

regions AG1, BRSC, ITS2 were obtained for the following species: Archontophoenix myolensis, A. tuckeri, A. maxima, A. alexandrae, Chambeyronia lepidota, Kentiopsis piersoniorum and K. magnifica (table 1). Two of the three regions were obtained for nine species: Archontophoenix cunninghamiana, A. purpurea, Chambeyronia macrocarpa,

Actinorhytis calapparia, Kentiopsis pyriformis, K. oliviformis, Actinokentia huerlimannii,

Cyphosperma balansae (outgroup) and Linospadix monostachyos (outgroup) (table 1). For three species, only one nuclear region could be amplified and sequenced per species:

Actinokentia divaricata (ITS2), Carpentaria acuminata (outgroup) (ITS2) and Rhopalostylis baueri (outgroup) (AG1), see Table 1.

Sequences from two nuclear regions were retrieved from GenBank for the following species:

PRK for Actinokentia divaricata, A. huerlimannii, Actinorhytis calapparia, Archontophoenix purpurea, Chambeyronia macrocarpa, Kentiopsis oliviformis, K. magnifica, Carpentaria acuminata (outgroup) and Rhopalostylis baueri (outgroup) (table 1); and RPB2 for

Actinokentia divaricata, A. huerlimannii, Actinorhytis calapparia, Archontophoenix purpurea, Chambeyronia macrocarpa, Kentiopsis oliviformis, K. magnifica, Carpentaria acuminata (outgroup) and Rhopalostylis baueri (outgroup) (table 1).

Phylogenetic analyses

Most regions were aligned easily and alignments required very few manual adjustments.

Table 2 shows the tree statistics for the MP analyses based on the different combinations of data. The ML trees based on the different datasets are shown on figure 1 (plastid tree), figure

2 (nuclear tree) and figure 3 (total evidence analysis). The BI and MP trees are shown on

Figures S1-S2 (plastid trees), S3-S4 (nuclear trees) and S5-S6 (total evidence trees).

A well supported clade (PP>95% for all Bayesian analyses, bootstrap value>85% for all ML analysis) including all species from the genera Archontophoenix, Actinokentia, Chambeyronia and Kentiopsis emerges from the analyses (figures 1 to 3 and S1, S2, S3, S5, S6). This clade

273

will be termed here the “core Archontophoenicinae” and is present in all analyses except for those conducted in MP on the nuclear dataset (figure S4). This clade was recovered in previous analyses (Baker et al. 2009, 2011, Norup et al., 2006) in which it was moderately to highly supported. The placement of Actinorhytis as the sister group of the core

Archontophoenicinae has been previously resolved in both separate and combined analyses of the nuclear genes PRK and RPB2 (Baker et al. 2011) and the supertree study of Baker et al.

(2009), which also draws on these two DNA regions. It is also consistent with earlier findings

(Lewis and Doyle, 2002 Norup et al. 2006). In this study, however, Actinorhytis is consistently placed in an unresolved position at the base of the tree, whatever the dataset or method used, as emerged from the earliest analyses of the group based on morphological data

(Pintaud 1999). Our results neither refute nor support the placement of Actinorhytis as a member of the Archontophoenicinae. However, the fact that so large a dataset based on so many DNA regions fails to recover this relationship is noteworthy and supports concerns expressed by the authors of the current classification regarding this genus (Dransfield et al.

2008). But in some analyses (combined matrix in ML, nuclear dataset in ML and BI),

Actinorhytis is closer to outgroups than to the “core Archontophoenicinae”. Although the morphology of Actinorhytis is consistent with the current morphological circumscription of the subtribe and its distribution in New Guinea and the Solomon Islands is adjacent to that of the core Archontophoenicinae in Australia and New Caledonia, Actinorhytis stands apart on a number of features. It is an extremely tall palm with a very slender crownshaft, the leaves are strongly recurved and the fruit is very large, not only in comparison to the core

Archontophoenicinae, but also relative to almost all other Areceae. The position of

Actinorhytis, along with several other ambiguously placed genera of Areceae, will only be solved with dense taxon and data sampling across the tribe.

274

Archontophoenix

This genus was recognized as monophyletic in previous studies (Pintaud, 1999; Dowe, 2010).

The six species of Archontophoenix form a well supported clade in all analyses based on the plastid and the combined datasets, except those based on the nuclear dataset (ML bootstrap support >85%, MP bootstrap>50% and BI PP=1 with the plastid and combined datasets), confirming that the genus is indeed a natural group, as suggested by its shared morphological features (highly branched inflorescences and small fruits with ruminate endosperm

(Dransfield et al., 2008)). In the nuclear trees there is a splitting of Archontophoenix in three distinct groups: [[Archontophoenix. alexandrae + A. myolensis] + A. cunninghamiana] separated from [A. maxima + A. tuckeri] and A. purpurea alone. The sister group relationship between [Archontophoenix alexandrae + A. myolensis] one the one hand, and [A. maxima + A. tuckeri] on the other hand is well supported in all our analyses except in the plastid trees. In spite of the large amount of characters sampled in this study, the relationships between

Archontophoenix and the other genera of the subtribe remain however unclear.

Actinokentia

The monophyly of this genus (two species) is strongly supported in the plastid trees (MP bootstrap support > 95%, ML bootstrap support > 95% and BI PP = 1; figures 1, S1 and S2) and in the total evidence trees (MP bootstrap support = 94%, ML bootstrap support > 95% and BI PP = 1; figures 3, S5 and S6). It is supported by lower values in the nuclear trees obtained with ML and BI (ML bootstrap value = 86% and BI PP = 0.77; figures 2 and S3), and the MP analysis of the nuclear dataset failed to recover this clade (figure S4). The two species, both endemic from New Caledonia, are markedly smaller palms than the rest of the subtribe, making them easily distinguishable. They show strong divaricate branches, small inflorescences bearing staminate asymmetrical flowers with prominent columnar pistillode and a slender stem. (Dowe, 1989; Dransfield et al., 2008)

275

The monophyly of Actinokentia was evidenced by Pintaud (1999) using morphological characters, and the genus was considered to be closely related to Chambeyronia because of shared morphological features. This relationship is not supported in our analyses, as already suggested by Baker et al. (2011).

Kentiopsis and Chambeyronia

None of our analyses recovered monophyly for Chambeyronia and Kentiopsis. It should be noted that the three species K. magnifica, K. oliviformis and C. macrocarpa are consistently grouped together in all the analyses (except in the BI and MP analyses of the plastid dataset; figures S1 and S2), suggesting that Kentiopsis and Chambeyronia are not monophyletic. Both genera are endemic from New Caledonia. Within Archontophoenicinae, the two species of

Chambeyronia are characterized by the absence of a pistillode in the male flowers, which is a derived trait in this subtribe (Nadot et al., 2011). The pistillode has been lost several times within the Areceae, making it a homoplasious character state, perhaps not entirely reliable as a synapomorphy for a genus. The four species of Kentiopsis occur also in New Caledonia and share broom-like inflorescences, as well as asymmetrical staminate flowers, an unusual feature in palms. The unresolved placement of C. lepidota, K. piersoniorum and K. pyriformis is problematic and does not allow us to make further conclusion as to the delimitation of

Kentiopsis or Chambeyronia. Both Chambeyronia macrocarpa and Actinokentia divaricata have been formerly placed in the genus Kentiopsis (Brongniart, 1873), stressing the very close relationship among these genera.

Actinorhytis

The single species of this monotypic genus (Actinorhytis calapparia) is located in New

Guinea and the Solomon Islands (Dransfield et al., 2008; Pintaud and Baker, 2008). Baker et al., (2011) suggested that this genus was sister to all other Archontophoenicinae. The BI and

ML nuclear trees (figures S3 and S4) as well as the ML total evidence tree (figure 3) support

276

this sister-group relationship. In all other analyses, the position of the specie is unresolved among outgroups.

Discussion

Molecular phylogenies have led to dramatic changes in the classification of palms, highlighting the usefulness of molecular characters for palm systematic. Archontophoenicinae was highlighted in some studies (Lewis and Doyle, 2002; Norup et al., 2006; Baker et al.,

2011) to be part of the South West Pacific and Australia clade (especially the Western Pacific clade). Previous studies based on morphological characters (Uhl and Dransfield, 1987;

Pintaud, 1999) resulted in the inclusion of Hedyscepe and Rhopalostylis in the subtribe

Archontophoenicinae, but this inclusion is not supported in phylogenetic analyses based on molecular data (Baker et al., 2011), and our results confirm this latter view. Our multigene analysis of the subtribe also confirm the position of Actinorhytis as sister group to the other genera (Kentiopsis, Actinokentia, Archontophoenix and Chambeyronia), as suggested by

Baker et al., (2009, 2011) in large scale studies of the subfamily Arecoideae based on a smaller taxonomic sampling of Archontophoenicinae. Our results furthermore challenge the monophyly of Chambeyronia and Kentiopsis.

Palms are known to evolve particularly slowly at the molecular level (Wilson et al., 1990;

Gaut et al., 1996), and adding up molecular characters was a way to optimize our chances to resolve phylogenetic relationships among closely related species. The close examination of the relative support brought by the nuclear and plastid data reveals that nuclear regions tend to support external nodes in the phylogeny, whereas plastid regions bring resolution to the deepest nodes of the tree. In the case of Archontophoenix for example, the phylogenetic analyses of plastid regions result in a large clade with little resolution among species, whereas

277

nuclear regions suggest affinities between species ([A. alexandrae + A. myolensis] and [A. maxima + A. tuckeri]), although failing to recover the monophyly of the genus.

Overall, plastid data contain less information that nuclear data (Table 3), as suggested by the comparison of the statistics associated with the MP analyses of nuclear, plastid and combined datasets. These statistics show that the best results are obtained with the combined analysis of nuclear and plastid data (figures 1 and 2, and S1-S4 to compare the resolution of trees).

Interestingly, plesiomorphic characters bring resolution to the deepest nodes of the phylogeny.

The combined analysis of 14 DNA regions resulted in improving the resolution of phylogenetic relationships within Archontophoenicinae and suggested that the circumscription of some genera should perhaps be revised. The lack of support remaining in parts of the phylogeny may be due to the variable evolutionary rate of these 14 DNA regions, leading to conflicts between the plastid and nuclear datasets, as already stressed by Cuenca and Asmussen, (2007). Although we used both non-coding and coding plastid and nuclear

DNA regions, there was a high level of homoplasy, especially within the plastid regions

(almost 38% in MP when excluding non-uninformative character). The nuclear dataset displayed a little less homoplasy (~31% in MP), and the combined dataset had an intermediate level of homoplasy (~35% in MP) (table 2).

Conclusion

Obtaining well resolved phylogenies at the species level in the palm family is a challenge.

The plastid genome, which is a valuable source of informative markers in plants at various taxonomic levels, has a particularly low rate of evolution in palms even in the non-coding regions, a phenomenon identified in the early 90’s, when the very first molecular phylogenies

278

of angiosperms, and then palms, were produced (Chase et al., 1995; Nadot et al., 1995, Baker et al., 1999; Asmussen & Chase, 2001; Asmussen et al., 2006). According to Cuenca and

Asmussen (2007), using plastid DNA brings sometimes as much information as nuclear DNA, and sometimes even much more.. In contrast, the present study confirms that the amount of phylogenetic information that can be extracted from chloroplast data in palms is extremely low. However, when used in combination with nuclear markers, which are more variable and bear more informative, they can prove useful, as shown by the results obtained here, which fully support the use of multigene approaches in palm molecular systematics.

Our results raise two questions. One question is the delimitation of genera within the core

Archontophoenicinae. The large polytomy in this clade indicates that the genera (in particular

Kentiopsis and Chambeyronia) are difficult to delimit not only at the morphological level but also at the molecular level, which may be an indication of a rapid radiation having occurred at the base of core Archontophoenicinae. Second, our results raise the question of whether

Actinorhytis should remain in Archontophoenicinae. Clarifying this point will require the addition of still more molecular data in combination with additional outgroups from other subtribes.

279

References

ASMUSSEN, C.B., AND M.W. CHASE. 2001. Coding and noncoding plastid DNA in Palm systematics. American journal of botany 88: 1103–1117.

ASMUSSEN, C.B., J. DRANSFIELD, V. DEICKMANN, A.S. BARFOD, J.C. PINTAUD, AND W.J. BAKER. 2006. A new subfamily classification of the palm family (Arecaceae): evidence from plastid DNA phylogeny. Botanical Journal of the Linnean Society 151: 15–38. Available at: http://doi.wiley.com/10.1111/j.1095-8339.2006.00521.x.

BACON, C.D., A. FELTUS, A.H. PATERSON, AND C.D. BAILEY. 2008. Novel nuclear intron- spanning primers for Arecaceae evolutionary biology. Molecular ecology resources 8: 211–214. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21585759 [Accessed February 19, 2013].

BAKER, W.J., C.B. ASMUSSEN, S.C. BARROW, J. DRANSFIELD, AND T.A. HEDDERSON. 1999. A phylogenetic study of the palm family (Palmae) based on chloroplast DNA sequences from the trnL-trnF region. Plant Systematics and Evolution 219: 111–126. Available at: http://www.springerlink.com/index/10.1007/BF01090303.

BAKER, W.J., AND T.L.P. COUVREUR. 2012. Biogeography and distribution patterns of Southeast Asian palms. In Biotic Evolution and Environmental Change in Southeast Asia,

BAKER, W.J., M. V NORUP, J.J. CLARKSON, T.L.P. COUVREUR, J.L. DOWE, C.E. LEWIS, J.C. PINTAUD, ET AL. 2011. Phylogenetic relationships among arecoid palms (Arecaceae: Arecoideae). Annals of botany 108: 1417–32. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21325340 [Accessed October 26, 2012].

BAKER, W.J., V. SAVOLAINEN, C.B. ASMUSSEN, M.W. CHASE, J. DRANSFIELD, F. FOREST, M.M. HARLEY, ET AL. 2009. Complete Generic-Level Phylogenetic Analyses of Palms ( Arecaceae ) with Comparisons of Supertree and Supermatrix Approaches. Systematic Biology.

BRONGNIART. 1873. Comptes rendus hebdomadaires des séances de l’Académie des sciences.

CUENCA, A., AND C.B. ASMUSSEN. 2007. Phylogeny of the Palm Tribe Chamaedoreeae ( Arecaceae ) Based on Plastid DNA Sequences. Systematic Botany 32: 250–263.

DOWE, J.L. 2010. Australian palms.

DOWE, J.L. 1989. Palms of the South-West Pacific.

DRANSFIELD, J., N.W. UHL, C.B. ASMUSSEN, W.J. BAKER, M.M. HARLEY, AND C.E. LEWIS. 2005. A new phylogenetic classification of the palm family , Arecaceae. Kew Bulletin 60: 559–569.

DRANSFIELD, J., N.W. UHL, C.B. ASMUSSEN, W.J. BAKER, M.M. HARLEY, AND C.E. LEWIS. 2008. Genera Palmarum.

280

GAUT, B., B.R. MORTON, B.C. MCCAIG, AND M.T. CLEGG. 1996. Substitution rate comparisons between grasses and palms: synonymous rate differences at the nuclear gene Adh parallel rate differences at the plastid gene rbcL. Proceedings of the National Academy of Sciences of the United States of America 93: 10274–10279. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=38374&tool=pmcentrez&ren dertype=abstract.

GUINDON, S., J.-F. DUFAYARD, V. LEFORT, M. ANISIMOVA, W. HORDIJK, AND O. GASCUEL. 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic biology 59: 307–321. Available at: http://www.ncbi.nlm.nih.gov/pubmed/20525638 [Accessed October 26, 2012].

HALL, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95,98,NT. In Nucleic Acids Symposium Series, 95–98.

JEANSON, M.L., J.-N. LABAT, AND D.P. LITTLE. 2011. DNA barcoding: a new tool for palm taxonomists? Annals of botany 108: 1445–1451. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21757475 [Accessed November 7, 2012].

KATOH, K., AND H. TOH. 2008. Recent developments in the MAFFT multiple sequence alignment program. Briefings in bioinformatics 9: 286–298. Available at: http://www.ncbi.nlm.nih.gov/pubmed/18372315 [Accessed November 1, 2012].

LEWIS, C.E., AND J.J. DOYLE. 2002. A phylogenetic analysis of tribe Areceae (Arecaceae) using two low-copy nuclear genes. Plant Systematics and Evolution 236: 1–17.

LUDENA, B., N. CHABRILLANGE, F. ABERLENC-BERTOSSI, H. ADAM, J.W. TREGEAR, AND J.C. PINTAUD. 2011. Phylogenetic utility of the nuclear genes AGAMOUS 1 and PHYTOCHROME B in palms (Arecaceae): an example within Bactridinae. Annals of botany 108: 1433–1444.

NADOT, S., J. SANNIER, A.S. BARFOD, AND W.J. BAKER. 2011. Evolution of the palm androecium as revealed by character mapping on a supertree. In Flowers of the Tree of Life, 156–180.

NORUP, M. V, J. DRANSFIELD, M.W. CHASE, A.S. BARFOD, E.S. FERNANDO, AND W.J. BAKER. 2006. Homoplasious character combinations and generic delimitation: a case study from the Indo-Pacific arecoid palms (Arecaceae: Areceae). American journal of botany 93: 1065–1080. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21642171.

NYLANDER, J.A.A. 2004. MrModeltest v2. Evolutionary Biology Centre, Uppsala University.

PINTAUD, J.C. 1999. A cladistic analysis of the Archontophoenicinae (Palmae, Areceae) based on morphological and anatomical characters. In Memoirs of the New York Botanical Garden,

PINTAUD, J.C., AND W.J. BAKER. 2008. A revision of the palm genera (Arecaceae) of New Caledonia. Kew Bulletin 63: 61–73.

281

RONQUIST, F., AND J.P. HUELSENBECK. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics Applications Note 19: 1572–1574. Available at: http://bioinformatics.oxfordjournals.org/cgi/doi/10.1093/bioinformatics/btg180 [Accessed November 1, 2012].

SWOFFORD, D.L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.

THOMAS, M.M., N.C. GARWOOD, W.J. BAKER, S. A HENDERSON, S.J. RUSSELL, D.R. HODEL, AND R.M. BATEMAN. 2006. Molecular phylogeny of the palm genus Chamaedorea, based on the low-copy nuclear genes PRK and RPB2. Molecular phylogenetics and evolution 38: 398–415. Available at: http://www.ncbi.nlm.nih.gov/pubmed/16249101 [Accessed November 23, 2012].

UHL, N.W., AND J. DRANSFIELD. 1987. Genera Palmarum (1st edition).

VAIDYA, G., D.J. LOHMAN, AND R. MEIER. 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27: 171–180.

WILSON, M.A., B. GAUT, AND M.T. CLEGG. 1990. Chloroplast DNA Evolves Slowly in the Palm Family (Arecaceae). Molecular biology and evolution 7: 303–314.

Acknowledgements

This project was supported by the "Bibliothèque du Vivant" funded by CNRS, Muséum

National d'Histoire Naturelle, INRA and CNS (Centre National de Séquençage). We thank the various botanical gardens which provided us with plant material.

282

Table 1. Species name, accession and voucher information for each of the specimens studied.

atpF- psbK- matK ndhF rbcL rpoC rps16 trnL-F trnQ AG1 BRSC ITS2 PRK RPB2 atpH psbI CBA59 CBA59 CBA59 CBA59 CBA59 CBA59 CBA59 CBA59 CBA59 - 015BD ------AJ831221.1 ------FR729727.1 CBA280 CBA280 CBA280 CBA280 CBA280 CBA280 CBA280 CBA280 CBA280 15729 019BD ------AJ831222.1 ------AJ830023.1 CBA505 CBA505 CBA505 CBA505 CBA505 CBA505 CBA505 CBA505 CBA505 CBA505 - CBA505 ------AJ830024.1 ------AJ831223.1 - CBA263 CBA263 CBA263 CBA263 CBA263 CBA263 CBA263 CBA293 CBA263 014BD 014BD 014BD - - CBA261 CBA261 CBA261 CBA261 CBA261 CBA261 CBA261 CBA261 CBA261 ------009BD - 009BD - - CBA723 ------CBA724 CBA724 CBA724 CBA724 CBA724 CBA724 CBA724 CBA724 CBA724 CBA724 CBA724 - - CBA708 CBA708 CBA708 CBA708 CBA708 CBA708 CBA708 CBA708 CBA708 ------001BD 001BD 001BD - - CBA650 - - CBA650 - - - - CBA650 ------CBA264 CBA264 - CBA264 CBA264 CBA264 CBA264 ------003BD 003BD ------AJ831227.1 ------AJ830028.1 CBA709 CBA709 CBA709 CBA709 CBA709 CBA709 CBA709 CBA709 CBA709 ------002BD 002BD 002BD - - CBA60 CBA60 CBA60 CBA60 CBA60 CBA60 CBA60 CBA60 - CBA60 CBA60 CBA60 - - CBA61 CBA61 CBA61 - - - - CBA61 CBA61 ------CBA711 CBA711 CBA711 CBA711 ------013BD 013BD ------AJ831260.1 ------AJ830056.1 CBA72 CBA72 CBA72 CBA72 CBA72 CBA72 CBA72 CBA72 CBA72 - - - - AY543100.1 ------010BD 010BD ------AF453353.1 - - CBA71 CBA71 - CBA71 - - CBA71 - 017BD - - - - CBA706 - - CBA706 - CBA706 CBA706 - CBA706 - CBA706 CBA706 ------AJ831299.1 ------AJ830103.1 CBA45 CBA45 CBA45 CBA45 CBA45 CBA45 CBA45 CBA45 ------004BD 004BD 004BD - - CBA25 CBA25 CBA25 CBA25 CBA25 CBA25 CBA25 CBA25 CBA25 CBA25 - - - - , P) ------CBA86 - - - - - CBA390 CBA390 CBA390 CBA390 CBA390 CBA390 CBA390 CBA390 CBA390 - - CBA390 ------AJ831259.1 ------AJ830196.1 CBA291 CBA291 CBA291 CBA291 CBA291 CBA291 CBA291 CBA291 CBA291 022BD 022BD - - - CBA371 CBA371 CBA371 CBA371 CBA371 CBA371 CBA371 CBA371 CBA371 - CBA371 CBA371 - - CBA64 CBA64 CBA64 CBA64 CBA64 CBA64 CBA64 CBA64 CBA64 ------38381 ------AJ831333.1 ------AJ830145.1

283

Table 2. Tree statistics for the maximum parsimony analyses.

Plastid dataset (9 DNA Nuclear dataset (5 DNA Combined dataset (nuclear regions) regions) and plastid sequences: 14 DNA regions) Number of characters 8546 1043 11004 Number of unchanged 8425 830 10592 (constant) characters Number of uninformative 95 123 278 variable characters Number of informative 26 90 134 characters Informative characters (%) 0.30% 8.63% 1.22% Number of equally 141 557 49 parsimonious trees Best tree length 141 284 522 CI* 0.8794 0.8522 0.8448 HI* 0.1206 0.1478 0.1552 CI excluding uninformative 0.6222 0.6875 0.6478 characters* HI excluding uninformative 0.3778 0.3125 0.3522 characters* RI* 0.7463 0.7500 0.7178 * index values for one randomly chosen tree

Table 3. Proportion of apomorphic and plesiomorphic characters in the MP analyses Apomorphic characters Plesiomorphic characters (strict homology) (homoplasy) Clade Plastid Nuclear Plastid Nuclear Total dataset dataset dataset dataset Core Archontophoenicinae 3 10 0 6 19 Actinokentia 0 1 0 1 2 Archontophoenix 2 9 1 53 65 [Kentiopsis oliviformis + [K. magnifica + 1 2 0 4 7 Chambeyronia macrocarpa]] [Kentiopsis magnifica + Chambeyronia 1 0 1 0 2 macrocarpa] [Archontophoenix alexandrae + A. 0 7 3 3 13 myolensis] [Archontophoenix maxima + A. tuckeri] 0 5 3 46 54

Figure legends

Figure 1. Tree resulting from the Maximum Likelihood analysis of the combined plastid dataset (rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, and trnQ). Bootstrap supports are indicated above branches (first value: ML analysis, second value: MP analysis).

Figure 2. Tree resulting from the Maximum Likelihood analysis of the combined nuclear dataset (AG1, BRSC, ITS2, PRK and RPB2). ML bootstrap supports are indicated above branches.

284

Figure 3. Total evidence tree resulting from the Maximum Likelihood analysis of the combined plastid and nuclear datasets (rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, trnQ, AG1, BRSC, ITS2, PRK and RPB2). ML bootstrap supports are indicated above branches.

Supplementary material

Figure S1. Tree resulting from the Bayesian Inference analysis of the combined plastid dataset

(rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, and trnQ). BI supports are indicated above branches.

Figure S2. Tree resulting from the Maximum Parsimony analysis of the combined plastid dataset (rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, and trnQ). Bootstrap supports are indicated above branches.

Figure S3. Tree resulting from the Bayesian Inference analysis of the combined nuclear dataset (AG1, BRSC, ITS2, PRK and RPB2). BI supports are indicated above branches.

Figure S4. Tree resulting from the Maximum Parsimony analysis of the combined plastid dataset (rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, and trnQ).

Figure S5. Total evidence tree resulting from the Bayesian Inference analysis of the combined plastid and nuclear datasets (rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, trnQ, AG1, BRSC, ITS2, PRK and RPB2). BI supports are indicated above branches.

Figure S6. Tree resulting from the Maximum Parsimony analysis of the combined plastid dataset (rbcL, matK, ndhF, rps16, rpoC, atpF-atpH, psbK-psbI, trnL-F, trnQ, AG1, BRSC,

ITS2, PRK and RPB2). Bootstrap supports are indicated above branches.

285

Figure 1

Linospadix monostachyos

Carpentaria acuminata Actinorhytis calapparia 91,9 Cyphosperma balansae Rhopalostylis baueri Kentiopsis pyriformis 74,3 Archontophoenix purpurea 86,8 Archontophoenix cunninghamiana 91,4 Archontophoenix tuckeri 93,7 Archontophoenix myolensis Archontophoenix alexandrae Archontophoenix maxima Chambeyronia lepidota Kentiopsis oliviformis 95,9 73,5 88,8 Chambeyronia macrocarpa Kentiopsis magnifica Kentiopsis piersoniorum

70,8 Archontophoenicinae Core 96,4 Actinokentia divaricata Actinokentia huerlimannii

Figure 2

Archontophoenix purpurea Kentiopsis pyriformis 89,9 86 Actinokentia huerlimannii Actinokentia divaricata Chambeyronia lepidota

96 Archontophoenix maxima Archontophoenix tuckeri Chambeyronia macrocarpa 77,7 79,4 Kentiopsis magnifica 69,9 Kentiopsis oliviformis Kentiopsis piersoniorum 69,1

1 ArchontophoenicinaeCore 89,6 Archontophoenix alexandrae Archontophoenix myolensis 90,4 Rhopalostylis baueri 79 Carpentaria acuminata 71 Cyphosperma balansae Actinorhytis calapparia

Linospadix monostachyos

286

Figure 3

Linospadix monostachyos

Rhopalostylis baueri Carpentaria acuminata 83,3 Cyphosperma balansae Actinorhytis calapparia

97,2 Actinokentia huerlimannii Actinokentia divaricata 79,3 93,7 Chambeyronia lepidota Kentiopsis piersoniorum 79,7 Kentiopsis oliviformis 77 99,6 Chambeyronia macrocarpa 85,4 Kentiopsis magnifica Kentiopsis pyriformis Archontophoenix maxima 98,1 Archontophoenix tuckeri 87,3 Archontophoenix cunninghamiana

1 Archontophoenix purpurea Core Archontophoenicinae 91,8 Archontophoenix alexandrae Archontophoenix myolensis

Figure 3. Total evidence tree (ML. BS ML)

Figure S1

Actinorhytis calapparia Actinokentia divaricata 1 Actinokentia huerlimannii Archontophoenix alexandrae

1 Archontophoenix maxima Archontophoenix myolensis

1 Archontophoenix tuckeri Archontophoenix cunninghamiana 0,67 Archontophoenix purpurea

0,99 Kentiopsis pyriformis Chambeyronia lepidota Chambeyronia macrocarpa 0,9 Kentiopsis magnifica

Kentiopsis oliviformis Core Archontophoenicinae Kentiopsis piersoniorum

0,99 Cyphosperma balansae Rhopalostylis baueri Carpentaria acuminata Linospadix monostachyos

287

Figure S2

97 Actinokentia divaricata Actinokentia huerlimannii Archontophoenix alexandrae 95 Archontophoenix maxima Archontophoenix myolensis

67 Archontophoenix tuckeri Archontophoenix cunninghamiana Archontophoenix purpurea

54 Chambeyronia lepidota 58 Chambeyronia macrocarpa Kentiopsis magnifica Core Core Archontophoenicinae Kentiopsis oliviformis Kentiopsis piersoniorum Kentiopsis pyriformis Actinorhytis calapparia Carpentaria acuminata Cyphosperma balansae Rhopalostylis baueri Linospadix monostachyos

Figure S3

0,77 Actinokentia divaricata Actinokentia huerlimannii 0,98 Archontophoenix alexandrae 0,99 Archontophoenix myolensis Archontophoenix cunninghamiana 0,8 Archontophoenix maxima Archontophoenix tuckeri 0,96 Archontophoenix purpurea Chambeyronia lepidota Chambeyronia macrocarpa 0,88 Kentiopsis magnifica Core ArchontophoenicinaeCore Kentiopsis oliviformis Kentiopsis piersoniorum Kentiopsis pyriformis Actinorhytis calapparia 0,58 Carpentaria acuminata Cyphosperma balansae Rhopalostylis baueri Linospadix monostachyos

288

Figure S4

Actinokentia divaricata Actinokentia huerlimannii Archontophoenix purpurea Chambeyronia lepidota Kentiopsis pyriformis Chambeyronia macrocarpa Kentiopsis magnifica Kentiopsis oliviformis Actinorhytis calapparia Archontophoenix maxima Archontophoenix tuckeri Kentiopsis piersoniorum Archontophoenix alexandrae Archontophoenix myolensis Archontophoenix cunninghamiana Carpentaria acuminata Cyphosperma balansae Rhopalostylis baueri Linospadix monostachyos

Figure S5

Actinorhytis calapparia 1 Actinokentia divaricata Actinokentia huerlimannii 0,99 Archontophoenix alexandrae 0,94 Archontophoenix myolensis 0,51 Archontophoenix cunninghamiana 1 Archontophoenix purpurea 0,99 Archontophoenix maxima 1 Archontophoenix tuckeri Chambeyronia lepidota

0,99 Chambeyronia macrocarpa 0,94 Kentiopsis magnifica Core Archontophoenicinae Core 0,69 Kentiopsis oliviformis Kentiopsis piersoniorum Kentiopsis pyriformis

0,6 Carpentaria acuminata 0,8 Cyphosperma balansae Rhopalostylis baueri Linospadix monostachyos BI

289

Figure S6

94 Actinokentia divaricata Actinokentia huerlimannii

89 Archontophoenix alexandrae Archontophoenix myolensis

Archontophoenix cunninghamiana 52 86 Archontophoenix maxima

Archontophoenix tuckeri

Archontophoenix purpurea 68 Chambeyronia lepidota

77 Chambeyronia macrocarpa Core Core Archontophoenicinae 64 Kentiopsis magnifica

Kentiopsis oliviformis

Kentiopsis piersoniorum

Kentiopsis pyriformis

Actinorhytis calapparia

Carpentaria acuminata

Cyphosperma balansae

Rhopalostylis baueri Linospadix monostachyos

290