Frequent Co-Expression of the HOXA9 and MEIS1 Homeobox Genes in Human Myeloid Leukemias

Total Page:16

File Type:pdf, Size:1020Kb

Frequent Co-Expression of the HOXA9 and MEIS1 Homeobox Genes in Human Myeloid Leukemias Leukemia (1999) 13, 1993–1999 1999 Stockton Press All rights reserved 0887-6924/99 $15.00 http://www.stockton-press.co.uk/leu Frequent co-expression of the HOXA9 and MEIS1 homeobox genes in human myeloid leukemias HJ Lawrence1, S Rozenfeld1, C Cruz1, K Matsukuma1, A Kwong1,LKo¨mu¨ves1, AM Buchberg2 and C Largman1 1Division of Hematology and Medical Oncology, Department of Medicine, University of California VA Medical Center, San Francisco, CA; and 2Kimmel Cancer Center, Jefferson Medical College, Philadelphia, PA, USA There is increasing evidence that HOX homeobox genes play these leukemias.12 Recent work has shown that the engine- a role in leukemogenesis. Recent studies have demonstrated ered co-expression of the Hoxa-9 and Meis1 genes in murine that enforced co-expression of HOXA9 and MEIS1 in murine 13 marrow leads to rapid development of myeloid leukemia, and hematopoietic cells leads to rapid development of AML, that these proteins exhibit cooperative DNA binding. However, indicating a synergy between the two genes and suggesting it is unclear whether co-activation of HOXA9 and MEIS genes that co-activation of these genes is sufficient for transform- is a common occurrence in human leukemias. We surveyed ation. expression of HOXA9 and MEIS1 in 24 leukemic cell lines and We have recently demonstrated that HOXA9 and HOXA10 80 patient samples, using RNase protection analyses and proteins can interact with the MEIS1 protein and stabilize immunohistochemistry. We demonstrate that the expression of 14 HOXA9 and MEIS1 in leukemia cells is uniquely myeloid, and MEIS1-DNA interactions on consensus binding sites. These that these genes are commonly co-expressed in myeloid cell data support the notion that the leukemogenicity of the lines and in samples of acute myelogenous leukemia (AML) of HOXA9 and MEIS1 genes is related to the concerted actions all subtypes except in promyelocytic leukemia. While HOXA9 of their protein products on gene targets. A major question is expressed in most cases of chronic myelogenous leukemia, remains whether co-activation of these genes occurs in human MEIS1 is weakly expressed or not at all. Immunohistochemical leukemias. In this study we surveyed expression patterns of staining of selected AML samples showed moderate to high levels of HOXA9 protein, primarily cytoplasmic, in leukemic both genes in a large panel of human cell lines and primary myeloblasts, with weaker and primarily nuclear staining for samples of leukemia, and observed frequent lineage-specific MEIS1. These data support the concept that co-activation of co-expression of these two genes in AML. HOXA9 and MEIS1 is a common event in AML, and may rep- resent a common pathway of many different oncogenic mutations. Materials and methods Keywords: homeobox genes; myeloid leukemia; oncogenes; tran- scription factors Leukemic cell lines and patient samples Twenty-four human leukemic cell lines were studied, as out- Introduction lined in Figure 1. All lines were maintained in media as pre- viously described.15 Cryopreserved cell samples from 80 There is increasing evidence that DNA-binding proteins enco- patients, gathered from six different centers, with various ded by the HOX family of homeobox genes play a role in forms of myeloid and lymphoid leukemias and myelodyspla- leukemic transformation. Several HOXA and HOXB genes are sia were studied and subclassified according to the French– expressed in myeloid leukemias,1–3 with HOXC genes American–British (FAB) nomenclature. The original samples expressed predominantly in lymphoid malignancies.4,5 Evi- contained a range of 30–100 × 106 cells each and in some dence that mutations of HOX genes occur in human leuke- cases were over 10 years old. In all cases, leukocytes were mias comes from characterization of the t(7;11) translocation, isolated by either a buffy-coat preparation or Ficoll–Hypaque seen in rare cases of acute myelogenous leukemia (AML),6 and density centrifugation before freezing in liquid nitrogen. Cryo- which results in the fusion of the HOXA9 gene with a nucleo- preserved samples were thawed quickly by shaking in a 37°C porin gene.7,8 However, these studies do not establish a causal water bath, diluted in warm RPMI with 10% fetal calf serum, role for HOX genes in leukemic transformation. In this regard, pelleted, washed with medium and repelleted for RNA iso- the enforced expression of HOXB8 together with IL-3 in lation by the guanidinium thiocyanate/acid phenol method.16 murine marrow cells leads to myeloid leukemia;9 similarly, Samples of normal marrow and peripheral blood leukocytes over-expression of Hoxa-10 can induce myeloid leukemia were prepared as previously described.4 after a long latency period.10 These findings suggest that mis- expression of HOX genes can contribute to transformation but additional genetic events are required. RNase protection analysis Support for a role of HOX genes in spontaneous leukemias arose from studies of the BXH-2 mice, which develop a high Templates were constructed by subcloning a 378-nt fragment incidence of myeloid leukemia. A novel non-HOX homeobox of the HOXA9 cDNA, extending from amino acid 147 to the gene, Meis1, is up-regulated as a consequence of retroviral end of the coding cDNA at amino acid 270; and a 394 nt integration in 15% of leukemias arising in BXH-2 mice.11 Sub- fragment of MEISI, extending from amino acid 287 to the end sequent studies have revealed frequent activating insertions of of the MEISIa cDNA, into the sk+ Bluescript vector using stan- the Hoxa-9 or Hoxa-7 genes together with the Meis1 gene in dard procedures. Total RNA (25–50 ␮g/samples) from individ- ual specimens was subjected to separate RNase protection Correspondence: HJ Lawrence, 1, rue Laurent Fries, BP 163, 67 404 assays for each gene, following previously published 17 Illkirch Codex, France methods. As an internal control for loading, a probe protect- Received 8 October 1998; accepted 26 July 1999 ing an 83-nt fragment of glyceraldehyde 3-phosphate Expression of HOXA9 and MEIS1 in myeloid leukemias HJ Lawrence et al 1994 Figure 1 Expression of HOXA9 and MEIS1 in human leukemic cell lines. Total RNA was isolated from 24 immortalized human leukemic lines and subjected to separate RNase protection assays for HOXA9 (top panel) and MEIS1 (middle panel), using a probe for glyceraldehyde- 3 phosphate dehydrogenase (G3PD, lower panel) as an internal control for RNA loading, as described in Materials and methods. A clear signal for HOXA9 and MEIS1 is seen in 6/8 and 4/7 myeloid cell lines, respectively, with isolated expression of HOXA9 in the MB02 and M70E lines, and isolated expression of MEIS1 in a few of the non-myeloid lines. The signals for G3PD represent short exposure times to more clearly demonstrate relative loading. dehydrogenase (G3PD) was included in each assay. RNA iso- Burlingame, CA, USA). MEIS1 was detected with affinity-pur- lated from the KG-1 cell line was used as a positive control. ified guinea pig antibodies followed by biotin-conjugated anti- For patient samples, autoradiographs of RNase protection guinea pig rabbit IgG FAB fragment followed by detection experiments were developed for 1 day for visualization of the with ABC alkaline phosphatase. Specimens were coun- G3PD signal and for 3–7 days for HOXA9 and MEIS1. Densi- terstained with methyl green to visualize nuclei. Slides were tometric scanning of the RNase protection bands for HOXA9 mounted with Vectashield (Vector Labs), photographed and and MEIS1 were performed and normalized to the G3PD band scanned, and images were assembled and labeled on a Mac- from the same gel (to correct for differences in loading), and Intosh G3 computer with Adobe Photoshop. Protein then normalized between gels by comparing the signals for expression levels were scored on an arbitrary scale of +1to KG-1 cell RNA, as previously described.1 Expression levels for +4. both genes were then assigned a value of 0 to 4+. Results Immunohistochemical localization of homeobox proteins Myeloid-specific expression of HOXA9 expression in leukemic cell lines Previously unstained blood or bone marrow smears from selected samples of acute leukemia were fixed in 4% formal- Total RNA was isolated from 24 human leukemic cell lines dehyde (freshly prepared from paraformaldehyde) in PBS for and analyzed for HOXA9 expression by RNase protection 24 h. For immunohistochemical localization, HOXA9 was analysis. As shown in Figure 1, HOXA9 was expressed exclus- detected with affinity-purified chicken antibodies followed by ively in myelomonocytic cells, with the sole exception of the biotin-conjugated anti-chicken rabbit IgG FAB fragment bi-phenotypic MBO2 erythroid/myeloid line and the M70E (Jackson Immunochemicals, West Grove, PA, USA), followed megakaryocytic line. Two of eight myeloid cell lines tested, by detection with ABC alkaline phosphatase (Vector Labs, TMM and HL60, had no detectable HOXA9 message. The Expression of HOXA9 and MEIS1 in myeloid leukemias HJ Lawrence et al 1995 lymphoid lines studied were uniformly negative for expression Table 1. The expression of HOXA9 in these primary samples of this gene. This pattern of expression is virtually identical to was essentially identical to that seen in our previous survey the pattern previously observed for the neighboring for HOXA10 expression, using many of the same samples.1 HOXA10 gene.1 HOXA9 shows an exclusively myeloid-specific expression with rare exceptions, namely one of three cases of T cell leu- MEIS1 expression in leukemic cell lines kemia involving the t(10:14) translocation. Of the five cases of mixed-lineage leukemias involving translocations of 11q When the myeloid cell lines were assayed for MEIS1 one was positive and two showed barely detectable expression by RNase protection analysis, transcripts were expression (Table 1). Otherwise, HOXA9 message was uni- detected in all but one (THP-1) of the lines which showed formly undetectable in 18 samples of B cell acute lymphocytic HOXA9 expression (Figure 1).
Recommended publications
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy
    Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy by Ian Lawrence Belle Department of Immunology Duke University Date:_______________________ Approved: ___________________________ Yuan Zhuang, Supervisor ___________________________ Michael Krangel, Chair ___________________________ Qi-jing Li ___________________________ Richard Lee Reinhardt ___________________________ Arno Greenleaf Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunology in the Graduate School of Duke University 2015 ABSTRACT Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy by Ian Lawrence Belle Department of Immunology Duke University Date:_______________________ Approved: ___________________________ Yuan Zhuang, Supervisor ___________________________ Michael Krangel, Chair ___________________________ Qi-jing Li ___________________________ Richard Lee Reinhardt ___________________________ Arno Greenleaf An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunology in the Graduate School of Duke University 2015 Copyright by Ian Lawrence Belle 2015 Abstract Within the field of immunology, the existence of autoimmune diseases presents a unique set of challenges. The immune system typically protects the host by identifying foreign pathogens and mounting an appropriate response to eliminate them. Great strides have been made in understanding how foreign pathogens are identified and responded to, leading to the development of powerful immunological tools, such as vaccines and a myriad of models used to study infectious diseases and processes. However, it is occasionally possible for host tissues themselves to be inappropriately identified as foreign, prompting an immune response that attempts to eliminate the host tissue. The immune system has processes in place, referred to as selection, designed to prevent the development of cells capable of recognizing the self as foreign.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Based Mechanism Study on the Beneficial Effects of Vitamin D
    www.nature.com/scientificreports OPEN Network Systems Pharmacology- Based Mechanism Study on the Benefcial Efects of Vitamin D against Psychosis in Alzheimer’s Disease Peihao Fan1, Xiguang Qi1, Robert A. Sweet2,3* & Lirong Wang1* Alzheimer’s disease (AD) is a chronic neurodegenerative disease with signifcant fnancial costs and negative impacts on quality of life. Psychotic symptoms, i.e., the presence of delusions and/ or hallucinations, is a frequent complication of AD. About 50% of AD patients will develop psychotic symptoms (AD with Psychosis, or AD + P) and these patients will experience an even more rapid cognitive decline than AD patients without psychosis (AD-P). In a previous analysis on medication records of 776 AD patients, we had shown that use of Vitamin D was associated with delayed time to psychosis in AD patients and Vitamin D was used more by AD-P than AD + P patients. To explore the potential molecular mechanism behind our fndings, we applied systems pharmacology approaches to investigate the crosstalk between AD and psychosis. Specifcally, we built protein-protein interaction (PPI) networks with proteins encoded by AD- and psychosis-related genes and Vitamin D-perturbed genes. Using network analysis we identifed several high-impact genes, including NOTCH4, COMT, CACNA1C and DRD3 which are related to calcium homeostasis. The new fndings highlight the key role of calcium-related signaling pathways in AD + P development and may provide a new direction and facilitate hypothesis generation for future drug development. Alzheimer’s disease (AD) is a chronic neurodegenerative disease commonly seen in the aging population, and the presence of AD is responsible for a signifcant decrease in the quality of life1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
    Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.
    [Show full text]
  • Geminin Deletion Increases the Number of Fetal Hematopoietic Stem Cells by Affecting the Expression of Key Transcription Factors Dimitris Karamitros1,*, Alexandra L
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 70-81 doi:10.1242/dev.109454 RESEARCH ARTICLE STEM CELLS AND REGENERATION Geminin deletion increases the number of fetal hematopoietic stem cells by affecting the expression of key transcription factors Dimitris Karamitros1,*, Alexandra L. Patmanidi1,*, Panoraia Kotantaki1, Alexandre J. Potocnik2, Tomi Bähr-Ivacevic3, Vladimir Benes3, Zoi Lygerou4, Dimitris Kioussis2,‡ and Stavros Taraviras1,‡ ABSTRACT hematological stress and challenges (Beerman et al., 2010; Balancing stem cell self-renewal and initiation of lineage specification Cheshier et al., 2007). The prevailing model of hematopoiesis programs is essential for the development and homeostasis of the supports the existence of long-term hematopoietic stem cells (LT- hematopoietic system. We have specifically ablated geminin in the HSCs), which can provide long-term multipotent reconstitution of developing murine hematopoietic system and observed profound the hematopoietic system, and of short-term hematopoietic stem defects in the generation of mature blood cells, leading to embryonic cells (ST-HSCs) or multipotent progenitors (MPPs), with the lethality. Hematopoietic stem cells (HSCs) accumulated in the fetal potential to generate all blood lineages but with reduced self- liver following geminin ablation, while committed progenitors were renewal capacity (Luc et al., 2007; Mebius et al., 2001; Morrison reduced. Genome-wide transcriptome analysis identified key HSC et al., 1995; Randall et al., 1996; Traver et al., 2001). transcription factors as being upregulated upon geminin deletion, Even though it remains unclear how the balance between self- revealing a gene network linked with geminin that controls fetal renewal of HSCs and fate commitment is controlled and how a hematopoiesis.
    [Show full text]
  • C/Ebpα Is an Essential Collaborator in Hoxa9/Meis1-Mediated Leukemogenesis
    C/EBPα is an essential collaborator in Hoxa9/Meis1-mediated leukemogenesis Cailin Collinsa, Jingya Wanga, Hongzhi Miaoa, Joel Bronsteina, Humaira Nawera, Tao Xua, Maria Figueroaa, Andrew G. Munteana, and Jay L. Hessa,b,1 aDepartment of Pathology, University of Michigan, Ann Arbor, MI 48109; and bIndiana University School of Medicine, Indianapolis, IN 46202 Edited* by Louis M. Staudt, National Institutes of Health, Bethesda, MD, and approved May 19, 2014 (received for review February 12, 2014) Homeobox A9 (HOXA9) is a homeodomain-containing transcrip- with Hoxa9. In addition, C/EBP recognition motifs are enriched tion factor that plays a key role in hematopoietic stem cell expan- at Hoxa9 binding sites. sion and is commonly deregulated in human acute leukemias. A C/EBPα is a basic leucine-zipper transcription factor that plays variety of upstream genetic alterations in acute myeloid leukemia a critical role in lineage commitment during hematopoietic dif- −/− (AML) lead to overexpression of HOXA9, almost always in associ- ferentiation (18). Whereas Cebpa mice show complete loss of ation with overexpression of its cofactor meis homeobox 1 (MEIS1). the granulocytic compartment, recent work shows that loss of α A wide range of data suggests that HOXA9 and MEIS1 play a syn- C/EBP in adult HSCs leads to both an increase in the number ergistic causative role in AML, although the molecular mechanisms of functional HSCs and an increase in their proliferative and leading to transformation by HOXA9 and MEIS1 remain elusive. In repopulating capacity (19, 20). Conversely, CEBPA overexpression can promote transdifferentiation of a variety of fibroblastic cells to this study, we identify CCAAT/enhancer binding protein alpha (C/ the myeloid lineage and can induce monocytic differentiation in EBPα) as a critical collaborator required for Hoxa9/Meis1-mediated α MLL-fusion protein-mediated leukemias (21, 22).
    [Show full text]
  • Supplementary Materials
    Supplementary Materials + - NUMB E2F2 PCBP2 CDKN1B MTOR AKT3 HOXA9 HNRNPA1 HNRNPA2B1 HNRNPA2B1 HNRNPK HNRNPA3 PCBP2 AICDA FLT3 SLAMF1 BIC CD34 TAL1 SPI1 GATA1 CD48 PIK3CG RUNX1 PIK3CD SLAMF1 CDKN2B CDKN2A CD34 RUNX1 E2F3 KMT2A RUNX1 T MIXL1 +++ +++ ++++ ++++ +++ 0 0 0 0 hematopoietic potential H1 H1 PB7 PB6 PB6 PB6.1 PB6.1 PB12.1 PB12.1 Figure S1. Unsupervised hierarchical clustering of hPSC-derived EBs according to the mRNA expression of hematopoietic lineage genes (microarray analysis). Hematopoietic-competent cells (H1, PB6.1, PB7) were separated from hematopoietic-deficient ones (PB6, PB12.1). In this experiment, all hPSCs were tested in duplicate, except PB7. Genes under-expressed or over-expressed in blood-deficient hPSCs are indicated in blue and red respectively (related to Table S1). 1 C) Mesoderm B) Endoderm + - KDR HAND1 GATA6 MEF2C DKK1 MSX1 GATA4 WNT3A GATA4 COL2A1 HNF1B ZFPM2 A) Ectoderm GATA4 GATA4 GSC GATA4 T ISL1 NCAM1 FOXH1 NCAM1 MESP1 CER1 WNT3A MIXL1 GATA4 PAX6 CDX2 T PAX6 SOX17 HBB NES GATA6 WT1 SOX1 FN1 ACTC1 ZIC1 FOXA2 MYF5 ZIC1 CXCR4 TBX5 PAX6 NCAM1 TBX20 PAX6 KRT18 DDX4 TUBB3 EPCAM TBX5 SOX2 KRT18 NKX2-5 NES AFP COL1A1 +++ +++ 0 0 0 0 ++++ +++ ++++ +++ +++ ++++ +++ ++++ 0 0 0 0 +++ +++ ++++ +++ ++++ 0 0 0 0 hematopoietic potential H1 H1 H1 H1 H1 H1 PB6 PB6 PB7 PB7 PB6 PB6 PB7 PB6 PB6 PB6.1 PB6.1 PB6.1 PB6.1 PB6.1 PB6.1 PB12.1 PB12.1 PB12.1 PB12.1 PB12.1 PB12.1 Figure S2. Unsupervised hierarchical clustering of hPSC-derived EBs according to the mRNA expression of germ layer differentiation genes (microarray analysis) Selected ectoderm (A), endoderm (B) and mesoderm (C) related genes differentially expressed between hematopoietic-competent (H1, PB6.1, PB7) and -deficient cells (PB6, PB12.1) are shown (related to Table S1).
    [Show full text]
  • HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2007-02-28 HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes Mohammad Q. Hassan University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Repository Citation Hassan MQ, Tare RS, Lee SH, Mandeville M, Weiner B, Montecino MA, Van Wijnen AJ, Stein JL, Stein GS, Lian JB. (2007). HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes. Open Access Articles. https://doi.org/10.1128/MCB.01544-06. Retrieved from https://escholarship.umassmed.edu/oapubs/1334 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. MOLECULAR AND CELLULAR BIOLOGY, May 2007, p. 3337–3352 Vol. 27, No. 9 0270-7306/07/$08.00ϩ0 doi:10.1128/MCB.01544-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved. HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genesᰔ Mohammad Q. Hassan,1 Rahul Tare,1† Suk Hee Lee,1 Matthew Mandeville,1 Brian Weiner,1 Martin Montecino,2 Andre J. van Wijnen,1 Janet L. Stein,1 Gary S. Stein,1 and Jane B. Lian1* Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, Massachusetts 01655,1 and Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Biologicas, Universidad de Concepcion, Concepcion, Chile2 Received 18 August 2006/Returned for modification 4 October 2006/Accepted 9 February 2007 HOXA10 is necessary for embryonic patterning of skeletal elements, but its function in bone formation beyond this early developmental stage is unknown.
    [Show full text]
  • Genequery™ Human Stem Cell Transcription Factors Qpcr Array
    GeneQuery™ Human Stem Cell Transcription Factors qPCR Array Kit (GQH-SCT) Catalog #GK125 Product Description ScienCell's GeneQuery™ Human Stem Cell Transcription Factors qPCR Array Kit (GQH-SCT) surveys a panel of 88 transcription factors related to stem cell maintenance and differentiation. Transcription factors are proteins that can regulate target gene transcription level by binding to specific regions of the genome known as enhancers or silencers. Brief examples of how genes may be grouped according to their functions are shown below: • Pluripotency transcription factors: NANOG, POU5F1, SOX2 • Embryonic development: EOMES, FOXC2/D3/O1, HOXA9/A10, KLF2/5, LIN28B, MAX, PITX2, SMAD1, TBX5, ZIC1 • Germ layer formation and differentiation: FOXA2, GATA6, HAND1, ISL1, KLF4, SMAD2, SOX9 • Organ morphogenesis: EZH2, HOXA11/B3/B5/C9, MSX2, MYC, PAX5/8, VDR • Angiogenesis: CDX2, JUN, NR2F2, RUNX1, WT1 • Hematopoiesis and osteogenesis: EGR3, ESR1, GATA1/2/3, GLI2, NFATC1, PAX9, RB1, SOX6, SP1, STAT1 • Neural stem cell maintenance and differentiation: ATF2, CREB1, FOSB, FOXO3, HES1, HOXD10, MCM2/7, MEF2C, NEUROD1/G1, OLIG1/2, PAX3/6, POU4F1, PPARG, SMAD3/4, SNAI1, STAT3 Note : all gene names follow their official symbols by the Human Genome Organization Gene Nomenclature Committee (HGNC). GeneQuery™ qPCR array kits are qPCR ready in a 96-well plate format, with each well containing one primer set that can specifically recognize and efficiently amplify a target gene's cDNA. The carefully designed primers ensure that: (i) the optimal annealing temperature in qPCR analysis is 65°C (with 2 mM Mg 2+ , and no DMSO); (ii) the primer set recognizes all known transcript variants of target gene, unless otherwise indicated; and (iii) only one gene is amplified.
    [Show full text]
  • Association Between Vitamin D Receptor Rs731236 (Taq1
    Medicine® OBSERVATIONAL STUDY Association Between Vitamin D Receptor rs731236 (Taq1) Polymorphism and Risk for Restless Legs Syndrome in the Spanish Caucasian Population Fe´lix Javier Jime´nez-Jime´nez, MD, PhD, Elena Garcı´a-Martı´n, MD, PhD, Hortensia Alonso-Navarro, MD, PhD, Carmen Martı´nez, MD, PhD, Martı´n Zurdo, MD, Laura Turpı´n-Fenoll, MD, PhD, Jorge Milla´n-Pascual, MD, Teresa Adeva-Bartolome´, MD, PhD, Esther Cubo, MD, PhD, Francisco Navacerrada, MD, Ana Rojo-Sebastia´n, MD, Lluisa Rubio, MD, Sara Ortega-Cubero, MD, Pau Pastor, MD, PhD, Marisol Calleja, CN, Jose´ Francisco Plaza-Nieto, Bele´n Pilo-De-La-Fuente, MD, PhD, Margarita Arroyo-Solera, MD, Esteban Garcı´a-Albea, MD, PhD, and Jose´ A.G. Agu´ndez, MD, PhD Abstract: Several recent works suggest a possible role of vitamin D carrying the allelic variant rs731236G had an earlier age at onset, and deficiency in the etiology or restless legs syndrome (RLS). We analyzed those carrying the rs731236GG genotype had higher severity of RLS, the possible relationship of 2 common single nucleotide polymorphisms although these data disappeared after multivariate analyses. None of (SNPs) in the vitamin D3 receptor (VDR) gene with the risk for RLS. the SNPs studied was related with the positivity of family history of We studied the genotype and allelic variant frequencies of VDR RLS. rs2228570 and VDR rs731236 SNPs in 205 RLS patients and 445 These results suggest a modest, but significant association between healthy controls using a TaqMan essay. VDR rs731236 SNP and the risk for RLS. The frequencies of the rs731236AA genotype and the allelic variant (Medicine 94(47):e2125) rs731236A were significantly lower in RLS patients than in controls (P < 0.005 and < 0.01, respectively).
    [Show full text]