Association Between Vitamin D Receptor Rs731236 (Taq1
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 - 
												
												Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy
Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy by Ian Lawrence Belle Department of Immunology Duke University Date:_______________________ Approved: ___________________________ Yuan Zhuang, Supervisor ___________________________ Michael Krangel, Chair ___________________________ Qi-jing Li ___________________________ Richard Lee Reinhardt ___________________________ Arno Greenleaf Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunology in the Graduate School of Duke University 2015 ABSTRACT Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy by Ian Lawrence Belle Department of Immunology Duke University Date:_______________________ Approved: ___________________________ Yuan Zhuang, Supervisor ___________________________ Michael Krangel, Chair ___________________________ Qi-jing Li ___________________________ Richard Lee Reinhardt ___________________________ Arno Greenleaf An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunology in the Graduate School of Duke University 2015 Copyright by Ian Lawrence Belle 2015 Abstract Within the field of immunology, the existence of autoimmune diseases presents a unique set of challenges. The immune system typically protects the host by identifying foreign pathogens and mounting an appropriate response to eliminate them. Great strides have been made in understanding how foreign pathogens are identified and responded to, leading to the development of powerful immunological tools, such as vaccines and a myriad of models used to study infectious diseases and processes. However, it is occasionally possible for host tissues themselves to be inappropriately identified as foreign, prompting an immune response that attempts to eliminate the host tissue. The immune system has processes in place, referred to as selection, designed to prevent the development of cells capable of recognizing the self as foreign. - 
												
												Based Mechanism Study on the Beneficial Effects of Vitamin D
www.nature.com/scientificreports OPEN Network Systems Pharmacology- Based Mechanism Study on the Benefcial Efects of Vitamin D against Psychosis in Alzheimer’s Disease Peihao Fan1, Xiguang Qi1, Robert A. Sweet2,3* & Lirong Wang1* Alzheimer’s disease (AD) is a chronic neurodegenerative disease with signifcant fnancial costs and negative impacts on quality of life. Psychotic symptoms, i.e., the presence of delusions and/ or hallucinations, is a frequent complication of AD. About 50% of AD patients will develop psychotic symptoms (AD with Psychosis, or AD + P) and these patients will experience an even more rapid cognitive decline than AD patients without psychosis (AD-P). In a previous analysis on medication records of 776 AD patients, we had shown that use of Vitamin D was associated with delayed time to psychosis in AD patients and Vitamin D was used more by AD-P than AD + P patients. To explore the potential molecular mechanism behind our fndings, we applied systems pharmacology approaches to investigate the crosstalk between AD and psychosis. Specifcally, we built protein-protein interaction (PPI) networks with proteins encoded by AD- and psychosis-related genes and Vitamin D-perturbed genes. Using network analysis we identifed several high-impact genes, including NOTCH4, COMT, CACNA1C and DRD3 which are related to calcium homeostasis. The new fndings highlight the key role of calcium-related signaling pathways in AD + P development and may provide a new direction and facilitate hypothesis generation for future drug development. Alzheimer’s disease (AD) is a chronic neurodegenerative disease commonly seen in the aging population, and the presence of AD is responsible for a signifcant decrease in the quality of life1. - 
												
												SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line - 
												
												A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons. - 
												
												Targeting Chromatin Regulators Inhibits Leukemogenic Gene Expression in NPM1 Mutant Leukemia
Published OnlineFirst August 17, 2016; DOI: 10.1158/2159-8290.CD-16-0237 RESEARCH ARTICLE Targeting Chromatin Regulators Inhibits Leukemogenic Gene Expression in NPM1 Mutant Leukemia Michael W.M. Kühn1,2, Evelyn Song1, Zhaohui Feng1, Amit Sinha1, Chun-Wei Chen1, Aniruddha J. Deshpande1, Monica Cusan1, Noushin Farnoud1, Annalisa Mupo3, Carolyn Grove4,5, Richard Koche1, James E. Bradner6, Elisa de Stanchina7, George S. Vassiliou3, Takayuki Hoshii1, and Scott A. Armstrong1,8 ABSTRACT Homeobox (HOX) proteins and the receptor tyrosine kinase FLT3 are frequently highly expressed and mutated in acute myeloid leukemia (AML). Aberrant HOX expression is found in nearly all AMLs that harbor a mutation in the Nucleophosmin (NPM1) gene, and FLT3 is concomitantly mutated in approximately 60% of these cases. Little is known about how mutant NPM1 (NPM1mut) cells maintain aberrant gene expression. Here, we demonstrate that the histone modi- fiers MLL1 and DOT1L controlHOX and FLT3 expression and differentiation in NPM1mut AML. Using a CRISPR/Cas9 genome editing domain screen, we show NPM1mut AML to be exceptionally dependent on the menin binding site in MLL1. Pharmacologic small-molecule inhibition of the menin–MLL1 protein interaction had profound antileukemic activity in human and murine models of NPM1mut AML. Combined pharmacologic inhibition of menin–MLL1 and DOT1L resulted in dramatic suppression of HOX and FLT3 expression, induction of differentiation, and superior activity against NPM1mut leukemia. SIGNIFICANCE: MLL1 and DOT1L are chromatin regulators that control HOX, MEIS1, and FLT3 expres- sion and are therapeutic targets in NPM1mut AML. Combinatorial small-molecule inhibition has synergistic on-target activity and constitutes a novel therapeutic concept for this common AML subtype. - 
												
												The Sumo Proteome of Proliferating and Neuronal-Differentiating Cells Reveals Utf1 Among Key Sumo Targets Involved in Neurogenesis Juan F
Correa-Vázquez et al. Cell Death and Disease (2021) 12:305 https://doi.org/10.1038/s41419-021-03590-2 Cell Death & Disease ARTICLE Open Access The Sumo proteome of proliferating and neuronal-differentiating cells reveals Utf1 among key Sumo targets involved in neurogenesis Juan F. Correa-Vázquez1, Francisco Juárez-Vicente 1, Pablo García-Gutiérrez1,SinaV.Barysch2,FraukeMelchior 2 and Mario García-Domínguez 1 Abstract Post-translational modification by covalent attachment of the Small ubiquitin-like modifier (Sumo) polypeptide regulates a multitude of processes in vertebrates. Despite demonstrated roles of Sumo in the development and function of the nervous system, the identification of key factors displaying a sumoylation-dependent activity during neurogenesis remains elusive. Through a SILAC (stable isotope labeling by/with amino acids in cell culture)-based proteomic approach, we have identified the Sumo proteome of the model cell line P19 under proliferation and neuronal differentiation conditions. More than 300 proteins were identified as putative Sumo targets differentially associated with one or the other condition. A group of proteins of interest were validated and investigated in functional studies. Among these, Utf1 was revealed as a new Sumo target. Gain-of-function experiments demonstrated marked differences between the effects on neurogenesis of overexpressing wild-type and sumoylation mutant versions of the selected proteins. While sumoylation of Prox1, Sall4a, Trim24, and Utf1 was associated with a positive effect on neurogenesis in P19 cells, sumoylation of Kctd15 was associated with a negative effect. Prox1, Sall4a, and 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Kctd15 were further analyzed in the vertebrate neural tube of living embryos, with similar results. - 
												
												Deciphering Mechanisms of Diapause Entry and Exit in the Annual Killifish Austrofundulus Limnaeus
Portland State University PDXScholar Dissertations and Theses Dissertations and Theses 4-15-2021 Connecting Environment and Phenotype: Deciphering Mechanisms of Diapause Entry and Exit in the Annual Killifish Austrofundulus limnaeus Erin Monica Davis Portland State University Follow this and additional works at: https://pdxscholar.library.pdx.edu/open_access_etds Part of the Animal Sciences Commons, and the Biology Commons Let us know how access to this document benefits ou.y Recommended Citation Davis, Erin Monica, "Connecting Environment and Phenotype: Deciphering Mechanisms of Diapause Entry and Exit in the Annual Killifish Austrofundulus limnaeus" (2021). Dissertations and Theses. Paper 5680. https://doi.org/10.15760/etd.7552 This Thesis is brought to you for free and open access. It has been accepted for inclusion in Dissertations and Theses by an authorized administrator of PDXScholar. Please contact us if we can make this document more accessible: [email protected]. Connecting Environment and Phenotype: Deciphering Mechanisms of Diapause Entry and Exit in the Annual Killifish Austrofundulus limnaeus by Erin Monica Davis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology Thesis Committee: Jason Podrabsky, Chair Deborah Duffield Annie Lindgren Portland State University 2021 ©2021 Erin Monica Davis ABSTRACT Embryonic development is complex, dynamic, and dependent on environmental factors. Mechanisms of sensing and integrating environmental stimuli are diverse, and understanding these mechanisms in extant species can elucidate how complex phenotypes emerge from genomic information expressed in an environmental context. In Austrofundulus limnaeus, an annual killifish with alternative developmental trajectories, light and temperature are vital factors that determine if an embryo will enter a state of diapause. - 
												
												Frequent Co-Expression of the HOXA9 and MEIS1 Homeobox Genes in Human Myeloid Leukemias
Leukemia (1999) 13, 1993–1999 1999 Stockton Press All rights reserved 0887-6924/99 $15.00 http://www.stockton-press.co.uk/leu Frequent co-expression of the HOXA9 and MEIS1 homeobox genes in human myeloid leukemias HJ Lawrence1, S Rozenfeld1, C Cruz1, K Matsukuma1, A Kwong1,LKo¨mu¨ves1, AM Buchberg2 and C Largman1 1Division of Hematology and Medical Oncology, Department of Medicine, University of California VA Medical Center, San Francisco, CA; and 2Kimmel Cancer Center, Jefferson Medical College, Philadelphia, PA, USA There is increasing evidence that HOX homeobox genes play these leukemias.12 Recent work has shown that the engine- a role in leukemogenesis. Recent studies have demonstrated ered co-expression of the Hoxa-9 and Meis1 genes in murine that enforced co-expression of HOXA9 and MEIS1 in murine 13 marrow leads to rapid development of myeloid leukemia, and hematopoietic cells leads to rapid development of AML, that these proteins exhibit cooperative DNA binding. However, indicating a synergy between the two genes and suggesting it is unclear whether co-activation of HOXA9 and MEIS genes that co-activation of these genes is sufficient for transform- is a common occurrence in human leukemias. We surveyed ation. expression of HOXA9 and MEIS1 in 24 leukemic cell lines and We have recently demonstrated that HOXA9 and HOXA10 80 patient samples, using RNase protection analyses and proteins can interact with the MEIS1 protein and stabilize immunohistochemistry. We demonstrate that the expression of 14 HOXA9 and MEIS1 in leukemia cells is uniquely myeloid, and MEIS1-DNA interactions on consensus binding sites. These that these genes are commonly co-expressed in myeloid cell data support the notion that the leukemogenicity of the lines and in samples of acute myelogenous leukemia (AML) of HOXA9 and MEIS1 genes is related to the concerted actions all subtypes except in promyelocytic leukemia. - 
												
												Novel Mechanisms of Transcriptional Regulation by Leukemia Fusion Proteins
Novel mechanisms of transcriptional regulation by leukemia fusion proteins A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirement for the degree of Doctor of Philosophy in the Department of Cancer and Cell Biology of the College of Medicine by Chien-Hung Gow M.S. Columbia University, New York M.D. Our Lady of Fatima University B.S. National Yang Ming University Dissertation Committee: Jinsong Zhang, Ph.D. Robert Brackenbury, Ph.D. Sohaib Khan, Ph.D. (Chair) Peter Stambrook, Ph.D. Song-Tao Liu, Ph.D. ABSTRACT Transcription factors and chromatin structure are master regulators of homeostasis during hematopoiesis. Regulatory genes for each stage of hematopoiesis are activated or silenced in a precise, finely tuned manner. Many leukemia fusion proteins are produced by chromosomal translocations that interrupt important transcription factors and disrupt these regulatory processes. Leukemia fusion proteins E2A-Pbx1 and AML1-ETO involve normal function transcription factor E2A, resulting in two distinct types of leukemia: E2A-Pbx1 t(1;19) acute lymphoblastic leukemia (ALL) and AML1-ETO t(8;21) acute myeloid leukemia (AML). E2A, a member of the E-protein family of transcription factors, is a key regulator in hematopoiesis that recruits coactivators or corepressors in a mutually exclusive fashion to regulate its direct target genes. In t(1;19) ALL, the E2A portion of E2A-Pbx1 mediates a robust transcriptional activation; however, the transcriptional activity of wild-type E2A is silenced by high levels of corepressors, such as the AML1-ETO fusion protein in t(8;21) AML and ETO-2 in hematopoietic cells. - 
												
												NKX2-5: an Update on This Hypermutable Homeodomain Protein and Its Role in Human Congenital Heart Disease (CHD) Stella Marie Reamon-Buettner, Juergen T Borlak
NKX2-5: An Update on this Hypermutable Homeodomain Protein and its Role in Human Congenital Heart Disease (CHD) Stella Marie Reamon-Buettner, Juergen T Borlak To cite this version: Stella Marie Reamon-Buettner, Juergen T Borlak. NKX2-5: An Update on this Hypermutable Home- odomain Protein and its Role in Human Congenital Heart Disease (CHD). Human Mutation, Wiley, 2010, 31 (11), pp.1185. 10.1002/humu.21345. hal-00585168 HAL Id: hal-00585168 https://hal.archives-ouvertes.fr/hal-00585168 Submitted on 12 Apr 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Human Mutation NKX2-5: An Update on this Hypermutable Homeodomain Protein and its Role in Human Congenital Heart Disease (CHD) For Peer Review Journal: Human Mutation Manuscript ID: humu-2010-0256.R1 Wiley - Manuscript type: Review Date Submitted by the 15-Jul-2010 Author: Complete List of Authors: Reamon-Buettner, Stella Marie; Fraunhofer Institute of Toxicology and Experimental Medicine, Molecular Medicine and Medical Biotechnology Borlak, Juergen; Fraunhofer Institute of Toxicology and Experimental Medicine, Molecular Medicine and Medical Biotechnology heart development, congenital heart disease, cardiac Key Words: malformations, transcription factors, NKX2-5, mutations John Wiley & Sons, Inc. - 
												
												Identification and Functional Validation of Novel Foxp2 Regulatory Transcription Factors in Human Cell Lines
IDENTIFICATION AND FUNCTIONAL VALIDATION OF NOVEL FOXP2 REGULATORY TRANSCRIPTION FACTORS IN HUMAN CELL LINES Quimbaya, Mauricio1 and España, Jina Marcela1 1Pontificia Universidad Javeriana Cali, Colombia ABSTRACT Different types of genetic analyzes based on individuals with different hereditary forms of speech disorders, such as verbal dyspraxia and some types of autism, have allowed the identification of specific genes closely associated with the disorders mentioned above. In humans, the transcription factor FOXP2 has been widely studied. Mutations in FOXP2 are directly associated with inherited verbal dyspraxia and speech disorders. However, there is little experimental evidence on which genes or transcription factors directly regulate FOXP2, from this point of view, it is essential to determine the transcriptional regulators that act upstream of FOXP2. The identification of new transcription factors associated with FOXP2 regulation will allow the construction of more holistic and inclusive networks, providing an important advance in the identification of molecular pathways involved in the establishment of neural circuit associated with the evolution of vertebrate communication skills. In the same way, the identification of specific regulatory elements that control FOXP2 expression could be of great importance for the appearance of new therapies to prevent or control nervous system development pathologies, specifically those related to speech and language. Here, four transcription factors were chose to evaluate their regulation function with FOXP2. POU3F2 and TBR1 showed great significance in the study since both confirmed a positive FOXP2 regulation and have special roles in the nervous system development. INTRODUCTION Language and communication are inherent characteristics of the human brain with great importance in the establishment of social relations.