DOCSLIB.ORG

Mouse Ndufb4 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Ndufb4 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ndufb4 Knockout Project (CRISPR/Cas9) Objective: To create a Ndufb4 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ndufb4 gene (NCBI Reference Sequence: NM_026610 ; Ensembl: ENSMUSG00000022820 ) is located on Mouse chromosome 16. 3 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 3 (Transcript: ENSMUST00000023514). Exon 1~3 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 1 starts from about 0.26% of the coding region. Exon 1~3 covers 100.0% of the coding region. The size of effective KO region: ~6698 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 Legends Exon of mouse Ndufb4 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(25.0% 500) | C(21.65% 433) | T(29.1% 582) | G(24.25% 485) Note: The 2000 bp section upstream of start codon is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(27.45% 549) | C(23.0% 460) | T(23.95% 479) | G(25.6% 512) Note: The 2000 bp section downstream of stop codon is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr16 - 37654360 37656359 2000 browser details YourSeq 248 889 1402 2000 87.6% chr9 - 57429769 57430335 567 browser details YourSeq 234 897 1400 2000 87.8% chr4 + 39682659 39683231 573 browser details YourSeq 230 899 1308 2000 88.4% chr18 + 24333957 24334408 452 browser details YourSeq 218 897 1401 2000 85.5% chr13 + 44939148 44939692 545 browser details YourSeq 217 907 1354 2000 90.5% chr1 - 86061125 86150917 89793 browser details YourSeq 215 895 1409 2000 86.8% chr1 - 35981614 35982161 548 browser details YourSeq 210 910 1409 2000 89.5% chr3 - 79394084 79394637 554 browser details YourSeq 210 897 1297 2000 90.2% chr3 - 58078678 58079110 433 browser details YourSeq 208 895 1354 2000 90.8% chrX - 163024750 163233302 208553 browser details YourSeq 208 909 1412 2000 83.0% chr12 - 106169552 106170046 495 browser details YourSeq 206 899 1407 2000 87.4% chr3 - 69506244 69506771 528 browser details YourSeq 206 895 1407 2000 88.2% chr2 - 32122110 32122640 531 browser details YourSeq 203 895 1409 2000 87.2% chr1 + 75342245 75342793 549 browser details YourSeq 201 910 1407 2000 86.3% chr2 - 84056876 84057402 527 browser details YourSeq 198 904 1402 2000 88.2% chr19 + 28872676 28873256 581 browser details YourSeq 198 907 1411 2000 89.3% chr14 + 61325897 61326463 567 browser details YourSeq 193 923 1354 2000 86.8% chr7 - 144078362 144078808 447 browser details YourSeq 185 996 1410 2000 89.5% chr5 - 149925262 150357136 431875 browser details YourSeq 184 996 1410 2000 87.7% chr15 + 76993167 76993712 546 Note: The 2000 bp section upstream of start codon is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr16 - 37645660 37647659 2000 browser details YourSeq 56 1452 1510 2000 98.4% chr1 - 93834108 93834176 69 browser details YourSeq 56 1448 1508 2000 96.8% chr16 + 18425129 18425191 63 browser details YourSeq 55 1452 1508 2000 98.3% chr15 - 59578240 59578296 57 browser details YourSeq 55 1452 1508 2000 98.3% chr9 + 59545631 59545687 57 browser details YourSeq 55 1452 1508 2000 98.3% chr19 + 23037920 23037976 57 browser details YourSeq 55 1452 1508 2000 98.3% chr16 + 4580746 4580802 57 browser details YourSeq 54 1452 1510 2000 96.7% chr2 + 13075110 13075170 61 browser details YourSeq 54 1 60 2000 89.5% chr19 + 25033529 25033585 57 browser details YourSeq 53 1452 1506 2000 98.2% chr9 - 110510058 110510112 55 browser details YourSeq 53 1452 1504 2000 100.0% chr9 - 74753100 74753152 53 browser details YourSeq 53 1452 1508 2000 96.5% chr18 + 17714331 17714387 57 browser details YourSeq 52 1452 1510 2000 95.0% chrX - 136880271 136880331 61 browser details YourSeq 51 1452 1508 2000 94.8% chrX - 104429545 104429601 57 browser details YourSeq 51 1452 1508 2000 94.8% chr6 + 13558666 13558722 57 browser details YourSeq 50 1 57 2000 94.7% chr5 - 26859911 26859969 59 browser details YourSeq 49 1452 1504 2000 96.3% chr3 - 38315760 38315812 53 browser details YourSeq 48 1 52 2000 96.2% chr15 - 73809458 73809509 52 browser details YourSeq 44 1453 1496 2000 100.0% chr17 - 36986358 36986401 44 browser details YourSeq 42 1 49 2000 93.8% chr7 - 100738003 100738053 51 Note: The 2000 bp section downstream of stop codon is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Ndufb4 NADH:ubiquinone oxidoreductase subunit B4 [ Mus musculus (house mouse) ] Gene ID: 68194, updated on 10-Oct-2019 Gene summary Official Symbol Ndufb4 provided by MGI Official Full Name NADH:ubiquinone oxidoreductase subunit B4 provided by MGI Primary source MGI:MGI:1915444 See related Ensembl:ENSMUSG00000022820 Gene type protein coding RefSeq status PROVISIONAL Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as 0610006N12Rik; 1300010H20Rik Expression Ubiquitous expression in kidney adult (RPKM 303.2), heart adult (RPKM 262.0) and 28 other tissues See more Orthologs human all Genomic context Location: 16; 16 B3 See Ndufb4 in Genome Data Viewer Exon count: 3 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 16 NC_000082.6 (37647602..37654368, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 16 NC_000082.5 (37647688..37654454, complement) Chromosome 16 - NC_000082.6 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 3 transcripts Gene: Ndufb4 ENSMUSG00000022820 Description NADH:ubiquinone oxidoreductase subunit B4 [Source:MGI Symbol;Acc:MGI:1915444] Gene Synonyms 0610006N12Rik, 1300010H20Rik Location Chromosome 16: 37,647,170-37,654,453 reverse strand. GRCm38:CM001009.2 About this gene This gene has 3 transcripts (splice variants), 234 orthologues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ndufb4-201 ENSMUST00000023514.3 971 129aa ENSMUSP00000023514.3 Protein coding CCDS28161 Q9CQC7 TSL:1 GENCODE basic APPRIS P1 Ndufb4-203 ENSMUST00000231881.1 933 No protein - Retained intron - - - Ndufb4-202 ENSMUST00000135019.1 465 No protein - Retained intron - - TSL:2 27.28 kb Forward strand 37.64Mb 37.65Mb 37.66Mb Contigs < AC129539.11 Genes (Comprehensive set... < Ndufb4-201protein coding < Ndufb4-202retained intron < Ndufb4-203retained intron Regulatory Build 37.64Mb 37.65Mb 37.66Mb Reverse strand 27.28 kb Regulation Legend CTCF Enhancer Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Non-Protein Coding processed transcript Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000023514 < Ndufb4-201protein coding Reverse strand 7.28 kb ENSMUSP00000023... Transmembrane heli... PDB-ENSP mappings Pfam NADH:ubiquinone oxidoreductase, subunit NDUFB4 PANTHER NADH:ubiquinone oxidoreductase, subunit NDUFB4 PTHR15469:SF1 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 20 40 60 80 100 129 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Increased COUP-TFII Expression in Adult Hearts Induces Mitochondrial Dysfunction Resulting in Heart Failure
    ARTICLE Received 9 Mar 2015 | Accepted 30 Jul 2015 | Published 10 Sep 2015 DOI: 10.1038/ncomms9245 OPEN Increased COUP-TFII expression in adult hearts induces mitochondrial dysfunction resulting in heart failure San-Pin Wu1,2, Chung-Yang Kao1, Leiming Wang1, Chad J. Creighton3,4, Jin Yang5, Taraka R. Donti6, Romain Harmancey7, Hernan G. Vasquez7, Brett H. Graham6,8, Hugo J. Bellen6,8, Heinrich Taegtmeyer7, Ching-Pin Chang5, Ming-Jer Tsai1,8 & Sophia Y. Tsai1,8 Mitochondrial dysfunction and metabolic remodelling are pivotal in the development of cardiomyopathy. Here, we show that myocardial COUP-TFII overexpression causes heart failure in mice, suggesting a causal effect of elevated COUP-TFII levels on development of dilated cardiomyopathy. COUP-TFII represses genes critical for mitochondrial electron transport chain enzyme activity, oxidative stress detoxification and mitochondrial dynamics, resulting in increased levels of reactive oxygen species and lower rates of oxygen consumption in mitochondria. COUP-TFII also suppresses the metabolic regulator PGC-1 network and decreases the expression of key glucose and lipid utilization genes, leading to a reduction in both glucose and oleate oxidation in the hearts. These data suggest that COUP- TFII affects mitochondrial function, impairs metabolic remodelling and has a key role in dilated cardiomyopathy. Last, COUP-TFII haploinsufficiency attenuates the progression of cardiac dilation and improves survival in a calcineurin transgenic mouse model, indicating that COUP-TFII may serve as a therapeutic target for the treatment of dilated cardiomyopathy. 1 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030, USA. 2 Adrienne Helis Malvin Medical Research Foundation, New Orleans, Louisiana 70130, USA.
    [Show full text]
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • Mitoxplorer, a Visual Data Mining Platform To
    mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, Cecilia Garcia-Perez, José Villaveces, Salma Gamal, Giovanni Cardone, Fabiana Perocchi, et al. To cite this version: Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, et al.. mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dy- namics and mutations. Nucleic Acids Research, Oxford University Press, 2020, 10.1093/nar/gkz1128. hal-02394433 HAL Id: hal-02394433 https://hal-amu.archives-ouvertes.fr/hal-02394433 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gkz1128 Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gkz1128/5651332 by Bibliothèque de l'université la Méditerranée user on 04 December 2019 mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim1,†, Prasanna Koti1,†, Adrien Bonnard2, Fabio Marchiano3, Milena Durrbaum¨ 1, Cecilia Garcia-Perez4, Jose Villaveces1, Salma Gamal1, Giovanni Cardone1, Fabiana Perocchi4, Zuzana Storchova1,5 and Bianca H.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • WO 2017/070647 Al 27 April 2017 (27.04.2017) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/070647 Al 27 April 2017 (27.04.2017) P O P C T (51) International Patent Classification: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, A61K 31/455 (2006.01) C12N 15/86 (2006.01) KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, A61K 31/465 (2006.01) A61P 27/02 (2006.01) MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, A61K 31/19 (2006.01) A61P 27/06 (2006.01) OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, A61K 48/00 (2006.01) A61K 45/06 (2006.01) SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, (21) International Application Number: ZW. PCT/US2016/058388 (84) Designated States (unless otherwise indicated, for every (22) International Filing Date: kind of regional protection available): ARIPO (BW, GH, 24 October 2016 (24.10.201 6) GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (25) Filing Language: English TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (26) Publication Language: English DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (30) Priority Data: LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, 62/245,467 23 October 2015 (23.
    [Show full text]
  • Electron Transport Chain Activity Is a Predictor and Target for Venetoclax Sensitivity in Multiple Myeloma
    ARTICLE https://doi.org/10.1038/s41467-020-15051-z OPEN Electron transport chain activity is a predictor and target for venetoclax sensitivity in multiple myeloma Richa Bajpai1,7, Aditi Sharma 1,7, Abhinav Achreja2,3, Claudia L. Edgar1, Changyong Wei1, Arusha A. Siddiqa1, Vikas A. Gupta1, Shannon M. Matulis1, Samuel K. McBrayer 4, Anjali Mittal3,5, Manali Rupji 6, Benjamin G. Barwick 1, Sagar Lonial1, Ajay K. Nooka 1, Lawrence H. Boise 1, Deepak Nagrath2,3,5 & ✉ Mala Shanmugam 1 1234567890():,; The BCL-2 antagonist venetoclax is highly effective in multiple myeloma (MM) patients exhibiting the 11;14 translocation, the mechanistic basis of which is unknown. In evaluating cellular energetics and metabolism of t(11;14) and non-t(11;14) MM, we determine that venetoclax-sensitive myeloma has reduced mitochondrial respiration. Consistent with this, low electron transport chain (ETC) Complex I and Complex II activities correlate with venetoclax sensitivity. Inhibition of Complex I, using IACS-010759, an orally bioavailable Complex I inhibitor in clinical trials, as well as succinate ubiquinone reductase (SQR) activity of Complex II, using thenoyltrifluoroacetone (TTFA) or introduction of SDHC R72C mutant, independently sensitize resistant MM to venetoclax. We demonstrate that ETC inhibition increases BCL-2 dependence and the ‘primed’ state via the ATF4-BIM/NOXA axis. Further, SQR activity correlates with venetoclax sensitivity in patient samples irrespective of t(11;14) status. Use of SQR activity in a functional-biomarker informed manner may better select for MM patients responsive to venetoclax therapy. 1 Department of Hematology and Medical Oncology, Winship Cancer Institute, School of Medicine, Emory University, Atlanta, GA, USA.
    [Show full text]
  • C6orf203 Controls OXPHOS Function Through Modulation of Mitochondrial Protein Biosynthesis
    bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. C6orf203 controls OXPHOS function through modulation of mitochondrial protein biosynthesis number of characters excluding Materials and Methods: 40,651 Sara Palacios-Zambrano1,2, Luis Vázquez-Fonseca1,2, Cristina González-Páramos1,2, Laura Mamblona1,2, Laura Sánchez-Caballero3, Leo Nijtmans3, Rafael Garesse1,2 and Miguel Angel Fernández-Moreno1,2,* 1 Departamento de Bioquímica, Instituto de Investigaciones Biomédicas “Alberto Sols” UAM CSIC and Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER). Facultad de Medicina, Universidad Autónoma de Madrid. Madrid 28029, Spain. 2 Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Madrid 28041, Spain. 3 Department of Pediatrics, Radboud Center for Mitochondrial Medicine, Radboud University Medical Center, Nijmegen, The Netherlands. * To whom correspondence should be addressed. Tel:+34 91 497 31 29; Email: [email protected] Running title “C6orf203 controls mt-proteins synthesis” bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Mitochondria are essential organelles present in the vast majority of eukaryotic cells. Their central function is to produce cellular energy through the OXPHOS system, and functional alterations provoke so-called mitochondrial OXPHOS diseases. It is estimated that several hundred mitochondrial proteins have unknown functions. Very recently, C6orf203 was described to participate in mitochondrial transcription under induced mitochondrial DNA depletion stress conditions.
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]
  • Bayesian Hidden Markov Tree Models for Clustering Genes with Shared Evolutionary History
    Submitted to the Annals of Applied Statistics arXiv: arXiv:0000.0000 BAYESIAN HIDDEN MARKOV TREE MODELS FOR CLUSTERING GENES WITH SHARED EVOLUTIONARY HISTORY By Yang Liy,{,∗, Shaoyang Ningy,∗, Sarah E. Calvoz,x,{, Vamsi K. Moothak,z,x,{ and Jun S. Liuy Harvard Universityy, Broad Institutez, Harvard Medical Schoolx, Massachusetts General Hospital{, and Howard Hughes Medical Institutek Determination of functions for poorly characterized genes is cru- cial for understanding biological processes and studying human dis- eases. Functionally associated genes are often gained and lost together through evolution. Therefore identifying co-evolution of genes can predict functional gene-gene associations. We describe here the full statistical model and computational strategies underlying the orig- inal algorithm CLustering by Inferred Models of Evolution (CLIME 1.0) recently reported by us [Li et al., 2014]. CLIME 1.0 employs a mixture of tree-structured hidden Markov models for gene evolution process, and a Bayesian model-based clustering algorithm to detect gene modules with shared evolutionary histories (termed evolutionary conserved modules, or ECMs). A Dirichlet process prior was adopted for estimating the number of gene clusters and a Gibbs sampler was developed for posterior sampling. We further developed an extended version, CLIME 1.1, to incorporate the uncertainty on the evolution- ary tree structure. By simulation studies and benchmarks on real data sets, we show that CLIME 1.0 and CLIME 1.1 outperform traditional methods that use simple metrics (e.g., the Hamming distance or Pear- son correlation) to measure co-evolution between pairs of genes. 1. Introduction. The human genome encodes more than 20,000 protein- coding genes, of which a large fraction do not have annotated function to date [Galperin and Koonin, 2010].
    [Show full text]
  • Snps in Genes Coding for ROS Metabolism and Signalling in Association with Docetaxel Clearance
    The Pharmacogenomics Journal (2010) 10, 513–523 & 2010 Macmillan Publishers Limited. All rights reserved 1470-269X/10 www.nature.com/tpj ORIGINAL ARTICLE SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance H Edvardsen1,2, PF Brunsvig3, The dose of docetaxel is currently calculated based on body surface area 1,4 5 and does not reflect the pharmacokinetic, metabolic potential or genetic H Solvang , A Tsalenko , background of the patients. The influence of genetic variation on the 6 7 A Andersen , A-C Syvanen , clearance of docetaxel was analysed in a two-stage analysis. In step one, 583 Z Yakhini5, A-L Børresen-Dale1,2, single-nucleotide polymorphisms (SNPs) in 203 genes were genotyped on H Olsen6, S Aamdal3 and samples from 24 patients with locally advanced non-small cell lung cancer. 1,2 We found that many of the genes harbour several SNPs associated with VN Kristensen clearance of docetaxel. Most notably these were four SNPs in EGF, three SNPs 1Department of Genetics, Institute of Cancer in PRDX4 and XPC, and two SNPs in GSTA4, TGFBR2, TNFAIP2, BCL2, DPYD Research, Oslo University Hospital Radiumhospitalet, and EGFR. The multiple SNPs per gene suggested the existence of common Oslo, Norway; 2Institute of Clinical Medicine, haplotypes associated with clearance. These were confirmed with detailed 3 University of Oslo, Oslo, Norway; Cancer Clinic, haplotype analysis. On the basis of analysis of variance (ANOVA), quantitative Oslo University Hospital Radiumhospitalet, Oslo, Norway; 4Institute of
    [Show full text]
  • Transcriptomic and Proteomic Landscape of Mitochondrial
    TOOLS AND RESOURCES Transcriptomic and proteomic landscape of mitochondrial dysfunction reveals secondary coenzyme Q deficiency in mammals Inge Ku¨ hl1,2†*, Maria Miranda1†, Ilian Atanassov3, Irina Kuznetsova4,5, Yvonne Hinze3, Arnaud Mourier6, Aleksandra Filipovska4,5, Nils-Go¨ ran Larsson1,7* 1Department of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, Cologne, Germany; 2Department of Cell Biology, Institute of Integrative Biology of the Cell (I2BC) UMR9198, CEA, CNRS, Univ. Paris-Sud, Universite´ Paris-Saclay, Gif- sur-Yvette, France; 3Proteomics Core Facility, Max Planck Institute for Biology of Ageing, Cologne, Germany; 4Harry Perkins Institute of Medical Research, The University of Western Australia, Nedlands, Australia; 5School of Molecular Sciences, The University of Western Australia, Crawley, Australia; 6The Centre National de la Recherche Scientifique, Institut de Biochimie et Ge´ne´tique Cellulaires, Universite´ de Bordeaux, Bordeaux, France; 7Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden Abstract Dysfunction of the oxidative phosphorylation (OXPHOS) system is a major cause of human disease and the cellular consequences are highly complex. Here, we present comparative *For correspondence: analyses of mitochondrial proteomes, cellular transcriptomes and targeted metabolomics of five [email protected] knockout mouse strains deficient in essential factors required for mitochondrial DNA gene (IKu¨ ); expression, leading to OXPHOS dysfunction. Moreover,
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa Gene Symbol NDUFB4 Organism Human Gene Summary This gene encodes a non-catalytic subunit of the multisubunit NADH:ubiquinone oxidoreductase the first enzyme complex in the mitochondrial electron transport chain (complex I). Mammalian complex I is composed of 45 different subunits and transfers electrons from NADH to ubiquinone. Gene Aliases B15, CI-B15, MGC5105 RefSeq Accession No. NC_000003.11, NT_005612.16 UniGene ID Hs.304613 Ensembl Gene ID ENSG00000065518 Entrez Gene ID 4710 Assay Information Unique Assay ID qHsaCEP0041283 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000184266, ENST00000485064, ENST00000492739 Amplicon Context Sequence CAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGT CGAGCCTGCGCACTCTGCCTGAGACCCTCGACCCAGCCGAATACAACATATCTC CGGAAACCCGGCGGGCGCAAGCCGAGCGGTTGGCCATAAGAGCCCAGCTGAA ACGAGAGTACCT Amplicon Length (bp) 142 Chromosome Location 3:120315178-120315349 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9997 cDNA Cq 18.56 cDNA Tm (Celsius) 88.5 gDNA Cq 23.17 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report NDUFB4, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of
    [Show full text]