Mouse Ndufb4 Knockout Project (CRISPR/Cas9)
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Increased COUP-TFII Expression in Adult Hearts Induces Mitochondrial Dysfunction Resulting in Heart Failure
ARTICLE Received 9 Mar 2015 | Accepted 30 Jul 2015 | Published 10 Sep 2015 DOI: 10.1038/ncomms9245 OPEN Increased COUP-TFII expression in adult hearts induces mitochondrial dysfunction resulting in heart failure San-Pin Wu1,2, Chung-Yang Kao1, Leiming Wang1, Chad J. Creighton3,4, Jin Yang5, Taraka R. Donti6, Romain Harmancey7, Hernan G. Vasquez7, Brett H. Graham6,8, Hugo J. Bellen6,8, Heinrich Taegtmeyer7, Ching-Pin Chang5, Ming-Jer Tsai1,8 & Sophia Y. Tsai1,8 Mitochondrial dysfunction and metabolic remodelling are pivotal in the development of cardiomyopathy. Here, we show that myocardial COUP-TFII overexpression causes heart failure in mice, suggesting a causal effect of elevated COUP-TFII levels on development of dilated cardiomyopathy. COUP-TFII represses genes critical for mitochondrial electron transport chain enzyme activity, oxidative stress detoxification and mitochondrial dynamics, resulting in increased levels of reactive oxygen species and lower rates of oxygen consumption in mitochondria. COUP-TFII also suppresses the metabolic regulator PGC-1 network and decreases the expression of key glucose and lipid utilization genes, leading to a reduction in both glucose and oleate oxidation in the hearts. These data suggest that COUP- TFII affects mitochondrial function, impairs metabolic remodelling and has a key role in dilated cardiomyopathy. Last, COUP-TFII haploinsufficiency attenuates the progression of cardiac dilation and improves survival in a calcineurin transgenic mouse model, indicating that COUP-TFII may serve as a therapeutic target for the treatment of dilated cardiomyopathy. 1 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030, USA. 2 Adrienne Helis Malvin Medical Research Foundation, New Orleans, Louisiana 70130, USA. -
Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3. -
Mitoxplorer, a Visual Data Mining Platform To
mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, Cecilia Garcia-Perez, José Villaveces, Salma Gamal, Giovanni Cardone, Fabiana Perocchi, et al. To cite this version: Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, et al.. mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dy- namics and mutations. Nucleic Acids Research, Oxford University Press, 2020, 10.1093/nar/gkz1128. hal-02394433 HAL Id: hal-02394433 https://hal-amu.archives-ouvertes.fr/hal-02394433 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gkz1128 Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gkz1128/5651332 by Bibliothèque de l'université la Méditerranée user on 04 December 2019 mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim1,†, Prasanna Koti1,†, Adrien Bonnard2, Fabio Marchiano3, Milena Durrbaum¨ 1, Cecilia Garcia-Perez4, Jose Villaveces1, Salma Gamal1, Giovanni Cardone1, Fabiana Perocchi4, Zuzana Storchova1,5 and Bianca H. -
In This Table Protein Name, Uniprot Code, Gene Name P-Value
Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2- -
WO 2017/070647 Al 27 April 2017 (27.04.2017) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/070647 Al 27 April 2017 (27.04.2017) P O P C T (51) International Patent Classification: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, A61K 31/455 (2006.01) C12N 15/86 (2006.01) KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, A61K 31/465 (2006.01) A61P 27/02 (2006.01) MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, A61K 31/19 (2006.01) A61P 27/06 (2006.01) OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, A61K 48/00 (2006.01) A61K 45/06 (2006.01) SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, (21) International Application Number: ZW. PCT/US2016/058388 (84) Designated States (unless otherwise indicated, for every (22) International Filing Date: kind of regional protection available): ARIPO (BW, GH, 24 October 2016 (24.10.201 6) GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (25) Filing Language: English TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (26) Publication Language: English DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (30) Priority Data: LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, 62/245,467 23 October 2015 (23. -
Electron Transport Chain Activity Is a Predictor and Target for Venetoclax Sensitivity in Multiple Myeloma
ARTICLE https://doi.org/10.1038/s41467-020-15051-z OPEN Electron transport chain activity is a predictor and target for venetoclax sensitivity in multiple myeloma Richa Bajpai1,7, Aditi Sharma 1,7, Abhinav Achreja2,3, Claudia L. Edgar1, Changyong Wei1, Arusha A. Siddiqa1, Vikas A. Gupta1, Shannon M. Matulis1, Samuel K. McBrayer 4, Anjali Mittal3,5, Manali Rupji 6, Benjamin G. Barwick 1, Sagar Lonial1, Ajay K. Nooka 1, Lawrence H. Boise 1, Deepak Nagrath2,3,5 & ✉ Mala Shanmugam 1 1234567890():,; The BCL-2 antagonist venetoclax is highly effective in multiple myeloma (MM) patients exhibiting the 11;14 translocation, the mechanistic basis of which is unknown. In evaluating cellular energetics and metabolism of t(11;14) and non-t(11;14) MM, we determine that venetoclax-sensitive myeloma has reduced mitochondrial respiration. Consistent with this, low electron transport chain (ETC) Complex I and Complex II activities correlate with venetoclax sensitivity. Inhibition of Complex I, using IACS-010759, an orally bioavailable Complex I inhibitor in clinical trials, as well as succinate ubiquinone reductase (SQR) activity of Complex II, using thenoyltrifluoroacetone (TTFA) or introduction of SDHC R72C mutant, independently sensitize resistant MM to venetoclax. We demonstrate that ETC inhibition increases BCL-2 dependence and the ‘primed’ state via the ATF4-BIM/NOXA axis. Further, SQR activity correlates with venetoclax sensitivity in patient samples irrespective of t(11;14) status. Use of SQR activity in a functional-biomarker informed manner may better select for MM patients responsive to venetoclax therapy. 1 Department of Hematology and Medical Oncology, Winship Cancer Institute, School of Medicine, Emory University, Atlanta, GA, USA. -
C6orf203 Controls OXPHOS Function Through Modulation of Mitochondrial Protein Biosynthesis
bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. C6orf203 controls OXPHOS function through modulation of mitochondrial protein biosynthesis number of characters excluding Materials and Methods: 40,651 Sara Palacios-Zambrano1,2, Luis Vázquez-Fonseca1,2, Cristina González-Páramos1,2, Laura Mamblona1,2, Laura Sánchez-Caballero3, Leo Nijtmans3, Rafael Garesse1,2 and Miguel Angel Fernández-Moreno1,2,* 1 Departamento de Bioquímica, Instituto de Investigaciones Biomédicas “Alberto Sols” UAM CSIC and Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER). Facultad de Medicina, Universidad Autónoma de Madrid. Madrid 28029, Spain. 2 Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Madrid 28041, Spain. 3 Department of Pediatrics, Radboud Center for Mitochondrial Medicine, Radboud University Medical Center, Nijmegen, The Netherlands. * To whom correspondence should be addressed. Tel:+34 91 497 31 29; Email: [email protected] Running title “C6orf203 controls mt-proteins synthesis” bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Mitochondria are essential organelles present in the vast majority of eukaryotic cells. Their central function is to produce cellular energy through the OXPHOS system, and functional alterations provoke so-called mitochondrial OXPHOS diseases. It is estimated that several hundred mitochondrial proteins have unknown functions. Very recently, C6orf203 was described to participate in mitochondrial transcription under induced mitochondrial DNA depletion stress conditions. -
Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts. -
Bayesian Hidden Markov Tree Models for Clustering Genes with Shared Evolutionary History
Submitted to the Annals of Applied Statistics arXiv: arXiv:0000.0000 BAYESIAN HIDDEN MARKOV TREE MODELS FOR CLUSTERING GENES WITH SHARED EVOLUTIONARY HISTORY By Yang Liy,{,∗, Shaoyang Ningy,∗, Sarah E. Calvoz,x,{, Vamsi K. Moothak,z,x,{ and Jun S. Liuy Harvard Universityy, Broad Institutez, Harvard Medical Schoolx, Massachusetts General Hospital{, and Howard Hughes Medical Institutek Determination of functions for poorly characterized genes is cru- cial for understanding biological processes and studying human dis- eases. Functionally associated genes are often gained and lost together through evolution. Therefore identifying co-evolution of genes can predict functional gene-gene associations. We describe here the full statistical model and computational strategies underlying the orig- inal algorithm CLustering by Inferred Models of Evolution (CLIME 1.0) recently reported by us [Li et al., 2014]. CLIME 1.0 employs a mixture of tree-structured hidden Markov models for gene evolution process, and a Bayesian model-based clustering algorithm to detect gene modules with shared evolutionary histories (termed evolutionary conserved modules, or ECMs). A Dirichlet process prior was adopted for estimating the number of gene clusters and a Gibbs sampler was developed for posterior sampling. We further developed an extended version, CLIME 1.1, to incorporate the uncertainty on the evolution- ary tree structure. By simulation studies and benchmarks on real data sets, we show that CLIME 1.0 and CLIME 1.1 outperform traditional methods that use simple metrics (e.g., the Hamming distance or Pear- son correlation) to measure co-evolution between pairs of genes. 1. Introduction. The human genome encodes more than 20,000 protein- coding genes, of which a large fraction do not have annotated function to date [Galperin and Koonin, 2010]. -
Snps in Genes Coding for ROS Metabolism and Signalling in Association with Docetaxel Clearance
The Pharmacogenomics Journal (2010) 10, 513–523 & 2010 Macmillan Publishers Limited. All rights reserved 1470-269X/10 www.nature.com/tpj ORIGINAL ARTICLE SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance H Edvardsen1,2, PF Brunsvig3, The dose of docetaxel is currently calculated based on body surface area 1,4 5 and does not reflect the pharmacokinetic, metabolic potential or genetic H Solvang , A Tsalenko , background of the patients. The influence of genetic variation on the 6 7 A Andersen , A-C Syvanen , clearance of docetaxel was analysed in a two-stage analysis. In step one, 583 Z Yakhini5, A-L Børresen-Dale1,2, single-nucleotide polymorphisms (SNPs) in 203 genes were genotyped on H Olsen6, S Aamdal3 and samples from 24 patients with locally advanced non-small cell lung cancer. 1,2 We found that many of the genes harbour several SNPs associated with VN Kristensen clearance of docetaxel. Most notably these were four SNPs in EGF, three SNPs 1Department of Genetics, Institute of Cancer in PRDX4 and XPC, and two SNPs in GSTA4, TGFBR2, TNFAIP2, BCL2, DPYD Research, Oslo University Hospital Radiumhospitalet, and EGFR. The multiple SNPs per gene suggested the existence of common Oslo, Norway; 2Institute of Clinical Medicine, haplotypes associated with clearance. These were confirmed with detailed 3 University of Oslo, Oslo, Norway; Cancer Clinic, haplotype analysis. On the basis of analysis of variance (ANOVA), quantitative Oslo University Hospital Radiumhospitalet, Oslo, Norway; 4Institute of -
Transcriptomic and Proteomic Landscape of Mitochondrial
TOOLS AND RESOURCES Transcriptomic and proteomic landscape of mitochondrial dysfunction reveals secondary coenzyme Q deficiency in mammals Inge Ku¨ hl1,2†*, Maria Miranda1†, Ilian Atanassov3, Irina Kuznetsova4,5, Yvonne Hinze3, Arnaud Mourier6, Aleksandra Filipovska4,5, Nils-Go¨ ran Larsson1,7* 1Department of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, Cologne, Germany; 2Department of Cell Biology, Institute of Integrative Biology of the Cell (I2BC) UMR9198, CEA, CNRS, Univ. Paris-Sud, Universite´ Paris-Saclay, Gif- sur-Yvette, France; 3Proteomics Core Facility, Max Planck Institute for Biology of Ageing, Cologne, Germany; 4Harry Perkins Institute of Medical Research, The University of Western Australia, Nedlands, Australia; 5School of Molecular Sciences, The University of Western Australia, Crawley, Australia; 6The Centre National de la Recherche Scientifique, Institut de Biochimie et Ge´ne´tique Cellulaires, Universite´ de Bordeaux, Bordeaux, France; 7Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden Abstract Dysfunction of the oxidative phosphorylation (OXPHOS) system is a major cause of human disease and the cellular consequences are highly complex. Here, we present comparative *For correspondence: analyses of mitochondrial proteomes, cellular transcriptomes and targeted metabolomics of five [email protected] knockout mouse strains deficient in essential factors required for mitochondrial DNA gene (IKu¨ ); expression, leading to OXPHOS dysfunction. Moreover, -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa Gene Symbol NDUFB4 Organism Human Gene Summary This gene encodes a non-catalytic subunit of the multisubunit NADH:ubiquinone oxidoreductase the first enzyme complex in the mitochondrial electron transport chain (complex I). Mammalian complex I is composed of 45 different subunits and transfers electrons from NADH to ubiquinone. Gene Aliases B15, CI-B15, MGC5105 RefSeq Accession No. NC_000003.11, NT_005612.16 UniGene ID Hs.304613 Ensembl Gene ID ENSG00000065518 Entrez Gene ID 4710 Assay Information Unique Assay ID qHsaCEP0041283 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000184266, ENST00000485064, ENST00000492739 Amplicon Context Sequence CAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGT CGAGCCTGCGCACTCTGCCTGAGACCCTCGACCCAGCCGAATACAACATATCTC CGGAAACCCGGCGGGCGCAAGCCGAGCGGTTGGCCATAAGAGCCCAGCTGAA ACGAGAGTACCT Amplicon Length (bp) 142 Chromosome Location 3:120315178-120315349 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9997 cDNA Cq 18.56 cDNA Tm (Celsius) 88.5 gDNA Cq 23.17 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report NDUFB4, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of