Sex, Drugs, and Transgenerational Inheritance: Are the Kids Alright?

University of Pennsylvania ScholarlyCommons

Publicly Accessible Penn Dissertations

2016

Nicole Lynn Yohn University of Pennsylvania, [email protected]

Follow this and additional works at: https://repository.upenn.edu/edissertations

Part of the Neuroscience and Neurobiology Commons

Recommended Citation Yohn, Nicole Lynn, "Sex, Drugs, and Transgenerational Inheritance: Are the Kids Alright?" (2016). Publicly Accessible Penn Dissertations. 2118. https://repository.upenn.edu/edissertations/2118

This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2118 For more information, please contact [email protected]. Sex, Drugs, and Transgenerational Inheritance: Are the Kids Alright?

Abstract The occurrence of neuropsychiatric disorders and substance abuse is subject to familial inheritance (nature) as well influence from the environment (nurture). In addition, familial patterns of behavior and disease are also mediated by transgenerational epigenetic inheritance. The dynamic nature of the epigenome allows for exposures to stress, drugs of abuse, environmental toxins, and even changes in diet to produce changes in gene expression. In addition these changes can be inherited by offspring. Therefore, offspring behavior and quality of life are shaped by their own experiences as well as the experiences of their parents and more distant relatives. The studies in this dissertation had two objectives: first ot identify the transgenerational inheritance of adolescent stress exposure and its effects on offspring behavior including response to nicotine and second, to determine the cross-generational interaction of nicotine and stress exposures on offspring behavior. To address the first objective, we exposed male and female mice to adolescent stress exposure, determined the long-term effects of exposure on their behavior, and identified changes in phenotype in their F1 and F2 offspring. eW found that adolescent stress exposure produced changes in anxiety, startle response, and gene expression in adulthood that was not found when the same stress exposure occurred in adult mice. In addition, we found that transgenerational inheritance of adolescent stress exposure promoted sex- and lineage- dependent changes in anxiety, depression, startle, and response to nicotine in F1 and F2 offspring. Furthermore, to determine if parental stress exposure influenced gene expression in the brains of offspring we analyzed the transcriptome of F1 males and found 240 differentially expressed genes in the amygdala of males whose fathers were exposed to stress. In our final study, we developed a novel multigenerational exposure paradigm and determined that F0 nicotine and F1 stress exposure interact across generations to produce unique phenotypes in F2 and F3 offspring. Together, research from this dissertation provides evidence of an adolescent chronic stress exposure that mediates anxiety in adulthood and is inherited in future generations by reprogramming the brain of offspring, and provides the first example of cross-generational interactions of two environmental exposures to influence offspring phenotype.

Degree Type Dissertation

Degree Name Doctor of Philosophy (PhD)

Graduate Group Neuroscience

First Advisor Julie A. Blendy

Keywords Behavior, Chronic stress, Drug abuse, Inheritance, Mouse, Nicotine

Subject Categories Neuroscience and Neurobiology

This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/2118 SEX, DRUGS, AND TRANSGENERATIONAL INHERITANCE: ARE THE KIDS ALRIGHT?

Nicole Lynn Yohn

A DISSERTATION

Neuroscience

Presented to the Faculties of the University of Pennsylvania

Partial Fulfillment of the Requirements for the

Degree of Doctor of Philosophy

2016

Supervisor of Dissertation Graduate Group Chairperson

______

Julie A. Blendy, PhD Joshua I. Gold, PhD

Professor of Pharmacology Professor of Neuroscience

Dissertation Committee

Jon Lindstrom, PhD, Professor of Neuroscience Caryn Lerman, PhD, Professor of Psychiatry Irwin Lucki, PhD, Professor of Pharmacology Marsia S. Bartolomei, PhD, Professor of Cell and Developmental Biology

To the women in science who inspired me to pursue my degree: Martha Kermizis, Dr. Lina Yoo, Dr. Susan Kennedy, and Dr. Julie Blendy. And to the most inspiring woman I know, Lisa Yohn.

ACKNOWLEDGMENT

First, I would like to express my sincere gratitude to my advisor Dr. Julie Blendy for the continuous support of my PhD study and related research, for her patience, motivation, and immense knowledge. Her guidance helped me in all the time of research and writing of this thesis, and in many moments her selfless time and care were sometimes all that kept me going. I could not have imagined having a better advisor and mentor for my PhD study.

Besides my advisor I would like to thank the rest of my thesis committee: Dr. Jon

Lindstrom, Dr. Caryn Lerman, Dr. Irwin Lucki, and Dr. Marisa Bartolomei, for their insightful comments and encouragement, but also for the hard questions which incented me to widen my rsearch from various perspectives.

My sincere thanks also goes to Dr. Klaus Keastner, Dr. Diana Bernstein, the

Bartolemei Lab, and the Next Generation Sequencing Core who provided me with collaboration and access to their research knowledge and facilities. In addition, I would like to thank Dr. Yemin Lan and Dr. Jonathan Schug for their expertise in data analysis.

Without there precious support it would not have been possible to conduct this research.

I thank my fellow labmates for the stimulating discussions, the countless hours spent in the animal colony working together, and for all the fun we had over the past five years. In particular, I am grateful for Dr. Bridgin Lee, without whom this would not have been possible. I am lucky to be leaving graduate school with one of the best friends I will have made in my entire life. Not only did she challenge me to be a better scientist but also taught me poise, grace, and courage in the process. I would like to thank my fellow

iii

“Penn Pals” in the Neuroscience Graduate Group and BGS for their support, shoulders to lean on, and countless memories made together. Finally thank you to Liz, Jessie, Britt, and Laura – behind every successful woman is a tribe of women who have her back.

Last but not leat, I would like to thank my family: my parents and husband Jason.

There unwavering support has propelled me to places I never thought possible. Thank you Jason for reading every page of this thesis and being with me every step of the way!

To my extended family, thank you for supporting me each and every day, before, during, and after graduate school.

ABSTRACT

SEX, DRUGS, AND TRANSGENERATIONAL INHERITANCE:

ARE THE KIDS ALRIGHT?

Nicole L. Yohn

Julie A. Blendy

The occurrence of neuropsychiatric disorders and substance abuse is subject to familial inheritance (nature) as well influence from the environment (nurture). In addition, familial patterns of behavior and disease are also mediated by transgenerational epigenetic inheritance. The dynamic nature of the epigenome allows for exposures to stress, drugs of abuse, environmental toxins, and even changes in diet to produce changes in gene expression. In addition these changes can be inherited by offspring. Therefore, offspring behavior and quality of life are shaped by their own experiences as well as the experiences of their parents and more distant relatives. The studies in this dissertation had two objectives: first to identify the transgenerational inheritance of adolescent stress exposure and its effects on offspring behavior including response to nicotine and second, to determine the cross-generational interaction of nicotine and stress exposures on offspring behavior. To address the first objective, we exposed male and female mice to adolescent stress exposure, determined the long-term effects of exposure on their behavior, and identified changes in phenotype in their F1 and F2 offspring. We found that adolescent stress exposure produced changes in anxiety, startle response, and gene expression in adulthood that was not found when the same stress exposure occurred in

v adult mice. In addition, we found that transgenerational inheritance of adolescent stress exposure promoted sex- and lineage-dependent changes in anxiety, depression, startle, and response to nicotine in F1 and F2 offspring. Furthermore, to determine if parental stress exposure influenced gene expression in the brains of offspring we analyzed the transcriptome of F1 males and found 240 differentially expressed genes in the amygdala of males whose fathers were exposed to stress. In our final study, we developed a novel multigenerational exposure paradigm and determined that F0 nicotine and F1 stress exposure interact across generations to produce unique phenotypes in F2 and F3 offspring. Together, research from this dissertation provides evidence of an adolescent chronic stress exposure that mediates anxiety in adulthood and is inherited in future generations by reprogramming the brain of offspring, and provides the first example of cross-generational interactions of two environmental exposures to influence offspring phenotype.

TABLE OF CONTENTS

ACKNOWLEDGMENT ...... III

ABSTRACT ...... V

LIST OF TABLES ...... VIII

LIST OF FIGURES ...... X

CHAPTER 1 ...... 1 General Introduction

CHAPTER 2 ...... 23 Adolescent chronic unpredictable stress exposure is a critical window for long-term changes in adult behavior in mice

CHAPTER 3 ...... 50 Transgenerational inheritance of stress: Effects on nicotine response

CHAPTER 4 ...... 100 Exposure interactions across generations: Transgenerational effects of nicotine and stress

CHAPTER 5 ...... 129 General Discussion

APPENDIX ...... 149 Activation of α4β2*/α6β2* nicotinic receptors alleviates anxiety during nicotine withdrawal without upregulating nicotinic receptors

REFERENCES ...... 179

vii

LIST OF TABLES

Chapter 1 – General Introduction

Chapter 2 – Adolescent chronic unpredictable stress exposure is a critical window for long-term changes in adult behavior in mice 2.1 Stressors and lengths of exposure for CUS paradigm s2.1 Primer sequences used for qRT-PCR

Chapter 3 – Transgenerational inheritance of stress: Effects on nicotine response

3.1 Summary of behavior of F1 offspring of fathers exposed to stress 3.2 Summary of behavior of F1 offspring of mothers exposed to stress 3.3 Summary of behavior of F2 offspring derived from F0 male stress exposure 3.4 Summary of behavior of F2 offspring derived from F0 female stress exposure s3.1 Differentially expressed genes in the amygdala of F1 males

Chapter 4 – Exposure interactions across generations: Transgenerational effects of nicotine and stress 4.1 Summary of F2 offspring derived from F1 male lineage anxiety, startle, and depression behavior 4.2 Summary of F3 offspring derived from F2 male/F1 male lineage anxiety and startle behavior 4.3 Summary of F3 offspring derived from F2 female/F1 male lineage anxiety and startle behavior s4.1 Summary of F2 offspring derived from F1 female lineage anxiety, startle, and depression behavior s4.2 Summary of F3 offspring derived from F2 male/F1 female lineage anxiety and startle behavior s4.3 Summary of F3 offspring derived from F2 female/F1 female lineage anxiety and startle behavior viii

Chapter 5 – General Discussion

Appendix – Activation of α4β2*/α6β2* nicotinic receptors alleviates anxiety during nicotine withdrawal without upregulating nicotinic receptors

LIST OF FIGURES

Chapter 1 – General Introduction 1.1 Multi- and transgenerational phenotype following drug exposure

Chapter 2 – Adolescent chronic unpredictable stress exposure is a critical window for long-term changes in adult behavior in mice 2.1 Experimental timeline 2.2 Loss of sucrose preference following CUS exposure in adolescents and adults 2.3 Adolescent CUS increases anxiety-like behaviors in adulthood

2.4 Adolescent CUS decreases acoustic startle response in male mice in adulthood 2.5 Adolescent and adult CUS induces depression-like phenotype in mice in adulthood 2.6 Quantitative real-time PCR analysis of Crf, CrfR1, and CrfR2 expression in the amygdala of stressed mice shows increased CrfR2 in male mice exposed to adolescent CUS

Chapter 3 – Transgenerational inheritance of stress: Effects on nicotine response 3.1 Schematic of experimental design 3.2 Paternal adolescent CUS exposure alters F1 male and female response to nicotine 3.3 Maternal adolescent CUS exposure blunts nicotine sensitization in F1 offspring 3.4 Altered transcription in the amygdala in F1 male offspring derived from paternal stress 3.5 F0 male adolescent CUS exposure alters F2 response to nicotine 3.6 F0 female adolescent CUS exposure alters F2 response to nicotine s3.1 Female F1 mice spend less time immobile in FST regardless of stress lineage

Chapter 4 – Exposure interactions across generations: Transgenerational effects of nicotine and stress

4.1 Schematic of experimental design 4.2 F2 and F3 nicotine response is influenced by F0 nicotine and F1 male stress exposure s4.1 Decreased anxiety- and depression-like behaviors in F1 male offspring of paternal nicotine exposure s4.2 No change in ASR in male and female F1 offspring of nicotine exposed fathers s4.3 F2 and F3 nicotine response is influenced by F0 nicotine and F1 female stress exposure

Chapter 5 – General Discussion

Appendix – Activation of α4β2*/α6β2* nicotinic receptors alleviates anxiety during nicotine withdrawal without upregulating nicotinic receptors A.1 The effect of short-term ABT-089 and ABT-107 on the behavior of mice during nicotine withdrawal in the NIH A.2 The effect of long-term ABT-089 and ABT-107 on the behavior of mice during nicotine withdrawal in the NIH A.3 Nicotinic receptor regulation after nicotine withdrawal in the presence or absence of ABT-089 or ABT-107 A.4 Nicotinic receptor regulation after long-term treatment with ABT-089 A.5 The effect of long-term ABT-089 and withdrawal from ABT-089 on the behavior of mice in the NIH

CHAPTER 1

GENERAL INTRODUCTION

Much of the content in this chapter was originally published in Progress in Biophysics and Molecular Biology, 2015 Jul, Vol. 118(1-2):21-33, PMID: 25839742. I. Inheritance of familial experience

Familial inheritance patterns suggest that the behavior of genetically similar individuals is a product of their genome (Darwin, 1859; Laland et al., 2014). However, physiological systems are able to respond and adapt to changes in real time in their environment, making it so that traits are a product of the environment as well. While natural selection is an efficient process of generational responses to environmental challenges over a long period of time, there is evidence that nongenetic processes, or any process that is brought about by the transmission of factors to offspring other than sequences of DNA, may establish stable phenotypes that can be inherited through germline transmission (Bonduriansky et al., 2012). Nongenetic inheritance of phenotype is modulated by mechanisms that include social learning (Aoki and Feldman, 2014), nutrition or maternal contribution (Mousseau and Fox, 1998), somatic factors such as hormones (Groothuis and Schwabl, 2008), and epigenetic variants in the genome

(Youngson and Whitelaw, 2008; Roux et al., 2011; Ashe et al., 2012; Liebers et al.,

2014). In light of these findings, familial patterns of phenotypic inheritance are a function of nature and nurture, and the longevity of inheritance through several generations of offspring suggests that nature can be translated as a heritable nongenetic component and incorporated into the genome (Szyf, 2015). Therefore, nongenetic transmission gives rise

1 to phenotypic plasticity so that the phenotype of offspring not only depends on the genes it inherits and its own environment but also on the phenotype and environment of the parents or more distant ancestors (Uller, 2008). Epigenetic modifications to DNA that ultimately produce functional consequences in phenotype provide a means by which parental experience can be transmitted to offspring by creating an intersection of parental environment and offspring gene expression.

Evidence of a neo-Lamarckian evolution theory

Although predominantly discounted for his theory that parental environment promotes behavioral alterations associated with evolution, the ideas of the French naturalist Jean-Baptiste Lamarck (1744-1829) deserve to be revisited. With growing research on environmental epigenetics and epigenetic mechanisms of inheritance, a possible molecular mechanism to explain Lamarckian theories of evolution has been identified. Therefore, a neo-Lamarckian theory of evolution, in which environment directly alters phenotype, generationally, supports observations that acute experiences within a family can be inherited across generations to alter the behavior of offspring

(Skinner, 2015). For example, the driving hypothesis behind the Dutch Hunger famine’s contribution to physiological abnormalities in offspring and, more recently, changes in stress response in offspring of Holocaust survivors (Veenendaal et al., 2013; Yehuda et al., 2014), is that offspring inherited parental experiences of trauma. Parents with adolescent or prenatal exposure to the Dutch Hunger famine produced offspring with increased mortality rates and diabetic death, and increased weights and body mass index,

2 respectively (Pembrey et al., 2006; Pembrey, 2010; Veenendaal et al., 2013). In addition, offspring of parents who were survivors of the Holocaust that reported suffering from post traumatic stress disorder (PTSD) during their lifetime showed a blunted cortisol response to stress challenges in the absence of any personal psychiatric condition

(Yehuda et al., 2014). The inheritance of such historical events, suggests phenotypic response to the environment is subject to nongenetic transmission in humans as early as the next generation of offspring. In addition, epigenetic changes to the genome are thought to mediate neo-Lamarkian familial inheritance. Researchers have made strides in replicating environmental exposures that impact human behavior in the laboratory to study this phenomenon. Alterations in offspring behavior, physiology, and epigenetics have been characterized in animals following parental exposure to changes in diet

(Carone et al., 2010; Ng et al., 2010), drugs of abuse (Byrnes, 2005; Vassoler et al.,

2013a, 2013b; Kim et al., 2014; Zhu et al., 2014), environmental toxins (Anway et al.,

2005; Manikkam et al., 2013), stress (Gapp et al., 2014a), and aging (Milekic et al.,

2015).

II. Mechanisms of familial inheritance

Epigenetics

In an attempt to rectify the vast differences in use of the term epigenetics, Adrian

Bird proposed a definition that encompasses both the chemical mechanisms as well as the necessity for inheritance: epigenetics is "the structural adaptation of chromosomal regions so as to register, signal or perpetuate altered activity states" (Bird, 2007).

Therefore, these chromosomal modifications can be sudden or accumulate over time in response to exposure to a stimulus and are, nevertheless, inherited in the absence of the signal or event that initiated the change (Bird, 2007). In addition, chemical alterations to the genome, also referred to as the epigenome when including the DNA packaging, can ultimately change the functional expression of genes (Bird, 2002). Epigenetic inheritance occurs by persistence of the modifications through several generations of cell division or offspring (Bird, 2007). Cellular epigenetic modifications that have been identified in the individual animal in response to the environment include chromatin remodeling and

DNA methylation (Skinner, 2011; Daxinger and Whitelaw, 2012), as well as the expression of small non-coding RNAs (sncRNAs) including micro RNAs (miRNAs)

(Stuwe et al., 2014). In addition, these epigenetic mechanisms have been implicated in inheritance (Weaver et al., 2004; Maze et al., 2010; Vassoler et al., 2013b; Rodgers and

Bale, 2015).

Chromatin remodeling

In the nucleus, chromatin is organized into nucleosomes containing 147 base pairs of DNA wrapped around a histone protein complex. The histone is an octamer protein complex composed of 4 histone proteins (H2A, H2B, H3, and H4) (Kornberg and Lorch,

1999). The proteins contain contain an amino (N) terminal tail that can undergo modifications; these modifications condense or relax the state of DNA wrapped around the histone. Sixteen types of post translational histone modifications have been identified, including acetylation, methylation, phosphorylation, ubiquitylation, and SUMOylation

(Tweedie-Cullen et al., 2009). Acetylation of lysine residues on the histone tail relaxes chromatin which gives transcription factors access to the promoter regions of a gene and promotes gene expression (Allfrey, 1966). For example acetylation of lysine 14 of histone 3 (aceH3K14) is correlated with increased transcription of nearby genes

(Sadakierska-Chudy and Filip, 2015). Methylation of lysine and arginine residues on the histone tail can cause gene activation or repression depending on the residue undergoing modification. Histone 3 lysine 4 trimethylation (H3K4me3) causes the activation of gene transcription while histone 3 lysine 9 dimethylation (H3K9me2) association with a gene is correlated to repression of that gene (Kouzarides, 2002) . In addition to altering chromatin state, multiple histone modifications can be present to form a histone code that is read by other proteins to promote distinct downstream signaling events leading toward gene expression or repression in the cell (Strahl and Allis, 2000).

DNA methylation

DNA methylation governs cellular function and differentiation through regulation of gene transcription by acting directly on the genome (Razin and Riggs, 1980). DNA methyltransferases (DNMTs) catalyze the addition of a methyl group onto a cytosine nucleotide that is usually positioned next to a guanine nucleotide on the DNA phosphate backbone (Cytosine-phosphate-Guanine; CpG). Methyl groups are donated by S- adenosyl methionine (SAM); therefore, the addition of a methyl onto the cytosine converts the cytosine to 5-methylcytosine. Gene regulation via DNA methylation is achieved through CpGs in the regulatory regions (promoters, enhancers, insulators) of

5 genes. Methylation can directly interfere with transcription factor binding to DNA recognition elements (Comb and Goodman, 1990) or recruit methylated DNA binding factors that promote interaction with chromatin modifying complexes to repress gene expression (Lewis et al., 1992; Jones et al., 1998). In the past, research has suggested that the presence of methyl groups suppresses gene expression. However, this is not always the case. Instead, a differential methylated state of a gene is accompanied by changes in gene expression, although not always in a predictable direction (Franklin et al., 2010). In addition, non-CpG methylation (cytosine methylation not positioned directly next to a guanine) occurs within the genome and can be altered in response to the environment

(Petropoulos et al., 2014).

sncRNAs

Small non-coding RNAs are short RNA sequences including miRNAS, small interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), and small nucleolar

RNAs (snoRNAs) that regulate transcription and translation (Ghildiyal and Zamore,

2009). miRNAs comprise an abundant class of regulatory molecules that can modulate a regulatory code for gene expression (Bartel, 2004) as well as transmit phenotypes to the next generation (Rassoulzadegan et al., 2006). miRNAs bind to recognition sites in the 3’ untranslated region of target mRNAs and promote gene repression through destabilization and degradation of the mRNA (Guo et al., 2010). In addition, miRNAs can repress translation of proteins without degradation of target mRNA (Bazzini et al.,

2012). Noncoding RNAs direct epigenetic states in somatic and germ cells through

6 cooperation with other epigenetic modifications, including histone modifications (Stuwe et al., 2014) and CpG methylation (Mohammad et al., 2012), to promote long-lasting cellular and heritable effects.

III. Epigenetics across generations

Multi- and transgenerational inheritance across generations

Epigenetic transgenerational inheritance is defined as "germline-mediated inheritance of epigenetic information between generations in the absence of direct environmental influences that leads to phenotypic variation" (Skinner, 2011). In contrast, multigenerational phenotypes are those derived from direct exposure. Thus, if exposure occurs in F0 males or females prior to pregnancy, the germ cells, which go on to produce the F1 generation, are also "exposed". Therefore, phenotypes found in F0 and F1 animals are multigenerational and only those present in F2 animals are considered transgenerational, as the F2 animals are the first generation whose cells have not been exposed to the environmental challenge (Figure 1.1, top).

In contrast, if F0 mothers are exposed to an environmental challenge during pregnancy, the somatic and germ cells of the F1 offspring receive direct exposure in utero (Figure 1.1, bottom). Since the germ cells of the F1 offspring are exposed to the environment and the F2 offspring originate from the exposed germ cells, the F0 parents,

F1 and F2 offspring are all exposed to the parental environment (Skinner, 2008). In this case, F0, F1, and F2 phenotypes are multigenerational and only phenotypes observed in the F3 generation and beyond are transgenerational (Figure 1.1) .

Gamete development and reprogramming

Germline reprogramming events may directly facilitate epigenetic inheritance across generations. Genome wide DNA methylation reprogramming occurs at two time points in early embryonic development, and both reprogramming events are well understood in mice. First, genome-wide DNA demethylation occurs post-fertilization in the zygote, erasing gamete epigenome methylation in order to promote cellular totipotency in the developing embryo. However, at this time genomic imprints

(methylation on imprinted genes such as H19 and Igf2) remain intact. Later, a second major reprogramming event occurs in the germline where paternal and maternal somatic programming is erased from most genes, including imprinted genes. Parent-specific imprints are subsequently imposed in the germline, and DNA methylation occurs across the genome through the action of DNA methyltransferases (for a complete review see

Daxinger and Whitelaw, 2012). During these periods of reprogramming, exposure to a challenge that increases or decreases the activity of the epigenomic machinery may lead to alterations in DNA methylation. Embryonic reprogramming suggests that epigenetic modifications to the DNA made in response to drug exposure may be lost. However, there is evidence that some methylation marks escape complete erasure. The best known example is that of imprinted genes, whose methylation marks are retained in the developing embryo (Bartolomei, 2009). In addition there is growing evidence that non- imprinted genes and repetitive genomic elements escape complete loss of methylation patterning following reprogramming events (Lane et al., 2003; Orozco et al., 2014). In mice, non imprinted genes have been shown to inherit DNA methylation from gametes

8 and escape reprogramming during preimplantation (Borgel et al., 2010). The retention of genomic methylation patterns in sperm of exposed parents and brains of offspring may occur following generational stress (Franklin et al., 2010) or drug-exposure (Govorko et al., 2012).

Histone acetylation and methylation, although not as well described as DNA methylation, may also be subject to epigenetic mechanisms of modulation by drug exposure. While the vast majority of histones are replaced by protamines during spermatogenesis, not all histones are lost, and sperm DNA retention within histones has been discovered in both humans and mice (Gatewood et al., 1987; Bench et al., 1996;

Hammoud et al., 2009). Furthermore, DNA methylation retention in sperm may be due to the association of DNA with histones. There is an enrichment of histone bound sperm

DNA at loci of imprinted genes and developmentally important genes that retain methylation marks in the embryo (Wykes and Krawetz, 2003; Hammoud et al., 2009). In addition, histone variants as well as the presence of histone methyltransferases have been identified in mature oocytes, and differential acetylation and methylation have been implicated in oocyte development (Wang et al., 2014). In addition, histone marks in the oocyte can be transmitted across generations (Gaydos et al., 2014). Therefore the genomic content in sperm and oocytes, along with chemical modifications, are potential carriers of epigenetic information.

The miRNA environment of sperm can be altered in adulthood (Li et al., 2012) and is capable of mediating changes in behavior and physiology in offspring (Gapp et al.,

2014a). Interestingly, while it is unknown if the germline is receptive to certain

9 environmental exposures such as stress and drugs of abuse, miRNA expression is considered a mechanism by which somatic cells and the germline are capable of communicating. Specifically, RNA containing vesicles released from somatic cells may serve as the conduit for parental influence on offspring development. Mice xenografted with human cells expressing green fluorescent protein (GFP) express GFP in sperm heads suggesting that RNA expressed by somatic cells can be transferred to sperm (Cossetti et al., 2014). In addition, the oocyte is composed of its own distinct milieu of RNA content, shown to undergo dynamic changes in composition during oogenesis, that is vital for early embryonic development (Tang et al., 2007).

IV. Inheritance of environmental exposures

IVa. Stress

Stress is the physiological reaction to the perception of an aversive or threatening situation or stressor (Cannon, 1940). Stress, when experienced acutely, can promote survival and genetic longevity (Joëls et al., 2006). However, when experienced for an extended period of time, stress can be detrimental. Chronic stress promotes long-term debilitation of psychiatric condition and physiological fitness (McEwen and Stellar,

1993; McEwen, 1998; McEwen and Wingfield, 2003). In addition, parental stress exposure, both paternal and maternal, is inherited by offspring.

Paternal stress exposure is inherited by future generations

Changes in behavior, physiology, and epigenetic programming have been found in offspring of paternal stress exposure. Male mice exposed to prenatal, adolescent, or adult chronic stress produce male and female F1 offspring with increased anxiety- and depression-like behaviors (Franklin et al., 2010; Dietz et al., 2011; Morgan and Bale,

2011; Gapp et al., 2014a). Stress may influence offspring behavior in a sex-dependent manner. Chronic social defeat in male adult mice produces male offspring with a greater number of aberrant depression- and anxiety- like behaviors than female offspring, although both sexes are affected by the stress lineage (Dietz et al., 2011). In other studies,

F1 male offspring of fathers exposed to prenatal stress are anatomically and genetically dysmasculinized as reflected by altered sex-organ morphology and “feminized” gene expression (Morgan and Bale, 2011). While male specific physiological and neurochemical sensitivities have been found in response to paternal stress, the same have not been found in females. Transgenerational changes in anxiety- and depression-like behaviors are transmitted to F2 and F3 offspring, also in a sex-dependent manner.

Paternal F0 stress from post-natal day 1 through 14 (PND1-14) produces increased anxiety- and depression-like phenotypes in male and female F2 and F3 offspring but are more pervasive in females (Franklin et al., 2010). Therefore, paternal stress produces multi- and transgenerational inheritance in a sex dependent manner.

Paternal stress produces physiological changes in offspring that may impact response to stressors within the offspring’s lifetime. While F1 male offspring of adult paternal stress have increased basal corticosterone (Dietz et al., 2011; Niknazar et al.,

2013), male and female F1 offspring of male mice exposed to 42 day chronic variable stress have blunted circulating corticosterone in response to restraint stress, as compared to offspring from fathers not exposed to a stressor (Rodgers et al., 2013). Maladaptive physiological stress response, along with increased anxiety and depression-like behavior, may predispose the offspring of fathers exposed to stress to altered responses and sensitivity to environmental challenges and experiences. The inheritance of paternal stress may therefore predispose individuals to a greater risk for neuropsychiatric disorders, as basal anxiety and depression levels influence mental disorder and psychiatric illness (Gold, 2015).

Although the impact of paternal stress on behavior and physiological stress response have been thoroughly examined, especially with respect to the exposure window for stress in the father’s lifetime, the neurochemical and neuroanatomical effects of paternal stress that mediate behavior have not been as well-explored. Rather, several studies have identified epigenetic modifications that accompany changes in physiology and behavior in offspring. Female offspring of male mice exposed to maternal separation have increased promoter methylation and decreased transcription of genes involved in learning, memory, and stress signaling in the cortex: methyl CpG binding protein 2

(MeCP2), cannabinoid receptor 1 (Cb1) and corticotropin releasing factor receptor 2

(CrfR2) (Franklin et al., 2010). These same epigenetic modifications are found in the sperm of fathers exposed to stress (Franklin et al., 2010), suggesting a mechanism by which the exposure is inherited. Observations of epigenetic modifications linked to generational stress exposure have been extended to human subjects. Offspring of fathers

12 who reported experiences of PTSD following the Holocaust had increased methylation of the glucocorticoid receptor (Nr3c1) in blood samples and suppressed cortisol response to a stress challenge (Yehuda et al., 2014). Animal research has also implicated glucocorticoid receptor (Gr) signaling in paternal stress inheritance. Male mice exposed to synthetic glucocorticoids for five days show global non-CpG methylation 60 days later in mature spermatocytes and produce male F1 offspring with the same methylation changes in the kidney, as well as altered melanocortin receptor (MR) and GR expression in the hippocampus (Petropoulos et al., 2014). Therefore, stressful adult experiences that evoke increases in endogenous glucocorticoids may produce similar effects on germline methylation and offspring methylation profiles (Petropoulos et al., 2014; Yehuda et al.,

2014).

Finally, the miRNA environment of sperm following stress exposure has been implicated in paternal stress inheritance. Sperm of male mice exposed to chronic stress have altered expression of miRNAs that target genes known to modulate chromatin remodeling in the developing embryo (Rodgers et al., 2013). By taking the sncRNAs purified from sperm of mice exposed to stress and injecting it into fertilized oocytes, F1 offspring are produced that show depressive-like phenotypes and resemble mice produced from male mice exposed to stress and mated with females (Gapp et al., 2014a).

The male germline, therefore, is a capable vehicle for influence by stress and transmission of the molecular memory. Indeed, the male germline is responsive to peripheral stress signaling. GR expression, one of two receptors targeted by corticosterone/cortisol, has been characterized in mouse, rat, and human primary

13 spermatocytes as well as epididymal sperm (Kaufmann et al., 1992; Haeussler and Claus,

2007; Silva et al., 2011).

Maternal stress exposure impacts offspring behavior through non-genetic mechanisms

- review of the role of maternal environment and epigenetics

Maternal stress, although well-studied, adds the additional variable of maternal environment in stress inheritance. In the case of the nuclear family, gene and environment interactions confound inheritance models (Weaver et al., 2004). For example, it cannot be overlooked that a child of a depressed mother inherits the genetic vulnerability as well as the depressed parent (Field, 1998). In animal studies of stress exposure and inheritance following conception, stressed males can be removed from interaction with offspring, while with maternal stress paradigms, maternal environment must be controlled for either using cross-fostering or in vitro fertilization (IVF) (Francis et al., 1999; Dietz et al., 2011). Early studies observing maternal stress identified the power of nongenetic factors, specifically maternal rearing environment, in shaping offspring development and behavior. Mating pairs of rodents in which both parents underwent an enrichment period during early adolescence produced offspring that were less fearful than offspring of control parents that were not immersed in an enrichment protocol (Denenberg, 1964). Therefore, the benefits of an enriched adolescent environment influenced the next generation of offspring without the means of Mendelian genetic mutation, but rather through a nongenetic factor. This factor was identified as the

14 post-natal maternal environment provided by the females that were enriched during adolescence (Cutuli et al., 2015).

Additional studies identified the post-natal maternal environment as a nongenetic factor that influences offspring behavior. Female rats exposed to mild preconception stress produce male offspring with increased fear behavior and altered startle response to an acoustic tone (Zaidan et al., 2013). While at first this seems to be evidence of epigenetic inheritance of maternal stress exposure, experimenters must tread cautiously.

Francis and colleagues found that offspring anxiety and fear behavior correlated with the mother’s rearing behavior and not the phenotype of the biological mother. For example, mice born to a fearful mother but reared by a “good mother” showed no alterations in fear or anxiety behavior while the reverse exposure produced fearful and anxious offspring

(Francis et al., 1999). Additional work has shown that maternal stress is a pervasive environmental exposure that is heritable and produces behavioral changes in several generations of offspring. Female mice and rats exposed to maternal separation and chronic stress produce F1 offspring with altered anxiety and social behavior (Weiss et al.,

2011; Babb et al., 2014). In mice, this finding has been extended to the F2 generation of offspring that also show changes in anxiety and exploration behavior (Weiss et al., 2011).

However, it should be noted that in the case of maternal inheritance paradigms, without cross-fostering or IVF control experiments, it is not clear if this effect is dependent on the post-natal rearing environment with the mother, maternal epigenetics, or both.

Physiological changes in response to maternal stress have also been found in offspring. In a clinical population, children whose mothers experienced the Holocaust

15 during childhood showed reduced cortisol levels in blood samples (Bierer et al., 2014).

Male and female offspring of female rats exposed to repeated forced swim for 21 days, however, have increased levels of basal circulating corticosterone (Niknazar et al., 2013).

Therefore, in both human and animal populations, there is a dysregulated stress response in the offspring of mothers exposed to stress.

Observation of the neurochemical correlates of stress signaling has garnered much attention in maternal stress research. Oocytes of female rats exposed to preconception stress have increased corticotropin-releasing factor receptor 1 (CrfR1) mRNA and produce male offspring with increased CrfR1 expression in brain tissues (Zaidan et al.,

2013). Furthermore, CrfR1 expression in the cortex and amygdala of the offspring was correlated with aberrant response to acoustic startle tones (Zaidan et al., 2013).

Interestingly, even morphological changes have been found in the offspring of maternal stress exposure, suggesting evidence of neurobiological correlates to changes in behavior.

Maternal stress exposure two weeks prior to conception changes the neuronal morphology of the medial prefrontal cortex in offspring (Bock et al., 2016).

Finally, research suggests the existence of epigenetic marks in the genome that may mediate transmission of maternal stress and the corresponding changes in behavior, gene expression, and neuroanatomy. Decreased expression of brain derived neurotrophic factor (Bdnf), a gene implicated in learning behaviors and neuropsychiatric disease, was found in the prefrontal cortex of male and female offspring of female rats that experienced a maltreatment regimen in their first week of life and were also poor mothers

(Roth et al., 2009). This decreased expression was correlated with increased methylation

16 of Bdnf (Roth et al., 2009). In addition, germline exposure to physiological effects of stress may also mediate the inheritance of maternal stress exposure. CrfR1 mRNA is expressed in mature oocytes and is altered by exposure to stress in rodents (Nappi and

Rivest, 1995; Zaidan et al., 2013). In addition, urocortin (UCN), a peptide in the CRF family that binds with high-affinity to CRF receptors, is expressed in the ovaries and has been implicated in steroid signaling (Muramatsu et al., 2001; Celik et al., 2013).

IVb. Nicotine

Nicotine is the active ingredient in tobacco and is responsible for the positive experience associated with tobacco use. Nicotine binds to nicotinic acetylcholine receptors (nAChRs), which are pentameric ligand-gated ion channels (Benowitz, 1999).

While no studies have investigated the influence of parental nicotine exposure on offspring nicotine response, there is evidence that nicotine exposure can cause multigenerational changes in cognition and dopamine signaling in offspring. Zhu and colleagues found that F1 male and female offspring of F0 mothers exposed to nicotine during pregnancy are hyperactive with decreased attention. In addition, this phenotype is transmitted to F2 and F3 offspring through the maternal line (Zhu et al., 2014).

Hyperactivity in F2 offspring is attenuated by methylphenidate-induced dopamine increase (Zhu et al., 2014), thereby implicating a hypodopaminergic state as the mechanism by which nicotine alters offspring response. Thus, F0 maternal exposure to nicotine during pregnancy produces transgenerational changes in behavior and multigenerational changes in dopamine signaling (Zhu et al., 2014). Studies have

17 examined additional neurochemical changes following exposure to nicotine. However, these are only found in offspring of F0 mothers exposed to nicotine during pregnancy

(Zhu et al., 2012; Yochum et al., 2014). To date, no neurochemical changes have been identified in animals not directly exposed to nicotine.

The epigenome is vulnerable to modification by nicotine exposure. Global DNA methylation patterns in leukocytes are similar between non-smoking offspring and non- smoking fathers, while there are differences in methylation between children that smoke and fathers that do not (Hillemacher et al., 2008). In addition, nicotine-induced variation in DNA methylation has been identified in several genes implicated in drug abuse. For example, nicotine exposure is associated with DNA methylation changes in the gene coding for monoamine oxidase A (Maoa), a key enzyme in the metabolism of dopamine and other monoamines. Decreased methylation of the Maoa promoter is found in the blood and lymphoblasts of current smokers (Philibert et al., 2010). This modification may be mechanistically important, as it has been proposed by Zhu and colleagues that nicotine induced hypomethylation of MAOA decreases dopamine synthesis in animals exposed to nicotine in utero (Philibert et al., 2010; Zhu et al., 2012) . Chronic nicotine administration produces an increase in expression of DNMT1, resulting in methylation of glutamate decarboxylase (Gad67), and reduced Gad67 mRNA expression (Satta et al., 2008).

Consequently, changes in Gad67 mRNA can influence cortical GABAergic signaling. In addition, evidence that methylation and expression of Gad67, a gene implicated in the phenotype of patients with schizophrenia, is modulated by chronic nicotine administration suggests that the co-morbidity that exists between the disorder and

18 smoking addiction may have an epigenetic basis. Interestingly, DNA methylation has been associated with multigenerational exposure to nicotine. F0 mothers exposed to nicotine during pregnancy produce F1 offspring with increased methylation at Bdnf in blood (Toledo Rodriguez et al., 2010) and decreased Bdnf mRNA and protein in the frontal cortex (Yochum et al., 2014) . Decreases in expression and activity of BDNF have been implicated in the self-administration of drugs including cocaine (Sadri-Vakili et al.,

2010), as well as methylphenidate (Cadet et al., 2014) and alcohol (Jeanblanc et al.,

2012).

In addition to changes in DNA methylation, nicotine can remodel chromatin through histone modifications. Following nicotine administration in mice there is an increase in the acetylation of histone H3 in the striatum (Levine et al., 2011) and a decrease in H3K9me2 at promoter regions of target genes (Chase and Sharma, 2013) .

Taken together, these studies suggest that nicotine reduces epigenetic histone marks that promote a restrictive genomic state, thereby opening normally repressed genes to enhanced transcription.

Nicotine-mediated increases in the production of cholesterol, triglycerides, phospholipids and free fatty acids in the testes can be blocked by administration of the nAChR antagonist mecamylamine, suggesting binding sites for both drugs in the testes

(Kavitharaj and Vijayammal, 1998). Indeed, the mRNA of subunits that compose the pentameric nAChR (i.e. α7, α9, α3, α5, and β4) are expressed in sperm (Kumar and

Meizel, 2005). Furthermore, functional nAChRs have been found in sperm (Kumar and

Meizel, 2005). Acetylcholine mediated spikes in calcium through α7 homomeric

19 receptors occurs in the sperm head during the acrosomal reaction (Bray et al., 2005).

Finally, nicotine, likely acting on nAChRs, has detrimental effects on sperm viability.

The male germline is also subject to epigenetic and transcriptional modification by nicotine exposure. In individuals who are smokers, spermatozoan miRNA is differentially expressed (Marczylo et al., 2012), there are abnormalities in histone-to-protamine transition in mature sperm (Yu et al., 2014), and there is significant DNA and RNA damage as compared to non-smokers (Selit et al., 2013). Therefore, the miRNA milieu, chromatin environment, and integrity of both DNA and RNA of the male germline is subject to influence by nicotine.

Maternal smoking has been linked to infertility in male offspring through gonadal toxicity (Ratcliffe et al., 1992). While it is well-established that nicotine exposure produces reproductive challenges in females and in the early developing embryo

(Omotoso et al., 2013), nicotine binding has not been identified in oocytes. Therefore, inheritance through the maternal line may be through indirect effects of nicotine exposure.

V. Overview of Dissertation

The motivation of this dissertation was two-fold - first to characterize the multi- and transgenerational effects of chronic adolescent stress on offspring and to determine the multi-and transgenerational interaction of stress and nicotine exposure. In this effort in Chapter 2, I used an adolescent chronic stress exposure paradigm in mice to determine the impact of stress on long-term alterations in behavior. Of importance, this chronic

20 stress exposure was timed to coincide with critical windows of gamete development, specifically, when epigenetic reprogramming might occur. Therefore, in Chapter 3, I was able to investigate the multi- and trans-generational effects of adolescent stress exposure on offspring anxiety, depression, stress, and nicotine response. RNA-Sequencing analysis was used to identify changes in gene expression in the brains of F1 offspring of stress exposure. In an effort to understand the interaction of nicotine and stress exposure across generations, in Chapter 4, F0 animals were exposed to nicotine and F1 animals were exposed to stress. The effects of these exposures on behavior across several generations were characterized, identifying both nicotine specific as well as nicotine and stress interactions that influence offspring behavior. This dissertation concludes with Chapter 5 in a discussion of the implications of this work and future directions.

Multigenerational Transgenerational

F1 F2 Germline

Embryo F1 F2 F3 Germline

Figure 1.1 Paternal or maternal exposure paradigms are used as a model for inheritance in rodents. F0 males or females exposed to drug prior to mating produce F1 offspring with multigenerational phenotypes and F2 offspring with transgenerational phenotypes (top). F0 females exposed to drug during pregnancy produce F1 and F2 offspring with multigenerational phenotypes and F3 offspring with transgenerational phenotypes (bottom). Figure is as originally published in Progress in Biophysics and Molecular Biology, 2015 Jul, Vol. 118(1-2):21-33, PMID: 25839742.

CHAPTER 2

ADOLESCENT CHRONIC UNPREDICTABLE STRESS EXPOSURE IS A

CRITICAL WINDOW FOR LONG-TERM CHANGES IN ADULT BEHAVIOR

IN MICE

Nicole L. Yohn. Julie A. Blendy

Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania, PA 19104

Prepared for submission to

Neuropsychopharmacology

2016

ACKNOWLEDGEMENTS: This work was supported by NIH grants: T32-DA28874

(N.Y.) and R01- DA033646 (J.B.).

Abstract

Adolescence is a time period in development when the brain undergoes substantial remodeling in response to the environment. To determine if a stressful experience during adolescence affects adult behavior, we exposed adolescent male and female C57BL/6J mice to chronic unpredictable stress (CUS) for 12 days starting at post-natal day 28

(PND28). We also exposed adult male and female mice to CUS for 12 days beginning at

PND70 to determine if adolescence is a critical time period when stress can have long- lasting effects on behavior. Regardless of when mice were exposed to stress, they were all tested exactly 30 days later in the marble burying task, elevated zero maze, acoustic startle response, and forced swim test. Adolescent stress exposure increased anxiety-like behaviors in adult male and female mice and decreased acoustic startle response in a sex- dependent manner. However, adult stress exposure did not change anxiety or response to an acoustic tone in adult male or female mice as compared to non-stressed animals. Of interest, increased depression-like behavior in the forced swim test was observed in all mice, regardless of when the stress occurred. Gene expression analysis in the amygdala showed significant upregulation of corticotropin releasing factor receptor 2 (CrfR2) in males subjected to CUS during adolescence, but not in males that experienced CUS during adulthood. However, females were not affected. This data supports clinical data suggesting that early life stress may predispose individuals to increased anxiety and depression later in life.

Introduction

Adolescence is a dynamic time period for growth and development. For example, the developing nervous system undergoes heightened remodeling in response to the environment (Spear, 2000). During this time marked synapse overproduction and pruning

(Teicher et al., 1995), as well as transient changes in neurotransmitter and receptor production, facilitate neuronal maturation (Daval et al., 1987; Whitaker-Azmitia, 1991).

However, extreme early life adversity may interrupt some of these processes, predisposing an individual to neuropsyhicatric disorders and maladaptative behavior later in life (Andersen and Teicher, 2004). The onset of anxiety, depression, and post traumatic stress disorders have been correlated with exposure to stressors during adolescence

(Pelcovitz et al., 1994; Felitti et al., 1998; Turner and Lloyd, 2004). Furthermore, exposure to uncontrollable adverse events throughout childhood is linked to future psychiatric disorders and, interestingly, adolescent stressors are additive in predicting development and persistence of psychiatric events later in life (Kessler et al., 1997; Heim et al., 2004). Therefore, clinical data suggests that early life stress that is chronic and uncontrollable constitutes a major risk factor for the development of mental disorders

(Heim and Nemeroff, 2001).

Developmental evidence suggests that adolescence is critical window for the effects of stress exposure. The amygdala undergoes significant remodeling through synapse overproduction and pruning during adolescence and is particularly sensitive to early-life stress exposure (Andersen and Teicher, 2004). Maladaptation of stress signaling, specifically altered expression of corticotropin releasing factor (Crf) has been

25 found in the amygdala of rodents exposed to chronic adolescent stress (Plotsky et al.,

2005) and CRF signaling in the limbic system mediates control of anxiety (Wiersma et al., 1995), stress (Bale et al., 2002), and startle response (Dirks et al., 2002).

Animal studies modeling the effects of adolescent stress on behavior later in life suggest that exposure to early-life adversity facilitates differential responses to stressful situations during adulthood, such as enhanced anxiety and stress sensitivity. Chronic exposure to physical, social, or a combination of physical and social stressors during the juvenile and peripubertal phases of development yields altered cognition, anxiety, and depression in adulthood in mice (Schmidt et al., 2010; Weiss et al., 2011; Saavedra-Rodríguez and

Feig, 2013) and rats (Maslova et al., 2002; Tsoory et al., 2007; McCormick et al., 2008;

Eiland et al., 2012). While these studies provide evidence of the long-lasting impact of adolescent stress, few studies have conducted a direct examination of the effects of stress on behavior and neurobiology when experienced by the adolescent versus the adult brain.

We determined the long-term effects of chronic stress on anxiety, startle response, and depression behavior in animals using a chronic unpredictable stress (CUS) paradigm.

This paradigm is composed of both physical and social stressors that last 12 days and produces anhedonia and depression phenotypes in mice (Schmidt and Duman, 2010). The use of CUS in rodents mirrors uncontrolled stress experienced by individuals (Hollis et al., 2013) and also prevents animal habituation to stress exposure, thus avoiding attenuated responses (Girotti et al., 2006). As animals were exposed to the same CUS during different developmental time windows, adolescence prior to puberty (post-natal day 28-40) or adulthood (PND70-82), and tested during adulthood (30 days following the

26 last day of the stressor), we were able to identify adolescence as a critical window for

CUS to have long-term effects on both behavior and differential gene expression.

Materials and Methods

Animals

Male and Female C57BL/6JTac mice (6-8 weeks of age, 20-30 g) were ordered from Taconic Farms (Hudson, NY), group housed, maintained on a 12 hour light/dark cycle with food and water ad libitum in accordance with the University of Pennsylvania

Animal Care and Use Committee (Philadelphia, PA, USA), and bred for two generations to generate offspring used in the current study. Breeding within the facility decreased the impact of transportation stress on the mice and allowed us to isolate the effects of the exposure of CUS in adolescents and adults. All experimental testing sessions were conducted between 8:00 a.m. and 5:00 p.m., with animals randomly assigned to treatment conditions and tested in counterbalanced order. The same mice were used for all behavioral and molecular studies.

Chronic Unpredictable Stress (CUS)

Male and female mice underwent chronic unpredictable stress (CUS) for 12 days starting at PND28 or PND70 (4 weeks or 10 weeks of age). The CUS paradigm was adapted from previous studies that produced anhedonia as measured by the sucrose preference test (SPT) immediately following exposure (Schmidt & Duman 2010). The exact stressors, duration of stressor, and sequence of exposures can be found in Table 2.1.

Briefly, animals were exposed to three stressors each day, in the morning, afternoon, and overnight, for 12 consecutive days in dedicated procedure rooms. Mice were returned to the animal colony between stressors and after the final stressor.

Sucrose Preference Test (SPT)

Sucrose consumption was evaluated on the last two days of the CUS exposure to determine the consequence of CUS on sucrose or water preference in the animals. Mice were habituated to a 1% sucrose solution for 48 hours starting on day 6 of CUS exposure to prevent neophobia during testing. Following sucrose exposure, increasing water restriction was used to habituate animals to water restriction: water was restricted for 4 hours on day 8, 14 hours on day 9, and 19 hours on day 10. On day 11, mice were allowed access to sucrose solution in a cage filled with home cage bedding for 1 hour without the presence of cage mates. Testing was repeated on day 12 of CUS exposure except that mice were given access to water instead of the sucrose solution. Sucrose preference was reported as the difference between total sucrose consumption divided by total liquid consumption (mL) on both test days.

Behavioral tests

Behavioral testing was conducted 4 to 6 weeks following the last day of CUS exposure: PND70-82 (10-12 weeks of age) for the adolescent stress exposure group or

PND112-126 (16-18 weeks of age) for the adult stress exposure group (Spear, 2000). For a more complete explanation of stress exposure in relation to behavioral testing, refer to

Figure 2.1. Behavior was assayed in the following sequential order in every animal: 1) marble burying task, 2) elevated zero maze, 3) acoustic startle response, and 4) forced swim test, with a period of rest of at least two days between each test. Previous studies demonstrate that order of testing affects behavioral measurements. Therefore, all animals were tested in the same order, and forced swim test was the final behavioral assay to be administered (Wahlsten, 2010). Immediately following the forced swim test, animals were sacrificed and whole brains were rapidly removed and flash frozen in isopentane (-

80°C).

Marble Burying (MB)

Differences in anxiety between treatment groups were evaluated using the marble burying (MB) test (Jimenez-Gomez et al., 2011). After a 1-hour period of acclimation, mice were placed individually in a test cage that resembled their home cage (26x20x14 cm). Twenty marbles were distributed evenly in the cages in 5 rows of 4 on top of mouse bedding (5 cm in depth), and a clear lid was placed on top of the cage. Animals were left undisturbed for 15 minutes, after which the number of marbles buried, distinguished by being three-fourths or more submerged under bedding, was quantified by a trained observer blind to experimental groups.

Elevated Zero Maze (EZM)

The elevated zero maze (EZM) was used as a second test of changes in anxiety during adulthood. Following a 1-hour period of acclimation to the testing room, mice were placed in the maze consisting of two open arms and two closed arms elevated 24 inches (61 cm) off the ground and left undisturbed for five minutes. Mice were video recorded for the duration of testing, and the time spent in the open arms of the maze was measured by a trained observer blind to experimental groups.

Acoustic Startle Response (ASR)

The reflexive response to an unexpected tone was assessed using the acoustic startle response (ASR) (Davis, 1980). After a 1-hour period of acclimation to the testing room, animals were placed in acoustic startle chambers (SR-Labs, San Diego, CA, USA) for behavioral testing. The chamber consisted of a light- and sound-attenuating outer plastic box and an inner non-restrictive plastic cylinder chamber affixed to a stage platform. Broadband acoustic startle tones were emitted from a high frequency speaker mounted above the mouse chamber, and startle reflexes were measured by a piezo electronics monitor mounted under the stage platform. Each testing session lasted 30 minutes. Animals were habituated to the inside of the startle chamber with a 67 decibel sound pressure level (dB SPL) background white-noise for five minutes. After the habituation period, animals were presented with 10 rounds of 5 pseudo random startle tones (50 total trials) differing in dB SPL (75, 80, 85, 90, 95, 100 105, 100, 115, and

120dB SPL). Pseuedo random inter-stimulus intervals (ISIs) were generated by the

Startle Response software (SR-Labs; San Diego, CA). ISIs consisted of 26, 28, 30, 32, and 34 seconds. Immediately after each startle tone presentation, the startle amplitude was measured as the average voltage emitted by the piezo electric pickup per each millisecond for the 100 ms response window.

Forced Swim Test (FST)

Behavioral immobility differences between treatment groups were evaluated using the forced swim test (FST). Mice were placed into plexiglas cylinders filled with water (25°C; 30-38 cm high) for 6 minutes, and behavior was video recorded. The time spent immobile during the swim session was recorded by an observer blinded to treatment groups. A mouse was considered immobile when making only those movements necessary to keep its head above water.

RNA extraction, cDNA synthesis, and quantitative real-time polymerase chain reaction

Coronal brain sections (300 um) between Bregma -0.58 and -1.70 (Franklin and

Paxinos, 1997) were used to collect 1.2 mm punches of the amygdala bilaterally. RNA was extracted by homogenizing in 800 µl of TRIzol and 160 µl of chloroform. RNA was purified using an RNeasy Mini Kit (Qiagen, Cat. No. 74104). RNA concentration and integrity were determined with a Nanodrop spectrophotometer (Nanodrop Technologies,

Wilmington, DE). cDNA was synthesized from RNA (100ng) using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using the SYBR-green master mix

(Applied Biosystems) and 10 uM primers (final concentration) for corticotropin relating factor (Crf) and corticotropin releasing factor receptors 1 and 2 (CrfR1, CrfR2) on theStratagen MX3000using MXPro QPCR software. Primer sequences for Crf, CrfR1,

CrfR2 and the housekeepers Tbp and Hprt can be found in table s2.1. Cycling parameters were 95°C for 10 min and then 40 cycles of 95°C (30 s) and 60°C (1 min), followed by a melting curve analysis. All reactions were run in triplicate, and median cycles to threshold (Ct) values were used for analysis. Housekeeping genes were used to normalize against experimental genes, and relative gene expression was determined using the 2−ΔΔCT method (Livak and Schmittgen, 2001).

Statistical analysis

All data are presented as the mean ± standard error of the mean (SEM). For comparison between two groups (e.g. mRNA fold change, latency to immobility in FST), a Student’s t-test was used. For comparisons among both sexes at two time points for stress exposure (e.g. SPT, MB, EZM) a two-way analysis of variance (ANOVA) was used. Finally, for comparisons between multiple groups at multiple measurement points

(e.g. ASR, FST) a repeated measures two-way ANOVA (RM-ANOVA) was used to determine significant differences with tone (ASR) or time (FST) representing the within, repeated-measures independent factor and stress exposure the dependent variable.

Statistical analyses were performed using Graphpad Prism 7 (Graphpad Software, La

Jolla, CA), with the threshold for statistical significance set as P < 0.05, and Bonferroni multiple comparison test used for all post hoc analysis.

Results

Loss of sucrose preference immediately following CUS exposure in adolescents and adults

Adolescent and adult mice exposed to CUS had a significantly lower preference score in the sucrose preference test as compared to within group control animals not

exposed to adolescent or adult stress (Figure 2.2; F1,54 = 5.766, P < 0.05). In addition, a two-way ANOVA revealed a significant effect of age of testing. Animals exposed to

CUS and evaluated with the SPT in adulthood (PND82) had a significantly lower preference score compared to animals exposed to CUS and tested during adolescence

(PND40) (F1,54 = 8.788, P < 0.01).

Adolescent CUS increases anxiety-like behaviors in adulthood

Exposure to CUS during adolescence increased number of marbles buried in the

MB task by adult mice compared to non-stressed controls (Figure 2.3A; F1,48=12.41, P =

0.0009). However, mice exposed to CUS during adulthood and tested 30 days later did not bury more marbles than to non-stressed controls tested at the same time and age

(Figure 2.3B; F1,40 = 3.622, P = 0.0642). In a second test of anxiety, the EZM, adult male and female mice exposed to adolescent CUS spent less time in the open arm of the maze

compared to non-stress controls tested at the same time and age (Figure 2.3C; F1,33 =

4.707, P < 0.05). A two-way ANOVA also revealed a significant effect of sex across

treatments (Figure 2.3C; F1,33 = 7.541, P < 0.01). In contrast, adult CUS exposure had no

33 effect on anxiety behavior in the EZM in male or female mice (Figure 2.3D; F1,39 =

0.01236, P = 0.9120) and no differences in behavior were found between sexes.

Adolescent CUS decreases acoustic startle response at high decibel tones in a sex- dependent manner

Exposure to adolescent CUS decreased average startle response at high decibel

tones in male mice. A two-way RM-ANOVA revealed a main effect of tone (F3,69 =

46.72, P < 0.0001) and a main effect of adolescent stress exposure (F1,23 = 6.573, P =

0.0174) along with a tone by stress exposure interaction (F3,69 = 5.332, P = 0.0023) in male mice on the ASR task (Figure 2.4A). Multiple comparisons further revealed a significant effect of adolescent stress on startle response at the highest tone administered,

120 dB SPL (P < 0.0001). In contrast, CUS exposure during adulthood showed no significant change in startle response at high decibel tones when compared to non-

stressed controls in males (Figure 2.4B; F1,21 = 0.3038, P = 0.5873). However as expected

there was a main effect of startle tone on startle response amplitude (F3,63 = 55.59, P <

0.0001).

There was no change in startle response due to adolescent CUS exposure in

female mice tested for startle response in adulthood (F1,25 = 3.424, P = 0.0761), but, as expected, there was a main effect of tone across both treatment groups (Figure 2.4C; F3,75

= 31.17, P < 0.0001). In addition, female mice exposed to adult CUS showed no significant changes in startle responses compared to non-stressed controls (Figure 2.4D;

F1,19 = 2.491, P = 0.1310), but did show an expected effect of tone on startle amplitude

(F3,57 = 37.31, P < 0.0001).

Adolescent and adult CUS increases time spent immobile in the FST

Exposure to CUS increased total time spent immobile in the FST and decreased latency to the first bout of immobility in both male and female mice, regardless of when stress was presented. A student’s two-tailed t-test revealed that male and female mice exposed to adolescent CUS and tested 30 days later have a shorter latency to the first bout of immobility (Figure 2.5A; P< 0.0001). Male mice exposed to adolescent CUS spent significantly more time immobile over the course of the 6-minute swim test as compared

to non-stressed controls (Figure 2.5B; F1,30 = 8.261, P < 0.01). In addition, female mice exposed to CUS during adolescence spent more time immobile (Figure 2.5C; F1,9 = 5.637,

P < 0.05). Both male and female mice exposed to CUS during adulthood showed a decreased latency to the first bout of immobility (P < 0.0001) and spent more time

immobile (Male: F1,21 = 39.5, < 0.0001, Female: F1,19 = 6.014, P < 0.05) compared to controls (Figure 2.5D-E).

Adolescent CUS increases CrfR2 expression in adult male mice

To evaluate molecular changes associated with anxiety and startle reactivity, we measured mRNA in the amygdala of the adult mice. Adolescent CUS exposure increased expression of CrfR2 mRNA in the amygdala of adult males (Figure 2.6C; P < 0.01) but did not effect the expression of Crf (Figure 2.6A) or CrfR1 (Figure 2.6B). However, adult

CUS exposure did not significantly change the expression of Crf , CrfR1, or CrfR2 mRNA in males (Figure 2.6D-F). In addition, females exposed to adolescent CUS did not have any significant changes in the expression of Crf (Figure 2.6G), CrfR1 (Figure

2.6H), or CrfR2 (Figure 2.6I) in the amygdala. Finally, the same results were found in females exposed to adult CUS (Figure 2.6J-L).

Discussion

Early life stress may predispose individuals to neuropsychiatric disorders later in life. Evidence from human studies suggest that adolescence is a time period vulnerable to the effects of chronic unpredictable stress (Heim and Nemeroff, 2001). Childhood trauma is associated with the emergence of stress-related pathologies in adulthood that include depression, anxiety, and post traumatic stress disorder (Heim et al., 2004; Moffitt et al.,

2007; Rikhye et al., 2008). In addition, quality of life and coping psychopathology is heavily influenced by experiences during adolescence (Iversen et al., 2007; Neigh et al.,

2009). Reports have even suggested that the effect of stress exposure during adolescence is as influential as current stress experience on quality of life (McCauley et al., 1997).

We investigated whether or not adolescence is a critical window of development that is particularly sensitive to stress exposure. Previous work has identified effects of adolescent stress exposure on adult behavior in mice (Schmidt et al., 2010; Weiss et al.,

2011; Saavedra-Rodríguez and Feig, 2013). However, these studies did not directly compare adolescent and adult exposure windows to study the effect of stress on behavior.

Therefore, we exposed adolescent and adult animals to the same stress experience, in

36 both duration and intensity, and tested for changes in behavior exactly 30 days following the final day of stress exposure. In this experimental paradigm we controlled for the type of stress experienced as well as the incubation period between stress and behavior testing.

In addition, we used a stress paradigm composed of physical and emotional stressors and one that is both chronic and unpredictable in nature to better model the human experience of stress (Kessler et al., 1997; Hill et al., 2012).

The CUS protocol used in this study is sufficient to induce an anhedonic state to examine depression-like behaviors (Schmidt and Duman, 2010) and test the efficacy of antidepressants (Falcon et al., 2016). Of importance, the mouse strain used in these experiments, C57BL/6J, shows varying levels of resilience to the effects of stress

(Pothion et al., 2004). Previous research found loss of sucrose preference using much longer paradigms, 7 or 8 weeks of chronic unpredictable mild stress exposure, in this strain (Strekalova et al., 2011; Monteiro et al., 2015). We show here that this shortened

CUS paradigm can induce long-lasting behavioral and neurochemical changes in adolescent C57BL/6J mice that are still evident during adulthood. Importantly, we document a decrease in preference for sucrose over water in stress exposed mice. The sucrose preference test is a well-validated behavior associated with stress-induced anhedonia in animals (Willner et al., 1987) and increased thresholds for intracranial self- stimulation, a more direct measure of anhedonic state (Moreau et al., 1992; Carlezon and

Chartoff, 2007). In the current study, adolescent mice showed a stronger preference score for sucrose compared to adults. This finding is consistent with other reports that show younger mice consume more sugary substances as compared to adults (Brunell and

Spear, 2005; Agoglia et al., 2016). This could be due to an increase in sucrose consumption based on developmental requirements, as adolescence is characterized by the greatest consummatory behavior and the presence of hyperphagia (Ganji and Betts,

1995; Spear, 2000).

Approximately 30 days following the end of CUS exposure, stress-exposed male and female mice spent more time immobile in the forced swim test. Decreased mobility in the FST is associated with decreased sucrose preference in rodents (Strekalova et al.,

2004). The FST has been used to characterize the effect of chronic stress in rats immediately following 21 day restraint stress exposure beginning in adolescence (Eiland et al., 2012) but not later in life. Therefore, this study provides evidence that the FST in adulthood is sensitive to the effects of CUS in adolescence. In addition, we found that adult CUS exposure also promotes altered FST later in life. These findings support the results of Schmidt and colleagues (2010) that showed an increase in depression-like behavior using an alternative assay, the tail suspension test, in mice exposed to 7 weeks of chronic mild unpredictable stress during adulthood and tested 5 weeks later (Schmidt et al., 2010).

We used a series of behavioral assays to determine anxiety-like behavior in male and female mice 30 days following exposure to CUS. Each test for anxiety-like behavior comes with peculiarities and limitations, and no one test provides the ideal model of anxiety. Using several tests to measure anxiety-like behavior allows for the best assessment of basal anxiety state in different conditions (Steimer, 2011). We chose two paradigms that measure different aspects of anxiety. The MB test measures active and

38 compulsive anxiety behavior (Jimenez-Gomez et al., 2011) while the EZM measures exploratory behavior in open or closed arms of a circular maze (Shepherd et al., 1994).

Adolescent CUS exposure increased anxiety-like behavior. Of importance for clinical translation, a predisposition towards an anxious temperament promotes depression and anxiety diagnosis in patients (Nyman et al., 2011). In contrast, adult CUS exposed mice showed no change in anxiety behavior. Of note, control and CUS exposed female mice shared greater anxiety behavior in the EZM compared to males. This sex-specific effect has been previously characterized (Dalla et al., 2010) and appears to be a product of age

(Walf et al., 2009) and estrous cycle (Gouveia et al., 2004).

Finally, to characterize additional stress-relevant behaviors following CUS, we examined startle response to an acoustic tone. The ASR is a twitch-like motor reflex in response to an unexpected auditory stimulus (Koch, 1999). We found adolescent CUS decreased startle amplitudes in males, but not females, compared to controls. Animals administered antidepressants, anxiolytics, and drugs that decrease overall CNS excitability have a blunted startle response (Davis, 1980; Davis et al., 1993; Hijzen et al.,

1995). Enhanced startle is typically indicative of an increased basal state of anxiety

(Walker and Davis, 1997) or administration of an anxiogenic compound (Morgan et al.,

1993; Fendt et al., 1994). There are conflicting reports on the effects of chronic stress on

ASR immediately following the stress exposure, including both increases (Servatius et al., 1994; Gewirtz et al., 1998) and no change in startle (Sipos et al., 2000). Rats exposed to a predator scent during adolescence for approximately 1 week had increased startle responses when tested 4 weeks later, along with increased measures of anxiety (Tsoory et

39 al., 2007). However, our studies, composed of both a different species and different stress exposure, did not find anxiety 30 days following stress exposure was accompanied by increased startle response.

We found sex-specific differences in ASR behavior. Due to hormonal differences, males and females are predisposed to experience the effects of stress differently. In fact, programming of limbic stress circuitry and sex-specific responses to stress later in life occurs prior to puberty and is dependent on intricate sex-specific hormone signaling

(Bale et al., 2010). Some studies found female rodents to be resilient to the effects of stress, unless ovariectomized (Galea et al., 1997; McEwen, 2007), while others characterized females to be more vulnerable to the effects of stress (McCormick et al.,

2004; Mueller and Bale, 2008). The female brain is inherently dissimilar to the male brain with respect to structure and composition over the life-span (Cahill, 2006). Further research into sex-dependent effects of chronic stress will continue to promote a better understanding of stress dependent changes in behavior.

Increased anxiety- and depressive-like behavior and sex-specific effects may be related to the vulnerability of the developing amygdala to stress during adolescence

(Lupien et al., 2009). The neuropeptide CRF is a signaling molecule in the amygdala that mediates extra-hypothalamic stress response and is implicated in both anxiety and depression disorders (Arborelius et al., 1999). Increased CRF activity in the amygdala is found immediately following chronic stress (Menzaghi et al., 1993), and increases in

CRF signaling in the amygdala increases anxiety in rats (Rainnie et al., 2004). Crf expression and signaling has also been implicated in ASR behavior in rodents. CRF

40 projections from the amygdala to the pontine reticular nucleus mediate startle response in rodents (Davis, 1980), and stimulation of the amygdala (Koch and Ebert, 1993) or pharmacologic increase of CRF signaling enhances startle amplitudes (Swerdlow et al.,

1986; Liang et al., 1992).

Six weeks following stress exposure, we found evidence that CRF signaling was altered in males exposed to adolescent stress. CrfR2 mRNA expression was increased in the amygdala of male, but not female, mice that underwent CUS during adolescence.

CRFR2, which is activated by either CRF or urocortin, mediates stress coping through dampening stress sensitivity (Bale et al., 2002). Therefore, increased CrfR2 expression in the amygdala may contribute to blunted startle response. In addition, heightened anxiety found in animals exposed to adolescent stress is consistent with increased CRFR2 activity, as acute CRFR2 activation is anxiogenic (Reul, 2002). Further, we found no change in expression of CrfR1 in animals exposed to adolescent or adult CUS.

In summary, evidence from these studies suggest that adolescence is a critical window for stress exposure, producing a disposition towards increased anxiety, depression, and altered reactivity to stress in the future. In addition, characterization extends to both sexes and identified sex-specific differences in response to stress, providing evidence that sex is a biological variable that affects response to CUS. These findings provide novel evidence of a stress exposure paradigm that produces changes in behavior and stress signaling in the central nervous system.

Figure 2. 1 Experimental timeline. Experimental schematic for chronic stress exposure during adolescence and adulthood and behavioral testing. Male and female mice underwent 12 days of CUS during adolescence, PND28-40, or adulthood, PND70-82. A sucrose preference test was conducted on the final two days of CUS exposure in both groups. Four weeks following the final day of CUS exposure, beginning on PND70 or PND112 respectively, animals were tested in the MB task, EZM, ASR, and FST with at least two days of rest between behavioral testing. Animals were killed and whole brains were removed and frozen immediately following FST.

1.0 #

0.8

0.6 * * 0.4 Sucrose Preference

(sucrose / sucrose+water) 0.2

0.0 NS S NS S Adolescent CUS Adult CUS PND40 PND82

Figure 2.2 Loss of sucrose preference following CUS exposure in adolescents and adults. Adolescent and adult CUS exposure decreases preference for sucrose over water in mice. Male and female mice were combined for analysis. Bars represent volume of sucrose consumed divided by total volume of water and sucrose consumed ± SEM. (n = 8-22), * P < 0.05. A significant effect of time of testing (adolescent vs. adult) was also found, # P < 0.05. NS = no CUS, S = CUS.

A B

20 20

15 15 * *

10 10

5 5 # Marbles buried over 15 min # Marbles Buried over 15 min 0 0 NS S NS S NS S NS S Male Female Male Female

C D 80 80

60 # # 60 * 40 * 40

20 20 Time spent open arm (s) arm open spent Time Time spent open arm (s) arm open spent Time

0 0 NS S NS S NS S NS S Male Female Male Female

Figure 2.3 Adolescent CUS increases anxiety-like behaviors in adulthood. A) Male and female mice exposed to adolescent CUS (S) buried more marbles in the MB task in adulthood than non-stressed (NS) control animals. Bars represent number of marbles buried ± SEM. (n=8-22, * P < 0.05). B) There is no difference in number of marbles buried between animals exposed to adult CUS or non-stressed control animals later in adulthood. (n = 10-12) C) Male and female mice exposed to adolescent CUS spend less time in the open arm of the EZM as compared to NS controls. Bars represent time spent in the open arm of the EZM in seconds ± SEM. (n=8-22,* P < 0.05). Female mice spent less time in the open arm of the EZM regardless of adolescent stress exposure compared to male mice (## P < 0.01). D) There is no difference in the amount of time spent in the open of the EZM in male and female mice exposed to adult CUS compared to non-stressed controls. (n=10-12). NS = no CUS, S = CUS.

A B 100 # 100 No Stress No Stress 80 Stress * 80 Stress

60 60

40 40 Startle Amplitude 20 Startle Amplitude 20

0 0 75 dB 110 dB 115 dB 120 dB 75 dB 110 dB 115 dB 120dB Tone Tone

C D 100 100 No Stress No Stress 80 Stress 80 Stress

60 60

40 40 Startle Amplitude 20 Startle Amplitude 20

0 0 75 dB 110 dB 115 dB 120 dB 75 dB 110 dB 115 dB 120dB Tone Tone

Figure 2.4 Adolescent CUS decreases acoustic startle response in male mice in adulthood. A) Exposure to adolescent CUS (Stress) decreases startle amplitude at high decibel tones in male adult mice compared to non- stressed controls (No Stress). Values are plotted as startle amplitude ± SEM (n = 5-20, * P < 0.05). The lowest dB SPL and three highest db SPL tones are shown. Multiple comparisons revealed a significant difference between groups at 120 dB SPL (# P < 0.001). Male mice exposed to adult CUS (B) and female mice exposed to adolescent CUS (C) or adult CUS (D) showed no difference in startle response compared to non-stressed controls (n = 8-19).

A B C 80 400 400 No Stress No Stress Stress ** Stress * 60 300 300

40 * 200 200

of immobility (s) *** Cumulative Time Cumulative Time Spent Immobile (s) 20 Spent Immobile (s) 100 100 Latency to first bout

0 0 0 NS S NS S 1 2 3 4 5 6 1 2 3 4 5 6 Male Female Minute Minute

D 80 E 400 F 400 No Stress No Stress Stress *** Stress 60 300 300 *

40 200 200 of immobility (s) Cumulative Time Cumulative Time

20 Spent Immobile (s) 100 100 Spent Immobile (s) Latency to first bout *** ***

0 0 0 NS S NS S 1 2 3 4 5 6 1 2 3 4 5 6 Male Female Minute Minute

Figure 2.5 Adolescent and adult CUS induces depression-like phenotype in mice in adulthood. A) Exposure to adolescent CUS (S) decreases latency to first bout of immobility in male and female mice. Bars represent latency in seconds to first bout of immobility ± SEM (n = 5 – 20, * P < 0.05, *** P < 0.0001). B) Male adult mice exposed to adolescent CUS (Stress) spend more time immobile over the 6 minute FST compared to non-stressed control male mice (No Stress). Values represent cumulative time spent immobile in seconds over 6 consecutive minutes ± SEM (n = 12-20, ** P < 0.01). C) Female adult mice exposed to adolescent CUS spend more time immobile over the 6 minute FST compared to non-stressed controls (n = 5-6, ** P < 0.01). D) Exposure to adult CUS decreases latency to first bout of immobility in male and female mice (n = 10-12, *** P < 0.0001). E) Male adult mice exposed to adult CUS spend more time immobile over the 6 minute FST compared to non-stressed controls (n = 11-12, *** P < 0.0001). F) Female adult mice exposed to adult CUS spend more time immobile over the 6 minute FST compared to non-stressed controls (n = 10-12, * P < 0.05). NS = no CUS, S = CUS.

Crf CrfR1 CrfR2

2.0 3 A 2.0 B C *

1.5 1.5 Adolescent 2 CUS 1.0 1.0 Fold Change Fold Change Fold Change 1 0.5 0.5 (normalized to TBP, arbitrary units) (normalized to HPRT, arbitrary units) (normalized to HPRT, arbitrary units)

0.0 0.0 0 No Stress Stress No Stress Stress No Stress Stress

D 2.0 E 2.0 F 3

1.5 1.5 2

Adult 1.0 1.0 Fold Change Fold Change CUS Fold Change 1 0.5 0.5 (normalized to TBP, arbitrary units) (normalized to HPRT, arbitrary units) (normalized to HPRT, arbitrary units)

0.0 0.0 0 No Stress Stress No Stress Stress No Stress Stress

G 2.0 H 2.0 I 3

1.5 1.5 Adolescent 2 CUS 1.0 1.0 Fold Change Fold Change Fold Change 1 0.5 0.5 (normalized to TBP, arbitrary units) (normalized to HPRT, arbitrary units) (normalized to HPRT, arbitrary units)

0.0 0.0 0 No Stress Stress No Stress Stress No Stress Stress

J 2.0 K 2.0 L 3

1.5 1.5 2

Adult 1.0 1.0 Fold Change Fold Change CUS Fold Change 1 0.5 0.5 (normalized to TBP, arbitrary units) (normalized to HPRT, arbitrary units) (normalized to HPRT, arbitrary units)

0.0 0.0 0 No Stress Stress No Stress Stress No Stress Stress

Figure 2.6 Quantitative real-time PCR analysis of Crf, CrfR1, and CrfR2 expression in the amygdala of stressed mice shows increased CrfR2 in male mice exposed to adolescent CUS. A-C) Male mice exposed to adolescent stress (Stress) have no fold change in a) Crf b) CrfR1 mRNA expression in the amygdala and but an increase in CrfR2 (c) fold change compared to controls (No Stress). Bars represent fold change measured by qRT-PCR and normalized to Tbp or HPRT ± SEM (n = 3-5, * P < 0.01). D-F) No fold change in Crf (d), CrfR1 (e), or CrfR2 (f) in the amygdala of male mice exposed to adult CUS compared to controls (n = 3-5). G-I) No fold change in Crf (g), CrfR1 (h), or CrfR2 (i) in the amygdala of female mice exposed to adolescent CUS compared controls (n = 3-5). J-L) No fold change in Crf (j), CrfR1 (k), or CrfR2 (l) in the amygdala of female mice exposed to adult CUS compared to controls (n = 3-5).

Table 2.1 Stressors and lengths of exposure for CUS paradigm

Day$$ Morning$~$9:00$ A0ernoon$~$14:00$ Overnight$~$19:00$(12$hr)$ $$ 1$ Lights$on$ 2$ Rotate$$ 1$hr$ Tilt$$ 3$hr$ Food$depriva9on$$ 3$ Restraint$$ 1$hr$ Lights$off$$ 3$hr$ Stroboscope$ Swim$at$room$ Cold$$ Wet$bedding$ 4$ temperature$ 10$min$ 1$hr$ 5$ Rat$odor$$ 3$hr$ Restraint,$dark$$ 1$hr$ Isola9on$$ 6$ Rotate$$ 1$hr$ New$partner$$ 3$hr$ Lights$on,$sta9c$$ 7$ Cold$$ 1$hr$ Lights$off,$cage$9lt$$ 3$hr$ Wet$bedding$ 8$ Swim$at$18°C$ 8$min$ Restraint,$shaker$$ 1$hr$ Cage$9lt$ 9$ New$partner$ 3$hr$ Rat$odor,$sta9c$ 3$hr$ Lights$on$$ Lights$off,$cage$9lt,$ Cold,$dividers$$ Stroboscope$ 10$ wet$bedding$$ 3$hr$ 1$hr$ 11$ Rat$odor,$rota9on$$ 3$hr$ Restraint,$light$off$$ 1$hr$ Isola9on$$ Swim$at$room$ Rotate$$ Wet$bedding$$ 12$ temperature$ 10$min$ 1$hr$

Cage rotation. Animals were placed 4 per cage and the cage was placed on a Thermo Scientific Multi-purpose Oscillator and run at an oscillation speed of 100 rotations/min. Cage tilt. The cage was tilted 45 degrees. Restraint: Animals were placed in 50ml conical tubes in which holes had been drilled at the front for air and on the cap to allow the tail to extend. Tubes were taped to a table top to stabilize and restrict movement. Animals were continuously monitored during restraint. If animals were continuously struggling for 10 minutes or show severe respiratory distress (respiratory rate 2x baseline) for 5 minutes, the restraint stress was terminated and the animal was removed from the study. Swim. Animals swam one at a time in water in a clear cylinder either at room temperature or 18 degrees Celsius. Animals were continuously monitored during swim stress. At any time if the animal was not actively swimming or floating (i.e. sinking), the animal was immediately removed from the tank. Cold. Cage was placed in a container filled with ice so only the bottom of the cage was in contact with ice. Rat Odor. Animals were placed in a cage filled with used rat bedding. New partner. Animals were placed in a cage with a new partner of the same gender. Stroboscope. Cages were placed in a room overnight with a stroboscope running at 180 light flicks/min with the lights off. Wet bedding. 50 mL of water was added to bedding in the home cage. Lights on plus static. Lights were left on overnight and mice were placed in a room with white noise. The stressors were given 3 times a day, morning, late afternoon and overnight. The duration of these stressors (as indicated in Table 2.1) are all based on published protocols in mice that demonstrate depression-like symptoms, as assessed both behaviorally and at a molecular level (Schmidt & Duman 2010). Animals were continuously monitored for the first 15 minutes of all the stressors and for the duration of the swim and restraint stressors. If the animals met any of the removal criteria outlined above they were removed from the study and euthanized.

48 table s2. 1 Primer sequences used for qRT-PCR

Gene Forward (5’-3’) Reverse (5’-3’)

Crf TAAAGAAAATGTGGCCCCAAG CTAGCCACCCCTCAAGAATGA

CrfR1 CTTCTCCTTCTGGGGCTGA AGGTGCCAATGAGGTCCAC

CrfR2 AAGTGCACGAGGGCAATG TGGTGACCACAAAATAGTTGAAG

Tbp CAGCAATCAACATCTCAGCAA GGGGTCATAGGAGTCATTGGT

Hprt GGCCATCTGCCTAGTAAAGCT GTCGGCCTATAGGCTCATAGT

CHAPTER 3

TRANSGENERATIONAL INHERITANCE OF STRESS: EFFECTS ON

NICOTINE RESPONSE

Nicole L. Yohn1, Yemin Lan2, Marisa S. Bartolomei2, Julie. A Blendy1

1Department of Systems Pharmacology and Translational Therapeutics, 2Department of

Cell and Developmental Biology, Perelman School of Medicine, University of

Pennsylvania, PA 19104

ACKNOWLEDGEMENTS: This work was supported by NIH grants: T32-DA28874

(N.Y.) and R01- DA033646 (J.B.).

Abstract

Parental stress exposure is inherited by future generations in both humans and animals.

However, it is not known whether parental stress exposure influences offspring's response to drugs of abuse, including nicotine. Thus, we determined if stress administered to F0 animals altered the response to nicotine in future generations. Male and female C57BL/6 mice underwent chronic unpredictable stress (CUS) for 2 weeks, starting at 4 weeks of age. Following CUS, mice were mated with naïve partners to produce F1 offspring. A second generation of mice was obtained by mating F1 offspring with naïve partners. Sex- and lineage-dependent changes in response to nicotine were found in both F1 and F2 offspring tested between 10-14 weeks of age. Rna-Seq analysis of the amygdala of F1 male offspring identified 240 genes with altered expression in mice derived from fathers exposed to CUS (fold change > 1.74, FDR < 0.05, and P <

0.05). Of these genes, 41 displayed increased mRNA while 199 were repressed. Gene ontology (GO) functional annotation clustering (DAVIDv6.7) revealed significant enrichment of extracellular matrix and plasma membrane gene sets. Thus, multi- and transgenerational inheritance of parental stress exposure produces altered responses to chronic nicotine exposure in mice. In addition, epigenetic inheritance is reflected in differential expression of genes found in offspring that may contribute to these phenotypes.

Introduction

Stressors are an inescapable part of everyday life. While the nervous system is adept at responding to and recovering from acute stressors, long-term stress exposure promotes detrimental maladaptation in physiological responses to additional stress and a predisposition to disease (de Kloet et al., 2005). In addition, parental exposure to stressors that can result in long-term changes in individual behavior, including the development of neuropsychiatric disorders, is a risk factor for altered physiology and behavior in offspring (Yehuda et al., 1998). This was first noted as increased risk of cardiovascular disease for children of mothers that were exposed to the Dutch Hunger famine (Barker, 1990), which led to the “developmental origins of health and disease” or

DOHaD hypothesis (Barker, 2007). Paternal transmission of exposure to trauma has also been associated with male exposure to the Dutch Hunger famine and the incidence of metabolic disorders in offspring (Kaati et al., 2007), as well as other traumatic events experienced by fathers and their contributions to offspring risk for psychiatric disorders

(Yehuda et al., 2008).

While it is evident that traumatic events experienced by parents can impact offspring behavior and physiology (Matthews and Phillips, 2012), clinical studies are unable to clearly dissociate the influence of parental rearing environment, or the household environment, from biological transmission as a mechanism of inheritance

(Bowers and Yehuda, 2016). Therefore, animal models provide the only means of creating controlled stressful life experiences to study the effects of stress exposure on offspring in the absence of confounding variables. Work in rodents has recapitulated

52 many clinical findings, showing inheritance of both maternal and paternal stress exposure in first and second generation offspring (Franklin et al., 2010, 2011; Dietz et al., 2011;

Leshem and Schulkin, 2012; Rodgers et al., 2013; Saavedra-Rodríguez and Feig, 2013).

In addition, transmission through the germline as a mechanism of inheritance of parental stress exposure has been suggested (Franklin et al., 2010; Dias and Ressler, 2014; Gapp et al., 2014a; Rodgers and Bale, 2015), as have lineage- and sex-dependent inheritance

(Franklin et al., 2010; Saavedra-Rodríguez and Feig, 2013; Babb et al., 2014).

Transmission of the consequences of stress exposure across several generations in offspring that had no direct contact with the stressor, is evidence of transgenerational inheritance of parental experience (Skinner and Guerrero-Bosagna, 2009).

Interestingly, while the multi- and transgenerational effects of parental stress exposure on offspring anxiety, depression, and response to stress has been characterized

(Franklin et al., 2010; Weiss et al., 2011; Rodgers et al., 2013; Saavedra-Rodríguez and

Feig, 2013), little work has explored other domains of physiology and behavior in offspring (Wu et al., 2016). For example, the response to drugs of abuse is heavily modulated by stress in humans and animals (Koob and Volkow, 2009; Briand and

Blendy, 2010), and stress has been implicated in the facilitation of drug self- administration (Haney et al., 1995), conditioned place preference (Der-Avakian et al.,

2007; Smith et al., 2012), and reinstatement of drug seeking behavior (Ahmed and Koob,

1997). In particular, nicotine reinforcement is dependent on stress signaling pathways

(George et al., 2007), and exposure to stress predisposes animals to altered response to

53 nicotine later in life (McCormick et al., 2004). However, it is unknown if parental stress exposure influences offspring's response to nicotine.

Here we evaluate transgenerational maternal and paternal adolescent chronic unpredictable stress (CUS) exposure in two generations of male and female offspring, as well as evidence of lineage and sex-dependent transmissions of exposure. We hypothesized that paternal and maternal adolescent CUS exposure would produce changes in behavior of F1 and F2 offspring, particularly response to nicotine. We employed an adolescent CUS paradigm that was previously shown to induce long-term changes in anxiety and depression-like behavior in mice (Chapter 2). In addition, RNA- sequencing performed in the amygdala of F1 male offspring demonstrated differential gene expression in animals derived from fathers exposed to stress.

Materials and Methods

Animals

Male and Female C57BL/6JTac mice (6-8 weeks of age, 20-30 g) were ordered from Taconic Farms (Hudson, NY), maintained on a 12-h light/dark cycle with food and water ad libitum in accordance with the University of Pennsylvania Animal Care and Use

Committee (Philadelphia, PA, USA), and bred for two generations to generate the F0 animals used in the current study. This decreased the impact of transportation on the mice and allowed us to isolate the effects of CUS on several generations of offspring.

Adolescent chronic unpredictable stress (CUS) exposure

Male and female mice underwent chronic unpredictable stress (CUS) for 12 days starting at post-natal day 28 (PND28). Mice were randomly chosen for exposure to CUS and cagemates were assigned to only one treatment group. The CUS paradigm was adapted from previous studies that induced anhedonia immediately following exposure

(Schmidt and Duman, 2010). The exact stressors, duration of stressor, and sequence of exposures can be found in Table 2.1. Briefly, animals were exposed to three stressors a day, in the morning, afternoon, and overnight, for 12 consecutive days in dedicated procedure rooms. Mice were returned to the animal colony between stressors and after the final stressor.

Mating and offspring generation

One week following CUS exposure, on PND49 (7 weeks of age), males were placed with unexposed females for 1 week. Females were removed from cages and a second group of unexposed females were placed with males on PND56 (8 weeks of age) to produce F1 offspring. The presence of vaginal plugs was monitored daily to test for pregnancy, and males were removed when a plug was found. Non-stressed males underwent the same mating protocol. Both non-stressed and stressed females were mated with non-stressed males approximately one week following the end of CUS exposure on PND49 (7 weeks of age). The presence of vaginal plugs was monitored daily to test for pregnancy, and males were removed when a plug was found. Three cohorts of F0 animals were exposed to adolescent stress and used to produce F1 offspring over three years. To produce a F2

55 animals, F1-Cohort 2 and F1-Cohort 3 were mated at PND96 (12 weeks of age) to produce F2 offspring (Figure 3.1). In order to maintain lineages, male and female F1 animals were not mated together but instead with naive partners.

Behavioral testing

All experimental testing sessions were conducted between 8:00 a.m. and 5:00 p.m.

Behavior in F1 and F2 offspring was assayed between PND70-84 (10 to 12 weeks of age). Three cohorts of F1 and two cohorts of F2 offspring were produced (Figure 3.1).

All animals were sacrificed following final behavioral testing. Brains were rapidly removed and flash frozen in isopentane (-80°C) for use in molecular analysis. Coronal brain sections (300 micron) between Bregma -0.58 and -1.70 (Franklin and Paxinos,

1997) were used to collect 1.2 mm punches of the amygdala bilaterally and used for RNA extraction.

Marble Burying (MB)

Differences in anxiety between treatment groups were evaluated using the marble burying (MB) test (Njung’e and Handley, 1991). After a 1-hour period of acclimation, mice were placed individually in a test cage that resembled their home cage (26x20x14 cm). Twenty marbles were distributed evenly in the cages in 5 rows of 4 on top of mouse bedding (5 cm in depth) and a clear lid was placed on top of the cage. Animals were left undisturbed for 15 minutes, after which the number of marbles buried, distinguished by

56 being three-fourths or more submerged under bedding, was quantified by a trained observer blind to experimental groups.

Elevated Zero Maze (EZM)

The elevated zero maze (EZM) was used as a second test of changes in anxiety in offspring. Following a 1-hour period of acclimation to the testing room, mice were placed in the maze consisting of two open arms and two closed arms elevated 24 inches (61 cm) off the ground and left undisturbed for five minutes. Mice were video recorded for the duration of testing and the time spent in the open arms of the maze was measured by a trained observer blind to experimental groups.

Acoustic Startle Response (ASR)

The reflexive response to an unexpected tone was assessed using the acoustic startle response (ASR) (Davis, 1980). After a 1-hour period of acclimation to the testing room, animals were placed in acoustic startle chambers (SR-Labs, San Diego, CA, USA) for behavioral testing. The chamber consisted of a light- and sound-attenuating outer plastic box and an inner non-restrictive plastic cylinder chamber affixed to a stage platform. Broadband acoustic startle tones were emitted from a high frequency speaker mounted above the mouse chamber and startle reflexes were measured by a piezo electronics monitor mounted under the stage platform. Each testing session lasted 30 minutes. Animals were habituated to the inside of the startle chamber with a 67 decibel sound pressure level (dB SPL) background white-noise for five minutes. After the

57 habituation period, animals were presented with 10 rounds of 5 pseudo random startle tones (50 total trials) differing in dB SPL (75, 80, 85, 90, 95, 100 105, 100, 115, and

120dB SPL). Pseuedo random inter-stimulus intervals (ISIs) were generated by the

Forced Swim Test (FST)

Behavioral immobility differences between treatment groups were evaluated using the forced swim test (FST). Mice were placed into plexiglas cylinders filled with water (25°C; 30-38 cm high) for 6 minutes while being video recorded. The time spent immobile during the swim session was recorded by an observer blinded to treatment groups. A mouse was considered immobile when making only those movements necessary to keep its head above water.

Nicotine Locomotor Sensitization

Locomotor response to repeated nicotine administration was assayed in F1 and F2 offspring at 10 to 12 weeks of age. To evaluate locomotor activity, mice were placed in a test cage with the same dimensions as their home cage containing a small layer of bedding (28.9 x 17.8 x 12 cm). Each test cage was surrounded by a photobeam frame (30 x 24 x 8 cm) with sensors arranged in an eight-beam array strip. Locomotor activity was

58 recorded as beam breaks and was collected over 60 minutes using an activity monitoring system (MED Associates, St. Albans, VT). Data are reported as locomotor activity (beam breaks) over the first 15 minutes of recording.

For two consecutive days, animals received intraperitoneal (i.p.) injections of

0.9% saline solution and were immediately placed in test cages to record baseline level of activity (Baseline). Animals received 1 mg/kg nicotine (i.p.) daily and locomotor activity was recorded for four consecutive days (Sensitization). We chose a low dose of nicotine to determine the effects of chronic exposure on nicotine response. Past work has shown a range of low nicotine doses, 0.015 mg/kg (Tapper et al., 2004) to 0.05 mg/kg (Kim and

Kim, 1999), and higher doses, 0.5 mg/kg (Itzhak and Martin, 1999), that can induce nicotine locomotor sensitization. Two weeks following the last nicotine injection, animals received an additional 1 mg/kg (i.p.) nicotine injection and locomotor activity was recorded (Challenge).

RNA-sequencing (RNA-Seq)

Total RNA was isolated from amygdala punches (bilateral, 10 mg) of F1 male animals using AllPrep DNA/RNA micro kit (Qiagen, Cat. No. 80824). 100 ng of RNA was used to construct cDNA libraries with TruSeq® Stranded mRNA kit poly-A enrichment (Illumina, RS 122-2101) according to the manufacturer’s protocol. The molarity of libraries was quantified using the KAPA library quantification assay (Kapa

Biosystems, Cat. No. KK4873). Next-generation sequencing was conducted on an

Illumina HiSeq2000. With 5-7 replicates per F1 male offspring treatment group, we

59 prepared a total of 24 cDNA libraries. The libraries were multiplexed into two groups, with 12 unique adaptors in each group, and sequenced by the University of Pennsylvania

Next-Generation Sequencing Core (NGSC). Differentially expressed genes (DEGs) were identified using EdgeR (Robinson et al., 2010). Only those transcripts with at least 1.74- fold differential expression (log2 fold change greater than 0.8) and a false discovery rate

(FDR) and P-value lower than 0.05 were included. Davidv6.7 was used to perform functional annotation cluttering of the DEGs. Cluster enrichment scores of a GO annotation above 1.3 (alpha 0.05) were considered significant (Huang et al., 2009).

Statistical analysis

All data are presented as the mean ± standard error of the mean (SEM). For comparison between two groups (e.g. acoustic startle at a single tone), a Student’s t-test was used. For comparisons of the effects of stress across both sexes (e.g. MB, EZM,

FST) the two-way analysis of variance (ANOVA) was employed. Finally, for comparisons between multiple groups at multiple measurement points (e.g. nicotine locomotor sensitization) a repeated measures two-way ANOVA (RM-ANOVA) was used to determine significant differences with time representing the within, repeated-measures independent factor and stress exposure the dependent variable. Statistical analyses were performed using Graphpad Prism 7 (Graphpad Software, La Jolla, CA), with the threshold for statistical significance set as P < 0.05. The Bonferroni multiple comparison test was used for all post hoc analysis.

Results

F1 offspring display lineage and sex-specific changes in affect

We tested F1 male and female offspring in adulthood to determine if paternal or maternal adolescent CUS would impact their behavior. No changes in the number of marbles buried (MB), the time spent in the open arm of the elevated zero maze, the startle response to an acoustic tone (ASR), or the time spent immobile in the forced swim test were found in F1 male or female offspring of fathers exposed to adolescent CUS compared to controls (Table 3.1). Likewise, F1 male and female offspring of mothers exposed to adolescent CUS displayed no significant changes in anxiety- and depressive- like behaviors (Table 3.2). F1 female offspring of maternal adolescent CUS exposure showed a non-significant trend towards an increase in startle at 120 dB compared to non- stressed lineage control animals (P = 0.08). Behaviors are summarized in Tables 3.1 and

3.2 for both lineages. Mice exhibited a sex-dependent difference in FST, in that F1 females spent less time immobile as compared to males, regardless of parental stress

(figure s3.1).

Paternal adolescent CUS exposure alters F1 male and female nicotine locomotor sensitization

In addition to testing F1 offspring for anxiety, depression, and startle behaviors, we sought to determine if parental stress exposure would impact the response to nicotine exposure. Repeated exposure to nicotine causes behavioral sensitization in mice (Reid et al., 1996), reflected by increased locomotor activity following the second treatment with

61 nicotine. This is clearly demonstrated in Figures 3.2 and 3.3 for both male and female descendants of mice that were never exposed to stress.

F1 male offspring of fathers exposed to adolescent CUS showed a different locomotor response to chronic nicotine exposure as compared to controls (Figure 3.2A).

Control animals developed behavioral sensitization to nicotine with increased locomotor response on nicotine day 4 (P < 0.05) and on the challenge day (P < 0.05) compared to the first day of nicotine administration. However, the same development of sensitization was not found in male F1 offspring whose fathers were exposed to adolescent CUS.

Rather, these animals did not exhibit increased locomotor activity on day 4 nicotine compared to day 1 and, instead, only showed expression of locomotor sensitization with a significant increase in locomotor response on the challenge day compared to nicotine day

1 (P < 0.0001).

F1 female offspring of paternal stress showed increased locomotor response to repeated nicotine administration but no development of behavioral sensitization (Figure

3.2B). Paternal stress exposure increased locomotor response to nicotine in F1 females at all time points (P < 0.05). Additional tests showed that, while control female mice

(Father No Stress) increased their locomotor response to nicotine on the challenge day compared to nicotine day 1 (P < 0.05), F1 female mice derived from fathers exposed to stress did not significantly increase their locomotor response to nicotine over time.

Therefore, paternal stress exposure significantly changed the response of F1 male and female offspring to nicotine.

Maternal adolescent CUS exposure eliminates behavioral sensitization to nicotine in offspring

The effect of stress exposure on behavioral sensitization to nicotine was even more striking in the offspring of stressed mothers (Figure 3.3). F1 male and female offspring of mothers exposed to adolescent CUS showed a dramatically blunted locomotor response to chronic nicotine exposure compared to controls. As before, F1 male control animals significantly increased locomotor response on nicotine day 4 and on the challenge day (P < 0.01) compared to the first day of nicotine administration (Figure

3.3A). However, F1 males whose mothers were exposed to stress showed no significant change in locomotor response to nicotine on the fourth day of administration or the challenge day. The same patterns were observed in F1 female offspring. While F1 control females had increased responses to nicotine on both day 4 and challenge day as compared the first day of nicotine administration (P < 0.05), F1 females from mothers exposed to adolescent CUS did not increase response to nicotine over time (Figure 3.3B). Thus, exposing female mice to stress in adolescence causes striking behavioral desensitization in their offspring.

F2 offspring have sex- and lineage- dependent changes in anxiety and startle

In order to determine if F0 paternal or maternal stress exposure impacts the behavior of a second generation of offspring, we tested male and female F2 mice in the

MB test and ASR. Remarkably, F2 male offspring derived from F1 males whose fathers were exposed to CUS buried fewer marbles in the MB test compared to control F2 males

(Table 3.3; P < 0.05). In addition, F2 females derived from the male F1 lineage and whose fathers were exposed to stress showed a non-significant trend towards fewer marbles buried compared to F2 female controls (P = 0.08). Finally, F2 males derived from F1 females whose fathers were exposed to stress, also showed a non-significant trend towards less marbles buried (P = 0.07). Therefore, decreased anxiety-like behavior in the MB test was found in offspring of parents exposed to adolescent stress.

In addition, startle behavior in F2 offspring was altered in a lineage- and sex- dependent manner (Table 3.3). F2 males derived from F1 males whose fathers were exposed to stress had a blunted startle amplitude at the 120 dB tone compared to F2 controls (P < 0.05). However, female F2 mice of the same lineage showed no change in

ASR. In addition, both F2 males and females derived from F1 females whose fathers were exposed to stress showed no change in startle behavior. Finally, we found F0 female stress to have no impact on F2 marble burying or startle behavior (Table 3.4). In summary, we found only one group of offspring derived from F0 stress to have significantly altered startle response.

Sex- and lineage-dependent changes in the response to nicotine are present in F2 offspring of F0 male and female mice with adolescent CUS exposure

As discussed, repeated administration of nicotine results in behavioral sensitization in mice reflected in increased locomotor activity following the first day of nicotine exposure (Figure 3.4). However, F2 male offspring derived from F1 males whose fathers were exposed to adolescent CUS displayed blunted locomotor response to

64 chronic nicotine exposure, demonstrating a deficit in sensitization to nicotine that originated in the grandfather (Figure 3.4A). Female siblings, however, were not significantly different in the expression of nicotine locomotor sensitization compared to controls.

Interestingly, F0 male stress exposure did not transmit changes in locomotor response to nicotine to F2 offspring through F1 females. F2 male offspring of F1 females whose fathers were exposed to stress developed sensitization like controls (Figure 3.4B).

Similarly, F2 female offspring of F1 females whose fathers were exposed to stress showed no differences in response to nicotine compared to controls. Taken together, these results suggest that paternal stress exposure is transmitted through F1 males, but not

F1 females, to affect the F2 generation's response to nicotine.

Finally, we also determined if stress exposure in grandmothers would influence

F2 offspring locomotor response to nicotine. F2 male and female offspring of F1 males whose mothers were exposed to stress developed locomotor sensitization to nicotine exposure (Figure 3.5A). Interestingly, control animals did not significantly sensitize to nicotine administration although they showed trends of an increased locomotor response over time, a finding that is also reflected in previous reports (Itzhak and Martin, 1999). In addition, F2 male and female offspring of F1 females whose mothers were exposed to stress showed nicotine sensitization, as reflected in increased locomotor activity on challenge day compared to the first administration of nicotine (Figure 3.5B). Therefore, we found maternal stress exposure to have no effect on the development of locomotor sensitization to nicotine in F2 offspring.

Differential gene expression in the amygdala of F1 male mice derived from fathers exposed to stress

Transcriptome changes in the amygdala of F1 male offspring were analyzed using

RNA-Seq. Differential gene expression analysis using a stringent threshold and significance criteria (fold change > 1.74, FDR < 0.05, and P < 0.05) identified 240 genes with altered expression in the amygdala of F1 male offspring of stress-exposed fathers

(table s3.1). Of those genes, 41 had increased expression while 199 were deactivated

(Figure 3.6A). Gene ontology (GO) functional annotation clustering of the differentially expressed genes (DEGs), performed using DAVIDv6.7, revealed significant enrichment of several gene sets (table s3.2). The greatest enrichment was found in gene sets identified by "extracellular matrix" and "plasma membrane" component terms that also represented approximately 10% to 40% of DEGs identified within each respective gene set (Figure 3.6B). Driving the GO clustering was the altered expression of collagen and developmental genes, as well as genes implicated in the cellular response to stress and drugs of abuse (Figure 3.6C).

Briefly, collagen genes, Col8a1 and Col8a2, showed 4-fold repression in the amygdala of F1 males from fathers exposed to stress compared to controls. In addition, trophic factors insulin-like growth factor 2 (Igf2) and insulin-like growth factor 2 binding protein (Igfbp2) were significantly deactivated. Remarkably, two subunits of nicotinic acetylcholine receptors, Chrnb3 and Chrnb4, were differentially expressed with a 4-fold repression of Chrnb4 and an 8-fold activation of Chrnb3. Finally, a striking increase in

66 the expression of dopamine receptor 2 (Drd2) was found along with several other genes implicated in the reward pathway.

Discussion

Through a three-year study of multi- and transgenerational inheritance in mice, we made the remarkable discovery that exposure of grandparents to chronic unpredictable stress during adolescence affects behavioral sensitization to nicotine and thus brain plasticity in the grandchildren. Thus, we provide a detailed family tree of the inheritance of a novel adolescent stressor on behavioral sensitization to nicotine in a sex- and lineage-dependent manner.

We sought to characterize phenotype penetrance of both paternal and maternal adolescent CUS exposure. In this effort, male and female F0 mice were exposed to CUS in adolescence and then mated with non-stressed partners. For the F0 male line, fathers were removed from mating cages during pregnancy and had no interaction with offspring, thus controlling for the effect of adolescent CUS may have on F0 interaction with pups. However, in the case of maternal adolescent CUS exposure, mothers were kept with their offspring until pups were weaned at PND21. Therefore, interpretation of multigenerational changes in behavior are subject to the influence of both maternal environment in the homecage as well as maternal epigenetics. Maternal rearing environment has been shown to produce changes in offspring anxiety, stress response, and even social behavior (Francis et al., 1999; Johnson et al., 2011; Zaidan et al., 2013) .

In addition, changes in gene expression and offspring physiology have been correlated

67 with early life experiences in the homecage (Meaney et al., 1996; Menard et al., 2004).

We observed maternal interaction with newborn pups and found no significant differences in homcage behavior between mothers that had been previously stressed compared to non-stressed control mothers (data not shown), but we cannot exclude the subtle differences in maternal behavior. Cross-fostering and in vitro fertilization (IVF) experiments have been used to control for or eliminate the maternal environment.

However, both of these methods come with their own disadvantages. Cross-fostering promotes greater variability based on mother-dependent homecage interactions that can influence adult physiology and behavior (Bartolomucci et al., 2004). In addition, IVF has been shown to cause differential gene expression through altered methylation patterns of the genome during reprogramming (de Waal et al., 2014). Therefore, neither of these methods is likely to reduce the impact of maternal rearing environment in our paradigm.

Previous work in our own lab has shown that adolescent CUS exposure produces increased anxiety, increased depression-like behavior, and altered startle in a sex- dependent manner in animals during adulthood (Chapter 2). However, we did not find these behaviors transmitted to the next generation. Instead, we found that adolescent CUS exposure in F0 males or females did not produce any significant changes in anxiety, depression, or startle response behavior in F1 offspring.

Remarkably, we observed significant changes in the behavior of male F2 mice derived from F1 males whose fathers had been exposed to stress. These F2 males showed decreased anxiety-like behavior, in stark contrast to the effect of adolescent CUS exposure on male adult behavior, but also a blunted startle response, which mirrored the

68 behavior of F0 males (Chapter 2). Decreased startle (Davis et al., 1993; Hijzen et al.,

1995) and marbles buried is achieved through the administration of anxiolytics (Njung’e and Handley, 1991; Jimenez-Gomez et al., 2011), thus implying that decreased basal anxiety was epigenetically inherited from stressed grandfathers to grandsons through the male lineage.

Our study is the first to examine inheritance of chronic stress exposure and its impact on offspring response to drugs of abuse. We hypothesized that parental exposure to CUS during adolescence would impact the response to nicotine, a drug of abuse heavily reliant on stress signaling pathways in the central nervous system for reinforcement (George et al., 2007). Therefore, we employed behavioral sensitization to repeated nicotine exposure to test response to nicotine in F1 and F2 offspring of F0 male or female adolescent CUS exposure. Locomotor sensitization to psychostimulants is a quantifiable, behavioral measure of neuradaptations that occurs in response to chronic, intermittent exposure to drugs. Daily administration of nicotine (Benwell and Balfour,

1979), ethanol (Cunningham and Noble, 1992), amphetamines (Robinson and Becker,

1986), and opiates (Joyce and Iversen, 1979) causes enhanced locomotor activity in response to each consecutive drug exposure of the same dose. These sensitized responses are persistent and last several weeks after cessation of drug exposure (Steketee and

Kalivas, 2011), and may represent a form of neural plasticity (Nestler, 2001).

Importantly, increased locomotor response to nicotine over consecutive days of administration demonstrates induction of sensitization, while the increased locomotor response to nicotine on a challenge day, which is temporally removed from the initial and

69 chronic exposure, shows expression of sensitization. Induction of sensitization is not necessary for expression of sensitization in some animals (DiFranza and Wellman, 2007).

The long-lasting nature of behavioral sensitization is thought to be driven by a persistent enhanced response of neurons that innervate the nucleus accumbens, including glutamate projections from the basolateral amygdala (Pierce and Kalivas, 1997).

Complex family trees were characterized for sensitization to nicotine, revealing both lineage- and sex-specific effects of F0 stress exposure. F0 male stress exposure produced F1 male offspring with blunted development of nicotine sensitization, and, strikingly, this phenotype was stably transmitted to their F2 male offspring. Although paternal adolescent CUS exposure increased F1 female offspring response to nicotine, no changes were inherited by F2 male or female offspring. Therefore, we concluded that paternal nicotine exposure alters the response of F1 offspring to nicotine in a sex- and lineage-dependent manner. F0 female stress exposure produced F1 males and females with blunted locomotor sensitization to nicotine exposure. Interestingly, this phenotype was reversed in the male and female F2 offspring of F1 males and females, in that these mice developed locomotor sensitization to nicotine compared to controls.

It is not uncommon to see different transmission rates of transgenerational inheritance phenotypes (Heard and Martienssen, 2014). Rather, these complex patterns of transmission suggest dynamic processes that mediate multi- and transgenerational inheritance. Changes in the environment produce complex changes, which are malleable in the next generation, thus promoting survival fitness within proximal generations of families (Bonduriansky et al., 2012). The differing patterns of induction and expression

70 of nicotine sensitization observed suggest altered intrinsic development of sensitization between groups of animals. Therefore, we sought to determine if there was altered transcription in the brains of F1 male animals.

We analyzed differential gene expression in the amygdalas of F1 male offspring of paternal and maternal stress exposure using RNA-Seq. F1 male offspring were chosen because they showed altered response to nicotine, if derived from either paternal or maternal stress, and produced F2 offspring with directional changes in response to nicotine in lineage-dependent manners. By identifying a group of animals with altered nicotine response that transmitted this phenotype to the next generation, we could determine differentially expressed genes that may mediate behavior. In addition, we chose the amygdala due to its overlapping roles in drug response (Vanderschuren and

Kalivas, 2000), anxiety, and acoustic startle reactivity (Davis, 1992). The amygdala is functionally primed, through its substructural nuclear organization and connectivity to several regions throughout the brain, to integrate responses to external sensory information and mediate behaviors (Rodrigues et al., 2009).

Using EdgeR we identified 240 differentially expressed genes (DEGs), and using

David functional gene ontology (GO) clustering we revealed two sets of genes of particular interest. First, extracellular matrix genes had the greatest enrichment score.

Decreased expression of type VIII collagen genes (Col8a1, Col8a2), pro collagen C- endopeptidase enhancer (Pcolce), insulin-like growth factor 2 and insulin-like growth factor 2 binding protein (Igf2, Igfbp2), leptin receptor (Lepr), and increased reelin (Reln) expression were found in this functional cluster. Extracellular matrix components and

71 trophic factors are both major players in synaptic development and plasticity and, therefore, down regulation of these genes could greatly influence cell functionality and signaling throughout life (Bonneh Barkay and Wiley, 2009; Russo et al., 2011). In addition, changes in the expression of collagens, Pcolce, and have been implicated in other stress and stress inheritance studies. Col8a1, one of many collagen genes that codes for the fibrous extracellular matrix proteins, is decreased in the paraventricular nucleus of males derived from zygotes re-capitulating the miRNA environment in the germ cells of males exposed to chronic stress offspring (Rodgers et al., 2015). Pcolce, which encodes a glycoprotein necessary for cleavage of precursor collagens, is decreased in the amygdala in mice following chronic immobility stress (Jung et al., 2012). Reln, which encodes an extracellular matrix glycoprotein critical for brain development that mediates cytoskeletal architecture (Chai et al., 2009), is altered via DNA methylation in rats with anxiety following exposure to prenatal stress (Palacios-García et al., 2015). Interestingly, decreased expression of Reln in a schizophrenia mouse model is increased following nicotine exposure, demonstrating an interaction between Reln and nicotine (Romano et al., 2013).

The trophic factors, Igf2 and Igfbp2, were also strongly repressed in amygdala from F1 mice whose fathers were exposed to stress. Signaling of both trophic factors is responsive to immediate stress exposure, as they are found to be decreased in the amygdala of mice following chronic immobilization (Jung et al., 2012). Future research will have to determine by which mechanism decreased expression of these trophic factors in the amygdala contributes to decreased neuronal adaptation to nicotine exposure. Of

72 particular interest is the of epigenetic inheritance is Igf2 expression, which is imprinted and expressed only from the paternal allele (DeChiara et al., 1991; Ferguson-Smith et al.,

1991).

Interestingly, leptin signaling has been tied to stress response in humans and animals (Lu, 2007), and decreased leptin activity is found following chronic stress in rodents (Lu et al., 2006). We found expression of the gene encoding the leptin receptor,

Lepr, down regulated in F1 male amygdala derived from F0 paternal stress exposure. In addition, leptin mediates the release of dopamine in the mesolimbic pathway and is, thus, capable of modifying reward and nicotine response behaviors (Fulton et al., 2006).

The second gene set highly enriched among differentially expressed genes share the GO terms "plasma membrane" and "integral/intrinsic to the membrane". This includes a collection of genes that are primary receptors for drugs of abuse and others that mediate reward signaling, calcium signaling, and neural immune response. Previous stress inheritance studies in rodents have implicated calcium-signaling genes as being altered in the hippocampus for several generations following F0 stress exposure (Saavedra-

Rodríguez and Feig, 2013). In addition, because inherited changes in affect and drug response were found in offspring, mediators of cellular response to the environment and cellular memory formation are likely to be altered as well. Therefore, we were interested to find upregulation of calnueron 1 (Caln1) in the amygdala of F1 males whose fathers were exposed to adolescent stress. Caln1 codes for a calcium-binding protein of the calmodulin family and is regulated by the transcription factor cAMP response element binding protein (CREB) (Wu et al., 2001). Because of localization within neurons and its

73 functional role in intracellular calcium sensing, it is thought to mediate synaptic plasticity

(Hradsky et al., 2015). In addition, we found evidence that structural connectivity may be directly altered in F1 male offspring via upregulation of cadherin 9 (Cdh9), which encodes an integral membrane protein that mediates cell-cell interactions, and exhibits altered gene expression in the amygdala immediately following stress exposure in rodents

(Hohoff et al., 2013).

Remarkably, several important players in stress and reward signaling were differentially expressed in the amygdala of F1 male mice whose fathers were exposed to adolescent CUS. The kappa opioid receptor (Oprk1) plays an important role in stress response and stress-mediated drug response (Bruchas et al., 2010) via expression in the mesolimbic pathway and the extended amygdala (Mansour et al., 1995) and was upregulated (> 2.5-fold) in F1 male offspring of paternal stress. Chronic stress increases kappa opioid signaling in mice (McLaughlin et al., 2006), and we found that this increase may be transmitted to offspring of paternal stress exposure. In addition, the dopamine receptor 2 (Drd2) gene was upregulated in F1 male mice whose fathers were exposed to adolescent stress. Previous work has implicated stress as capable of modulating the dopamine system through DRD2. Pubertal stress in rats increases striatal Drd2 expression

(Novak et al., 2013), and D2 receptors mediate the reinforcing properties of drugs of abuse and are essential for behavioral locomotor sensitization to psychostimulants

(Schindler and Carmona, 2002). Interestingly, "regulator of G protein signaling 9 transcript variant 2" (Rgs9-2) was also upregulated in the amygdala of F1 male mice.

RGS9-2 stimulates GTPase activity of the G protein alpha subunit to serve as an

74 important modulator of G protein mediated signaling (Dohlman and Thorner, 1997). It heavily influences dopamine signaling through attenuation of the Drd2 receptor in the nucleus accumbens and mediates cocaine locomotor sensitization (Rahman et al., 2003;

Cabrera-Vera et al., 2004). In addition, RGS9-2 modulates opioid signaling and deletion of Rgs9-2 expression enhances morphine reward in mice (Zachariou et al., 2003).

Although its exact function remains unclear, Rgs9-2 is expressed in the amygdala (Gold et al., 1997). Therefore, we not only identified differential expression of receptors directly involved in drug abuse and reward, namely Oprk1 and Drd2, but we also found altered expression in a gene that interacts with, and attenuates, the reinforcing properties of both the dopamine and endogenous opioid systems.

Perhaps the most notable finding was that two genes that code for subunits of neuronal nicotinic acetylcholine receptors were differentially regulated in the amygdala of F1 male offspring derived from paternal stress. A striking activation ( >8 fold) was found for the cholinergic receptor nicotinic beta 3 subunit gene (Chrnb3) while the beta 4 subunit gene (Chrnb4) was down-regulated ( >5 fold). The beta 3 subunit is found in combination with other nicotinic acetylcholine receptor subunits, combinations of alpha 4 or 6 and beta 2, in the mesolimbic dopamine system and promotes nicotine reinforcement and sensitization (Picciotto et al., 2000; Cui et al., 2003). The beta 4 subunit exists in combination with the alpha 3 subunit in the amygdala and modulates amygdala output by potentiating GABA interneuron inhibition within the basolateral amygdala (Zhu et al.,

2005). This direct modulation of firing rate mediates fear-related information processing in the limbic system (Davis et al., 1994).

As chronic stress is closely related to immune dysfunction, it was also of interest that the gene encoding the T-cell surface glycoprotein CD4 was upregulated in the amygdala of F1 males derived from fathers exposed to adolescent CUS. Chronic stress in mice greatly increases the number of Cd4 expressing T-cells in peripheral organs (Kim et al., 2012). However, the role of Cd4 transcription in the limbic system has not been characterized. Microglia throughout the CNS are capable of expressing the CD4 receptor to indicate cellular distress (Tambuyzer et al., 2009). Anxious immunosuppressed mice given CD4+ T-cell injections show a decrease in anxiety-like behaviors (Rattazzi et al.,

2013). Therefore, if CD4 transcription and expression is a “red flag” for stress exposure, then perhaps this mark was inherited in offspring not directly exposed to the stress.

Our expression profiling revealed dramatic changes in the activation status of over 200 genes, several of which are excellent candidates to be mediators of the significantly altered response to nicotine that is produced by chronic stress exposure in parents and grandparents. Future studies will need to dissect the specific contribution of these genes , individually and in combination, to the altered neuronal plasticity resulting from parental stress exposures.

What molecular mechanisms could underlie this multigenerational inheritance?

Rodgers and colleagues have proposed that the miRNA environment inherited from paternal stress exposure promotes altered and largely down regulated gene expression in offspring (Rodgers et al., 2015). It should be noted that in our studies, the majority of differentially expressed genes identified were down regulated compared to controls (199 out of 240). Others have suggested that DNA methylation is a means by which altered

76 transcriptional level gene expression in the brain is inherited from the parent generation

(Franklin et al., 2010). The design of this study and the results support germline-mediated transgenerational inheritance.

Studies of true mediators of epigenetic inheritance, other than imprinting, are still in their infancy. Future studies will be aimed at identifying these mediators, which are now becoming amenable to targeted manipulation using TALE or CRISPR-dependent epigenetic modifiers (Gupta and Musunuru, 2014). In summary, chronic stress in adolescence has striking effects of blunting or even eliminating behavioral sensitization to the exposure to drugs of addiction, not only in children but in grandchildren as well.

These studies add valuable insight into stress and nicotine interactions across generations that affect behavior, and they contribute substantially to our understanding of the transcendence of epigenetic transmission of the parental environment.

Figure 3.1 Schematic of experimental design. Three cohorts of F0 male and female mice were exposed to chronic adolescent stress (CUS) and mated to produce F1 offspring. F1-Cohort 1 was tested in in the marble burying (MB) test and elevated zero maze (EZM). F1-Cohort 2 was tested in the MB test, EZM, and acoustic startle response (ASR) prior to FST testing or producing a second generation of mice. F1-Cohort 2 was tested in the MB test, EZM, and ASR prior to being tested for response to nicotine or used to create a second generation of mice. F2-Cohort 2 was tested in the MB test and ASR and F2-Cohort 3 was tested in the MB test, ASR, and nicotine locomotor response. Animals were sacrificed following final behavioral testing.

NS/S

A B

1000 * ** 1000 * 800 * 800 *

600 600

400 400 Locomotor Activity Locomotor Activity 200 200 (beam breaks over 15 min) (beam breaks over 15 min) 0 0 1 4 Challenge 1 4 Challenge 1 4 Challenge 1 4 Challenge Father No Stress Father Stress Father No Stress Father Stress Figure 3.2 Paternal adolescent CUS exposure alters F1 male and female response to nicotine. A) A main effect of time was found for male offspring response to nicotine (F2,28 = 16.82, P < 0.0001). Control F1 male offspring (Father No Stress) increased locomotor response to nicotine on day 4 and challenge day compared to day 1 (* P < 0.05). Male offspring of fathers exposed to stress (Father Stress) increased locomotor response to nicotine on challenge day compared to day 1 (* P < 0.0001). Bars represent number of beam breaks over 15 minutes following i.p. nicotine administration ± SEM (n = 8). B) A main effect of time was found for female offspring response to nicotine (F2,28 = 4.769, P < 0.05). Paternal stress exposure significantly increased F1 female response to nicotine on all days test (* P < 0.05). Control F1 females increased locomotor response to nicotine on challenge day compared to day 1 (* P < 0.05). (n = 8). Differences following two-way repeated measures analysis of variance.

NS/S

A B 1000 ** 1000 *

800 ** 800 *

600 600

400 400 Locomotor Activity Locomotor Activity 200 200 (beam breaks over 15 min) (beam breaks over 15 min) 0 0 1 4 Challenge 1 4 Challenge 1 4 Challenge 1 4 Challenge Mother No Stress Mother Stress Mother No Stress Mother Stress

Figure 3.3 Maternal adolescent CUS exposure eliminates nicotine sensitization in F1 offspring. A) A main effect of time was found for male offspring response to nicotine (F2,28 = 11.28, P < 0.001). Control F1 male offspring (Mother No Stress) increased locomotor response to nicotine on day 4 and challenge day compared to day 1 (** P < 0.01). Bars represent number of beam breaks over 15 minutes following i.p. nicotine administration ± SEM (n = 8). B) A main effect of time influenced the nicotine response in F1 females (F2,26 = 5.214, P < 0.05). Control F1 female offspring increased locomotor response to nicotine on day 4 and challenge day compared to day 1 (* P < 0.05, n = 7-8). Differences following two-way repeated measures analysis of variance.

A NS/S

1000 * 1000 ** * * 800 * 800

600 600

400 400 Locomotor Activity

200 Locomotor Activity 200 (beam breaks over 15 min) (beam breaks over 15 min) 0 1 4 Challenge 1 4 Challenge 0 1 4 Challenge 1 4 Challenge F0 No Stress F0 Stress F0 No Stress F0 Stress

B NS/S

1000 1000 * 800 * 800

600 600

400 400 Locomotor Activity 200 Locomotor Activity 200 (beam breaks over 15 min) (beam breaks over 15 min) 0 0 1 4 Challenge 1 4 Challenge 1 4 Challenge 1 4 Challenge F0 No Stress F0 Stress F0 No Stress F0 Stress

Figure 3. 4 F0 male adolescent CUS exposure alters F2 sensitization to nicotine. A) A main effect of time influenced F2 male and female offspring response to nicotine (Male: F2,28 = 11.44, P < 0.001, Female: F2,28 = 10.09, P < 0.0001). Control F2 male offspring (left, F0 No Stress) through the male line (F1 male) increased locomotor response to nicotine exposure on day 4 and challenge day compared to day 1 (* P < 0.05). F2 male offspring of F0 males exposed to stress through the male line (left, F0 Stress) increased locomotor response to nicotine on challenge day compared to day 1 (** P < 0.01). F2 female offspring derived from F0 control males (right, F0 No Stress) and F0 males exposed to stress (right, F0 Stress) through the male line increased locomotor response to nicotine on challenge day compared to day 1 (* P < 0.05). Bars represent number of beam breaks over 15 minutes following i.p. nicotine administration ± SEM

(n = 8). B) A main effect of time influenced F2 male response to nicotine (F2,26 = 10.42, P < 0.0001). F2 males derived from control F0 males (left, F0 No Stress) or F0 males exposed to stress (left, F0 Stress) through the female line (F1 female) increased locomotor response to nicotine administration on day 4 nicotine compared to day 1 (* P < 0.05, n=8). Differences following two-way repeated measures analysis of variance.

A NS/S

* 1000 1000 * ** 800 800 *

600 600

400 400 Locomotor Activity Locomotor Activity 200 200 (beam breaks over 15 min) (beam breaks over 15 min) 0 0 1 4 Challenge 1 4 Challenge 1 4 Challenge 1 4 Challenge F0 No Stress F0 Stress F0 No Stress F0 Stress

B NS/S

1000 1000 ** 800 ** * 800

600 600

Figure 3. 5 F0 female adolescent CUS exposure alters F2 response to nicotine. A) A main effect of time influenced F2 male and female response to nicotine (Male: F2,28 = 8.662, P < 0.01, Female: F2,28 = 8.476, P < 0.01). F2 male offspring of F0 stressed female mice (left, F0 Stress) through the male line (F1 male) increased locomotor response to nicotine exposure on day 4 and challenge day compared to day 1 (* P < 0.05). F2 female offspring derived from F0 stressed females (right, F0 Stress) through the male line increased locomotor response to nicotine on day 4 and challenge day compared to day 1 (* P < 0.05, ** P < 0.01). Bars represent number of beam breaks over 15 minutes following i.p. nicotine administration ± SEM

(n = 8). B) A main effect of time influenced F2 male and female response to nicotine (Male: F2,28 = 8.883, P < 0.01, Female: F2,28 = 8.838, P < 0.01). F2 males derived from control F0 females (left, F0 No Stress) and F0 females exposed to adolescent CUS (left, F0 Stress) through the female line (F1 female) increased locomotor response to nicotine administration on challenge day compared to day 1 (* P < 0.05, ** P < 0.01). F2 female offspring of F0 stressed females (right, F0 Stress) through the female line increased locomotor response on challenge day compared to day 1. (** P < 0.01, n = 8). Differences following two- way repeated measures analysis of variance.

A B

GO:0005615 4 Extracellular n = 41 region/part/space GO:0044421 ES = 4.09 2 GO:0005576

0 Plasma membrane, GO:0016021 intrinsic/integral to membrane GO:0005886 -2 ES = 4.05 GO:0031224 log2 fold change 0 10 20 30 40 50 -4 n = 199 % DEGs Fold Enrichment (F1 male father stress-no stress) -6 Differentially expressed genes C 6

0 log2 fold change -2

(F1 male father stress-no stress) -4

Igf2 Lepr Reln Drd2 CD4 Oprk1 Cdh9Caln1 Col8a1Col8a2PcolceIgfbp2 Rgs9-2 Chrnb4Chrnb3

Extracellular region/ Plasma membrane, intrinsic/ part/space integral to membrane

Figure 3. 6 Altered transcriptome in the amygdala in F1 male offspring derived from fathers exposed to stress. A) Differential gene expression analysis identified 240 (41 up, 199 down) genes changed by at least 2-fold in the amygdala of F1 male offspring whose fathers were exposed to adolescent CUS compared to controls. Genes are represented by dots ordered in rank by expression from low to high. (log2 fold change > 0.8, dotted lines; P < 0.05, FDR < 0.05). B) Functional annotation clustering of DEGs according to GO annotation (DAVIDv6.7). The top two enrichment scores (ES = 4.09 and 4.05) are shown. Bars represent GO annotation fold enrichment (white) and percent of DEGs included in the cluster (black). (P < 0.05, FDR < 0.05). C) Significantly increased and decreased expression of 16 genes found in the extracellular matrix or plasma membrane enriched GO clusters. (P < 0.05, FDR < 0.05). Bars represent log2 fold change in gene expression in F1 male offspring amygdala from fathers that were stressed during adolescence. 2-fold change in expression compared to controls (dotted lines, log2 > 0.8, fold change > 1.74).

Table 3.1 Summary of behavior of F1 offspring of fathers exposed to stress

F1 Male F1 Female Father No Stress Father Stress Father No Stress Father Stress Marble Burying (MB) Number of marbles buried ± SEM 9.6 ± 0.98 9.0 ± 1.3 8.6 ± 1.1 7.3 ± 1.0 n = 5-13 Elevated Zero Maze (EZM) Time spent in open arm (s) ± SEM 93.71 ± 9.4 87.85 ± 10.2 90.47 ± 9.9 81.38 ± 9.8 n = 4-14 Acoustic Startle Response (ASR) Startle amplitude (at 120 dB) ± SEM 72.25 ± 11.0 78.98 ± 14.4 49.03 ± 7.9 42.20 ± 8.3 n = 8 Forced Swim Test (FST) Time spent immobile (s) ± SEM 135.3 ± 20.7 173 .0 ± 17.0 105.2 ± 19.0 76.5 ± 25.4 n = 5-12

Table 3.2 Summary of behavior of F1 offspring of mothers exposed to stress

F1 Male F1 Female Mother No Stress Mother Stress Mother No Stress Mother Stress Marble Burying (MB) Number of marbles buried ± SEM 11.3 ± 1.2 8.4 ± 2.2 8.5 ± 1.2 7.9 ± 2.0 n = 8-18 Elevated Zero Maze (EZM) Time spent in open arm (s) ± SEM 110.0 ± 15.0 87.75 ± 2.1 90.63 ± 12.3 88.29 ± 11.5 n = 7-17 Acoustic Startle Response (ASR) Startle amplitude (at 120 dB) ± SEM 59.20 ± 8.25 72.55 ± 18.7 47.75 ± 12.4 93 ± 21.0 # n = 7-8 Forced Swim Test (FST) Time spent immobile (s) ± SEM 160.5 ± 24.3 162.1 ± 37.1 79.3 ± 32.9 114.1 ± 19.7 n = 6-18

Table 3.3 Summary of behavior of F2 offspring derived from F0 male stress exposure

F0 Male F1 Male F1 Female F2 Male F2 Female F2 Male F2 Female No Stress Stress No Stress Stress No Stress Stress No Stress Stress Marble Burying Number of marbles 9.6 ± 2.2 2.9 ± 0.77 * 3.7 ± 1.0 1.7 ± 0.48 # 7.6 ± 1.3 3.9 ± 1.5 # 4.2 ± 1.2 2.2 ± 0.67 (MB) n = 7 - 12 buried ± SEM Acoustic Startle F0 Male Startle amplitude (at Response (ASR) 80.0 ± 9.8 52.4 ± 6.3 F1 Male * 49.6 ± 9.6 44.1 ± 5.3 64.7 ± 10.0 89.2 ± 12.9F1 Female 66.9 ± 6.2 66.6 ± 7.0 120 dB) ± SEM n = 7-13 F2 Male F2 Female F2 Male F2 Female No Stress Stress No Stress Stress No Stress Stress No Stress Stress Marble Burying Number of marbles 9.6 ± 2.2 2.9 ± 0.77 * 3.7 ± 1.0 1.7 ± 0.48 # 7.6 ± 1.3 3.9 ± 1.5 # 4.2 ± 1.2 2.2 ± 0.67 (MB) n = 7 - 12 buried ± SEM Acoustic Startle Startle amplitude (at Response (ASR) 80.0 ± 9.8 52.4 ± 6.3 * 49.6 ± 9.6 44.1 ± 5.3 64.7 ± 10.0 89.2 ± 12.9 66.9 ± 6.2 66.6 ± 7.0 120 dB) ± SEM F0 Female n = 7-13 F1 Male F1 Female Table 3.4 Summary of behavior of F2F2 Male offspring derivedF2 Female from F0 female stressF2 Male exposure F2 Female No Stress Stress No Stress Stress No Stress Stress No Stress Stress Marble Burying Number of marbles 3.3 ± 0.53 4.6 ± 1.2 1.3 ± 0.99 1.6 ± 0.56 8.1 ± 1.7 6.1 ± 2.0 2.8 ± 1.2 3.0 ± 0.73 (MB) n = 8 - 12 buried ± SEM F0 Female Acoustic Startle Startle amplitude (at 73.0 ± 8.6 88.4 ± 16.4F1 Male 68.7 ±9.5 74.7 ± 5.1 81.2 ± 19.3 78.8 ± 12.4F1 Female 57.4 ± 4.5 53.4 ± 5.5 Response (ASR) n = 120 dB) ± SEM 8-12 F2 Male F2 Female F2 Male F2 Female No Stress Stress No Stress Stress No Stress Stress No Stress Stress Marble Burying Number of marbles 3.3 ± 0.53 4.6 ± 1.2 1.3 ± 0.99 1.6 ± 0.56 8.1 ± 1.7 6.1 ± 2.0 2.8 ± 1.2 3.0 ± 0.73 (MB) n = 8 - 12 buried ± SEM

Acoustic Startle Startle amplitude (at 73.0 ± 8.6 88.4 ± 16.4 68.7 ±9.5 74.7 ± 5.1 81.2 ± 19.3 78.8 ± 12.4 57.4 ± 4.5 53.4 ± 5.5 Response (ASR) n = 120 dB) ± SEM 8-12

A NS/S B NS/S

200 250

200 150 ** 150 * 100

100

50 Time spent immobile (s) immobile spent Time Time spent immobile (s) immobile spent Time 50

0 0 Father: NS S NS S Mother: NS S NS S F1 Male F1 Female F1 Male F1 Female

figure s3.1 Female F1 mice spend less time immobile in FST regardless of stress lineage. Parental exposure to adolescent CUS had no effect on time spent immobile in F1 offspring. F1 female mice spent less time immobile compared to F1 male mice regardless of (A) paternal or (B) maternal stress exposure. (n = 5-18, * P < 0.05, ** P < 0.01). Differences following one-way analysis of variance.

86 table s3.1 Differentially expressed genes in the amygdala of F1 males

log2 fold change Gene Transcript p-value FDR (F1 male father stress-no stress)

1 Tcf21 NM_011545 -3.309 1.50E-05 0.0060

2 4933429O19Rik NR_033783 -3.084 1.19E-04 0.0226

3 Fap NM_007986 -3.023 4.16E-08 0.0004

4 Fbxl13 NM_001199632 -3.019 2.27E-05 0.0073

5 Fbxl13 NM_177076 -3.019 2.27E-05 0.0073

6 Tmem184a NM_001161548 -2.966 1.14E-04 0.0223

7 Kcnv2 NM_183179 -2.964 3.00E-04 0.0421

8 Olfr574 NM_146360 -2.945 2.85E-05 0.0087

9 Tmem184a NM_144914 -2.915 1.37E-04 0.0245

10 Krt23 NM_033373 -2.899 2.60E-06 0.0019

11 Ccdc68 NM_201362 -2.874 2.51E-05 0.0078

12 Tcea3 NM_011542 -2.868 8.82E-08 0.0004

13 Zfp474 NM_025749 -2.849 4.43E-05 0.0120

14 1600029I14Rik NR_028123 -2.823 3.72E-05 0.0108

15 Rrh NM_009102 -2.817 4.97E-06 0.0027

16 2900093L17Rik NR_040666 -2.815 4.80E-05 0.0123

17 Dmrt3 NM_177360 -2.773 3.46E-04 0.0459

18 Wdr86 NM_001081441 -2.758 2.97E-04 0.0421

19 Lgals3 NM_001145953 -2.754 1.36E-06 0.0013

20 Lgals3 NM_010705 -2.754 1.36E-06 0.0013

21 Msx1 NM_010835 -2.721 6.82E-05 0.0157

22 Msx1as NR_027920 -2.694 8.83E-05 0.0194

23 Lmx1a NM_033652 -2.681 2.47E-04 0.0366

24 Col6a5 NM_001167923 -2.663 2.35E-04 0.0351

25 Zscan10 NM_001033425 -2.639 9.18E-05 0.0194

26 Cox8b NM_007751 -2.617 3.08E-04 0.0424

27 Tmem27 NM_020626 -2.613 1.52E-05 0.0060

28 Lbp NM_008489 -2.613 4.55E-05 0.0121

29 Anxa8 NM_013473 -2.601 1.97E-04 0.0319

30 Abca4 NM_007378 -2.600 4.50E-05 0.0120

31 Got1l1 NM_029674 -2.579 2.22E-05 0.0073

32 Capn6 NM_007603 -2.568 1.13E-04 0.0223

33 Clic6 NM_172469 -2.555 1.58E-05 0.0060

34 Col8a2 NM_199473 -2.554 1.34E-04 0.0240

35 Mlf1 NM_001039543 -2.539 1.38E-05 0.0060

36 Mlf1 NM_010801 -2.539 1.38E-05 0.0060

37 Scara5 NM_001168318 -2.525 2.26E-04 0.0348

38 Capsl NM_029341 -2.490 5.19E-06 0.0027

39 Baiap2l1 NM_025833 -2.463 1.71E-05 0.0063

40 Slc39a4 NM_028064 -2.455 7.62E-07 0.0010

41 Lrrc67 NM_145692 -2.448 1.86E-04 0.0305

42 Trpv4 NM_022017 -2.414 1.27E-04 0.0233

43 Myot NM_001033621 -2.408 6.34E-05 0.0153

44 Pla2g5 NM_011110 -2.406 4.03E-05 0.0112

45 Pla2g5 NM_001122954 -2.375 3.21E-05 0.0095

46 Mia1 NM_019394 -2.360 2.44E-05 0.0077

47 Tctex1d4 NM_175030 -2.346 3.84E-04 0.0485

48 Slc2a12 NM_178934 -2.331 3.57E-06 0.0023

49 Acp5 NM_001102404 -2.311 5.81E-06 0.0030

50 Zfp185 NM_001109043 -2.291 1.01E-04 0.0207

51 Zfp185 NM_009549 -2.291 1.01E-04 0.0207

52 Otx2 NM_144841 -2.290 1.59E-04 0.0275

53 Col8a1 NM_007739 -2.285 9.13E-07 0.0011

54 Dpep1 NM_007876 -2.282 2.30E-04 0.0349

55 1700003M02Rik NM_027041 -2.274 4.72E-05 0.0122

56 1700027A23Rik NM_001200028 -2.267 7.62E-05 0.0171

57 Tgtp2 NM_001145164 -2.266 9.25E-05 0.0194

58 Tgtp1 NM_011579 -2.266 9.24E-05 0.0194

59 Sulf1 NM_001198566 -2.255 3.10E-06 0.0021

60 Sulf1 NM_001198565 -2.255 3.12E-06 0.0021

61 Enpp2 NM_001136077 -2.248 7.09E-06 0.0034

62 Sulf1 NM_172294 -2.247 2.52E-06 0.0019

63 Enpp2 NM_015744 -2.242 4.77E-06 0.0027

64 1700027A23Rik NM_029604 -2.240 1.42E-04 0.0251

65 Acp5 NM_001102405 -2.239 1.16E-05 0.0053

66 Cdh3 NM_007665 -2.237 5.44E-05 0.0134

67 2210020M01Rik NM_183259 -2.232 1.19E-04 0.0227

68 Clic3 NM_027085 -2.202 2.02E-04 0.0323

69 Cdh3 NM_001037809 -2.196 8.20E-05 0.0182

70 Acp5 NM_007388 -2.195 1.40E-05 0.0060

71 Scara5 NM_028903 -2.183 2.54E-04 0.0373

72 Rsph1 NM_025290 -2.182 4.61E-05 0.0121

73 Llgl2 NM_145438 -2.181 3.98E-04 0.0485

74 Glt28d2 NM_177130 -2.176 2.96E-04 0.0421

75 Gm70 NM_001163103 -2.144 2.00E-04 0.0321

76 Lepr NM_001122899 -2.144 3.06E-04 0.0424

77 Dmrta2 NM_172296 -2.141 1.38E-05 0.0060

78 1700009P17Rik NM_001081275 -2.139 1.42E-05 0.0060

79 Igfbp2 NM_008342 -2.126 7.30E-07 0.0010

80 Dsp NM_023842 -2.126 3.67E-04 0.0477

81 Loxl4 NM_001164311 -2.111 2.66E-04 0.0383

82 Loxl4 NM_053083 -2.111 2.66E-04 0.0383

83 Ccdc11 NM_028948 -2.083 3.63E-04 0.0475

84 Rdh5 NM_134006 -2.079 3.98E-06 0.0024

85 Msx2 NM_013601 -2.073 1.77E-04 0.0295

86 2410004P03Rik NM_001201332 -2.072 3.98E-04 0.0485

87 2410004P03Rik NM_001201333 -2.072 3.98E-04 0.0485

88 Cldn1 NM_016674 -2.047 1.58E-05 0.0060

89 Dnali1 NM_175223 -2.042 3.97E-05 0.0112

90 Mdfic NM_175088 -2.022 3.46E-07 0.0010

91 Chrnb4 NM_148944 -1.980 1.97E-04 0.0319

92 Mfrp NM_147126 -1.977 1.14E-06 0.0012

93 C1qtnf5 NM_145613 -1.977 1.14E-06 0.0012

94 Mfrp NM_001190314 -1.977 1.14E-06 0.0012

95 C1qtnf5 NM_001190313 -1.977 1.14E-06 0.0012

96 Zmynd12 NM_001014900 -1.976 5.27E-05 0.0132

97 Ace NM_009598 -1.973 7.72E-08 0.0004

98 Myo5c NM_001081322 -1.971 3.92E-04 0.0485

99 Lrriq1 NM_001163559 -1.961 4.15E-04 0.0498

100 Arhgap28 NM_172964 -1.956 6.46E-05 0.0154

101 Ak8 NM_001033874 -1.935 2.65E-04 0.0383

102 Plp2 NM_019755 -1.933 3.48E-04 0.0459

103 Col9a3 NM_009936 -1.923 1.06E-04 0.0212

104 Kif9 NM_001163569 -1.918 2.37E-06 0.0019

105 Ace NM_207624 -1.904 5.18E-07 0.0010

106 Car12 NM_178396 -1.861 1.24E-04 0.0231

107 Igf2 NM_010514 -1.847 5.62E-08 0.0004

108 Igf2 NM_001122736 -1.844 5.13E-08 0.0004

109 Igf2 NM_001122737 -1.843 5.38E-08 0.0004

110 Slc13a4 NM_172892 -1.842 2.95E-05 0.0089

111 Galm NM_176963 -1.842 2.34E-06 0.0019

112 Kif9 NM_010628 -1.826 1.83E-05 0.0066

113 Hemk1 NM_133984 -1.823 6.61E-06 0.0033

114 Gpx8 NM_027127 -1.821 2.09E-06 0.0019

115 Sema3b NM_001042779 -1.809 7.80E-06 0.0037

116 Sema3b NM_009153 -1.796 8.99E-06 0.0042

117 1110017D15Rik NM_001048005 -1.790 4.13E-04 0.0498

118 Pqlc3 NM_172574 -1.789 3.25E-04 0.0440

119 Pon3 NM_173006 -1.735 2.04E-05 0.0068

120 Angptl2 NM_011923 -1.732 4.78E-06 0.0027

121 Cdkn1c NM_009876 -1.725 6.81E-07 0.0010

122 Cdkn1c NM_001161624 -1.718 6.95E-07 0.0010

123 Pcolce NM_008788 -1.716 3.67E-06 0.0023

124 Npr3 NM_008728 -1.683 2.05E-05 0.0068

125 Npr3 NM_001039181 -1.683 2.05E-05 0.0068

126 Stra6 NM_009291 -1.678 3.83E-04 0.0485

127 Stra6 NM_001162476 -1.677 3.97E-04 0.0485

128 Stra6 NM_001162479 -1.677 3.88E-04 0.0485

129 Stra6 NM_001162475 -1.677 3.88E-04 0.0485

130 Ltc4s NM_008521 -1.669 5.05E-05 0.0128

131 Crb2 NM_001163566 -1.659 1.26E-04 0.0233

132 Sgms2 NM_028943 -1.644 2.60E-06 0.0019

133 Cab39l NM_026908 -1.635 4.86E-07 0.0010

134 Fhad1 NM_177868 -1.604 2.56E-04 0.0375

135 Csrp2 NM_007792 -1.531 1.48E-05 0.0060

136 Itpripl1 NM_001163528 -1.530 6.06E-05 0.0148

137 Itpripl1 NM_001163527 -1.529 6.63E-05 0.0154

138 Ccdc113 NM_172914 -1.525 2.32E-04 0.0350

139 Ifi27l1 NM_194068 -1.489 5.39E-07 0.0010

140 Slc16a12 NM_172838 -1.482 3.84E-05 0.0110

141 Slc16a4 NM_146136 -1.479 6.61E-05 0.0154

142 Ifi27l1 NM_194069 -1.478 3.83E-07 0.0010

143 Fam84b NM_001162926 -1.477 8.90E-05 0.0194

144 Slc16a9 NM_025807 -1.475 3.37E-05 0.0098

145 Ifi27l1 NM_194067 -1.474 6.24E-07 0.0010

146 Ifi27l1 NM_194066 -1.467 5.56E-07 0.0010

147 Ifi27l1 NM_026790 -1.466 5.81E-07 0.0010

148 Pcolce2 NM_029620 -1.464 4.74E-06 0.0027

149 C1qtnf5 NM_001040631 -1.463 2.66E-07 0.0008

150 Slc37a2 NM_001145960 -1.463 2.06E-04 0.0326

151 C1qtnf5 NM_001040632 -1.460 2.41E-07 0.0008

152 Slc37a2 NM_020258 -1.456 2.20E-04 0.0341

153 C1qtnf5 NM_001190319 -1.449 2.55E-07 0.0008

154 Wdr96 NM_027559 -1.438 3.00E-04 0.0421

155 Slc31a1 NM_175090 -1.418 3.63E-06 0.0023

156 St6galnac2 NM_009180 -1.418 2.12E-04 0.0329

157 Bmp6 NM_007556 -1.384 2.08E-04 0.0327

158 Slc4a2 NM_009207 -1.363 1.65E-05 0.0061

159 Slc29a4 NM_146257 -1.346 5.49E-07 0.0010

160 Cd24a NM_009846 -1.336 1.33E-04 0.0240

161 Bst2 NM_198095 -1.323 3.69E-04 0.0478

162 Ocln NM_008756 -1.323 1.55E-05 0.0060

163 Rbp1 NM_011254 -1.314 2.41E-05 0.0077

164 Perp NM_022032 -1.309 1.17E-04 0.0226

165 Vamp8 NM_016794 -1.293 7.09E-05 0.0162

166 Ctnnal1 NM_018761 -1.293 2.05E-05 0.0068

167 Foxj1 NM_008240 -1.281 1.82E-05 0.0066

168 Prelp NM_054077 -1.263 5.31E-05 0.0132

169 Slc16a2 NM_009197 -1.244 1.32E-06 0.0013

170 Sfrp1 NM_013834 -1.237 4.00E-05 0.0112

171 Ankrd57 NM_172939 -1.202 1.86E-05 0.0066

172 Sept10 NM_001024911 -1.192 2.30E-04 0.0349

173 Tnfaip8 NM_001177760 -1.171 1.31E-04 0.0239

174 Ezr NM_009510 -1.158 2.01E-05 0.0068

175 Spag6 NM_015773 -1.148 3.84E-04 0.0485

176 Atp11c NM_001001798 -1.125 3.12E-04 0.0427

177 Atp11c NM_001037863 -1.123 3.37E-04 0.0449

178 Slco1c1 NM_021471 -1.103 4.89E-06 0.0027

179 Slco1c1 NM_001177772 -1.103 4.88E-06 0.0027

180 Acad8 NM_025862 -1.091 1.10E-04 0.0218

181 B4galt1 NM_022305 -1.084 3.22E-04 0.0437

182 Cgnl1 NM_026599 -1.078 1.23E-04 0.0230

183 Tnfaip8 NM_001177759 -1.057 9.05E-05 0.0194

184 Spint2 NM_011464 -1.056 1.60E-04 0.0275

185 Spint2 NM_001082548 -1.047 2.11E-04 0.0329

186 Tnfaip8 NM_134131 -1.042 1.02E-04 0.0208

187 Als2cr4 NM_001037812 -1.040 1.21E-04 0.0227

188 Als2cr4 NM_001033449 -1.035 1.50E-04 0.0262

189 Ucp2 NM_011671 -1.007 7.38E-05 0.0167

190 Tspan33 NM_146173 -0.999 3.96E-04 0.0485

191 Elovl7 NM_029001 -0.964 3.33E-04 0.0448

192 Acaa2 NM_177470 -0.939 6.51E-05 0.0154

193 Mccc1 NM_023644 -0.931 4.18E-04 0.0498

194 Tcn2 NM_015749 -0.897 1.77E-04 0.0295

195 Tcn2 NM_001130459 -0.897 1.77E-04 0.0295

196 Tcn2 NM_001130458 -0.896 1.79E-04 0.0296

197 Cdr2 NM_007672 -0.886 9.24E-05 0.0194

198 Arsg NM_001166177 -0.882 4.16E-04 0.0498

199 Ggh NM_010281 -0.810 3.83E-04 0.0485

200 Rab27b NM_030554 0.878 2.05E-04 0.0326

201 Rab27b NM_001082553 0.879 1.82E-04 0.0300

202 Wscd2 NM_177292 0.894 2.30E-04 0.0349

203 Caln1 NM_181045 1.039 1.05E-04 0.0212

204 Caln1 NM_021371 1.060 1.71E-04 0.0292

205 Reln NM_011261 1.158 2.53E-04 0.0373

206 Cdh9 NM_009869 1.311 6.13E-05 0.0149

207 Oprk1 NM_001204371 1.359 1.16E-04 0.0226

208 Oprk1 NM_011011 1.359 1.18E-04 0.0226

209 Arhgap36 NM_001081123 1.419 1.32E-04 0.0239

210 Dlk1 NM_001190705 1.524 2.85E-06 0.0020

211 Dlk1 NM_010052 1.532 2.51E-06 0.0019

212 Dlk1 NM_001190703 1.533 2.46E-06 0.0019

213 Dlk1 NM_001190704 1.536 2.49E-06 0.0019

214 Dlk1 NR_033813 1.536 2.14E-06 0.0019

215 6330527O06Rik NM_029530 1.727 4.22E-05 0.0116

216 Lingo3 NM_001013758 1.769 3.36E-04 0.0449

217 Syt6 NM_018800 1.773 1.57E-05 0.0060

218 Pde1b NM_008800 1.812 3.60E-04 0.0472

219 Agtr2 NM_007429 1.884 4.26E-05 0.0116

220 Rasd2 NM_029182 1.917 3.21E-04 0.0437

221 A230065H16Rik NM_001101503 2.024 1.74E-04 0.0295

222 Ghsr NM_177330 2.117 2.35E-04 0.0351

223 Lrrc10b NM_001111140 2.229 4.17E-04 0.0498

224 Kremen2 NM_028416 2.349 3.79E-04 0.0485

225 Accn4 NM_183022 2.411 2.98E-05 0.0089

226 Tmem90a NM_001033334 2.482 2.76E-04 0.0395

227 Cbln2 NM_172633 2.609 5.01E-06 0.0027

228 Drd2 NM_010077 2.623 2.55E-05 0.0078

229 Rgs9 NM_001165934 2.653 1.01E-04 0.0207

230 Pde10a NM_011866 2.717 7.30E-05 0.0166

231 Gipc2 NM_016867 2.833 9.26E-05 0.0194

232 Gpr6 NM_199058 2.837 1.48E-04 0.0260

233 Chrnb3 NM_173212 2.941 3.08E-04 0.0424

234 Chrnb3 NM_027454 2.941 3.08E-04 0.0424

235 Gm10754 NR_033537 2.944 3.75E-04 0.0484

236 Rgs9 NM_011268 3.332 1.45E-05 0.0060

237 Cd4 NM_013488 4.006 9.67E-06 0.0045

238 Ankk1 NM_172922 4.052 4.74E-05 0.0122

239 Calca NM_007587 4.212 1.67E-04 0.0287

240 Calca NM_001033954 5.573 5.98E-06 0.0030

95 table s3.2 Functional annotation clustering of DEGs identified in amygdala of F1 male offspring of paternal stress

Enrichment Fold Gene Ontology ID Functional Description % DEGs Score Enrichment

GO:0005576 Extracellular region 15.73 1.80

ES = 4.09 GO:0044421 Extracellular region part 8.99 2.23

GO:0005615 Extracellular space 6.18 2.32

Intrinsic to plasma GO:0031224 41.01 1.33 membrane ES = 4.05 GO:0005886 Plasma membrane 24.16 1.60

GO:0016021 Integral to membrane 38.76 1.30

Reproductive GO:0003006 5.06 4.03 developmental process

ES = 2.04 GO:0007548 Sex differentiation 3.37 5.45

Reproductive structure GO:0048608 2.25 3.64 development

GO:0007155 Cell adhesion 7.30 2.74 ES = 2.02 GO:0022610 Biological adhesion 7.30 2.73

GO:0017046 Peptide hormone binding 1.69 30.71

ES = 2.0 GO:0042277 Peptide binding 3.37 4.22

GO:0042562 Hormone binding 1.69 14.08

Cellular di-, tri-valent GO:0030005 inorganic cation 3.37 5.29 homeostasis

Di-, tri-valent inorganic GO:0055066 3.37 4.86 cation

Cellular cation GO:0030003 3.37 4.66 homeostasis ES = 1.58 GO:0050801 Ion homeostasis 4.49 3.23

GO:0055080 Cation homeostasis 3.37 3.85

GO:0006873 Cellular ion homeostasis 3.93 3.17

Ccellular chemical GO:0055082 3.93 3.09 homeostasis

GO:0048878 Chemical homeostasis 4.49 2.59

Cellular calcium ion GO:0006874 2.25 5.19 homeostasis

GO:0055074 Calcium ion homeostasis 2.25 4.98

Cellular metal ion GO:0006875 2.25 4.73 homeostasis

GO:0055065 Metal ion homeostasis 2.25 4.46

GO:0019725 Cellular homeostasis 3.93 2.41

GO:0042592 Homeostatic process 5.06 1.82

Regulation of blood GO:0008217 2.81 9.09 pressure

Neurological system process involved in GO:0001976 1.69 25.32 regulation of systemic arterial blood pressure

positive regulation of GO:0043085 catalytic activity 4.49 3.62

GO:0002027 Regulation of heart rate 1.69 22.15

Negative regulation of GO:0045776 1.69 22.15 blood pressure

Negative regulation of GO:0051241 multicellular organismal 2.81 5.91 process ES = 1.39 GO:0042277 Peptide binding 3.37 4.22

G-protein signaling, coupled to cyclic GO:0007187 2.25 7.88 nucleotide second messenger

GO:0008015 Blood circulation 2.81 5.32

Circulatory system GO:0003013 2.81 5.32 process

Positive regulation of GO:0044093 4.49 3.09 molecular function

Cyclic-nucleotide- GO:0019935 2.25 7.16 mediated signaling

Regulation of systemic GO:0003073 1.69 12.66 arterial blood pressure

GO:0008016 1.69 7.09 Regulation of heart

contraction

Second-messenger- GO:0019932 2.25 4.01 mediated signaling

G-protein signaling, coupled to cAMP GO:0007188 1.69 6.44 nucleotide second messenger

Regulation of system GO:0044057 2.81 2.94 process

Regulation of adenylate GO:0045761 1.69 5.91 cyclase activity

GO:0019933 cAMP-mediated signaling 1.69 5.81

Regulation of cyclase GO:0031279 1.69 5.72 activity

GO:0051339 Regulation of lyase activity 1.69 5.72

Regulation of cAMP GO:0030817 1.69 5.45 biosynthetic process

Regulation of cAMP GO:0030814 1.69 5.29 metabolic process

Regulation of cyclic GO:0030802 nucleotide biosynthetic 1.69 5.06 process

Regulation of nucleotide GO:0030808 1.69 5.06 biosynthetic process

Regulation of cyclic GO:0030799 nucleotide metabolic 1.69 4.86 process

Regulation of nucleotide GO:0006140 1.69 4.73 metabolic process

Intracellular signaling GO:0007242 5.62 1.29 cascade

Regulation of protein GO:0010627 1.69 2.29 kinase cascade

G-protein coupled receptor GO:0007186 5.62 0.63 protein signaling pathway

Regulation of smooth GO:0006940 1.69 14.18 muscle contraction ES = 1.37 Regulation of muscle GO:0006937 1.69 8.65 contraction

Regulation of system GO:0044057 2.81 2.94 process

GO:0008081 Phosphoric diester 1.69 4.69 hydrolase activity

GO:0050900 Leukocyte migration 2.25 10.99

Regulation of response to GO:0032101 2.81 5.74 external stimulus

Regulation of inflammatory GO:0050727 2.25 8.29 response ES = 1.34 GO:0016477 Cell migration 3.37 2.95

GO:0006954 Inflammatory response 2.81 2.63

GO:0009611 Response to wounding 3.37 2.04

GO:0006952 Defense response 2.81 1.32

Regulation of response to GO:0032101 2.81 5.74 external stimulus

Regulation of inflammatory GO:0050727 2.25 8.29 response

Positive regulation of ES = 1.30 GO:0032103 response to external 1.69 9.09 stimulus

Regulation of cytokine GO:0001817 2.25 3.40 production

Positive regulation of GO:0048584 1.69 1.91 response to stimulus

CHAPTER 4

EXPOSURE INTERACTIONS ACROSS GENERATIONS:

TRANSGENERATIONAL EFFECTS OF NICOTINE AND STRESS

Nicole L. Yohn, Julie. A Blendy

Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania, PA 19104

ACKNOWLEDGEMENTS: This work was supported by NIH grants: T32-DA28874

(N.Y.) and R01- DA033646 (J.B.).

100

Abstract

Inheritance of stress, diet, and drugs of abuse has been identified in offspring. Chronic administration of nicotine produces long-lasting behavioral and physiological changes in humans and animals alike. However, it is unknown if nicotine exposure in one generation influences behavior or subsequent response to nicotine in future generations. Further, while nicotine response may be influenced by stress exposure, it is not known if nicotine and stress interact across generations to influence offspring behavior. Therefore we exposed F0 male mice to nicotine and F1 male and female mice to chronic adolescent stress and characterized affective behaviors, reflexive startle, and response to nicotine response in F2 and F3 generations. F0 nicotine exposure decreased anxiety- and depression- like behavior exclusively in F1 male offspring. Sex- and lineage- dependent changes in response to nicotine were found in F2 and F3 male and female offspring derived from F0 male nicotine exposure. In addition, we found that F3 mice derived from

F0 nicotine exposure and F1 stress exposure showed altered anxiety- and startle behaviors in addition to differential response to nicotine. Therefore, these experiments characterized transgenerational inheritance of nicotine exposure and the combination of nicotine and stress exposure across generations. In addition, we produced a novel multigenerational exposure paradigm for examining the inheritance of multiple environmental exposures across generations.

101

Introduction

In the United States, there are an estimated 40 million adult (Agaku et al., 2014) and 3.5 million youth, under 18 years of age, smokers (Arrazola et al., 2015). In addition, the national prevalence of smokeless tobacco products continues to rise. Approximately 9 million adult (Schoenborn and Gindi, 2015) and 3 million youths (Arrazola et al., 2015) are users of electronic e-cigarettes for daily nicotine delivery. Therefore, with approximately 4 million births occurring each year in the United States (Hamilton et al.,

2015), a significant proportion of children will be born to individuals who are nicotine users. Nicotine, the active ingredient in tobacco products, produces the reinforcing effects in the brain to promote sustained drug use in individuals (Mereu et al., 1987; Damsma et al., 1989). In addition, nicotine produces long-term behavioral and physiological changes.

Nicotine exposure decreases anxiety and depression (Picciotto et al., 2002), enhances cognition (Heishman et al., 2010), alters metabolism (Grunberg, 1990), and influences additional drug use (Dani et al., 2001; Levine et al., 2011). Furthermore, nicotine exposure promotes increased nicotine use in offspring (Hill et al., 2005).

Transgenerational inheritance of environmental exposures from parent to offspring suggests that quality of offspring life can be affected by the actions and experiences of parents (Skinner, 2014). The use of rodent models of environmental exposures has allowed for substantial progress to be made studying the genetic and epigenetic inheritance of parental exposures to exogenous stimuli. For example, it has been determined that the inheritance of parental exposure to changes in diet (Ng et al.,

2010), environmental toxins (Manikkam et al., 2013), and stress (Franklin et al., 2010)

102 promotes altered behavior, physiology, and disease predisposition in future generations of offspring. These findings have also been extended to several drugs of abuse. The effects of parental cocaine (Vassoler et al., 2013b), morphine (Byrnes et al., 2013) , cannabinoids (Szutorisz et al., 2014) , and alcohol (Finegersh and Homanics, 2014) exposure have been studied in offspring. Evidence suggests that nicotine exposure is also subject to multi - and transgenerational inheritance. Mice exposed to nicotine in utero produce two generations of offspring with hyperactivity (Zhu et al., 2014), altered metabolism (Holloway et al., 2007), and a predisposition to respiratory disease (Rehan et al., 2012). However, studies have not been conducted to determine offspring sensitivity to nicotine following parental nicotine exposure and other domains of behavior have not been thoroughly examined.

Nicotine use and abuse is a complex behavioral process that is influenced by many factors. For example, the central nervous system stress signaling pathways are involved in promoting nicotine addiction (Koob and Le Moal, 2001; Koob and Volkow,

2009b) and withdrawal from nicotine is a stressful event that precipitates relapse and increases circulating cortisol (Benwell and Balfour, 1979; Shiffman, 1986). Further, juvenile stress can promote increased response to nicotine in adulthood (McCormick et al., 2004; Briand and Blendy, 2010). Therefore, stress exposure is capable of influencing response to nicotine. In addition, there is strong evidence for the inheritance of stress exposure from mothers and fathers to several generations of offspring (Yehuda et al.,

1998; Franklin et al., 2010; Rodgers et al., 2013; Saavedra-Rodríguez and Feig, 2013).

However, no studies have examined the interaction of nicotine and stress across

103 generations of animals and the resulting influence in future generations. We sought to determine if two behaviors that closely interact on the physiological and molecular level would be additive in their effects on offspring behavior.

Therefore, we first used a nicotine exposure paradigm in mice to study the effects of adolescent exposure on future generations of offspring. In addition, we tested if nicotine and stress interact across generations to influence offspring behavior by exposing both male and female offspring (F1 mice) to adolescent chronic unpredictable stress (CUS) during adolescence. In this effort, we sought to elucidate the influence of a secondary environmental exposure on generational drug exposure and its effects on family phenotypes. Therefore, we produced three lineages to examine multi- and transgenerational inheritance: F0 nicotine + F1 CUS, F0 nicotine exposure only and F0 placebo exposure only. This study is the first to our knowledge to explore the interaction of nicotine and stress across generations. We found that F0 nicotine + F1 CUS exposure altered affective behaviors and response to nicotine in F2 and F3 offspring in sex- and lineage-dependent manners. Therefore, different environmental exposures interact across generations to change offspring phenotype.

In addition, we tested if nicotine and stress interact across generations to influence offspring behavior by exposing both male and female offspring (F1 mice) to adolescent chronic unpredictable stress (CUS) also during puberty. In this effort, we sought to elucidate the influence of a secondary environmental exposure on generational drug exposure and its effects on family phenotypes. Therefore, we produced three lineages to examine multi- and transgenerational inheritance: F0 nicotine + F1 CUS, F0 nicotine

104 exposure only and F0 placebo exposure only. This study is the first to our knowledge to explore the interaction of nicotine and stress across generations. We found that F0 nicotine + F1 CUS exposure altered nicotine response in F2 and F3 offspring in sex- and lineage-dependent manners. Therefore, different environmental exposures interact across generations to change offspring phenotype.

Materials and Methods

Animals

Committee (Philadelphia, PA, USA), and bred for two generations to generate offspring used in the current study. This decreased the impact of transportation on the mice and allowed us to isolate the effects of the drug and chronic unpredictable stress exposure in generations of offspring.

F0 male nicotine exposure

Male mice were exposed to chronic nicotine (18 mg/kg/day; nicotine tartrate dissolved in 0.9% saline; Sigma-Aldrich, St. Louis, MO) or saline via osmotic mini pump

( model 1002; Alzet, Cupertino, CA) for 28 days from PND28 to PND56 (4 to 8 weeks of age). Mice were anesthetized with an isoflurane/oxygen mixture (1 - 3%), and osmotic minipumps were inserted subcutaneously using aseptic surgery techniques. Minipumps

105 were placed parallel to the spine at shoulder level with the flow moderator directed away from the surgical incision. The wound was closed with 7-mm stainless steel wound clips

(Reflex; Cellpoint Scientific, Gaithersburg, MD). Mini pumps were removed following

28 days of exposure using aseptic surgery techniques. A secondary incision site was used to remove the pump. Approximately 1 week following nicotine or placebo exposure mice were placed with unexposed females for 1 week. Females were removed from cages and a second group of unexposed females were placed with males to produce F1 offspring.

The presence of vaginal plugs was monitored daily to test for pregnancy, and males were removed when a plug was found.

F1 adolescent chronic unpredictable stress (CUS) exposure

Male and female offspring from nicotine-exposed fathers underwent chronic unpredictable stress (CUS) for 12 days starting at post-natal day 28 (PND28, 4 weeks of age). The CUS paradigm was adapted from previous studies that induced anhedonia immediately following exposure (Schmidt and Duman, 2010). The exact stressors, duration of stressor, and sequence of exposures can be found in Chapter 2 (Table 2.1) along with detailed descriptions. Briefly, animals were exposed to three stressors a day, in the morning, afternoon, and overnight, for 12 consecutive days in dedicated procedure rooms. Mice were returned to the animal colony between stressors and after the final stressor. One week following CUS exposure on PND49 (7 weeks of age), males were placed with non-stressed females for 1 week. Females were removed from cages and a second group of non-stressed females were placed with males at PND56 (8 weeks of age)

106 to produce F2 offspring. The presence of vaginal plugs was monitored daily to test for pregnancy, and males were removed when a plug was found. Non-stressed males underwent the same mating protocol. Both non-stressed and stressed females were mated with naive males 1 week following the end of CUS exposure at PND49. Presence of vaginal plugs was monitored daily to test for pregnancy and males were removed when a plug was found.

Behavioral testing

All experimental testing sessions were conducted between 8:00 a.m. and 5:00 p.m. Behavior in F1, F2, and F3 offspring was assayed between PND70-84 (10 to 12 weeks of age). Three cohorts of F1 and F2 offspring and one cohort of F3 were produced for behavioral testing (Figure 4.1). All animals were sacrificed following final behavioral testing.

Marble Burying (MB)

Differences in anxiety between treatment groups were evaluated using the marble burying (MB) test (Jimenez-Gomez et al., 2011). After a 1-hour period of acclimation, mice were placed individually in a test cage that resembled their home cage (26x20x14 cm). Twenty marbles were distributed evenly in the cages in 5 rows of 4 on top of mouse bedding (5 cm in depth) and a clear lid was placed on top of the cage. Animals were left undisturbed for 15 minutes, after which the number of marbles buried, distinguished by

107 being three-fourths or more submerged under bedding, was quantified by a trained observer blind to experimental groups.

Elevated Zero Maze (EZM)

Acoustic Startle Response (ASR)

The reflexive response to an unexpected tone was assessed using the acoustic startle response (ASR) (Davis, 1980). After a 1-hour period of acclimation to the testing room, animals were placed in acoustic startle chambers (SR-Labs, San Diego, CA, USA) for behavioral testing. The chambers consisted of a light- and sound-attenuating outer plastic box and an inner non-restrictive plastic cylinder chamber affixed to a stage platform. Broadband acoustic startle tones were emitted from a high frequency speaker mounted above the mouse chamber and startle reflexes were measured by a piezo electronics monitor mounted under the stage platform. Each testing session lasted 30 minutes. Animals were habituated to the inside of the startle chamber with a 67 decibel sound pressure level (dB SPL) background white-noise for five minutes. After the

108 habituation period, animals were presented with 10 rounds of 5 pseudo random startle tones (50 total trials) differing in dB SPL (75, 80, 85, 90, 95, 100 105, 100, 115, and

120dB SPL). Pseuedo random inter-stimulus intervals (ISIs) were generated by the

75dB, 110dB, 115dB, and 120dB tones was used.

Forced Swim Test (FST)

Behavioral immobility differences between treatment groups were evaluated using the forced swim test (FST). Mice were placed into Plexiglas cylinders filled with water (25°C; 30-38 cm high) for 6 minutes while being video recorded. The time spent immobile during the swim session was recorded by an observer blinded to treatment groups. A mouse was considered immobile when making only those movements necessary to keep its head above water.

Nicotine Locomotor Sensitization

109 x 24 x 8 cm) with sensors arranged in an eight-beam array strip. Locomotor activity was recorded as beam breaks and was collected over 60 minutes using an activity monitoring system (MED Associates, St. Albans, VT). Data are reported as locomotor activity (beam breaks) over the first 15 minutes of recording.

For two consecutive days, animals received intraperitoneal (i.p.) injections of

Kim, 1999), and higher doses, 0.5 mg/kg (Itzhak and Martin, 1999), that can induce nicotine locomotor sensitization. Two weeks following the last nicotine injection, animals received an additional 1mg/kg (i.p.) nicotine injection and locomotor activity was recorded (Challenge).

Statistical analysis

All data are presented as the mean ± standard error of the mean (SEM). For comparison between two groups (e.g. F1 MB, EZM, FST), a Student’s t-test was used. For comparisons of the effects of nicotine and stress within a generation (e.g. F2 and F3 MB,

EZM, FST) a one-way analysis of variance (ANOVA) was used. Finally, for comparisons between multiple groups at multiple measurement points (e.g. ASR and nicotine locomotor sensitization) a repeated measures two-way ANOVA (RM-ANOVA) was used

110 determine significant differences with tone or time representing the within, repeated- measures independent factor and lineage the dependent variable. Statistical analyses were performed using Graphpad Prism 7 (Graphpad Software, La Jolla, CA) with the threshold for statistical significance set as P < 0.05, and Bonferroni multiple comparison test used for all post hoc analysis.

Results

Male F1 offspring of fathers exposed to nicotine display decreased anxiety- and depression-like behavior

First, to determine if paternal nicotine exposure would influence offspring anxiety- and depression-like behavior we tested F1 offspring of placebo and nicotine exposed males in the marble burying (MB) test, elevated zero maze (EZM), and forced swim test (FST). Male and female F1 offspring of fathers exposed to nicotine showed no change in number of marbles buried compared to male and female F1 offspring of father exposed to placebo (figure s4.1A). However, a decrease in anxiety was found in F1 males whose fathers were exposed to nicotine in that they spent more time exploring the open arms of the elevated zero maze compared to controls (figure s4.1B). In addition, F1 male offspring of paternal nicotine exposure were exclusively affected by F0 nicotine exposure in the FST. Male F1 offspring of fathers exposed to nicotine spent less time immobile in the FST compared to placebo-sired F1 male offspring (figure s4.1C).

Finally, F1 offspring were also tested for reflexive startle response to varying decibel tones to determine if paternal nicotine exposure would affect startle reactivity. No

111 change was found in F1 male or female offspring of paternal nicotine exposure compared to placebo-sired controls in startle response to low or high decibel tones (figure s4.2).

Therefore, fathers exposed to nicotine produced male offspring with decreased anxiety- and depression-like behavior.

F2 male offspring of nicotine and stress display blunted response to nicotine that is not transmitted to F3 offspring

To determine if nicotine and stress interact across generations to influence offspring behavior, half of the F1 offspring were exposed to adolescent chronic unpredictable stress (CUS) and F2 offspring were generated. In addition, to test for transgenerationl inheritance of the two exposures, F2 mice were mated with naive partners and an F3 generation was produced.

Male F2 offspring of F1 males showed no significant changes between groups in number of marbles buried, time spent in the open arm of the EZM, time spent immobile in the FST, or startle response at high decibel tones (Table 4.1). However, a significant reduction in response to nicotine was found in F2 males derived from F0 nicotine or F0 nicotine and F1 male stress exposure compared to placebo/no stress controls that demonstrated a sensitized locomotor response to nicotine (Figure 4.2A). Furthermore, to determine if F2 males produced offspring with the same phenotype we characterized behavior in F3 male and female offspring. F3 male offspring decreased acoustic startle response at a 120 dB tone, if derived from nicotine exposed great-grand fathers, but no anxiety phenotypes were evident (Table 4.2). Of interest, locomotor response to nicotine

112 was no longer blunted in F3 male offspring of F0 nicotine exposure but these mice did not demonstrate a sensitized response to nicotine compared to F3 male offspring derived from F2 males whose fathers were exposed to stress and grandfathers were exposed to nicotine (Figure 4.2B, left). In addition, female siblings showed unique changes in response to nicotine. F3 females derived from the same F2 fathers and placebo/no stress controls did not show the expected locomotor response to nicotine over time (Figure

4.2B, right). However, F3 female offspring of F0 nicotine and F1 male stress exposure developed locomotor sensitization to repeated nicotine. No change in marble burying or startle response was found between F3 female offspring derived from different lineages of F2 males (Table 4.2).

F2 female offspring of nicotine and stress display transient sensitization to nicotine not found in F3 offspring

Female F2 offspring of F1 males showed no significant changes between groups in number of marbles buried, time spent in the open arm of the EZM, time spent immobile in the FST, or startle response at high decibel tones (Table 4.1). Interestingly, the expression of nicotine sensitization was significantly decreased in F2 females derived from F0 nicotine or F0 nicotine and F1 male stress exposure compared to placebo/no stress controls that demonstrated a sensitized locomotor response to nicotine (Figure

4.2C). These offspring significantly increased locomotor response to nicotine on day 4 of administration, but this response was lost by the challenge day. However, F2 females did not transmit this phenotype to offspring. Instead, F3 male offspring had a blunted

113 locomotor response to nicotine administration compared to both placebo/no stress controls and F3 males derived from F0 nicotine and F1 stress exposure that developed locomotor sensitization to nicotine over time (Figure 4.2D, left). Along with blunted sensitization, F3 males also increased startle response to a 120 dB tone if their grandfathers had been administered nicotine (Table 4.3).

Of interest, F3 female offspring also did not resemble the phenotype of their mothers. F3 female offspring did not sensitize to the effects of nicotine over time.

However the same was found in placebo/no stress controls (Figure 4.2D, right).

Interestingly, the interaction of F0 nicotine and F1 stress created a unique phenotype in

F3 females compared to the other groups in that they developed locomotor sensitization to nicotine. No change was found in marble burying behavior or startle response in F3 females offspring derived from F2 females (Table 4.3).

Phenotypes for F2 and F3 offspring derived from F1 female stress exposure and

F0 nicotine administration were also characterized. This data is summarized in supplemental tables s4.1-4.3 and figure s4.3. Briefly, F2 offspring showed no changes in affective behaviors or depression (table s4.1), while F3 animals displayed lineage specific increases in number of marbles buried in the MB test and blunted startle response (tables s4.2 and s4.3).In addition, F0 nicotine administration and F1 female stress exposure blunted F2 response to nicotine and induced subtle changes in F3 offspring(figure s4.3).

114

Discussion

We utilized a novel multigenerational exposure paradigm to identify the effects of two environmental exposures on the behavior of future generations of offspring. F0 male nicotine and F1 male chronic unpredictable stress exposure produced striking changes in affective behaviors and response to nicotine in F2 and F3 offspring. In addition, our work is the first to record transgenerational nicotine and stress interactions in male and female mice.

We found pervasive transmission of phenotypes derived from multigenerational exposures. F1 males transmitted stress exposure and F0 nicotine administration to two generations of offspring. F2 males whose grandfathers received nicotine showed a significantly blunted sensitization response to nicotine regardless of if their fathers also received stress. Remarkably, this phenotype was also partially transmitted to F3 male offspring in which F3 males whose fathers were not exposed to any insult, nicotine or stress, did not develop locomotor sensitization to nicotine administration if their great- grandfathers were exposed to nicotine. However nicotine and stress interacted to produce unique F3 phenotypes. For example, if F3 male offspring’s great-grandfathers were exposed to nicotine and grandfathers to stress then this phenotype was lost. Of interest, the same pattern was found in F3 females.

A sex-specific effect was seen in F2 female offspring that displayed different phenotypes than their male siblings. F2 females whose grandfathers received nicotine developed sensitization. However, this response was not long-lasting in that by the time testing was conducted on the challenge day, the females displayed decreased response to

115 nicotine. In addition, F2 females did not transmit their phenotype to offspring. Rather, F3 male offspring whose mothers were not exposed to an insult but whose grandfathers were exposed to nicotine showed a blunted response to nicotine and F3 females showed subtle changes in the development of sensitization. There was an overall trend towards decreased sensitization to nicotine in F2 and F3 offspring derived from F0 nicotine alone or the combination of F0 nicotine and F1 stress exposure. Decreased sensitization to repeated doses of nicotine correlates with decrease reward saliency of nicotine (Mao and

McGehee, 2010). Therefore, decreased reward value of nicotine may be arguably adaptive for the offspring.

For assaying response to nicotine we chose a nicotine dose that we found to be sub-threshold in its ability to increase locomotor response to repeated exposures. Varying doses of nicotine have been used in previous nicotine locomotor sensitization studies: low doses 0.015 mg/kg (Tapper et al., 2004) to 0.05 mg/kg (Kim and Kim, 1999) and higher doses, 0.5 mg/kg (Itzhak and Martin, 1999). A limitation of the study is the long-time frame over which repeated generational experiments must occur. It should be noted that for all groups of animals that were compared, animals were tested at the same time under the same conditions. In the cases where sensitization in control animals did not occur, we interpret the results as a straightforward as possible; that as a group composed of a sample size of specific animals, the average response was a lack of increased locomotor activity on any day assayed compared to the initial day of nicotine administration.

Increased response to nicotine over consecutive days, significant increased on day 4 compared to day 1, demonstrates induction of sensitization. However, response to

116 nicotine on a challenge day compared to day 1 nicotine is an expression of sensitization.

Induction of sensitization is not necessary for the expression of sensitization (DiFranza and Wellman, 2007). Enhanced locomotor response to nicotine following chronic administration of the drug is associated with potentiated nicotine induced dopamine release in the nucleus accumbens (Benwell and Balfour, 1979). Psychostimulant-induced locomotor sensitization shares this common mechanism. Therefore, behavioral sensitization has been implicated in drug addiction and has been used to indirectly assay the escalation of drug seeking behaviors and the reinforcement value of a drug (Robinson and Berridge, 1993).

To date, few studies have utilized rodent models to examine the multi- and transgenerational effects of nicotine exposure (Holloway et al., 2007; Rehan et al., 2012;

Zhu et al., 2014) although epidemiological evidence suggests the inheritance of nicotine exposure across generations (Hillemacher et al., 2008; Mill and Petronis, 2008). In addition, previous studies have used in utero nicotine administration paradigms to produce F0 mice directly exposed to drug (Holloway et al., 2007; Rehan et al., 2012; Zhu et al., 2014). However, inheritance of post-natal nicotine exposure has not been previously explored. While nicotine crosses the placental barrier to directly affect the developing fetus (Jordanov, 1990), in utero exposure paradigms also include maternal response and distress (Lambers and Clark, 1996) that influences fetal development.

Therefore we chose to expose F0 male mice to nicotine via osmotic minipumps during adolescence and produced a future generation of offspring. The use of osmotic minipumps allowed for strict temporal control of nicotine administration and dose. In

117 addition, we used a dose previously characterized in rodent models of chronic nicotine administration that upregulates nicotinic acetylcholine receptors in the brain, a hallmark of chronic nicotine use in humans (Benwell et al., 1988; Marks et al., 1992). Finally, we focused on male nicotine exposure in the F0 generation. This allowed for characterization of the effect of post-natal nicotine exposure on the first generation of offspring without interference of rearing environment, because males were removed from the mating cage prior to the birth of pups.

Therefore, we identified the effects of F0 male nicotine exposure alone on F1 male and female offspring behavior in addition to stress and nicotine exposure interactions in future generations. F0 nicotine exposure decreased anxiety and depression-like behaviors exclusively in F1 males but not females. It must be noted that previous work by Zhu and colleagues (2014) identified a hyperactive phenotype in male and female offspring of mice exposed to in utero nicotine (Zhu et al., 2014). Increased locomotor activity could have influenced the anxiety and depression measurements in this experiment. Therefore we assayed general locomotor activity in all F1 male and female offspring of placebo and nicotine exposed fathers and found no significant difference in general ambulation, rearing, or crossing during a 1-hour testing period (data not shown).

Interestingly, the lineage with the least number of phenotypes was F3 animals derived from F2 females and F1 females (Supplemental), as F0 nicotine exposure was not as robustly transmitted through repeated female derivations. While it is currently unknown what drives sex-specific inheritance of transgenerational phenotypes, we posit

118 that differential reprogramming events of the genome during early development may have promoted the retention of heritable marks in male offspring rather than female offspring. Alternatively, inheritance of exposures may be mediated through different routes and epigenetic modifications between the two sexes and therefore we see them manifest through different behaviors that were assayed (Smallwood and Kelsey, 2012;

Kelsey and Feil, 2013). In addition, males were removed from mating partners after confirmation of pregnancy. However, F1 mothers exposed to CUS and used to create F2 offspring were not separated from their offspring. Therefore, behavior of male and female

F2 offspring of F1 females may have been influenced by the home cage environment they experienced during early development (Francis et al., 1999). However, behavioral differences in F3 offspring suggests that germline exposure to F0 nicotine and F1 to stress is capable of reprogramming the adult brain in offspring. Furthermore, the interaction of multigenerational parental environments to influence offspring behavior suggests that the epigenome may mediate such effects (Richards, 2006).

In this study we exposed F0 males to nicotine and F1 males and females to adolescent stress and determined the transgenerational interaction of nicotine and stress.

Remarkably, we found that environmental exposures are subject to cross-generational inheritance and produce unique phenotypes in offspring. In addition we identified novel phenotypes in several generations of offspring derived from paternal nicotine exposure.

Future work to mechanistically identify and probe cellular changes that mediate the phenotypes characterized for functional significance will greatly add to our knowledge of transgenerational interactions and reprogramming of the offspring brain.

119

Figure 4. 1 Schematic of experimental design. Three cohorts of F0 male mice were exposed to placebo or nicotine and mated to produce F1 offspring. F1-Cohort 1 was tested in in the marble burying (MB) test and elevated zero maze (EZM) prior to the forced swim test (FST) or producing a second generation of mice. F1-Cohort 2 was tested in the MB test, EZM, and acoustic startle response (ASR) prior to FST testing or producing a second generation of mice. F1-Cohort 3 was tested in ASR prior to mating. F2-Cohort 1 was tested in the MB test, EZM, and FST. F2-Cohort 2 was tested in the MB test and EZM. F2-Cohort 3 was tested in the ASR prior to being tested for response to nicotine or used to create a third generation of mice. F3-Cohort 3 was tested in MB, ASR, and for response to nicotine. Animals were sacrificed following final behavioral testing.

120

Challenge 4 S NIC ** 1 Challenge 4 NS NIC 1 * Challenge 4 S NIC F3 Challenge 1 4

NS PLA 1 0 F0: F1: 800 600 400 200

1200 1000 * Challenge min) 15 over breaks (beam

4 NS Activity Locomotor NIC ** 1 F2 Challenge Challenge 4 S * 4 NIC ^

NS PLA * 1 1 0 F0: F1: 800 600 400 200

1200 1000 Challenge

(beam breaks over 15 min) 15 over breaks (beam 4

NS NIC Locomotor Activity Activity Locomotor 1 F3 Challenge 4

NS PLA * PLA/NIC NS/S C 1 0 F0: F1:

D 800 600 400 200

1200 1000 (beam breaks over 15 min) 15 over breaks (beam Locomotor Activity Activity Locomotor F0 F1 Challenge 4 S NIC ** *** 1 Challenge 4 NS NIC 1 Challenge 4 S NIC *** F3 Challenge 1 4

NS PLA 1 0 F0: F1: 800 600 400 200

1200 1000 Challenge (beam breaks over 15 min) 15 over breaks (beam

4 NS Activity Locomotor NIC ** 1 Challenge Challenge 4 S F2 ^ NIC 4

NS PLA ** 1 ** 1 0 F0: F1:

800 600 400 200

Challenge 1200 1000

(beam breaks over 15 min) 15 over breaks (beam 4

NS NIC Locomotor Activity Activity Locomotor 1 A F3 Challenge 4 *

NS PLA ** 1 0 F0: F1:

800 600 400 200

1200 1000 (beam breaks over 15 min) 15 over breaks (beam Locomotor Activity Activity Locomotor B

121

Figure 4. 2 F2 and F3 nicotine response is influenced by F0 nicotine and F1 male stress exposure

A) A main effect of lineage (two-way RM-ANOVA; F2,20 = 12.12; P < 0.001) and an interaction of lineage and time (F4,40 = 2.706; P < 0.05) influenced F2 male offspring response to nicotine. F2 male offspring of F0 placebo exposed mice through the male line (F0 PLA/F1 NS) increased locomotor activity in response to nicotine exposure on day 4 and challenge day compared to day 1 nicotine (Bonferroni; ## P < 0.01). F2 males derived from F0 nicotine (F0 NIC/F1 NS) and F0 nicotine + F1 male CUS (F0 NIC/F1 S) significantly decreased locomotor activity compared to control males (Bonferroni; ** P < 0.01, *** P < 0.001). Bars represent number of beam breaks over 15 minutes following i.p. nicotine administration ± SEM. (n = 7-8).

B, left) A main effect of time was found to influence F3 male offspring response to nicotine (two-way RM-ANOVA;

F2,38 = 10.88; P < 0.001). F3 males derived from F0 placebo , F1 males, and F2 males (F0 PLA/F1 NS) increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (Bonferroni; # P < 0.05, ## P < 0.01). F3 males derived from F0 nicotine + F1 male CUS through F2 males (F0 NIC/F1 S) showed a non-significant increase in locomotor activity on challenge day compared to nicotine day 1 (^ P = 0.08). (n = 7-8).

B, right) A main effect of time was found to influence F3 female offspring response to nicotine (two-way RM-

ANOVA; F2,34 = 15.42; P < 0.0001). F3 female offspring of F0 nicotine exposure + F1 male CUS through the F2 male line increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (## P < 0.01, ### P < 0.001) (n=6-8).

C) A main effect of time (two-way RM-ANOVA; F2,34 = 10.66; P < 0.001) and an interaction of lineage and time (F4,34 = 4.994; P < 0.01) influenced F2 female offspring response to nicotine. F2 female offspring of F0 nicotine exposure through the F1 male lineage (F0 NIC/F1 NS) increased locomotor activity on day 4 compared to nicotine day 1 but decreased locomotor acitivity on challenge day compared to nicotine day 4. (Bonferroni; # P < 0.05, ## P < 0.01). In addition, F2 female offspring of both F0 nicotine exposure and F1 male CUS (F0 NIC/F1 S) significantly decreased locomotor activity on challenge day compared to nicotine day 4 (# P< 0.05). F2 females derived from F0 placebo exposure through F1 male (F0 PLA/F1 NS) showed a non-significant trend towards an increase in locomotor activity on challenge day compared to nicotine day 1 (^ P = 0.08). (n=7-8).

D, left) A main effect of time was found to influence F3 male offspring response to nicotine (two-way RM-

ANOVA; F2,38 = 8.392; P < 0.001). F3 males derived from F0 placebo exposure through the F2 female lineage (F0 PLA/F1 NS) increased locomotor activity on nicotine day 4 compared to nicotine day 1 (Bonferroni; # P < 0.05). F3 males derived from F0 nicotine + F1 male CUS (F0 NIC/F1 S) through F2 females significantly increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (Bonferroni; # P < 0.05). (n = 7-8).

D, right) A main effect of time was found to influence F3 female offspring response to nicotine (two-way RM-

ANOVA; F2,30 = 3.684; P < 0.05). F3 female offspring of F0 nicotine exposure + F1 male CUS (F0 NIC/F1 S) through the F2 female lineage significantly increased locomotor activity on nicotine day 4 compared to nicotine day 1 (Bonferroni; ## P < 0.01). (n=4-8).

122

Table 4. 1 Summary of F2 offspring derived from F1 males anxiety, startle, and depression behavior

F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Male No Stress F1 Male Stress F1 Male No Stress F1 Male Stress F2 Male F2 Female Marble Burying Number of marbles 9.62 ± 0.98 7.48 ± 1.1 7.67 ± 0.94 8.56 ± 1.1 8.46 ± 0.83 7.0 ± 0.80 (MB) n = 12-28 buried ± SEM Elevated Zero Maze Time spent in open 93.71 ± 9.5 86.37 ± 9.3 100.5 ± 14.7 90.47 ± 9.9 100.2 ± 8.3 112.1 ± 9.0 (EZM) n = 12-25 arm (s) ± SEM Acoustic Startle Startle amplitude 72.25 ± 11.0 96.97 ± 19.4 78.25 ± 11.9 49.03 ± 20.8 55.63 ± 12.7 65.3 ± 35.0 Response (ASR) n = 7-8 (at 120 dB) ± SEM Forced Swim Test Time spent immobile 144.2 ± 18.8 151.2 ± 12.8 149.9 ± 21.3 105.2 ± 19.04 122.5 ± 12.8 153.2 ± 18.9 (FST) n = 12-25 (s) ± SEM

F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Female No Stress F1 Female Stress F1 Female No Stress F1 Female Stress F2 Male F2 Female TableMarble Burying (MB) 4. 2 Summary Number of marbles of F3 offspring derived from F2 male/F1 male lineage anxiety and startle 11.33 ± 1.2 7.54 ± 0.84 8.0 ± 1.1 8.5 ± 1.2 8.2 ± 0.97 6.32 ± 0.86 behaviorn = 5-19 buried ± SEM Elevated Zero Maze Time spent in open 105.7 ± 13.0 72.46 ± 12.8 83.33 ± 6.2 90.63 ± 12.3 104.4 ± 22.2 109.6 ± 12.4 (EZM) n = 5-19 arm (s) ± SEM Acoustic Startle Startle amplitude (at F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine 59.2 ± 8.2 61.95 ± 12.4 86.48 ± 33.0 47.75 ± 12.4 53.13 ± 11.3 59.12 ± 31.3 Response (ASR) n = 3-8 120 dB) ± SEM F1 Male No Stress F1 Male Stress F1 Male No Stress F1 Male Stress Forced Swim Test Time spent immobile 160.5 ± 24.3 206 ± 15.2 139.3 ± 23.6F2 Male 79.34 ± 32.8 118 ± 27.0 155.8 ± 23.4 (FST) n = 5-12 (s) ± SEM F3 Male F3 Female Marble Burying Number of marbles 9.63 ± 2.2 8.0 ± 1.5 6.4 ± 1.6 4.13 ± 1.0 5.13 ± 0.85 4.88 ± 1.0 (MB) n = 8-10 buried ± SEM Acoustic Startle Startle amplitude F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine 80.0 ± 9.8 52.43 ± 6.3 * 72.96 ± 8.2 49.64 ± 9.6 47.6 ± 7.2 50.68 ± 7.5 Response (ASR) n = 7-10 (at 120 dB) ± SEM F1 Male No Stress F1 Male Stress F1 Male No Stress F1 Male Stress F2 Male F3 Male F3 Female Marble Burying Number of marbles 9.63 ± 2.2 8.0 ± 1.5 6.4 ± 1.6 4.13 ± 1.0 5.13 ± 0.85 4.88 ± 1.0 (MB) n = 8-10 buried ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine Acoustic Startle Startle amplitude 80.0 ± 9.8F1 Male No Stress52.43 ± 6.3 * F1 Male Stress72.96 ± 8.2 49.64 ± 9.6F1 Male No Stress47.6 ± 7.2 F1 Male Stress50.68 ± 7.5 TableResponse (ASR) 4. 3 Summary n = 7-10 (at 120 dB) ± SEM of F3 offspring derived from F2 female/F1 male lineage anxiety and startle F2 Female behavior F3 Male F3 Female Marble Burying Number of marbles 6.85 ± 1.2 7.11 ± 1.3 6.17 ± 2.0 4.55 ± 1.2 4.67 ± 1.5 2.0 ± 0.71 (MB) n = 4-13 buried ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine Acoustic Startle Startle amplitude 64.74 ± 10.0F1 Male No Stress108.37 ± 14.4 * F1 Male Stress62.0 ± 8.9 66.9 ± 6.2F1 Male No Stress64.62 ± 8.5 F1 Male Stress80.6 ± 9.2 Response (ASR) n = 7-13 (at 120 dB) ± SEM F2 Female F3 Male F3 Female Marble Burying Number of marbles 6.85 ± 1.2 7.11 ± 1.3 6.17 ± 2.0 4.55 ± 1.2 4.67 ± 1.5 2.0 ± 0.71 (MB) n = 4-13 buried ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine Acoustic Startle Startle amplitude 64.74 ± 10.0F1 Female No Stress108.37 ± 14.4 * F1 Female Stress62.0 ± 8.9 66.9 ± 6.2F1 Female No Stress64.62 ± 8.5 F1 Female Stress80.6 ± 9.2 Response (ASR) n = 7-13 (at 120 dB) ± SEM F2 Male F3 Male F3 Female Marble Burying Number of marbles 4.64 ± 1.2 11.7 ± 1.5 * 5.33 ± 3.8 2.5 ± 0.53 8.63 ± 2.1 * 3.0 ± 1.2 (MB) n = 3-11 buried ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine Acoustic Startle Startle amplitude 72.98 ± 8.6F1 Female No Stress64.34 ± 10.7 F1 Female Stress79.73 ± 30.9 68.66 ± 9.45F1 Female No Stress51.91 ± 6.3 F1 Female Stress60.0 ± 15.4 Response (ASR) n = 3-11 (at 120 dB) ± SEM F2 Male F3 Male F3 Female Marble Burying Number of marbles 4.64 ± 1.2 11.7 ± 1.5 * 5.33 ± 3.8 2.5 ± 0.53 8.63 ± 2.1 * 3.0 ± 1.2 (MB) n = 3-11 buried ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine Acoustic Startle Startle amplitude 72.98 ± 8.6 64.34 ± 10.7 79.73 ± 30.9 68.66 ± 9.45 51.91 ± 6.3 60.0 ± 15.4 Response (ASR) n = 3-11 (at 120 dB) ± SEM F1 Female No Stress F1 Female Stress F1 Female No Stress F1 Female Stress F2 Female F3 Male F3 Female Marble Burying Number of marbles 7.78 ± 1.6 6.83 ± 1.6 8.33 ± 1.33 4.86 ± 1.8 5.63 ± 1.5 8.0 ± 1.8 (MB) n = 6-9 buried ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine Acoustic Startle Startle amplitude 81.27 ± 19.3F1 Female No Stress42.32 ± 7.3 * F1 Female Stress36.57 ± 7.9 ** 57.42 ± 4.5F1 Female No Stress63.89 ± 14.2 F1 Female Stress46.8 ± 8.2 Response (ASR) n = 5-12 (at 120 dB) ± SEM F2 Female F3 Male F3 Female Marble Burying Number of marbles 7.78 ± 1.6 6.83 ± 1.6 8.33 ± 1.33 4.86 ± 1.8 5.63 ± 1.5 8.0 ± 1.8 (MB) n = 6-9 buried ± SEM Acoustic Startle Startle amplitude 81.27 ± 19.3 42.32 ± 7.3 * 36.57 ± 7.9 ** 57.42 ± 4.5 63.89 ± 14.2 46.8 ± 8.2 Response (ASR) n = 5-12 (at 120 dB) ± SEM

123

A 15

5 # Marbles buried over 15 min

0 Father: PLA NIC PLA NIC

Male Female

B 150 *

100

50 Time spent open arm (s) arm open spent Time

0 Father: PLA NIC PLA NIC

Male Female

C 300

200 **

100 Time spent immobile (s) immobile spent Time

0 Father: PLA NIC PLA NIC Male Female figure s4. 1 Decreased anxiety- and depression-like behaviors in F1 male offspring of paternal nicotine exposure. A) Male and female offspring of males exposed to placebo or nicotine prior to mating showed no difference in number of marbles buried in the MB test. Bars represent number of marbles buried ± SEM (n = 5-15). B) Male offspring of nicotine exposed fathers spent more time in the open arm of the elevated zero maze compared to placebo-sired males (* P < 0.05, n=6-13). C) F1 male offspring of F0 nicotine exposure spend less time immobile in the forced swim test compared to placebo-sired controls (** P < 0.01, n = 5-13). Differences following student’s t-test.

124

PLA/NIC

150 150 Father Placebo Father Placebo Father Nicotine Father Nicotine

100 100

50 50 Startle Amplitude Startle Amplitude

0 0 75 dB 110 dB 115 dB 120 dB 75 dB 110 dB 115 dB 120 dB Tone Tone figure s4. 2 No change in ASR in male and female F1 offspring of nicotine exposed fathers. Male and female offspring of nicotine exposed fathers showed no change in startle response to an acoustic tone compared to placebo-sired same sex controls. As expected, a main effect of tone on startle response was found (F1 Male: F3,72 = 76.22, P < 0.0001; F1 Female: F3,36 = 26.64, P < 0.0001). Values are plotted as startle amplitude ± SEM (n = 6-16). Differences following two-way repeated measures analysis of variance.

125

Challenge 4 S NIC *** **** 1 Challenge 4 NS NIC **** *** 1 Challenge 4 S NIC Challenge F3 4 1

NS PLA 1 0 F0: F1: 800 600 400 200

1200 1000 Challenge (beam breaks over 15 min) 15 over breaks (beam

4 NS Activity Locomotor NIC 1 Challenge F2 Challenge 4 4 S * NS PLA NIC * 1 1 0 F0: F1: 800 600 400 200

1200 1000 (beam breaks over 15 min) 15 over breaks (beam Challenge

4 Locomotor Activity Activity Locomotor NS NIC 1 F3 Challenge 4

NS ** PLA 1 PLA/NIC NS/S C 0 F0: F1: 800 600 400 200

1200 1000

D min) 15 over breaks (beam Locomotor Activity Activity Locomotor F0 F1 Challenge 4 S NIC ** 1 Challenge 4 NS NIC *** * 1 Challenge 4 S NIC ** F3 Challenge 4

NS 1 PLA 1 0 F0: F1: 800 600 400 200

1200 1000

Challenge min) 15 over breaks (beam 4 Activity Locomotor NS NIC 1 Challenge Challenge 4 S F2 4 NIC *

NS PLA 1 ** 1 0 F0: F1:

800 600 400 200

Challenge 1200 1000

(beam breaks over 15 min) 15 over breaks (beam 4

* NS NIC Locomotor Activity Activity Locomotor 1 A F3 Challenge 4 *

NS PLA 1 0 F0: F1:

800 600 400 200

1200 1000

(beam breaks over 15 min) 15 over breaks (beam Locomotor Activity Activity Locomotor B

126 figure s4. 3 F2 and F3 nicotine response is influenced by F0 nicotine and F1 female stress exposure

A) A main effect of time was found to influence F2 male offspring response to nicotine (two-way RM-

ANOVA; F2,36 = 9.016; P < 0.001). F2 males derived from F0 placebo exposure through the F1 female lineage (F0 PLA/F1 NS) increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (Bonferroni; # P < 0.05, ## P < 0.01). F2 males derived from F0 nicotine + F1 female CUS (F0 NIC/F1 S) significantly increased locomotor activity on challenge day compared to nicotine day 1 (Bonferroni; ## P < 0.01). Bars represent number of beam breaks over 15 minutes following i.p. nicotine administration ± SEM. (n = 6-8).

B, left) A main effect of time was found to influence F3 male offspring response to nicotine (two-way RM-

ANOVA; F2,34 = 9.901; P < 0.001). F3 males derived from F0 placebo males and F1 females through the F2 male lineage (F0 PLA/F1 NS) increased locomotor activity on challenge day compared to nicotine day 1 (Bonferroni; # P < 0.05). F3 males derived from F0 nicotine through F1 female and F2 males (F0 NIC/F1 NS) increased locomotor activity on challenge day compared to nicotine day 1 (# P < 0.05). (n = 5-8).

B, right) A main effect of time was found to influence F3 female offspring response to nicotine (two-way

RM-ANOVA; F2,34 = 18.89; P < 0.001). F3 female offspring of F0 nicotine exposure through the F1 female and F2 male line increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (Bonferroni; # P < 0.05, ### P < 0.001). In addition, F3 female offspring of F0 nicotine exposure + F1 female CUS through the F2 male line increased locomotor response to nicotine on challenge day compared to nicotine day 1 (## P < 0.01). (n=5-8).

C) No change in locomotor activity over time was found in F2 female offspring of F0 placebo or nicotine administration derived from females with or without preconception CUS exposure. (n=3-8).

D, left) A main effect of time was found to influence F3 male offspring response to nicotine (two-way RM-

ANOVA; F4,32 = 11.78; P < 0.001). F3 males derived from F0 placebo exposure through F1 females and the F2 female lineage (F0 PLA/F1 NS) increased locomotor activity on challenge day compared to nicotine day 1 (Bonferroni; # P < 0.05). F3 males derived from F0 nicotine + F1 female CUS (F0 NIC/F1 S) through F2 females significantly increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (# P < 0.05, ## P < 0.01). (n = 6-8).

D, right) A main effect of time (two-way RM-ANOVA; F2,34 = 31.93; P < 0.0001) and an interaction of time and lineage (two-way RM-ANOVA; F4,34 = 4.489; P < 0.01) influenced F3 female offspring response to nicotine. F3 female offspring of F0 nicotine exposure or F0 nicotine + F1 female CUS (F0 NIC/F1 S) through the F2 female lineage significantly increased locomotor activity on nicotine day 4 and challenge day compared to nicotine day 1 (Bonferroni; ### P < 0.001, #### P < 0.0001). (n=6-8).

127

F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Male No Stress F1 Male Stress F1 Male No Stress F1 Male Stress F2 Male F2 Female Marble Burying Number of marbles 9.62 ± 0.98 7.48 ± 1.1 7.67 ± 0.94 8.56 ± 1.1 8.46 ± 0.83 7.0 ± 0.80 (MB) n = 12-28 buried ± SEM Elevated Zero Maze Time spent in open 93.71 ± 9.5 86.37 ± 9.3 100.5 ± 14.7 90.47 ± 9.9 100.2 ± 8.3 112.1 ± 9.0 (EZM) n = 12-25 arm (s) ± SEM Acoustic Startle Startle amplitude 72.25 ± 11.0 96.97 ± 19.4 78.25 ± 11.9 49.03 ± 20.8 55.63 ± 12.7 65.3 ± 35.0 Response (ASR) n = 7-8 (at 120 dB) ± SEM tableForced Swim Test s4. 1 SummaryTime spent immobile of F2 offspring derived from F1 female lineage anxiety, startle, and depression 144.2 ± 18.8 151.2 ± 12.8 149.9 ± 21.3 105.2 ± 19.04 122.5 ± 12.8 153.2 ± 18.9 behavior(FST) n = 12-25 (s) ± SEM

F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Female No Stress F1 Female Stress F1 Female No Stress F1 Female Stress F0 Placebo F0 NicotineF2 Male F0 Nicotine F0 Placebo F0 NicotineF2 Female F0 Nicotine Marble Burying (MB) Number of marbles 11.33 ± 1.2F1 Male No Stress7.54 ± 0.84 F1 Male Stress8.0 ± 1.1 8.5 ± 1.2F1 Male No Stress8.2 ± 0.97 F1 Male Stress6.32 ± 0.86 n = 5-19 buried ± SEM F2 Male Elevated Zero Maze Time spent in open 105.7 ± 13.0 72.46 ± 12.8F3 Male 83.33 ± 6.2 90.63 ± 12.3 104.4 ± 22.2F3 Female 109.6 ± 12.4 Marble Burying (EZM) n = 5-19 Number of marbles arm (s) ± SEM Acoustic Startle Startle amplitude (at 9.63 ± 2.2 8.0 ± 1.5 6.4 ± 1.6 4.13 ± 1.0 5.13 ± 0.85 4.88 ± 1.0 (MB) n = 8-10 buried ± SEM 59.2 ± 8.2 61.95 ± 12.4 86.48 ± 33.0 47.75 ± 12.4 53.13 ± 11.3 59.12 ± 31.3 Response (ASR)Acoustic Startle n = 3-8 Startle amplitude 120 dB) ± SEM Forced Swim Test Time spent immobile 80.0 ± 9.8 52.43 ± 6.3 * 72.96 ± 8.2 49.64 ± 9.6 47.6 ± 7.2 50.68 ± 7.5 Response (ASR) n = 7-10 (at 120 dB) ± SEM 160.5 ± 24.3 206 ± 15.2 139.3 ± 23.6 79.34 ± 32.8 118 ± 27.0 155.8 ± 23.4 (FST) n = 5-12 (s) ± SEM F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Male No Stress F1 Male Stress F1 Male No Stress F1 Male Stress F0 Placebo F0 Nicotine F0 NicotineF2 MaleF0 Placebo F0 Nicotine F0 Nicotine F1 Male No StressF3 Male F1 Male Stress F1 Male No StressF3 Female F1 Male Stress Marble Burying Number of marbles F2 Female 9.63 ± 2.2 8.0 ± 1.5 6.4 ± 1.6 4.13 ± 1.0 5.13 ± 0.85 4.88 ± 1.0 (MB) n = 8-10 buried ± SEM F3 Male F3 Female Acoustic Startle Marble Burying Number of marbles Startle amplitude 6.85 ± 1.280.0 ± 9.8 52.43 ± 6.37.11 ± 1.3 * 72.96 ± 8.26.17 ± 2.0 49.64 ± 9.64.55 ± 1.2 4.67 ± 1.547.6 ± 7.2 50.68 ± 7.52.0 ± 0.71 Response (ASR)(MB) n = 4-13 n = 7-10 (at 120 dB) ± SEMburied ± SEM Acoustic Startle Startle amplitude 64.74 ± 10.0 108.37 ± 14.4 * 62.0 ± 8.9 66.9 ± 6.2 64.62 ± 8.5 80.6 ± 9.2 tableResponse (ASR) s4. 2 Summary n = 7-13 (at 120 dB) ± SEM of F3 offspring derived from F2 male/F1 female lineage anxiety and startle behavior F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Male No Stress F1 Male Stress F1 Male No Stress F1 Male Stress F0 Placebo F0 Nicotine F0 NicotineF2 FemaleF0 Placebo F0 Nicotine F0 Nicotine F1 Female No StressF3 Male F1 Female Stress F1 Female No StressF3 Female F1 Female Stress Marble Burying Number of marbles F2 Male 6.85 ± 1.2 7.11 ± 1.3 6.17 ± 2.0 4.55 ± 1.2 4.67 ± 1.5 2.0 ± 0.71 (MB) n = 4-13 buried ± SEM F3 Male F3 Female Acoustic Startle Marble Burying Number of marbles Startle amplitude 64.74 ± 10.04.64 ± 1.2 108.37 ± 14.4 11.7 ± 1.5 * * 5.33 ± 3.862.0 ± 8.9 2.5 ± 0.53 66.9 ± 6.2 8.63 ± 2.164.62 ± 8.5 * 80.6 ± 9.23.0 ± 1.2 Response (ASR)(MB) n = 3-11 n = 7-13 (at 120 dB) ± SEMburied ± SEM Acoustic Startle Startle amplitude 72.98 ± 8.6 64.34 ± 10.7 79.73 ± 30.9 68.66 ± 9.45 51.91 ± 6.3 60.0 ± 15.4 Response (ASR) n = 3-11 (at 120 dB) ± SEM

F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Female No Stress F1 Female Stress F1 Female No Stress F1 Female Stress F0 Placebo F0 Nicotine F0 NicotineF2 MaleF0 Placebo F0 Nicotine F0 Nicotine F1 Female No StressF3 Male F1 Female Stress F1 Female No StressF3 Female F1 Female Stress Marble Burying Number of marbles F2 Female 4.64 ± 1.2 11.7 ± 1.5 * 5.33 ± 3.8 2.5 ± 0.53 8.63 ± 2.1 * 3.0 ± 1.2 (MB) n = 3-11 buried ± SEM F3 Male F3 Female Acoustic Startle Marble Burying Number of marbles Startle amplitude table s4. 3 Summary of F3 offspring72.98 ± 8.67.78 ± 1.6 derived from64.34 ± 10.76.83 ± 1.6 F2 female/F179.73 ± 30.98.33 ± 1.33 female68.66 ± 9.454.86 ± 1.8 lineage anxiety51.91 ± 6.35.63 ± 1.5 and startle60.0 ± 15.48.0 ± 1.8 Response (ASR)(MB) n = 6-9 n = 3-11 (at 120 dB) ± SEMburied ± SEM behaviorAcoustic Startle Startle amplitude 81.27 ± 19.3 42.32 ± 7.3 * 36.57 ± 7.9 ** 57.42 ± 4.5 63.89 ± 14.2 46.8 ± 8.2 Response (ASR) n = 5-12 (at 120 dB) ± SEM

F0 Placebo F0 Nicotine F0 Nicotine F0 Placebo F0 Nicotine F0 Nicotine F1 Female No Stress F1 Female Stress F1 Female No Stress F1 Female Stress F2 Female F3 Male F3 Female Marble Burying Number of marbles 7.78 ± 1.6 6.83 ± 1.6 8.33 ± 1.33 4.86 ± 1.8 5.63 ± 1.5 8.0 ± 1.8 (MB) n = 6-9 buried ± SEM Acoustic Startle Startle amplitude 81.27 ± 19.3 42.32 ± 7.3 * 36.57 ± 7.9 ** 57.42 ± 4.5 63.89 ± 14.2 46.8 ± 8.2 Response (ASR) n = 5-12 (at 120 dB) ± SEM

128

CHAPTER 5

GENERAL DISCUSSION

It is not the strongest of species that survives, nor the most intelligent, but the one most

responsive to change. - Attributed to Charles Darwin (1809-1882)

Transgenerational inheritance allows for the environmental experience of one generation to be transmitted to subsequent generations. Evidence of offspring inheritance of parental exposure in humans is documented for drugs of abuse (Cnattingius, 2004), intense and prolonged stressors (Yehuda et al., 2014), changes in diet (Heijmans et al.,

2008; Fumagalli et al., 2015), and environmental toxins (Hopenhayn et al., 2003; Guan et al., 2012). While nature (genetic transmission) and nurture (environment) contribute to human and animal phenotypes (both physical and behavioral assets as well as disease progression) (Lake and Pridmore, 2014), discovery of the epigenome and epigenetic transmission from one generation to the next is an exciting third factor that serves as the intersection between genes and the environment (Richards, 2006). In addition, while nature and nurture have been implicated in familial inheritance of psychiatric disorders and drug abuse (Nielsen et al., 2012; Lake and Pridmore, 2014), they do not account completely for familial occurrence of disease states. Many neuropsychiatric disorders, including depression (Dempster et al., 2011), stress responsivity and anxiety (Hunter and

McEwen, 2013), post traumatic stress disorder (Rampp et al., 2014), personality disorder

(Perroud et al., 2013) and drug addiction (Nielsen et al., 2008; Starkman et al., 2012) are

129 associated with epigenetic modifications. These epigenetic components can be modified in the germline by parental exposure to the environment and subsequently inherited by offspring. Germline mediated reprogramming of gene expression in the adult brain produces functional changes in offspring physiology and behavior (Rodgers et al., 2015).

The use of rodent models has allowed for striking advancement in our understanding of transgenerational inheritance. Rodent models are biological replicates with strictly controlled external environments that allow for control of many confounding variables present in clinical populations (Heard and Martienssen, 2014). Therefore, the influence of the epigenome on phenotype can be isolated and studied without interference of genetic inheritance or the environment (Marsit, 2015). Laboratory manipulations and identification of animal phenotypes can be correlated with molecular characterization of the brain tissue directly involved in behavior, a process that is only possible in human subjects post-mortem. Much of the clinical research on epigenetic mechanisms of inheritance in humans uses cellular populations (i.e. peripheral blood cells) that are readily available through minimally invasive procedures. However, cellular heterogeneity discountsthe functional relevance of such measures (Verma et al., 2014; Marsit, 2015), and the epigenetic marks found in blood cells may not reflect epigenetic modifications in the brain. Instead, epimutations, or modifications to the DNA causing aberrant chromatin states, may be reflected in an organ and tissue specific manner. Further, this is also complicated by the dynamic nature of epigenetic marks (Baker-Andresen et al., 2013).

Indeed, developmental biologist Conrad Waddington (1905-1975) first described the

130 function of epigenetics as directing cellular differentiation and tissue patterning in embryogenesis (Speybroeck, 2006).

The purpose of this dissertation was to study the transgenerational inheritance of stress and nicotine exposure, both as single exposures and as an exposure interaction using a rodent model. Chronic unpredictable stressors and nicotine, delivered with osmotic mini pumps, were administered to mice during critical windows of gamete development. A variety of animal behavior assays were used to phenotype response to nicotine as well as startle and anxiety- and depression-like behaviors in future generations of mice. In addition, we determined lineage dependent changes to the transcriptome using

RNA sequencing. Here, I first review novel findings produced from this body of work and their context within the current state of science. Then, I discuss the implications of transgenerational inheritance, beginning with an exploration into the mechanisms that mediate the phenomenon, and then commenting on the adaptive advantage of across- generation inheritance in the context of Darwin’s Theory of Evolution and natural selection.

Implications of current work

A particularly salient environmental exposure in both human and animal populations is the experience of stress. Chronic stress promotes maladaptive responses and disease states in the individual exposed to stress (McEwen and Stellar, 1993) as well as altered physiology and behavior in several generations of offspring in both humans and animals

(Yehuda et al., 1998, 2014; Franklin et al., 2010; Saavedra-Rodríguez and Feig, 2013). In

131 previous rodent research, stressors took place for extended periods of time and spanned developmental windows, i.e. 7 weeks of reorganized social hierarchy and chronic variable stress (Rodgers et al., 2013; Saavedra-Rodríguez and Feig, 2013), beginning at the onset of puberty. A recent study in rodents showed that inheritance of a fearful experience through the paternal line occurred after a very brief exposure, only 3 days, during adulthood (Dias and Ressler, 2014). However, to date, few studies have examined the impact of the same stressor in adolescents and adults, nor have they followed inheritance across multiple generations.

We used a chronic unpredictable stress (CUS) during an early developmental time window and explored its effect on the behavior of future generations of offspring. By including both males and females, we considered sex as a relevant biological variable that could affect stress exposure inheritance (Clayton, 2016). Epidemiological evidence suggests that puberty is a vulnerable window for germline modification by the environment (Kaati et al., 2007; Pembrey, 2010). Therefore, we exposed mice in adolescence, a period of time when animals are also vulnerable to the effects of environmental exposure (Biro and Deardorff, 2013). Moreover, adolescent CUS exposure has not been fully characterized for its long-term effects in the exposed population of mice. Therefore, we first sought to characterize the long-term effects of CUS on male and female mice that experienced the stressor during adolescence.

The work in Chapter 2 identified the long-term effects of adolescent CUS exposure as compared to adult CUS exposure. We found that adolescence is a critical window for the effects of CUS on adult anxiety behavior as well as sex-dependent startle

132 reactivity because the same stress exposure in adults did not alter these behaviors. Of interest, we found CUS induced a depression-like phenotype regardless of when the stress was given (i.e. during adolescence or adulthood). Depression-like phenotypes are commonly associated with early in life stress (Schmidt et al., 2010; Hill et al., 2012), but the stress paradigm reported here dissociates adult anxiety from depression when experienced during adolescence.

The extra-hypothalamic stress pathway mediates anxiety (Jankord and Herman,

2008). We found dysregulation of corticotropin releasing factor receptor 2 (CrfR2) in the amygdala of males exposed to adolescent CUS. This work suggests that long-term effects of adolescent stress on anxiety may be mediated through this receptor. This novel finding suggests a potential therapeutic target for adult anxiety due to early life stress. However, future work is necessary to characterize the efficacy of CRFR2 antagonists in alleviating the enhanced anxiety and altered startle reactivity in adult animals exposed to adolescent

CUS.

In Chapter 3, male and female mice were exposed to adolescent CUS and mated to produce F1 offspring. Previous studies focused on the inheritance of parental stress exposure and its influence on physiology and behavior, including anxiety, depression, anhedonia, and reactivity of the hypothalamic-pituitary-adrenal axis (Weaver et al., 2004;

Franklin et al., 2010; Leshem and Schulkin, 2012; Rodgers et al., 2013; Saavedra-

Rodríguez and Feig, 2013; Gapp et al., 2014a). Indeed, others have characterized increased anxiety and depression-like behaviors in mice derived from paternal or maternal chronic social instability (Saavedra-Rodríguez and Feig, 2013) or maternal

133 separation and unpredictable stress exposure (Franklin et al., 2010; Gapp et al., 2014a).

However, we found that adolescent CUS in the F0 generation did not produce a significant change in anxiety, depression, or startle behaviors in F1 offspring. Similarly,

Rodgers and colleagues (2013) found no change in anxiety, startle, or coping behaviors in

F1 male and female offspring after 7 week chronic variable stress (Rodgers et al., 2013).

Therefore, offspring phenotypes are likely a function of the type of stress exposure experienced by parents. Indeed, stress experiences are not alike and instead produce differential responses in animals based on several factors that include gender, hormonal state, stressor controllability, genetic polymorphisms, previous life experiences, and behavior assayed (Joëls and Baram, 2009). While it is impossible to know which stress exposure most readily mimics human experience, additional information on the variety of outcomes of parental stress exposure on offspring behavior adds substantially to the current understanding of stress induced familial inheritance and disease states.

Epidemiological data suggests that parental exposures can alter a variety of phenotypes in offspring. For example, rodent exposure to bisphenol-A, a plastic-derived endocrine disruptor, produces obesity in offspring (Manikkam et al., 2013). In Chapter 3, we provided novel evidence that adolescent stress exposure in parents affects offspring response to nicotine. To our knowledge, similar studies have not been conducted. While some work has characterized intragenerational interactions of stress and nicotine exposure (McCormick et al., 2004), this is the first to examine across-generation interactions. In addition, we extended our studies to determine transgenerational changes

(i.e. grand-offspring) in response to nicotine derived from F0 stress exposure. We found

134 both increases and decreases in nicotine locomotor sensitization in F2 offspring of F0 stress exposure, depending on sex and lineage. These findings have important clinical implications. Stress mediates response to nicotine in future generations of offspring in mice. Thus, in humans, nicotine use may also be influenced by stressful experiences within a person's lineage.

Nicotine use has been causally related to the inheritance of genetic information from parents, in the form of either functional gene mutations or single nucleotide polymorphisms (Lerman and Berrettini, 2003). In addition, we argue that transgenerational inheritance and its effect on nicotine use in offspring is a mechanism involving the epigenetic landscape created by parental stress exposure and transmitted to future generations. In essence, stress writes the story upon the genome that is read to future generations of offspring (a nod to the complex protein writers and readers that play an integral role in this process). In addition, we hypothesize that these findings can be extended to other drugs of abuse. Because nicotine’s primary reward action is through enhanced dopaminergic signaling in the nucleus accumbens to mediate long-lasting increase in reward sensitivity (Kenny and Markou, 2005), response to drugs of abuse that work through the same mechanism may also be altered by parental stress inheritance.

Future work should extend to other drugs of abuse and even highly palatable foods, both of which are capable of hijacking the natural reward network to promote reward seeking and addictive behaviors. This would further suggest that stress is capable of remodeling reward signaling directly but also across generations.

135

The interaction of parental stress and offspring response to nicotine led to an intriguing question: Do nicotine and stress exposures interact across generations to influence behavior in offspring never exposed to either challenge? Ample evidence supports the inheritance of stress (Bowers and Yehuda, 2016; Klengel et al., 2016) as well as the influence of stress on drug experience and addiction (Koob and Le Moal,

2001; Briand and Blendy, 2010). However, the impact of nicotine exposure across generations has not been as well explored. In order to determine the cross-generation interaction of nicotine and stress, we first had to characterize the effects of nicotine alone on offspring behavior.

Therefore in Chapter 4, we exposed male F0 mice to nicotine and examined its effect on affective behaviors and response to nicotine in F1, F2, and F3 animals. Nicotine was administered to males via osmotic mini pump for 4 weeks prior to mating. This is the first record of paternal adolescent exposure, as previous work has exclusively used in utero nicotine exposures (Zhu et al., 2014). We characterized generation, sex, and lineage-dependent changes in anxiety and depression-like behavior, startle reactivity, and locomotor sensitivity to repeated nicotine administration. Our work identified a novel phenotype that was not previously explored in studies of the inheritance of nicotine use and exposure. In addition, we found transgenerational phenotypes in the F3 generation of animals, the furthest removed generation to be examined to date in a rodent model for familial nicotine inheritance.

Once the effect of F0 nicotine exposure on several generations of offspring behavior was identified, we added an additional environmental exposure to the F1

136 generation to determine if there were multigenerational and transgenerational interactions of F0 nicotine and F1 stress exposure. This is the first example of a novel two-generation exposure paradigm in which F0 males were administered nicotine and F1 males and females were exposed to stress and we found unique phenotypes in F2 and F3 offspring.

Interestingly, the most common interactions were that 1) F0 nicotine exposure occluded the behavioral effects of F1 stress exposure and 2) F1 stress opposed the effects of F0 nicotine exposure. Occlusion was expected as concurrent nicotine administration alongside chronic unpredictable mild stress exposure in mice alleviates stress-induced depression- and anxiety-like behaviors (Biala et al., 2016). In addition, increased sensitivity to nicotine in F2 and F3 mice derived from F1 stress mirrors the effects of stress alone on offspring response to nicotine. Specifically, in Chapter 3 we demonstrated stress-mediated increases in sensitivity to nicotine.

A closer examination of the complex family trees derived from Chapters 3 and 4 provides phenotypic evidence for the importance of the male germline in transgenerational inheritance. Specifically, exposures derived through males were more stably transmitted. F2 males showed blunted startle responses and anxiety, but only if they were derived from F1 males whose fathers were exposed to adolescent CUS.

Anxiety and startle phenotypes were not altered in the lineages that depended upon female transmission of the exposure. In addition, F2 response to nicotine following F0 stress exposure was more significantly altered compared to controls in the lineages derived from male mice only. In addition, we found similar patterns in the experiments discussed in Chapter 4. Transmission of nicotine and stress interactions produced

137 offspring phenotypes exclusively in the lineages derived from paternal transmission of the exposure. Anxiety and depression was affected only in F1 males derived from paternal nicotine exposure.

Previous research has highlighted transmission through the sperm as mediating changes in offspring physiology and behavior following direct paternal exposure to an environmental stimulus (Carone et al., 2010; Dietz et al., 2011; Vassoler et al., 2013b).

From the onset of puberty, sperm are constantly produced over a male’s lifetime. By contrast, mature oocytes are predominantly developed by birth. Further, if primordial germ cells are constantly dividing into spermatocytes to divide into spermatids that develop into mature spermatozoa, then populations of mature sperm are temporally separated by the environment in which they develop. If the heritable epigenome is sensitive to the effects of a changing environment, then perhaps the inherent turn over of the male mature germline best mediates environmental-induced changes for offspring inheritance. The differential-allocation hypothesis suggests that maternal investment quality will differ based upon both male-female interaction and female perception of phenotypic quality in the male mating partner (Burley, 1988). Therefore, female mate selection may also be a product of selection for sperm environment, and the differential- allocation hypothesis can be extended to the selection of sperm based on epigenome inheritance. Although we provide evidence of maternal derived transmission of stress and nicotine inheritance, oocyte modification via epimutations following environmental exposures is not as well-studied (Pacchierotti and Spanò, 2015).

138

In Chapter 3, we used RNA sequencing (RNA-Seq) to mechanistically ascertain the state of the transcriptome in the amygdala of F1 male offspring of paternal stress compared to male F1 offspring derived from placebo-exposed fathers. RNA-Seq allows for unbiased survey of the entire transcriptome in a high-throughput and quantitative manner (Wang et al., 2009). In addition, it is a highly accurate technique for quantifying expression levels validated using quantitative real-time polymerase chain reaction

(Nagalakshmi et al., 2008). We reported differential expression of 240 genes in the male offspring derived from paternal stress, with the greatest functional enrichment found in genes classified as extracellular matrix and plasma membrane clusters (GO functional clustering via Davidv6.7). Differentially expressed genes included genes involved in cellular structure, such as collagen genes that have also been implicated in other studies of paternal stress inheritance (Rodgers et al., 2015). In addition, we identified novel genes that have not been previously implicated, adding substantially to targets for future research in the field. Our results provide evidence that the differential transcriptomes and resultant gene expression produced distinct molecular phenotypes in the male offspring of paternal stress exposure. Although not explored here, the modified cellular phenotype in the brain is likely mediated through epigenetic mechanisms maintained from the germline of stress-exposed parents (Marsit, 2015).

139

From parental germline to offspring brain: epigenetic reprogramming of the adult offspring brain

The body of evidence on transgenerational inheritance and the addition of our work in Chapters 2 and 3 supports the hypothesis that the adult brain of offspring is reprogrammed in the event of parental stress or nicotine exposure through the epigenome.

Therefore, the epigenome serves as an important biological mediator capable of integrating the parental environment into the genome of future generations. In the following section, I discuss evidence suggesting that the epigenome mediates transgenerational inheritance of nicotine and stress exposure. For the epigenome to truly act as a biological component, the following conditions must be met: 1) It must be responsive to the environment, 2) It must persist across time and cell division, and 3) It is capable of modulating phenotype. An examination of the current work on epigenetics as well as transgenerational inheritance suggests that the epigenome meets these requirements.

First, the epigenome is sensitive to and capable of responding to an animal’s changing surroundings. The epigenome is sensitive to exposure to drugs of abuse (Yohn et al., 2015), toxins (Baccarelli and Bollati, 2009), and high-fat diets (Milagro et al.,

2009). In addition, nicotine and stress exposure are capable of changing epigenetic patterning. Changes in DNA methylation (Blaze and Roth, 2015), histone modifications

(Hunter et al., 2009; Hinwood et al., 2011; McEwen et al., 2015), and microRNA

(miRNA) signaling (Volk et al., 2014) have been found in the brains of animals exposed to chronic stress. Nicotine-induced changes in the epigenome of somatic cells have been

140 identified in humans and animals, including changes in DNA methylation (Hillemacher et al., 2008; Philibert et al., 2008; Satta et al., 2008), post-translational histone modifications (Levine et al., 2011; Chase and Sharma, 2013), and miRNA content

(Huang and Li, 2009; Ng et al., 2013; Takahashi et al., 2013). In mice, methylation patterning is altered in sperm following chronic stress or nicotine administration

(Franklin et al., 2010; Dai et al., 2016). In addition miRNAs are altered in sperm following exposure to environmental challenges. Six week chronic variable stress significantly altered the miRNA milieu of sperm in mice (Rodgers et al., 2013) and sperm collected from smokers showed differential expression of miRNAs compared to nonsmokers, with significant enrichment for miRNAs capable of mediating additional epigenetic modifications to the genome (Marczylo et al., 2012). Female mice exposed to chronic restraint stress show significantly remodeled oocyte chromatin through altered methylation and changes in histone modifications (Wu et al., 2015). Although not as well explored, nicotine can alter chromatin stability and segregation during meiosis in oocytes

(Mailhes et al., 2000). Taken together, these studies indicate that germline epigenome modification following stress or nicotine exposure is not only a possibility but is evident across multiple systems. Furthermore, this suggests a homologous system by which transgenerational inheritance may occur in both humans and model organisms.

Second, epigenetic modifications following parental exposure to stress or nicotine are stable across time and cell division. The epigenome has been characterized as highly plastic and reactive to the environment, as discussed above, but also heritable to daughter cells and across generations. Remarkably, similar methylation patterning found in mature

141 sperm from males exposed to maternal separation and unpredictable stress was found in the cortex of F2 female offspring (Franklin et al., 2010; Dai et al., 2016). Therefore, epigenetic marks transcend cell types after several rounds of division during early embryogenesis. In addition, similar methylation patterns have been found in the lymphocytes of smokers and their offspring (Hillemacher et al., 2008). However, transcendent epigenetic marks that span cell types are a phenomenon that is not well- understood. DNA methylation in the germline undergoes two reprogramming events in the developing embryo, both of which are composed of complete erasure of the methylome followed by re-established methylation patterning (Smallwood and Kelsey,

2012). If methylation marks are retained, however, from fertilization to the pluripotent zygote and through reprogramming and cellular division, then universal propagation could create a common molecular signature that serves as a biomarker (Jenkins and

Carrell, 2012; Rodgers and Bale, 2015). Although targeted changes to the epigenome have been found in offspring, they may represent a global collection of histone modifications across cell types, which mediate intricate changes in physiology and behavior in a cellular and tissue-specific manner. It is more likely that inheritance of a broad change in cellular epigenotype promotes cellular cascades that lead to differential gene expression and, ultimately, phenotypes in offspring (Radford et al., 2014). Of interest, the transfer of miRNAs isolated from the sperm of stress-exposed fathers (Gapp et al., 2014a) or a synthetic collection of miRNAs mimicking those altered in the germline of stress-exposed males (Rodgers et al., 2015) can be used to fertilize oocytes

142 and recapitulate the behavioral and physiological phenotypes found in offspring derived directly from stress exposed fathers.

Cumulative epi-modifications are derived from the germline to promote sustained changes in chromatin structure. Therefore, germline-derived reprogramming of the adult brain produces changes in DNA expression. In Chapter 3, we used transcriptome analysis to identify changes in gene expression in the brains of F1 offspring of paternal stress exposure. Modifications to the epigenome are capable of directing gene expression through chromatin remodeling, recruitment of enhancer or repressor complexes to the

DNA, and even serving as physical barriers for the initiation of transcription

(Sadakierska-Chudy and Filip, 2015; Sadakierska-Chudy et al., 2015). Remarkably, first, second, and even third generation offspring show parental experience-derived changes in gene expression. For example, increased expression of calcium signaling genes was found in the hippocampus in three generations of offspring derived from chronic social instability exposure (Saavedra-Rodríguez and Feig, 2013). In addition, decreased mRNA expression of methyl CpG-binding protein (MeCp2), cannabinoid receptor type 1 (Cb1), and CrfR2 was found in the cortex of female offspring of males exposed to maternal separation and unpredictable stress (Franklin et al., 2010). Following paternal exposure to chronic variable stress for 6 weeks, F1 offspring had differential transcriptional regulation of genes that interact with the glucocorticoid receptor (GR), cAMP response element binding protein (CREB), and a collection of miRNAs in the paraventricular nucleus of the hypothalamus and the bed of the nucleus stria terminals (Rodgers et al.,

143

2013). In addition, paternal nicotine exposure decreased cortical dopamine signaling in three generations of offspring (Zhu et al., 2014).

Third, epigenetic modifications are capable of mediating phenotype, specifically, changes in behavior and disease state. Altered epigenotype and gene transcription found in the brains of offspring derived from stress- or nicotine-exposed parents is made meaningful by the existence of an altered phenotype or disease state. The role of histone modifications in mediating behavior has been explored in clinical and preclinical models.

For example, similar to single nucleotide polymorphisms and gene variants, variable

DNA methylation or histone acetylation and methylation have been implicated in the occurrence of psychiatric disorders in humans. In addition, rodent models in which intermediary molecules that mediate epigenetic cellular cascades have been deleted also yielded evidence of the functional importance of these marks (Bredy et al., 2010).

Therefore, the epigenome has been implicated in mediating response to drugs (Biliński et al., 2012; Nielsen et al., 2012), neuropsychiatric disorders that include anxiety (Jakobsson et al., 2008) and depression (Petronis, 2003), and response to stress (Maurice et al.,

2008). In addition, response to nicotine and stress are directly modulated by epigenetic mechanisms. For example, methylation of monoamine oxidase (Mao) has been associated with nicotine dependence in women (Philibert et al., 2008). Increased methylation of the serotonin transporter gene (Slc6a4) drives increased amygdala reactivity to a fearful stimulus and is correlated with the incidence of dysregulated stress response (Nikolova et al., 2014). The ability for researchers to conduct epigenome wide association studies

(EWAS) will add substantially to our understanding of how variation in the epigenome is

144 causally linked to phenotypes in humans (Marsit, 2015). In addition, epigenetic modifications found in rodent models can be mechanistically linked to phenotype via the availability of gene editing tools (Gupta and Musunuru, 2014).

Epigenetic transmission and the adaptive advantage of single generation inheritance

Given that changes in phenotype can be transmitted from parents to future generations of offspring through transgenerational epigenetic inheritance, it must also be considered why this mechanism exists. First, epigenetic inheritance has an advantage over classical inheritance because of the speed at which it mediates change. Fast-forward or rapid evolution can occur that is capable of producing adaptation to the environment that offspring will encounter (Jablonka and Raz, 2009). The gestation period for humans and rodents is a small portion of each animal’s lifetime. Therefore the preconception environment and birth environment are likely to be strikingly similar, and inheritance of epigenetic marks derived from the environment facilitates cellular knowledge of survival pressures.

When the environment of offspring is not aligned with epigenetic adaptation, it may lead to inheritance of a maladaptive phenotype (Bohacek and Mansuy, 2012). For instance, in the case of increased physiological response to stress in offspring of stress- exposed parents (Rodgers et al., 2013), if the anticipated environment is no longer present, i.e. everlasting threat, then the over-active stress response is dysregulated and out-of-context for the animal’s daily experience. Because complex cellular cascades are mediated by drugs of abuse, disease states may be particularly susceptible to parental

145 exposure to these chemicals (Jirtle and Skinner, 2007). For example, in our own research, we found both enhanced and blunted sensitivity to chronic nicotine exposure in several generations of mice along with altered anxiety and startle outcomes. However, if the parental environment is the same for offspring, retention of the epigenetic memory and it effects on behavior supports fitness and survival. Darwin explained this hypothesis eloquently when he wrote: "There is a struggle for existence leading to the preservation of each profitable deviation of structure or instinct (Darwin, 1859)”. This concept is strengthened by the neo-Lamarckian hypothesis that epigenetic inheritance drives single generation evolution in physiology and behavior (Skinner, 2015). Therefore, we exist in a state in which evolutionary pressure is felt in real-time and mediated by the heritable epigenome. There is no better indication of this phenomenon than when the impact of historical events that mediate changes in the environment experienced by parents has a ripple effect in mediating epigenomic-derived changes in physiology and behavior in offspring for several generations (Bowers and Yehuda, 2016). The implications of having this knowledge is striking. The choices we make directly shape the physiology, behavior, and experiences of our children, grandchildren, and future generations.

Finally, because environmental stimuli are capable of driving epigenetic inheritance within a single generation, we hypothesize that epigenetic profiles are a collection of ancestral exposures to the environment over time. This is supported by data generated in Chapter 4, in which nicotine and stress exposure interacted across generations to affect offspring phenotypes. Although not directly investigated, we argue that further experiments would also reveal unique epigenomes and transcriptomes in the

146 animals whose lineages were derived from both exposures. This would yield additional evidence that the current state of the epigenome is best suited and adapted for the present environment and that epigenetic modifications to DNA serve as a molecular memory of ancestral origins.

Concluding Remarks

Exposure to environmental stimuli has lasting effects that can be inherited by future generations of offspring. In this dissertation we identified the long-term impact of adolescent chronic unpredictable stress exposure on adult behavior and gene expression.

In addition, we determined that adolescent stress is inherited through paternal or maternal exposure by two generations of offspring resulting in altered phenotypes and transcriptomes. We extended our studies to include paternal nicotine exposure and characterized complex familial inheritance patterns in three generations of offspring.

Finally, we determined that two environmental exposures, stress and nicotine, can interact across generations to impact offspring behavior. We have demonstrated that the epigenome is the intersection between parental exposure to stress or nicotine and reprogramming of the adult brain of offspring. In addition, we have discussed the evolutionary advantage of across-generation inheritance of parental experience. These studies contribute to our understanding of adolescence as a critical window for stress exposure and provide evidence of a stress paradigm that may be used to study adolescent experience-based mediation of adult anxiety disorders. Importantly, we identified that the inheritance of stress exposure mediates response to nicotine, and we identified novel

147 molecular targets altered by paternal stress exposure using an unbiased, deep-sequencing assessment of the transcriptome, both of which are novel additions to the stress inheritance field. Lastly, we characterized a very novel two-exposure paradigm to study the interaction of two critical factors that impact an individual’s health and behavior, and we examined the influence they have on subsequent generations.

148

APPENDIX

ACTIVATION OF α4β2*/α6β2* NICOTINIC RECEPTORS ALLEVIATES

ANXIETY DURING NICOTINE WITHDRAWAL WITHOUT UPREGULATING

NICOTINIC RECEPTORS

Nicole L. Yohn1, Jill R. Turner2, Julie A. Blendy1

1Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania, PA 19104

2Department of Drug Discovery and Biomedical Sciences, South Carolina College of

Pharmacy, University of Couth Carolina, Columbia SC 29208

Originally published in the Journal of Pharmacology and Experimental Therapeutics

2014 May; 349(2): 384-54.

PMID: 24627467

ACKNOWLEDGEMENTS: This work was supported by the National Institute of Health/National Institute for Drug Abuse/National Cancer Institute [Grants P50 CA143187, K99 DA032681, T32 DA28874]. We thank AbbVie for generously providing ABT-089 and ABT-107 and Dr. Lynne Rueter (Associate Director II, Neuroscience Discovery; AbbVie) for helpful discussions. We thank Ms. Emily Fernandez for experimental assistance. 149

Abstract

While nicotine mediates its effects through several nicotinic acetylcholine receptor

(nAChR) subtypes, it remains to be determined which nAChR subtypes directly mediate heightened anxiety during withdrawal. Relative success in abstinence has been found with the nAChR partial agonist Varenicline (Chantix; Pfizer), however treatment with this drug fails to alleviate anxiety in individuals during nicotine withdrawal. Therefore, it is hypothesized that success can be found by the repurposing of other nAChR partial agonists for cessation therapies that target anxiety. Interestingly, the selective partial agonists for α4β2, ABT-089, and α7, ABT-107, (AbbVie) have not been evaluated as possible therapeutics for nicotine cessation. Therefore we examined the effect of ABT-

089 and ABT-107 on anxiety during withdrawal from nicotine in the novelty-induced hypophagia (NIH) paradigm. We found that acute ABT-089 and ABT- 107 alleviate anxiety-like behavior during withdrawal from nicotine while chronic ABT- 089 but not chronic ABT-107 reduces anxiety-like behavior during withdrawal. Following behavioral testing, brains were harvested and beta2-containing nAChRs were measured using

[3H]Epibaditine. ABT-089 and ABT-107 do not upregulate nAChRs, which is in contrast to the upregulation of nAChRs observed following nicotine. Furthermore, ABT-089 is anxiogenic in nicotine naivë animals, suggesting that the effects on anxiety are specifically related to the nicotine-dependent state. Together, these studies identify additional nAChR partial agonists that may aid in the rational development of smoking cessation aids.

150

Introduction

Cigarette smoking is the leading cause of death in the United States each year

(Centers for Disease Control and Prevention (CDC), 2002). However, approximately

20% of the American population smokes despite the acknowledged health risks and socioeconomic costs (Centers for Disease Control and Prevention (CDC), 2011). In addition, maintenance of smoking cessation is at best modest, with 80% of smokers relapsing within the first year of quitting (Polosa and Benowitz, 2011). It is projected that if prevalence of use does not decrease from present rates, cigarette smoking and tobacco use will result in 10 million deaths per year by 2020 (Adhikari et al., 2009). Thus, identification of effective smoking cessation therapies is urgently needed.

Nicotine, which is the major addictive component in tobacco, plays a critical role in initial tobacco reinforcement and dependence (Le Foll and Goldberg, 2005). While many factors influence ongoing nicotine dependence, relapse to smoking is highly correlated with the severity of withdrawal symptoms present during abstinence (Ockene et al., 2000; Krall et al., 2002). These symptoms include difficulty concentrating, increased craving, depressed mood, and increased anxiety (Hughes, 1992; 2007).

Varenicline (Chantix; Pfizer), a partial agonist at α4β2 nicotinic acetylcholine receptors

(nAChRs) and a full agonist at α7 and α3β4 nAChRs is currently the best in class treatment for smoking cessation (Coe et al., 2005; Garrison and Dugan, 2009). However, while varenicline has been shown to improve both concentration and depressed mood and mitigate craving, recent studies in mice and human subjects have shown treatment does not improve nicotine withdrawal-induced anxiety (Turner et al., 2013b; Cinciripini et al.,

151

2013). This may be of special importance because anxiety arising due to nicotine withdrawal has been correlated with relapse rates (Zhou et al., 2009).

Nicotine acts at multiple nAChR subtypes and understanding which subtypes contribute to the detrimental side effects experienced during withdrawal is critical for identification of novel and improved therapeutics. More specifically, it is important to examine how targeting of the cholinergic system can promote abstinence by reducing withdrawal-induced anxiety. The various subtypes of nAChRs play different roles in anxiety and nicotine withdrawal. For example, alterations in the activation of the α4 nAChR subunit result in heightened anxiety (Ross et al., 2000; Labarca et al., 2001).

Furthermore, although α7 nAChRs have not been implicated directly in anxiety (Paylor et al., 1998; Vicens et al., 2011) they are necessary in the ventral tegmental area (VTA) for the expression of withdrawal from nicotine suggesting that targeting of the α7 subtype may also relieve nicotine withdrawal symptoms (Nomikos et al., 1999).

Chronic nicotine exposure produces a region specific upregulation of β2- containing nAChRs. This phenomenon is thought to contribute to nicotine addiction

(Wonnacott, 1990; Marks et al., 1992; Buisson and Bertrand, 2002) and has been confirmed in several systems including cultured cells and rodent and human tissues

(Marks et al., 1983; Schwartz and Kellar, 1985; Benwell et al., 1988; Peng et al., 1994;

Breese et al., 1997; Perry et al., 1999; Staley et al., 2006). Chronic exposure to varenicline upregulates nAChRs, which parallels its anxiolytic effects during cessation from nicotine (Turner et al., 2011). However the more selective α4β2 nAChR compound, sazetidine-A, does not increase nAChRs despite behavioral anxiolytic

152 effects (Turner et al., 2010; Hussmann et al., 2012; Turner et al., 2013b). Therefore, the role of nAChR upregulation in mediating withdrawal-induced anxiety is as yet unclear.

ABT-089 (2-Methyl-3-(2(S)-pyrrolidinylmethoxy)pyridine; structure in Lin et al., 1997) is a selective partial agonist for α4β2* receptors with high selectivity for α4α5β2 and activity at α6β2* receptors (Rueter et al., 2004; Marks et al., 2009). ABT-089 has been rigorously studied as a treatment for cognitive disorders, and has been used successfully in patients with Alzheimer’s disease (AD) and attention deficit disorder with few unintended side effects (Lin et al., 1997; Rueter et al., 2004). ABT-107 (5-(6-[(3R)- 1- azabicyclo[2.2.2]oct-3-yloxy] pyridazin-3-yl)-1H-indole; structure in Bitner et al., 2010) is a selective agonist with high affinity at α7 nAChRs that has been characterized as a cognitive enhancer in animal models of AD and has low incidence of side effects at varying doses in patients (Bitner et al., 2010; Malysz et al., 2010; Othman et al., 2011).

Both ABT-089 and ABT-107 enhance learning in naïve animals (Decker et al., 1997;

Bitner et al., 2010). However, ABT-089 and ABT-107 have not been evaluated for their role in reducing anxiety following nicotine withdrawal or regulation of nAChRs.

Therefore, we tested ABT-089 and ABT-107 and the selective targeting of distinct nAChR subtypes in order to identify which subtype may mediate anxiety during withdrawal from nicotine.

Materials and Methods

Animals

Male 129SvJ;C57Bl/6J F1 hybrid mice (6-12 weeks of age, 20-30 g) were

153 purchased from Taconic Farms (Hudson, NY), double-housed, and maintained on a 12- h light/dark cycle with food and water ad libitum in accordance with the University of

Pennsylvania Animal Care and Use Committee. All experimental testing sessions were conducted between 9:00 a.m. and 1:00 p.m., with animals randomly assigned to treatment conditions and tested in counterbalanced order. For all studies, mice were acclimated to the behavioral testing facility for 1 hour prior to testing.

Drugs

Doses of nicotine tartrate (Sigma Aldrich, St. Louis, MO), ABT-089 and ABT-107

(synthesized by AbbVie, North Chicago, IL), are reported as free base weight. For acute studies, all drugs were prepared immediately before use in 0.9% saline and injected intraperitoneally. Dose response curves indicated that 1.2mg/kg for ABT-089 and 0.03 mg/kg for ABT-107 (data not shown) do not alter locomotor activity in male

129SvJ;C57Bl/6J F1 hybrid mice.

For chronic treatment studies, nicotine (18mg/kg/day), ABT-089

(0.769mg/kg/day), and ABT-107 (0.32mg/kg/day) were dissolved in 0.9% saline solution and administered for 14 days subcutaneously via osmotic minipump (model 2002; Alzet,

Cupetino, CA). Mice were anesthetized with an isoflurane/oxygen mixture (1-3%), and osmotic minipumps were inserted subcutaneously using aseptic surgery techniques.

Minipumps were placed parallel to the spine at shoulder level with the flow moderator directed away from the surgical incision. The wound was closed with 7-mm stainless steel wound clips (Reflex; Cellpoint Scientific, Gaithersburg, MD).

154

Novelty-induced hypophagia

One week prior to the start of training, mice were housed in groups of two. Training days consisted of daily sessions in which mice were exposed to a highly palatable food (peanut butter chips; Nestle, Glendale, CA) presented in a clear plastic dish. During training and home cage testing sessions, a plastic insert (dividing the standard cage lengthwise) was used to separate mice in each cage. Mice were acclimated to the barriers 1 hour prior to presentation of the food. Food was placed in the cage for 15 minutes and latency to consume was measured (seconds). Training criterion was met once a latency under 20 seconds to approach and consume the food with <20% variability existed between mice.

EXPERIMENT 1: Acute administration

For acute ABT-089/ABT-107 drug treatment studies, mice were implanted with

14-day osmotic minipumps filled with nicotine or saline (For experimental design schematic see Figure 1A). On the last day of minipump viability, animals were tested in the home cage environment 10 minutes following an injection of saline. After the home test occurred, the nicotine minipump was removed in three-fourths of the nicotine treated animals and half of the saline treated animals. Twenty-four hours later, animals were acclimated for novel testing day and given an intraperitoneal injection ABT- 089/ABT-

107 or saline 10 minutes prior to testing in the novel environment. The novel environment consisted of an empty standard cage with no bedding which was wiped with cleanser (1:10 pine sol dilution) to supply a novel odor, and placed in a white box with

155 white light illumination (2150 lux). Latency to consume was recorded over 15 minutes.

On both test days, the amount consumed (grams) of peanut butter chips was recorded.

EXPERIMENT 2: Chronic administration

For chronic drug treatment studies, mice were implanted with 14-day osmotic minipumps filled with nicotine or saline. After 14 days, nicotine minipumps were removed and replaced with a 14-day osmotic minipump containing either nicotine, ABT-

nd 089, or ABT-107. Following seven days of the 2 treatment, osmotic minipumps were removed from half of the nicotine, ABT-089, and ABT-107 treatment groups to initiate spontaneous withdrawal. The remaining animals continued drug treatment for an additional seven days or underwent seven days of withdrawal from nicotine, ABT-089, or

ABT-107. A home day was conducted and novel day testing occurred 24 hours later.

Animals were sacrificed and brains were harvested for receptor binding experiments (For experimental design schematic see Figure 2a).

Receptor Binding

Mice used in the chronic ABT-089/ABT-107 experiment were sacrificed and used for the receptor binding experiment. Brain regions examined were constrained by a minimal tissue amount required for homogenate-binding assays. Tissues were harvested from animals immediately following behavioral testing. The samples were homogenized in 50 mM Tris-HCl (Sigma Aldirch, St. Louis, MO) buffer, pH 7.4 at 24°C, and centrifuged twice at 35,000 x g for 10 minutes in fresh buffer. The membrane pellets

156 were resuspended in fresh buffer and added to tubes containing a saturating concentration

3 3 3 (2 nM) of [ H]epibaditine ([ H]EB; PerkinElmer, Boston, MA). [ H]EB binds is a high- affinity ligand for all heteromeric nAChRs with low nonspecific binding (Badio and

3 Daly, 1994). [ H]EB was incubated with tissue in Tris buffer pH 7.4 for 2 hours at 24°C

3 with [ H]EB. Bound receptors were separated from free ligand by vacuum filtration over

GF/C glass fiber filters (Brandel, Gaithersburg, MD) that were pretreated with 0.5% polyethyleneimine (Sigma Aldrich, St. Louis, MO). The filters were then counted in a liquid scintillation counter. Nonspecific binding was determined in the presence of 300

μM nicotine, and specific binding was defined as the difference between total binding and nonspecific binding.

Statistical Analysis

All data are presented as mean± stanadard error of mean (SEM). For experiment

1, latency served as a dependent variable in two-way analysis of variance (ANOVA) followed post hoc by Bonferroni multiple comparisons test to detect differences. In experiment 2 (Figure 2) a repeated measures two-way ANOVA was used to determine significant differences between treatment groups with time (Home Day, Novel Day) as a repeated-measure (within) factor. A planned comparison (Bonferroni multiple comparison) was performed to test the hypothesis that chronic ABT-089 or ABT-107 administration during nicotine withdrawal show decreased latency to consume in a novel environment, comparing the Nic/ABT-089 and Nic/ABT-107 group with all other groups.

For receptor binding studies an ANOVA followed post hoc by Bonferroni multiple 157 comparisons was used to detect differences between treatment groups. Statistical analyses were carried out using the GraphPad Prism 5.0 software package (GraphPad Software,

San Diego, CA).

Results

Acute ABT-089 and ABT-107 are anxiolytic during nicotine withdrawal in the NIH test

Withdrawal from chronic nicotine increases latency to consume in a novel environment and acute administration of ABT-089 and ABT-107 significantly reduces this latency

(Figure 1b). There are significant differences between treatment groups on novel day

(main effect of day, F(1,35)=82.34, P < 0.0001; main effect of treatment, F(4,35)=9.736,

P < 0.0001; interaction, F(4,35)=10.25, P < 0.0001). Bonferroni post hoc analysis indicated that nicotine treated mice had significantly lower latency to consume (P < 0.05) while mice experiencing 24h withdrawal from nicotine had significantly greater latency to consume (P < 0.001) when compared to saline treated controls. An acute administration of ABT-107 significantly reduced latency to consume the food in the novel environment during 24h withdrawal from nicotine (P < 0.01) when compared to saline controls. Administration of ABT-107 and ABT-089 significantly reduced latency to consume at 24h withdrawal when compared to mice undergoing 24h withdrawal from nicotine (P < 0.0001). Similarly, animals maintained on nicotine showed a reduced latency to consume in the novel environment when compared to animals experiencing

24h withdrawal from nicotine (P < 0.0001). There was no change in amount consumed

158 between home day and novel test day (data not shown).

Chronic ABT-089 is anxiolytic during nicotine withdrawal in the NIH test

To better model a therapeutic administration paradigm, we tested the impact of ABT-089 and ABT-107 on withdrawal induced anxiety following a chronic exposure of the drug. A schematic of the chronic administration paradigm is shown in Figure 2a. Data in Figure

2b demonstrate that 14 day administration of ABT-089 and ABT-107 during nicotine withdrawal reduced latency to consume compared to saline controls, although not significantly (main effect of day, F(1,24)=18.22, P = 0.0003). Planned comparison of

Nic/ABT-089 and Nic/ABT-107 to other treatment groups revealed that when compared to nicotine withdrawal (7d), ABT-089 significantly reduced latency to consume (P <

0.05), while ABT-107 did not. Animals in which minipumps were removed to induce spontaneous withdrawal from ABT-089 or ABT-107 did not show reduced latency to consume in the novel environment as compared to saline controls or nicotine withdrawal.

ABT-089 does not upregulate nAChRs during nicotine withdrawal

As previously demonstrated, nicotine upregulates nAChRs and receptors return to basal levels as early as 24h into withdrawal from nicotine (Figure 3 and Turner et al.,

2011). Chronic nicotine increases nAChRs in the hippocampus, cortex, striatum, and thalamus (Figure 3; main effect of treatment, Hippocampus: (F (4,27)=8.462;P = 0.0001),

Cortex: (F(4,29)=15.91;P < 0.0001), Striatum: (F(4,29)=8.017;P = 0.0002), Thalamus:

(F(4,28)=6.774;P = 0.0006). However, following seven days of withdrawal from nicotine

159

(WD), nAChRs are no longer upregulated when compared to saline control animals.

ABT-089 (Nic/ABT-089) and ABT-107 (Nic/ABT-107) administration over during withdrawal from nicotine does not maintain upregulated nAChRs when compared to saline control animals.

ABT-089 alone does not upregulate nAChRs

To determine if chronic administration of ABT-089 alone can upregulate nAChRs, brain regions of interest were harvested from animals exposed to ABT-089 for 14 days.

Chronic administration of ABT-089 in nicotine naivë mice did not significantly upregulate nAChRs in the hippocampus, cortex, striatum, or thalamus of treated animals compared to saline controls. Hippocampus: (F (2,21)=0.3893;P = 0.6820). Cortex:

(F(2,19)=0.3749;P = 0.6923). Striatum: (F(2,21)=0.9581;P = 0.3998). Thalamus:

(F(2,20)=2.985;P = 0.0734). Additionally, there is no up- or downregulation of receptors following 24h withdrawal from ABT-089 in brain regions chosen for analysis (Figure 4).

ABT-089 alone is anxiogenic in naivë animals

Since ABT-089 chronically blocked nicotine-induced anxiety in nicotine dependent mice, we tested the effects of chronic ABT-089 in nicotine naivë mice. An effect of day was revealed using two-way ANOVA (F (1,21) = 61.06; P < 0.0001) however there was no effect of treatment on latency to consume (Figure 5). While, latency to consume in the novel environment appears greater in animals treated with chronic ABT-089 as well as in

160 animals undergoing 24h withdrawal from chronic ABT-089 at the time of testing, this increase in latency is non-significant.

Discussion

Acute administrations of ABT-089 and ABT-107 alleviate anxiety during nicotine withdrawal however only ABT-089 is effective in alleviating anxiety following chronic administration. Additionally, ABT-089 mediates its effects without upregulating nAChRs, a hallmark of sustained nAChR activation with nicotine. Therefore, ABT-089 may be an effective compound in treating individuals with heightened anxiety during nicotine abstinence through a different cellular mechanism than other cessation therapies.

While administration of varenicline during smoking cessation results in the improvement of both positive affect and cognitive function (Patterson et al., 2009), efficacy in alleviating anxiety during nicotine withdrawal is more complicated (Cinciripini et al.,

2013). Specifically, acute but not chronic varenicline reduces anxiety during withdrawal.

For example, in naivë animals, acute and chronic varenicline administration is anxiolytic in the NIH test (Turner et al., 2010). However, in nicotine-experienced animals, acute administration of varenicline during nicotine withdrawal fails to alleviate anxiety-like behavior (Turner et al., 2013b), suggesting a differential effect of varenicline based on the drug experienced state of the subject. Additionally, a recent study in smokers identified anxiety as one of the symptom domains in which varenicline treatment was ineffective (Cinciprini et al., 2013). Therefore this lack of anxiolytic activity during nicotine withdrawal may underlie the low success rate of varenicline in a subset of

161 smokers (Garrison and Dugan, 2009; Moore et al., 2010). Because varenicline acts at a number of different nAChR subtypes, identifying those subtypes that underlie the beneficial effects of the drug while avoiding subtypes responsible for negative side effects is necessary. Additionally, using a more selective ligand to produce desirable effects during nicotine withdrawal could provide tailored therapies to suit the individual needs of quitters.

Nicotine exerts its biological effects through activation of central nAChRs that exist as subtypes determined by α and β subunit compositions (Gotti and Clementi,

2004). The heteromeric α4β2* subtype and the homomeric α7 are the most prevalent receptor subtypes in the central nervous system (Court et al., 2000). Varenicline, the best in class medication for smoking cessation, acts at both of these subtypes (Coe et al.,

2005). ABT-089 is selective for the α4β2* and α6β2* (Marks et al., 2009) subtypes that have been implicated in anxiety (Ross et al., 2000; Labarca et al., 2001). ABT-107 is selective for the α7 subtype (Malysz et al., 2010) that has been implicated in generalized nicotine withdrawal syndrome (Nomikos et al., 1999). Therefore, we used these highly- selective nicotinic compounds to determine the contribution of specific subtypes during nicotine withdrawal on anxiety using the NIH paradigm and further examined the effects of these drugs on receptor regulation with [3H]EB binding assay. The NIH paradigm is a sensitive measure for potential anxiolytic drugs and anxiogenic effects of withdrawal on both acute and extended drug administration paradigms (Dulawa et al., 2004; Dulawa and

Hen, 2005). The NIH test is sensitive to the anxiolytic effect of chronic nicotine (Turner et al., 2010; Turner et al., 2013b) and the anxiogenic effect of 24h withdrawal from

162 nicotine (as shown in Figure 1). Acute administration of ABT-089 and ABT-107 during

24h withdrawal from chronic nicotine treatment reduces anxiety-like behavior in animals

(Figure 1b). However, chronic administration of ABT- 089, but not ABT-107, during nicotine withdrawal showed a significant decrease in latency to consume compared to animals undergoing seven day WD from nicotine (Figure 2b).

Nicotine withdrawal typically causes an increased latency to consume food in a novel environment above that of saline treated animals (Figure 1b and Turner et al., 2010;

2013a; 2013b). However, these observations are generally evident during the first 24 to

72 hours of nicotine withdrawal. In Figure 2b the long-term effects of nicotine withdrawal are observed and data demonstrate that increased anxiety occurs compared to chronic nicotine administration during nicotine withdrawal that persists beyond a 72 hour timepoint. Thus, chronic exposure of ABT-089 throughout the withdrawal period when individuals may be particularly vulnerable to withdrawal-induced anxiety is an important aspect of our study design. In humans, while most reports of anxiety occur during the first 24 hours, a return to baseline can take up to four weeks (Hughes, 1992). Therefore, the efficacy of ABT-089 to reduce anxiety within an extended time period suggests it would be an effective treatment for the alleviation of both the initial anxiety experienced during withdrawal (Figure 1) as well as anxiety over the course of abstinence. However, it should be noted that the anxiolytic effect of ABT-089 is only evident when drug is on board as latency to consume in a novel environment is increased 7 days after withdrawal from ABT-089 (Figure 2b).

163

Previous studies suggest that the upregulated pool of nAChRs arising from chronic exposure to nicotine may drive elements of the nicotine withdrawal syndrome

(Turner et al., 2011; Gould et al., 2012) and this protracted upregulation of nAChRs has been correlated with reduced ability to maintain abstinence in the clinical population

(Staley et al., 2006). Therefore, to determine if ABT-089 reduced anxiety during nicotine withdrawal in the NIH via maintenance of upregulated nAChRs, we quantified [3H]EB binding density following chronic ABT-089 administration during nicotine withdrawal.

Chronic ABT-089 does not upregulate heteromeric nAChRs during nicotine withdrawal

(Figure 3). However, it is effective in alleviating anxiety during withdrawal (Figure 2b).

Likewise, chronic ABT-107 does not upregulate heteromeric nAChRs (Figure 3). This outcome was expected as α7 nAChRs do not upregulate to the same degree as heteromeric nAChRs following chronic nicotine treatment (Mugnaini et al., 2002). These findings suggest that ABT-089 functionally reduces anxiety during nicotine withdrawal without maintaining upregulation of heteromeric nAChRs. Therefore, in contrast to varenicline, ABT-089 allows nAChRs to down-regulate back to saline levels while providing an anxiolytic effect during withdrawal from nicotine.

Due to the efficacy of ABT-089 in alleviating nicotine withdrawal-induced anxiety we sought to determine if chronic ABT-089 alone could reduce anxiety in the

NIH, thereby broadening the clinical applications of this compound. In addition, we evaluated whether abstinence from chronic ABT-089 produces a withdrawal state that may impact anxiety-like behavior. We found that administration of ABT-089 for two weeks in drug- naivë animals did not decrease anxiety in the NIH. In addition, 24h

164 withdrawal from ABT-089 did not significantly increase latency compared to saline treated animals (Figure 5). While a previous study showed ABT-089 decreased anxiety, this was following acute rather than chronic administration (Lin et al., 1997). In addition, unlike the decrease in latency observed with chronic nicotine administration (Figure 1b),

ABT- 089 administration fails to produce an anxiolytic effect. The vastly different behavioral effects of ABT-089 compared to nicotine suggest that the partial agonist activity produces different biochemical effects compared to the promiscuous activity of nicotine. Additionally, our findings from [3H]EB binding assays demonstrate that chronic

ABT-089 administration in drug-naivë animals does not upregulate nAChRs (Figure 4), similar to its effects in nicotine dependent animals.

Our findings suggest that partial activation of α4β2*/α6* and α7 nAChRs may have an effect on the initial anxiety experienced during nicotine withdrawal and sustained activation of α4β2*/α6* nAChRs through chronic exposure to ABT-089 during nicotine withdrawal alleviates anxiety. This finding supports previous research implicating α4 in anxiety (Ross et al., 2000; Labarca et al., 2001). Additionally, β2 knockout mice, and therefore bereft of α4β2* heterodimers, have reduced anxiety during withdrawal from chronic nicotine and following mecamylamine precipitated withdrawal from nicotine (Jackson et al., 2008). Finally, a subset of α6-containing nAChRs (α6β2β3*) regulate sustained release on dopamine nerve terminals and therefore may provide the efficacy through which both acute and chronic ABT-089 alleviate withdrawal symptoms (Marks et al., 2009). To date, α7 nAChRs have not been implicated in anxiety during nicotine withdrawal (Vicens et al., 2011) and they do not 165 appear to be necessary for somatic signs of withdrawal (Markou and Paterson, 2001).

However, as acute ABT-107 reduced latency to consume during nicotine withdrawal, the targeting of α7 nAChRs may relieve withdrawal symptoms by activating nAChRs in the absence of nicotine.

Finally, findings from this study suggest a complex association between nAChR regulation and behavior. This study is the first to demonstrate that the selective partial nAChR agonist ABT-089 reduces anxiety during nicotine withdrawal without maintainingthe upregulated pool of heteromeric nAChRs. However, while the ligand binding results are similar in drug-naiv̈ e and drug-experienced animals exposed to chronic administration of ABT-089, their behavioral profiles are strikingly different.

These findings highlight the importance of drug screening in nicotine-experienced animals. Interestingly, ABT-107, a selective partial agonist at α7 nAChRs is capable of alleviating anxiety at 24h withdrawal from nicotine, but not following extended administration, suggesting the role of several types of nAChRs in the initial withdrawal symptoms following nicotine cessation that may differ when withdrawal is extended.

Therefore, the temporal specificity of the roles of discrete nAChR subtypes following the onset of nicotine withdrawal needs to be further studied to better identify improved therapeutics for nicotine cessation.

166

References (Appendix)

Adhikari B, Kahende J, Malarcher A, Pechacek T, and Tong V (2009) Smoking- Attributable Mortality, Years of Potential Life Lost, and Productivity Losses. Oncology Times 31: 40.

Badio B, and Daly JW (1994) Epibatidine, a potent analgetic and nicotinic agonist. Mol. Pharmacol. 45: 563–569.

Benwell ME, Balfour DJ, and Anderson JM (1988) Evidence that tobacco smoking increases the density of (-)-[3H]nicotine binding sites in human brain. J. Neurochem. 50: 1243–1247.

Bitner RS, Bunnelle WH, Decker MW, Drescher KU, Kohlhaas KL, Markosyan S, Marsh KC, Nikkel AL, Browman K, Radek R, et al. (2010) In vivo pharmacological characterization of a novel selective alpha7 neuronal nicotinic acetylcholine receptor agonist ABT-107: preclinical considerations in Alzheimer's disease. J. Pharmacol. Exp. Ther. 334: 875–886.

Breese CR, Marks MJ, Logel J, Adams CE, Sullivan B, Collins AC, and Leonard S (1997) Effect of smoking history on [3H]nicotine binding in human postmortem brain. J. Pharmacol. Exp. Ther. 282: 7–13.

Buisson B, and Bertrand D (2002) Nicotine addiction: the possible role of functional upregulation. Trends in Pharmacological Sciences 23: 130–136. Centers for Disease Control and Prevention (CDC) (2002) Annual smoking-attributable mortality, years of potential life lost, and economic costs--United States, 1995-1999. MMWR. Morbidity and Mortality Weekly Report 51: 300–303.

Centers for Disease Control and Prevention (CDC) (2011) Vital signs: current cigarette smoking among adults aged ≥18 years--United States, 2005-2010. MMWR. Morbidity and Mortality Weekly Report 60: 1207–1212.

Cinciripini PM, Robinson JD, Karam-Hage M, Minnix JA, Lam C, Versace F, Brown VL, Engelmann JM, and Wetter DW (2013) Effects of varenicline and bupropion sustained- release use plus intensive smoking cessation counseling on prolonged abstinence from smoking and on 167 depression, negative affect, and other symptoms of nicotine withdrawal. JAMA Psychiatry (Chicago, Ill.) 70: 522–533.

Coe JW, Brooks PR, Vetelino MG, Wirtz MC, Arnold EP, Huang J, Sands SB, Davis TI, Lebel LA, Fox CB, et al. (2005) Varenicline: an alpha4beta2 nicotinic receptor partial agonist for smoking cessation. J. Med. Chem. 48: 3474–3477.

Court JA, Martin-Ruiz C, Graham A, and Perry E (2000) Nicotinic receptors in human brain: topography and pathology. J. Chem. Neuroanat. 20: 281–298.

Decker MW, Bannon AW, Curzon P, Gunther KL, Brioni JD, Holladay MW, Lin NH, Li Y, Daanen JF, Buccafusco JJ, et al. (1997) ABT-089 [2-methyl-3-(2-(S)- pyrrolidinylmethoxy)pyridine dihydrochloride]: II. A novel cholinergic channel modulator with effects on cognitive performance in rats and monkeys. J. Pharmacol. Exp. Ther. 283: 247–258.

Dulawa SC, and Hen R (2005) Recent advances in animal models of chronic antidepressant effects: the novelty-induced hypophagia test. Neuroscience & Biobehavioral Reviews 29: 771– 783.

Dulawa SC, Holick KA, Gundersen B, and Hen R (2004) Effects of chronic fluoxetine in animal models of anxiety and depression. Neuropsychopharmacology 29: 1321–1330.

Le Foll B, and Goldberg SR (2005) Nicotine as a typical drug of abuse in experimental animals and humans. Psychopharmacology (Berl.) 184: 367–381.

Garrison GD, and Dugan SE (2009) Varenicline: a first-line treatment option for smoking cessation. Clinical Therapeutics 31: 463–491.Gotti C, and Clementi F (2004) Neuronal nicotinic receptors: from structure to pathology. Prog. Neurobiol. 74: 363–396.

Gould TJ, Portugal GS, André JM, Tadman MP, Marks MJ, Kenney JW, Yildirim E, and Adoff M (2012) The duration of nicotine withdrawal-associated deficits in contextual fear conditioning

168 parallels changes in hippocampal high affinity nicotinic acetylcholine receptor upregulation. Neuropharmacology 62: 2118–2125.

Hughes JR (1992) Tobacco withdrawal in self-quitters. Journal of Consulting and Clinical Psychology 60: 689–697.

Hughes JR (2007) Effects of abstinence from tobacco: valid symptoms and time course. Nicotine Tob. Res. 9: 315–327.

Hussmann GP, Hussmann GP, Turner JR, Turner JR, Lomazzo E, Lomazzo E, Venkatesh R, Venkatesh R, Cousins V, Cousins V, et al. (2012) Chronic sazetidine-A at behaviorally active doses does not increase nicotinic cholinergic receptors in rodent brain. J. Pharmacol. Exp. Ther. 343: 441–450.

Jackson KJ, Martin BR, Changeux JP, and Damaj MI (2008) Differential role of nicotinic acetylcholine receptor subunits in physical and affective nicotine withdrawal signs. J. Pharmacol. Exp. Ther. 325: 302–312.

Krall EA, Garvey AJ, and Garcia RI (2002) Smoking relapse after 2 years of abstinence: findings from the VA Normative Aging Study. Nicotine Tob. Res. 4: 95–100. Labarca C, Schwarz J, Deshpande P, Schwarz S, Nowak MW, Fonck C, Nashmi R, Kofuji P, Dang H, Shi W, et al. (2001) Point mutant mice with hypersensitive alpha 4 nicotinic receptors show dopaminergic deficits and increased anxiety. 98: 2786–2791.

Lin N-H, Gunn DE, Ryther KB, Garvey DS, Donnelly-Roberts DL, Decker MW, Brioni JD, Buckley MJ, Rodrigues AD, Marsh KG, et al. (1997) Structure−Activity Studies on 2- Methyl-3- (2( S)-pyrrolidinylmethoxy)pyridine (ABT-089): An Orally Bioavailable 3- Pyridyl Ether Nicotinic Acetylcholine Receptor Ligand with Cognition-Enhancing Properties. J. Med. Chem. 40: 385–390.

Malysz J, Anderson DJ, Grønlien JH, Ji J, Bunnelle WH, Håkerud M, Thorin-Hagene K, Ween H, Helfrich R, Hu M, et al. (2010) In vitro pharmacological characterization of a novel selective

169 alpha7 neuronal nicotinic acetylcholine receptor agonist ABT-107. J. Pharmacol. Exp. Ther. 334: 863–874.

Marks MJ, Burch JB, and Collins AC (1983) Genetics of nicotine response in four inbred strains of mice. J. Pharmacol. Exp. Ther. 226: 291–302.

Marks MJ, Pauly JR, Gross SD, Deneris ES, Hermans-Borgmeyer I, Heinemann SF, and Collins AC (1992) Nicotine binding and nicotinic receptor subunit RNA after chronic nicotine treatment. The Journal of Neuroscience : the Official Journal of the Society for Neuroscience 12: 2765– 2784.

Marks MJ, Wageman CR, Grady SR, Gopalakrishnan M, and Briggs CA (2009) Selectivity of ABT-089 for alpha4beta2* and alpha6beta2* nicotinic acetylcholine receptors in brain. Biochem. Pharmacol. 78: 795–802.

Markou A, and Paterson NE (2001) The nicotinic antagonist methyllycaconitine has differential effects on nicotine self-administration and nicotine withdrawal in the rat. Nicotine Tob. Res. 3: 361–373.

Moore TJ, Glenmullen J, and Furberg CD (2010) Thoughts and acts of aggression/violence toward others reported in association with varenicline. Ann Pharmacother 44: 1389–1394.

Mugnaini M, Tessari M, Tarter G, Merlo Pich E, Chiamulera C, and Bunnemann B (2002) Upregulation of [3H]methyllycaconitine binding sites following continuous infusion of nicotine, without changes of alpha7 or alpha6 subunit mRNA: an autoradiography and in situ hybridization study in rat brain. The European Journal of Neuroscience 16: 1633–1646.

Nomikos GG, Hildebrand BE, Panagis G, and Svensson TH (1999) Nicotine withdrawal in the rat: role of [alpha]7 nicotinic receptors in the ventral tegmental area. NeuroReport 10: 697.

Ockene JK, Emmons KM, Mermelstein RJ, Perkins KA, Bonollo DS, Voorhees CC, and Hollis JF (2000) Relapse and maintenance issues for smoking cessation. Health Psychol 19: 17–31.

170

Othman AA, Lenz RA, Zhang J, Li J, Awni WM, and Dutta S (2011) Single- and Multiple-Dose Pharmacokinetics, Safety, and Tolerability of the Selective 7 Neuronal Nicotinic Receptor Agonist, ABT-107, in Healthy Human Volunteers. The Journal of Clinical Pharmacology 51: 512–526.

Patterson F, Jepson C, Strasser AA, Loughead J, Perkins KA, Gur RC, Frey JM, Siegel S, and Lerman C (2009) Varenicline improves mood and cognition during smoking abstinence. Biol. Psychiatry 65: 144–149.

Paylor R, Nguyen M, Crawley JN, Patrick J, Beaudet A, and Orr-Urtreger A (1998) Alpha7 nicotinic receptor subunits are not necessary for hippocampal-dependent learning or sensorimotor gating: a behavioral characterization of Acra7-deficient mice. Learning & Memory 5: 302–316.

Peng X, Gerzanich V, Anand R, Whiting PJ, and Lindstrom J (1994) Nicotine-induced increase in neuronal nicotinic receptors results from a decrease in the rate of receptor turnover. 46: 523–530.

Perry DC, Dávila-García MI, Stockmeier CA, and Kellar KJ (1999) Increased nicotinic receptors in brains from smokers: membrane binding and autoradiography studies. J. Pharmacol. Exp. Ther. 289: 1545–1552.

Polosa R, and Benowitz NL (2011) Treatment of nicotine addiction: present therapeutic options and pipeline developments. Trends in Pharmacological Sciences 32: 281–289. Ross SA, Wong JY, Clifford JJ, Kinsella A, Massalas JS, Horne MK, Scheffer IE, Kola I, Waddington JL, Berkovic SF, et al. (2000) Phenotypic characterization of an alpha 4 neuronal nicotinic acetylcholine receptor subunit knock-out mouse. The Journal of Neuroscience : the Official Journal of the Society for Neuroscience 20: 6431–6441.

Rueter LE, Anderson DJ, Briggs CA, Donnelly-Roberts DL, Gintant GA, Gopalakrishnan M, Lin N-H, Osinski MA, Reinhart GA, Buckley MJ, et al. (2004) ABT-089: pharmacological properties of a neuronal nicotinic acetylcholine receptor agonist for the potential treatment of cognitive disorders. CNS Drug Reviews 10: 167–182.

171

Schwartz RD, and Kellar KJ (1985) In vivo regulation of [3H]acetylcholine recognition sites in brain by nicotinic cholinergic drugs. J. Neurochem. 45: 427–433.

Staley JK, Krishnan-Sarin S, Cosgrove KP, Krantzler E, Frohlich E, Perry E, Dubin JA, Estok K, Brenner E, Baldwin RM, et al. (2006) Human tobacco smokers in early abstinence have higher levels of beta2* nicotinic acetylcholine receptors than nonsmokers. The Journal of Neuroscience : the Official Journal of the Society for Neuroscience 26: 8707–8714.

Turner JR, Castellano LM, and Blendy JA (2010) Nicotinic partial agonists varenicline and sazetidine-A have differential effects on affective behavior. J. Pharmacol. Exp. Ther. 334: 665– 672.

Turner JR, Castellano LM, and Blendy JA (2011) Parallel anxiolytic-like effects and upregulation of neuronal nicotinic acetylcholine receptors following chronic nicotine and varenicline. 13: 41–46.

Turner JR, Ray R, Lee B, Everett L, Xiang J, Jepson C, Kaestner KH, Lerman C, and Blendy JA (2013a) Evidence from mouse and man for a role of neuregulin 3 in nicotine dependence. Mol. Psychiatry.

Turner JR, Wilkinson DS, Poole RL, Gould TJ, Carlson GC, and Blendy JA (2013b) Divergent Functional Effects of Sazetidine-A and Varenicline During Nicotine Withdrawal. Neuropsychopharmacology 38: 2035–2047.

Vicens P, Ribes D, Torrente M, and Domingo JL (2011) Behavioral effects of PNU- 282987, an alpha7 nicotinic receptor agonist, in mice. Behavioural Brain Research 216: 341–348.

Wonnacott S (1990) The paradox of nicotinic acetylcholine receptor upregulation by nicotine. Trends in Pharmacological Sciences 11: 216–219.

172

Zhou X, Nonnemaker J, Sherrill B, and Gilsenan AW (2009) Attempts to quit smoking and relapse: Factors associated with success or failure from the ATTEMPT cohort study. Addictive Behaviors 34: 365-373.

173

Figure 1

A. Day 0 14 15

Saline

Nicotine

500 Saline Nicotine 24h WD *** 400 WD/ABT-089 WD/ABT-107 ) s (

d 300 e e f

o t

c 200 n e t a L

100 **

0 Home Day Novel Day

Figure A. 1 The effect of short-term ABT-089 and ABT-107 on the behavior of mice during nicotine withdrawal in the NIH. A. Mice were implanted with osmotic minipumps containing nicotine or saline. After two weeks of treatment minipumps were removed from half of the nicotine animals to induce spontaneous nicotine withdrawal. ABT-089 and ABT-107 were administered intraperitoneally 10m prior to NIH testing. B. Latency to consume in the novel environment was measured over 15m and is reported as mean latency ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 compared with saline on Novel Day. †P < 0.0001 compared to 24h WD on Novel Day. (n = 8-12).

174

Figure 2

Day 0 14 21 28

Saline

Nicotine

Nicotine ABT-089/ABT-107

Nicotine ABT-089/ABT-107 Behavior Testing

300 Sal/Sal Nic/Nic Nic WD (7d) Nic/ABT-089 Nic/ABT-107 s) ( 200 Nic/ABT-089 WD (7d) d Nic/ABT-107 WD (7d) ee f

o t

cy n

e 100 t a L

0 Home Day Novel Day

Figure A. 2 The effect of long-term ABT-089 and ABT-107 on the behavior of mice during nicotine withdrawal in the NIH. Data are mean (± SEM) of treatment groups composed of five to nine mice per group. A. Mice were implanted with osmotic minipumps containing nicotine or saline. After two weeks of treatment minipumps were removed from half of the nicotine animals and replaced with a minipump containing ABT-089 or ABT-107. One week following minipump switch, minipumps were removed from half of the nicotine, ABT-089, and ABT-107 treatment groups to induce spontaneous withdrawal. B. Latency to consume in the novel environment two weeks following minipump switch and one week following removal of the second minipump animals were tested in the NIH and latency to consume was measured. Latency to consume in the novel environment two weeks following minipump exchange and 7d withdrawal from nicotine is reported as mean latency ± SEM. †P < 0.05 compared with nicotine withdrawal on Novel Day. (n = 4 – 9).

175

Figure 3

* 6 e u s s i t * * g 4 * * * m

/ * * * l o m f 2

0 e e e e alin WD alin WD alin WD alin WD S S S S Nicotine Nicotine Nicotine Nicotine

Nic/ABT-089Nic/ABT-107 Nic/ABT-089Nic/ABT-107 Nic/ABT-089Nic/ABT-107 Nic/ABT-089Nic/ABT-107

Hippocampus Cortex Striatum Thalamus

Figure A. 3 Nicotinic receptor regulation following nicotine withdrawal in the presence or absence of ABT-089 or ABT-107. Homogenate-binding experiments with a saturating concentration of [3H]epibadtidine ([3H]EB) were performed on hippocampal, cortical, striatal, and thalamic tissues from animals treated with chronically with nicotine for two weeks then chronically with ABT-089 or ABT-107 for two weeks during withdrawal from nicotine. Additional treatment groups include animals treated with chronic saline (four weeks), chronic nicotine (four weeks) and animals treated with nicotine for three weeks and then withdrawn from nicotine for 7d (via nicotine minipump removal and spontaneous withdrawal). Data are mean (± SEM) of treatment groups. *P < 0.01, **P < 0.001, *** P < 0.0001 compared with saline. (n = 5 – 10).

176

Figure 4

6 e u s s i t

g 4 m / l o m f 2

0 e D e D e D e D alin alin alin alin S S S S ABT-089 ABT-089 ABT-089 ABT-089

ABT-089 W ABT-089 W ABT-089 W ABT-089 W

Hippocampus Cortex Striatum Thalamus

Figure A. 4 Nicotinic receptor regulation following chronic treatment with ABT-089. Homogenate- binding experiments with a saturating concentration of [3H]Epibadtidine ([3H]EB) were performed on hippocampal, cortical, striatal, and thalamic tissues from animals treated chronically with ABT-089 or saline for two weeks. Minipumps were removed from half of the ABT-089 animals to induce spontaneous withdrawal for 24h. Data are mean (± SEM) of treatment groups. (n = 7 – 8).

177

Figure 5

300 Saline ABT-089 ABT-089 WD s) (

d 200 ee f

o t

cy n

e 100 t a L

0 Home Day Novel Day

Figure A. 5 The effect of chronic ABT-089 and withdrawal from ABT-089 on the behavior of mice in the NIH. Data are mean (± SEM) of treatment groups composed of eight mice per group. Mice were implanted with osmotic minipumps containing ABT-089 or saline. After two weeks of treatment minipumps were removed from half of the ABT-089 animals to induce spontaneous nicotine withdrawal. Twenty-four hours later latency to consume in a novel environment over 15m was measured in all treatment groups. Data is presented as mean latency (± SEM) of treatment groups. (n=8).

178

REFERENCES

Agaku IT, King BA, Dube SR, Centers for Disease Control and Prevention (CDC) (2014) Current cigarette smoking among adults - United States, 2005-2012. MMWR Morbidity and mortality weekly report 63:29–34.

Agoglia AE, Holstein SE, Eastman VR, Hodge CW (2016) Cannabinoid CB1 receptor inhibition blunts adolescent-typical increased binge alcohol and sucrose consumption in male C57BL/6J mice. Pharmacology Biochemistry and Behavior 143:11–17.

Ahmed SH, Koob GF (1997) Cocaine- but not food-seeking behavior is reinstated by stress after extinction. Psychopharmacology 132:289–295.

Allfrey VG (1966) Structural modifications of histones and their possible role in the regulation of ribonucleic acid synthesis. Proceedings Canadian Cancer Conference 6:313–335.

Andersen SL, Teicher MH (2004) Delayed effects of early stress on hippocampal development. Neuropsychopharmacology 29:1988–1993.

Anway MD, Cupp AS, Uzumcu M, Skinner MK (2005) Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science 308:1466–1469.

Aoki K, Feldman MW (2014) Evolution of learning strategies in temporally and spatially variable environments: a review of theory. Theoretical population biology 91:3–19.

Arborelius L, Owens MJ, Plotsky PM, Nemeroff CB (1999) The role of corticotropin-releasing factor in depression and anxiety disorders. The Journal of endocrinology 160:1–12.

Arrazola RA, Singh T, Corey CG, Husten CG, Neff LJ, Apelberg BJ, Bunnell RE, Choiniere CJ, King BA, Cox S, McAfee T, Caraballo RS, Centers for Disease Control and Prevention (CDC) (2015) Tobacco use among middle and high school students - United States, 2011-2014. MMWR Morbidity and mortality weekly report 64:381–385.

Ashe A, Sapetschnig A, Weick E-M, Mitchell J, Bagijn MP, Cording AC, Doebley A-L, Goldstein LD, Lehrbach NJ, Le Pen J, Pintacuda G, Sakaguchi A, Sarkies P, Ahmed S, Miska EA (2012) piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell 150:88–99.

Babb JA, Carini LM, Spears SL, Nephew BC (2014) Transgenerational effects of social stress on social behavior, corticosterone, oxytocin, and prolactin in rats. Hormones and behavior 65:386– 393.

Baccarelli A, Bollati V (2009) Epigenetics and environmental chemicals. Current opinion in pediatrics 21:243–251.

Baker-Andresen D, Ratnu VS, Bredy TW (2013) Dynamic DNA methylation: a prime candidate for genomic metaplasticity and behavioral adaptation. Trends in Neurosciences 36:3–13.

179

Bale TL, Baram TZ, Brown AS, Goldstein JM, Insel TR, McCarthy MM, Nemeroff CB, Reyes TM, Simerly RB, Susser ES, Nestler EJ (2010) Early Life Programming and Neurodevelopmental Disorders. Biological Psychiatry 68:314–319.

Bale TL, Lee K-F, Vale WW (2002) The role of corticotropin-releasing factor receptors in stress and anxiety. Integrative and comparative biology 42:552–555.

Barker DJ (1990) The fetal and infant origins of adult disease. BMJ (Clinical research ed) 301:1111.

Barker DJP (2007) The origins of the developmental origins theory. Journal of internal medicine 261:412–417.

Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:281– 297.

Bartolomei MS (2009) Genomic imprinting: employing and avoiding epigenetic processes. Genes & Development 23:2124–2133.

Bartolomucci A, Gioiosa L, Chirieleison A, Ceresini G, Parmigiani S, Palanza P (2004) Cross fostering in mice: behavioral and physiological carry-over effects in adulthood. Genes, brain, and behavior 3:115–122.

Bazzini AA, Lee MT, Giraldez AJ (2012) Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish. Science 336:233–237.

Bench GS, Friz AM, Corzett MH, Morse DH, Balhorn R (1996) DNA and total protamine masses in individual sperm from fertile mammalian subjects. Cytometry 23:263–271.

Benowitz NL (1999) Nicotine Addiction. Primary Care: Clinics in Office Practice 26:611–631.

Benwell ME, Balfour DJ (1979) Effects of nicotine administration and its withdrawal on plasma corticosterone and brain 5-hydroxyindoles. Psychopharmacology 63:7–11.

Benwell ME, Balfour DJ, Anderson JM (1988) Evidence that tobacco smoking increases the density of (-)-[3H]nicotine binding sites in human brain. Journal of neurochemistry 50:1243– 1247.

Biala G, Pekala K, Boguszewska-Czubara A, Michalak A, Kruk-Slomka M, Budzynska B (2016) Behavioral and Biochemical Interaction Between Nicotine and Chronic Unpredictable Mild Stress in Mice. Molecular Neurobiology.

Bierer LM, Bader HN, Daskalakis NP, Lehrner AL, Makotkine I, Seckl JR, Yehuda R (2014) Elevation of 11β-hydroxysteroid dehydrogenase type 2 activity in Holocaust survivor offspring: evidence for an intergenerational effect of maternal trauma exposure. Psychoneuroendocrinology 48:1–10.

180

Biliński P, Wojtyła A, Kapka-Skrzypczak L, Chwedorowicz R, Cyranka M, Studziński T (2012) Epigenetic regulation in drug addiction. Annals of agricultural and environmental medicine : AAEM 19:491–496.

Bird A (2002) DNA methylation patterns and epigenetic memory. Genes & Development 16:6– 21.

Bird A (2007) Perceptions of epigenetics. Nature 447:396–398.

Biro FM, Deardorff J (2013) Identifying opportunities for cancer prevention during preadolescence and adolescence: puberty as a window of susceptibility. The Journal of adolescent health : official publication of the Society for Adolescent Medicine 52.

Blaze J, Roth TL (2015) Evidence from clinical and animal model studies of the long-term and transgenerational impact of stress on DNA methylatio. Seminars in cell & developmental biology:1–9.

Bock J, Poeschel J, Schindler J, Börner F, Shachar-Dadon A, Ferdman N, Gaisler-Salomon I, Leshem M, Braun K, Poeggel G (2016) Transgenerational sex-specific impact of preconception stress on the development of dendritic spines and dendritic length in the medial prefrontal cortex. Brain structure & function 221:855–863.

Bohacek J, Mansuy IM (2012) Epigenetic Inheritance of Disease and Disease Risk. Neuropsychopharmacology 38:220–236.

Bonduriansky R, Crean AJ, Day T (2012) The implications of nongenetic inheritance for evolution in changing environments. Evolutionary applications 5:192–201.

Bonneh Barkay D, Wiley CA (2009) Brain Extracellular Matrix in Neurodegeneration. Brain pathology 19:573–585.

Borgel J, Guibert S, Li Y, Chiba H, Schübeler D, Sasaki H, Forné T, Weber M (2010) Targets and dynamics of promoter DNA methylation during early mouse development. Nature Genetics 42:1093–1100.

Bowers ME, Yehuda R (2016) Intergenerational Transmission of Stress in Humans. Neuropsychopharmacology 41:232–244.

Bray C, Son J-H, Meizel S (2005) Acetylcholine causes an increase of intracellular calcium in human sperm. Molecular human reproduction 11:881–889.

Bredy TW, Sun YE, Kobor MS (2010) How the epigenome contributes to the development of psychiatric disorders. Developmental psychobiology 52:331–342.

Briand LA, Blendy JA (2010) Molecular and genetic substrates linking stress and addiction. Brain Research 1314:219–234.

Bruchas MR, Land BB, Chavkin C (2010) The dynorphin/kappa opioid system as a modulator of stress-induced and pro-addictive behaviors. Brain Research 1314:44–55. 181

Brunell SC, Spear LP (2005) Effect of stress on the voluntary intake of a sweetened ethanol solution in pair-housed adolescent and adult rats. Alcoholism: Clinical and Experimental Research 29:1641–1653.

Burley N (1988) The differential-allocation hypothesis: an experimental test. American Naturalist

Byrnes EM (2005) Transgenerational consequences of adolescent morphine exposure in female rats: effects on anxiety-like behaviors and morphine sensitization in adult offspring. Psychopharmacology 182:537–544.

Byrnes JJ, Johnson NL, Carini LM, Byrnes EM (2013) Multigenerational effects of adolescent morphine exposure on dopamine D2 receptor function. Psychopharmacology 227:263–272.

Cabrera-Vera TM, Hernandez S, Earls LR, Medkova M, Sundgren-Andersson AK, Surmeier DJ, Hamm HE (2004) RGS9-2 modulates D2 dopamine receptor-mediated Ca2+ channel inhibition in rat striatal cholinergic interneurons. Proceedings of the National Academy of Sciences 101:16339–16344.

Cadet JL, Brannock C, Jayanthi S, Krasnova IN (2014) Transcriptional and Epigenetic Substrates of Methamphetamine Addiction and Withdrawal: Evidence from a Long-Access Self- Administration Model in the Rat. Molecular Neurobiology:1–22.

Cahill L (2006) Why sex matters for neuroscience. Nature reviews neuroscience 7:477–484.

Cannon WB (1940) The Adrenal Medulla. Bulletin of the New York Academy of Medicine 16:3– 13.

Carlezon WA, Chartoff EH (2007) Intracranial self-stimulation (ICSS) in rodents to study the neurobiology of motivation. Nature protocols 2:2987–2995.

Carone BR, Fauquier L, Habib N, Shea JM, Hart CE, Li R, Bock C, Li C, Gu H, Zamore PD, Meissner A, Weng Z, Hofmann HA, Friedman N, Rando OJ (2010) Paternally induced transgenerational environmental reprogramming of metabolic gene expression in mammals. Cell 143:1084–1096.

Celik O, Celik E, Yilmaz E, Celik N, Turkcuoglu I, Ulas M, Kumbak B, Aktan E, Ozerol İ (2013) Effect of ovarian stimulation with recombinant follicle-stimulating hormone, gonadotropin- releasing hormone agonist and antagonists, on follicular fluid stem cell factor and serum urocortin 1 levels on the day of oocyte retrieval. Archives of Gynecology and Obstetrics 288:1417–1422.

Chai X, Förster E, Zhao S, Bock HH, Frotscher M (2009) Reelin Stabilizes the Actin Cytoskeleton of Neuronal Processes by Inducing n-Cofilin Phosphorylation at Serine3. The Journal of Neuroscience 29:288–299.

Chase KA, Sharma RP (2013) Nicotine induces chromatin remodelling through decreases in the methyltransferases GLP, G9a, Setdb1 and levels of H3K9me2. The international journal of neuropsychopharmacology / official scientific journal of the Collegium Internationale Neuropsychopharmacologicum (CINP) 16:1129–1138.

182

Clayton JA (2016) Studying both sexes: a guiding principle for biomedicine. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 30:519– 524.

Cnattingius S (2004) The epidemiology of smoking during pregnancy: Smoking prevalence, maternal characteristics, and pregnancy outcomes. Nicotine & tobacco research : official journal of the Society for Research on Nicotine and Tobacco 6:S125.

Comb M, Goodman HM (1990) CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nucleic Acids Research 18:3975–3982.

Cossetti C, Lugini L, Astrologo L, Saggio I, Fais S, Spadafora C (2014) Soma-to-germline transmission of RNA in mice xenografted with human tumour cells: possible transport by exosomes. PloS one 9:e101629.

Cui C, Booker TK, Allen RS, Grady SR, Whiteaker P, Marks MJ, Salminen O, Tritto T, Butt CM, Allen WR, Stitzel JA, McIntosh JM, Boulter J, Collins AC, Heinemann SF (2003) The β3 Nicotinic Receptor Subunit: A Component of α-Conotoxin MII-Binding Nicotinic Acetylcholine Receptors that Modulate Dopamine Release and Related Behaviors. The Journal of Neuroscience 23:11045–11053.

Cunningham CL, Noble D (1992) Conditioned activation induced by ethanol: role in sensitization and conditioned place preference. Pharmacology Biochemistry and Behavior 43:307–313.

Cutuli D, Caporali P, Gelfo F, Angelucci F, Laricchiuta D, Foti F, De Bartolo P, Bisicchia E, Molinari M, Farioli Vecchioli S, Petrosini L (2015) Pre-reproductive maternal enrichment influences rat maternal care and offspring developmental trajectories: behavioral performances and neuroplasticity correlates. Frontiers in Behavioral Neuroscience 9:66.

Dai J, Xu W, Zhao X, Zhang M, Zhang D, Nie D, Bao M, Wang Z, Wang L, Qiao Z (2016) Protein profile screening: reduced expression of Sord in the mouse epididymis induced by nicotine inhibits tyrosine phosphorylation level in capacitated spermatozoa. Reproduction (Cambridge, England) 151:227–237.

Dalla C, Pitychoutis PM, Kokras N, Papadopoulou-Daifoti Z (2010) Sex differences in animal models of depression and antidepressant response. Basic & clinical pharmacology & toxicology 106:226–233.

Damsma G, Day J, Fibiger HC (1989) Lack of tolerance to nicotine-induced dopamine release in the nucleus accumbens. European Journal of Pharmacology 168:363–368.

Dani JA, Ji D, Zhou FM (2001) Synaptic plasticity and nicotine addiction. Neuron 31:349–352.

Darwin C (1859) On the Origin of Species, 6th.

Daval G, Vergé D, Becerril A, Gozlan H, Spampinato U, Hamon M (1987) Transient expression of 5-HT1A receptor binding sites in some areas of the rat CNS during postnatal development. International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience 5:171–180. 183

Davis M (1980) Neurochemical modulation of sensory-motor reactivity: Acoustic and tactile startle reflexes. Neuroscience and biobehavioral reviews 4:241–263.

Davis M (1992) The role of the amygdala in fear and anxiety. Annual review of neuroscience 15:353-375.

Davis M, Falls WA, Campeau S, Kim M (1993) Fear-potentiated startle: a neural and pharmacological analysis. Behavioural brain research 58:175–198.

Davis M, Rainnie D, Cassell M (1994) Neurotransmission in the rat amygdala related to fear and anxiety. Trends in Neurosciences 17:208–214.

Daxinger L, Whitelaw E (2012) Understanding transgenerational epigenetic inheritance via the gametes in mammals. Nature Reviews Genetics 13:153–162.

De Kloet ER, Joëls M, Holsboer F (2005) Stress and the brain: from adaptation to disease. Nature reviews neuroscience 6:463–475.

De Waal E, Mak W, Calhoun S, Stein P, Ord T, Krapp C, Coutifaris C, Schultz RM, Bartolomei MS (2014) In vitro culture increases the frequency of stochastic epigenetic errors at imprinted genes in placental tissues from mouse concepti produced through assisted reproductive technologies. Biology of reproduction 90:22.

DeChiara TM, Robertson EJ, Efstratiadis A (1991) Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64:849–859.

Dempster EL, Pidsley R, Schalkwyk LC, Owens S, Georgiades A, Kane F, Kalidindi S, Picchioni M, Kravariti E, Toulopoulou T, Murray RM, Mill J (2011) Disease-associated epigenetic changes in monozygotic twins discordant for schizophrenia and bipolar disorder. Human molecular genetics 20:4786–4796.

Denenberg VH (1964) CRITICAL PERIODS, STIMULUS INPUT, AND EMOTIONAL REACTIVITY: A THEORY OF INFANTILE STIMULATION. Psychological review 71:335– 351.

Der-Avakian A, Bland ST, Rozeske RR, Tamblyn JP, Hutchinson MR, Watkins LR, Maier SF (2007) The effects of a single exposure to uncontrollable stress on the subsequent conditioned place preference responses to oxycodone, cocaine, and ethanol in rats. Psychopharmacology 191:909–917.

Dias BG, Ressler KJ (2014) Parental olfactory experience influences behavior and neural structure in subsequent generations. Nature neuroscience 17:89–96.

Dietz DM, LaPlant Q, Watts EL, Hodes GE, Russo SJ, Feng J, Oosting RS, Vialou V, Nestler EJ (2011) Paternal transmission of stress-induced pathologies. Biological Psychiatry 70:408–414.

DiFranza JR, Wellman RJ (2007) Sensitization to nicotine: how the animal literature might inform future human research. Nicotine & tobacco research : official journal of the Society for Research on Nicotine and Tobacco 9:9–20. 184

Dirks A, Groenink L, Schipholt MI, van der Gugten J, Hijzen TH, Geyer MA, Olivier B (2002) Reduced startle reactivity and plasticity in transgenic mice overexpressing corticotropin-releasing hormone. BPS 51:583–590.

Dohlman HG, Thorner J (1997) RGS proteins and signaling by heterotrimeric G proteins. The Journal of biological chemistry 272:3871–3874.

Eiland L, Ramroop J, Hill MN, Manley J, McEwen BS (2012) Chronic juvenile stress produces corticolimbic dendritic architectural remodeling and modulates emotional behavior in male and female rats. Psychoneuroendocrinology 37:39–47.

Falcon E, Browne CA, Leon RM, Fleites VC, Sweeney R, Kirby LG, Lucki I (2016) Antidepressant-Like Effects of Buprenorphine are Mediated by Kappa Opioid Receptors. Neuropsychopharmacology.

Felitti VJ, Anda RF, Nordenberg D, Williamson DF, Spitz AM, Edwards V, Koss MP, Marks JS (1998) Relationship of childhood abuse and household dysfunction to many of the leading causes of death in adults. The Adverse Childhood Experiences (ACE) Study. American journal of preventive medicine 14:245–258.

Fendt M, Koch M, Schnitzler HU (1994) Amygdaloid noradrenaline is involved in the sensitization of the acoustic startle response in rats. Pharmacology Biochemistry and Behavior 48:307–314.

Ferguson-Smith AC, Cattanach BM, Barton SC, Beechey CV, Surani MA (1991) Embryological and molecular investigations of parental imprinting on mouse chromosome 7. Nature 351:667– 670.

Field T (1998) Early interventions for infants of depressed mothers. Pediatrics 102:1305–1310.

Finegersh A, Homanics GE (2014) Paternal alcohol exposure reduces alcohol drinking and increases behavioral sensitivity to alcohol selectively in male offspring. PloS one 9:e99078.

Francis D, Diorio J, Liu D, Meaney MJ (1999) Nongenomic transmission across generations of maternal behavior and stress responses in the rat. Science 286:1155–1158.

Franklin KBJ, Paxinos G (1997) The Mouse Brain in Stereotaxic Coordinates:186.

Franklin TB, Linder N, Russig H, Thöny B, Mansuy IM (2011) Influence of early stress on social abilities and serotonergic functions across generations in mice. PloS one 6:e21842.

Franklin TB, Russig H, Weiss IC, Gräff J, Linder N, Michalon A, Vizi S, Mansuy IM (2010) Epigenetic Transmission of the Impact of Early Stress Across Generations. Biological Psychiatry 68:408–415.

Fulton S, Pissios P, Manchon RP, Stiles L, Frank L, Pothos EN, Maratos-Flier E, Flier JS (2006) Leptin Regulation of the Mesoaccumbens Dopamine Pathway. Neuron 51:811–822.

185

Fumagalli M, Moltke I, Grarup N, Racimo F, Bjerregaard P, Jørgensen ME, Korneliussen TS, Gerbault P, Skotte L, Linneberg A, Christensen C, Brandslund I, Jørgensen T, Huerta-Sánchez E, Schmidt EB, Pedersen O, Hansen T, Albrechtsen A, Nielsen R (2015) Greenlandic Inuit show genetic signatures of diet and climate adaptation. Science 349:1343–1347.

Galea LAM, McEwen BS, Tanapat P, Deak T, Spencer RL, Dhabhar FS (1997) Sex differences in dendritic atrophy of CA3 pyramidal neurons in response to chronic restraint stress. Neuroscience 81:689–697.

Ganji V, Betts N (1995) Fat, cholesterol, fiber and sodium intakes of US population: evaluation of diets reported in 1987-88 Nationwide Food Consumption Survey. European journal of clinical nutrition 49:915–920.

Gapp K, Jawaid A, Sarkies P, Bohacek J, Pelczar P, Prados J, Farinelli L, Miska E, Mansuy IM (2014a) Implication of sperm RNAs in transgenerational inheritance of the effects of early trauma in mice. Nature neuroscience 17:667–669.

Gapp K, Ziegler L von, Tweedie-Cullen RY, Mansuy IM (2014b) Early life epigenetic programming and transmission of stress-induced traits in mammals: How and when can environmental factors influence traits and their transgenerational inheritance? BioEssays : news and reviews in molecular, cellular and developmental biology 36:491–502.

Gatewood JM, Cook GR, Balhorn R, Bradbury EM, Schmid CW (1987) Sequence-specific packaging of DNA in human sperm chromatin. Science 236:962–964.

Gaydos LJ, Wang W, Strome S (2014) Gene repression. H3K27me and PRC2 transmit a memory of repression across generations and during development. Science 345:1515–1518.

George O, Ghozland S, Azar MR, Cottone P, Zorrilla EP, Parsons LH, O’Dell LE, Richardson HN, Koob GF (2007) CRF-CRF1 system activation mediates withdrawal-induced increases in nicotine self-administration in nicotine-dependent rats. Proceedings of the National Academy of Sciences 104:17198–17203.

Gewirtz JC, Mcnish KA, Davis M (1998) Lesions of the bed nucleus of the stria terminalis block sensitization of the acoustic startle reflex produced by repeated stress, but not fear-potentiated startle. Progress in Neuro-Psychopharmacology and Biological Psychiatry 22:625–648.

Ghildiyal M, Zamore PD (2009) Small silencing RNAs: an expanding universe. Nature Reviews Genetics 10:94–108.

Girotti M, Pace TWW, Gaylord RI, Rubin BA, Herman JP, Spencer RL (2006) Habituation to repeated restraint stress is associated with lack of stress-induced c-fos expression in primary sensory processing areas of the rat brain. Neuroscience 138:1067–1081.

Gold PW (2015) The organization of the stress system and its dysregulation in depressive illness. Molecular Psychiatry 20:32–47.

186

Gold SJ, Ni YG, Dohlman HG, Nestler EJ (1997) Regulators of G-protein signaling (RGS) proteins: region-specific expression of nine subtypes in rat brain. The Journal of Neuroscience 17:8024–8037.

Gouveia A, Santos UD dos, Felisbino FE, de Afonseca TL, Antunes G, Morato S (2004) Influence of the estrous cycle on the behavior of rats in the elevated T-maze. Behavioural processes 67:167–171.

Govorko D, Bekdash RA, Zhang C, Sarkar DK (2012) Male germline transmits fetal alcohol adverse effect on hypothalamic proopiomelanocortin gene across generations. Biological Psychiatry 72:378–388.

Groothuis TGG, Schwabl H (2008) Hormone-mediated maternal effects in birds: mechanisms matter but what do we know of them? Philosophical transactions of the Royal Society of London Series B, Biological sciences 363:1647–1661.

Grunberg NE (1990) The Inverse Relationship between Tobacco Use and Body Weight. Research Advances in Alcohol and Drug Problems:273–315.

Guan H, Piao F, Zhang X, Li X, Li Q, Xu L, Kitamura F, Yokoyama K (2012) Prenatal Exposure to Arsenic and Its Effects on Fetal Development in the General Population of Dalian. Biological Trace Element Research 149:10–15.

Guo H, Ingolia NT, Weissman JS, Bartel DP (2010) Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466:835–840.

Gupta RM, Musunuru K (2014) Expanding the genetic editing tool kit: ZFNs, TALENs, and CRISPR-Cas9. The Journal of clinical investigation 124:4154–4161.

Haeussler S, Claus R (2007) Expression of the glucocorticoid receptor and 11 beta- hydroxysteroid dehydrogenase 2 in pig testes cells along fetal development. Reproduction, fertility, and development 19:664–669.

Hamilton BE, Martin JA, Osterman MJK, Curtin SC, Matthews TJ (2015) Births: Final Data for 2014. National vital statistics reports : from the Centers for Disease Control and Prevention, National Center for Health Statistics, National Vital Statistics System 64:1–64.

Hammoud S, Liu L, Carrell DT (2009) Protamine ratio and the level of histone retention in sperm selected from a density gradient preparation. Andrologia 41:88–94.

Haney M, Maccari S, Le Moal M, Simon H, Piazza PV (1995) Social stress increases the acquisition of cocaine self-administration in male and female rats. Brain Research 698:46–52.

Heard E, Martienssen RA (2014) Transgenerational epigenetic inheritance: myths and mechanisms. Cell 157:95–109.

Heijmans BT, Tobi EW, Stein AD, Putter H, Blauw GJ, Susser ES, Slagboom PE, Lumey LH (2008) Persistent epigenetic differences associated with prenatal exposure to famine in humans.

187

Proceedings of the National Academy of Sciences of the United States of America 105:17046– 17049.

Heim C, Nemeroff CB (2001) The role of childhood trauma in the neurobiology of mood and anxiety disorders: preclinical and clinical studies. BPS 49:1023–1039.

Heim C, Plotsky PM, Nemeroff CB (2004) Importance of studying the contributions of early adverse experience to neurobiological findings in depression. Neuropsychopharmacology 29:641–648.

Heishman SJ, Kleykamp BA, Singleton EG (2010) Meta-analysis of the acute effects of nicotine and smoking on human performance. Psychopharmacology 210:453–469.

Hijzen TH, Houtzager SW, Joordens RJ, Olivier B, Slangen JL (1995) Predictive validity of the potentiated startle response as a behavioral model for anxiolytic drugs. Psychopharmacology 118:150–154.

Hill KG, Hawkins JD, Catalano RF, Abbott RD, Guo J (2005) Family influences on the risk of daily smoking initiation. The Journal of adolescent health : official publication of the Society for Adolescent Medicine 37:202–210.

Hill MN, Hellemans KGC, Verma P, Gorzalka BB, Weinberg J (2012) Neurobiology of chronic mild stress: parallels to major depression. Neuroscience and biobehavioral reviews 36:2085– 2117.

Hillemacher T, Frieling H, Moskau S, Muschler MAN, Semmler A, Kornhuber J, Klockgether T, Bleich S, Linnebank M (2008) Global DNA methylation is influenced by smoking behaviour. European Neuropsychopharmacology 18:295–298.

Hinwood M, Tynan RJ, Day TA, Walker FR (2011) Repeated social defeat selectively increases δFosB expression and histone H3 acetylation in the infralimbic medial prefrontal cortex. Cerebral cortex (New York, NY : 1991) 21:262–271.

Hohoff C, Gorji A, Kaiser S, Willscher E, Korsching E, Ambrée O, Arolt V, Lesch K-P, Sachser N, Deckert J, Lewejohann L (2013) Effect of acute stressor and serotonin transporter genotype on amygdala first wave transcriptome in mice. PloS one 8:e58880.

Hollis F, Isgor C, Kabbaj M (2013) The consequences of adolescent chronic unpredictable stress exposure on brain and behavior. Neuroscience 249:232–241.

Holloway AC, Cuu DQ, Morrison KM, Gerstein HC, Tarnopolsky MA (2007) Transgenerational effects of fetal and neonatal exposure to nicotine. Endocrine 31:254–259.

Hopenhayn C, Ferreccio C, Browning SR, Huang B, Peralta C, Gibb H, Hertz-Picciotto I (2003) Arsenic Exposure from Drinking Water and Birth Weight. Epidemiology 14:593–602.

Hradsky J, Bernstein H-G, Marunde M, Mikhaylova M, Kreutz MR (2015) Alternative splicing, expression and cellular localization of Calneuron-1 in the rat and human brain. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 63:793–804. 188

Huang DW, Sherman BT, Lempicki RA (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols 4:44–57.

Huang W, Li MD (2009) Nicotine modulates expression of miR-140*, which targets the 3’- untranslated region of dynamin 1 gene (Dnm1). The international journal of neuropsychopharmacology / official scientific journal of the Collegium Internationale Neuropsychopharmacologicum (CINP) 12:537–546.

Hunter RG, McCarthy KJ, Milne TA, Pfaff DW, McEwen BS (2009) Regulation of hippocampal H3 histone methylation by acute and chronic stress. Proceedings of the National Academy of Sciences of the United States of America 106:20912–20917.

Hunter RG, McEwen BS (2013) Stress and anxiety across the lifespan: structural plasticity and epigenetic regulation. Epigenomics 5:177–194.

Itzhak Y, Martin JL (1999) Effects of cocaine, nicotine, dizocipline and alcohol on mice locomotor activity: cocaine–alcohol cross-sensitization involves upregulation of striatal dopamine transporter binding sites. Brain Research 818:204–211.

Iversen AC, Fear NT, Simonoff E, Hull L, Horn O, Greenberg N, Hotopf M, Rona R, Wessely S (2007) Influence of childhood adversity on health among male UK military personnel. The British journal of psychiatry : the journal of mental science 191:506–511.

Jablonka E, Raz G (2009) Transgenerational epigenetic inheritance: prevalence, mechanisms, and implications for the study of heredity and evolution. The Quarterly review of biology 84:131– 176.

Jakobsson J, Cordero MI, Bisaz R, Groner AC, Busskamp V, Bensadoun J-C, Cammas F, Losson R, Mansuy IM, Sandi C, Trono D (2008) KAP1-mediated epigenetic repression in the forebrain modulates behavioral vulnerability to stress. Neuron 60:818–831.

Jankord R, Herman JP (2008) Limbic regulation of hypothalamo-pituitary-adrenocortical function during acute and chronic stress. Annals of the New York Academy of Sciences 1148:64–73.

Jeanblanc J, Logrip ML, Janak PH, Ron D (2012) BDNF-mediated regulation of ethanol consumption requires the activation of the MAP kinase pathway and protein synthesis. European Journal of Neuroscience 37:607–612.

Jenkins TG, Carrell DT (2012) The sperm epigenome and potential implications for the developing embryo. Reproduction (Cambridge, England) 143:727–734.

Jimenez-Gomez C, Osentoski A, Woods JH (2011) Pharmacological evaluation of the adequacy of marble burying as an animal model of compulsion and/or anxiety. Behavioural Pharmacology 22:711–713.

Jirtle RL, Skinner MK (2007) Environmental epigenomics and disease susceptibility. Nature Reviews Genetics 8:253–262.

189

Joëls M, Baram TZ (2009) The neuro-symphony of stress. Nature reviews neuroscience 10:459– 466.

Joëls M, Pu Z, Wiegert O, Oitzl MS, Krugers HJ (2006) Learning under stress: how does it work? Trends in Cognitive Sciences 10:152–158.

Johnson NL, Carini L, Schenk ME, Stewart M (2011) Adolescent opiate exposure in the female rat induces subtle alterations in maternal care and transgenerational effects on play behavior. Frontiers in Psychiatry 2:29.

Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J, Wolffe AP (1998) Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nature Genetics 19:187–191.

Jordanov JS (1990) Cotinine concentrations in amniotic fluid and urine of smoking, passive smoking and non-smoking pregnant women at term and in the urine of their neonates on 1st day of life. European journal of pediatrics 149:734–737.

Joyce EM, Iversen SD (1979) The effect of morphine applied locally to mesencephalic dopamine cell bodies on spontaneous motor activity in the rat. Neuroscience letters 14:207–212.

Jung S, Lee Y, Kim G, Son H, Lee DH, Roh GS, Kang SS, Cho GJ, Choi WS, Kim HJ (2012) Decreased expression of extracellular matrix proteins and trophic factors in the amygdala complex of depressed mice after chronic immobilization stress. BMC Neuroscience 13:1.

Kaati G, Bygren LO, Pembrey M, Sjöström M (2007) Transgenerational response to nutrition, early life circumstances and longevity. European journal of human genetics : EJHG 15:784–790.

Kaufmann SH, Wright WW, Okret S, Wikström AC, Gustafsson JA, Shaper NL, Shaper JH (1992) Evidence that rodent epididymal sperm contain the Mr approximately 94,000 glucocorticoid receptor but lack the Mr approximately 90,000 heat shock protein. Endocrinology 130:3074–3084.

Kavitharaj NK, Vijayammal PL (1998) Nicotine Administration Induced Changes in the Gonadal Functions in Male Rats. Pharmacology 58:2–7.

Kelsey G, Feil R (2013) New insights into establishment and maintenance of DNA methylation imprints in mammals. Philosophical transactions of the Royal Society of London Series B, Biological sciences 368:20110336.

Kenny PJ, Markou A (2005) Nicotine self-administration acutely activates brain reward systems and induces a long-lasting increase in reward sensitivity. Neuropsychopharmacology 6:1203- 1211.

Kessler RC, Davis CG, Kendler KS (1997) Childhood adversity and adult psychiatric disorder in the US National Comorbidity Survey. Psychological medicine 27:1101–1119.

190

Kim H-R, Moon S, Lee HK, Kang JL, Oh S, Seoh J-Y (2012) Immune dysregulation in chronic stress: a quantitative and functional assessment of regulatory T cells. Neuroimmunomodulation 19:187–194.

Kim HS, Kim KS (1999) Inhibitory effects of ginseng total saponin on nicotine-induced hyperactivity, reverse tolerance and dopamine receptor supersensitivity. Behavioural brain research 103:55–61.

Kim P, Choi CS, Park JH, Joo SH, Kim SY, Ko HM, Kim KC, Jeon SJ, Park SH, Han S-H, Ryu JH, Cheong JH, Han JY, Ko KN, Shin CY (2014) Chronic exposure to ethanol of male mice before mating produces attention deficit hyperactivity disorder-like phenotype along with epigenetic dysregulation of dopamine transporter expression in mouse offspring. Journal of neuroscience research 92:658–670.

Klengel T, Dias BG, Ressler KJ (2016) Models of Intergenerational and Transgenerational Transmission of Risk for Psychopathology in Mice. Neuropsychopharmacology 41:219–231.

Koch M (1999) The neurobiology of startle. Progress in neurobiology 59:107–128.

Koch M, Ebert U (1993) Enhancement of the acoustic startle response by stimulation of an excitatory pathway from the central amygdala/basal nucleus of Meynert to the pontine reticular formation. Experimental brain research 93:231–241.

Koob GF, Le Moal M (2001) Drug addiction, dysregulation of reward, and allostasis. Neuropsychopharmacology 24:97–129.

Koob GF, Volkow ND (2009a) Neurocircuitry of Addiction. Neuropsychopharmacology 35:217– 238.

Koob GF, Volkow ND (2009b) Neurocircuitry of Addiction. Neuropsychopharmacology 35:217– 238 Available at: http://www.nature.com/doifinder/10.1038/npp.2009.110.

Kornberg RD, Lorch Y (1999) Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 98:285–294.

Kouzarides T (2002) Histone methylation in transcriptional control. Current Opinion in Genetics & Development 12:198–209.

Kumar P, Meizel S (2005) Nicotinic acetylcholine receptor subunits and associated proteins in human sperm. The Journal of biological chemistry 280:25928–25935.

Lake H, Pridmore S (2014) Epigenetics, Mental Health and Transgenerational Epigenetic Effects. Malaysian Journal of Psychiatry.

Laland K, Uller T, Feldman M, Sterelny K, Müller GB, Moczek A, Jablonka E, Odling-Smee J, Wray GA, Hoekstra HE, Futuyma DJ, Lenski RE, Mackay TFC, Schluter D, Strassmann JE (2014) Does evolutionary theory need a rethink? - PubMed - NCBI. Nature 514:161–164.

191

Lambers DS, Clark KE (1996) The maternal and fetal physiologic effects of nicotine. Seminars in perinatology 20:115–126.

Lane N, Dean W, Erhardt S, Hajkova P, Surani A, Walter J, Reik W (2003) Resistance of IAPs to methylation reprogramming may provide a mechanism for epigenetic inheritance in the mouse. Genesis 35:88–93.

Lerman C, Berrettini W (2003) Elucidating the role of genetic factors in smoking behavior and nicotine dependence. American journal of medical genetics Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 118B:48–54.

Leshem M, Schulkin J (2012) Transgenerational effects of infantile adversity and enrichment in male and female rats. Developmental psychobiology 54:169–186.

Levine A, Huang Y, Drisaldi B, Griffin EA, Pollak DD, Xu S, Yin D, Schaffran C, Kandel DB, Kandel ER (2011) Molecular mechanism for a gateway drug: epigenetic changes initiated by nicotine prime gene expression by cocaine. Science translational medicine 3:107ra109.

Lewis JD, Meehan RR, Henzel WJ, Maurer-Fogy I, Jeppesen P, Klein F, Bird A (1992) Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell 69:905–914.

Li Y, Li M, Liu Y, Song G, Liu N (2012) A microarray for microRNA profiling in spermatozoa from adult men living in an environmentally polluted site. Bulletin of environmental contamination and toxicology 89:1111–1114.

Liang KC, Melia KR, Miserendino MJ, Falls WA, Campeau S, Davis M (1992) Corticotropin- releasing factor: long-lasting facilitation of the acoustic startle reflex. The Journal of Neuroscience 12:2303–2312.

Liebers R, Rassoulzadegan M, Lyko F (2014) Epigenetic regulation by heritable RNA. PLoS genetics 10:e1004296.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif) 25:402–408.

Lu X-Y (2007) The leptin hypothesis of depression: a potential link between mood disorders and obesity? Current opinion in pharmacology 7:648–652.

Lu X-Y, Kim CS, Frazer A, Zhang W (2006) Leptin: a potential novel antidepressant. Proceedings of the National Academy of Sciences 103:1593–1598.

Lupien SJ, McEwen BS, Gunnar MR, Heim C (2009) Effects of stress throughout the lifespan on the brain, behaviour and cognition. Nature reviews neuroscience 10:434–445.

Mailhes JB, Young D, Caldito G, London SN (2000) Sensitivity of mouse oocytes to nicotine- induced perturbations during oocyte meiotic maturation and aneuploidy in vivo and in vitro. Molecular human reproduction 6:232–237.

192

Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner MK (2013) Plastics derived endocrine disruptors (BPA, DEHP and DBP) induce epigenetic transgenerational inheritance of obesity, reproductive disease and sperm epimutations. PloS one 8:e55387.

Mansour A, Fox CA, Akil H, Watson SJ (1995) Opioid-receptor mRNA expression in the rat CNS: anatomical and functional implications. Trends in Neurosciences 18:22–29.

Mao D, McGehee DS (2010) Nicotine and behavioral sensitization. Journal of Molecular Neuroscience 40:154–163.

Marczylo EL, Amoako AA, Konje JC, Gant TW, Marczylo TH (2012) Smoking induces differential miRNA expression in human spermatozoa: a potential transgenerational epigenetic concern? Epigenetics 7:432–439.

Marks MJ, Pauly JR, Gross SD, Deneris ES, Hermans-Borgmeyer I, Heinemann SF, Collins AC (1992) Nicotine binding and nicotinic receptor subunit RNA after chronic nicotine treatment. The Journal of Neuroscience 12:2765–2784.

Marsit CJ (2015) Influence of environmental exposure on human epigenetic regulation. Journal of Experimental Biology 218:71–79.

Maslova LN, Bulygina VV, Markel AL (2002) Chronic stress during prepubertal development: immediate and long-lasting effects on arterial blood pressure and anxiety-related behavior. Psychoneuroendocrinology 27:549–561.

Matthews SG, Phillips DI (2012) Transgenerational inheritance of stress pathology. Experimental Neurology 233:95–101.

Maurice T, Duclot F, Meunier J, Naert G, Givalois L, Meffre J, Célérier A, Jacquet C, Copois V, Mechti N, Ozato K, Gongora C (2008) Altered memory capacities and response to stress in p300/CBP-associated factor (PCAF) histone acetylase knockout mice. Neuropsychopharmacology 33:1584–1602.

Maze I, Covington HE, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ (2010) Essential role of the histone methyltransferase G9a in cocaine-induced plasticity. Science 327:213–216.

McCauley J, Kern DE, Kolodner K, Dill L, Schroeder AF, DeChant HK, Ryden J, Derogatis LR, Bass EB (1997) Clinical characteristics of women with a history of childhood abuse: unhealed wounds. Jama 277:1362–1368.

McCormick CM, Robarts D, Gleason E, Kelsey JE (2004) Stress during adolescence enhances locomotor sensitization to nicotine in adulthood in female, but not male, rats. Hormones and behavior 46:458–466.

McCormick CM, Smith C, Mathews IZ (2008) Effects of chronic social stress in adolescence on anxiety and neuroendocrine response to mild stress in male and female rats. Behavioural brain research 187:228–238. 193

McEwen BS (1998) Protective and Damaging Effects of Stress Mediators. The New England journal of medicine 338:171–179.

McEwen BS (2007) Physiology and neurobiology of stress and adaptation: central role of the brain. Physiological reviews 87:873–904.

McEwen BS, Bowles NP, Gray JD, Hill MN, Hunter RG, Karatsoreos IN, Nasca C (2015) Mechanisms of stress in the brain. Nature neuroscience 18:1353–1363.

McEwen BS, Stellar E (1993) Stress and the individual. Mechanisms leading to disease. Archives of internal medicine 153:2093–2101.

McEwen BS, Wingfield JC (2003) The concept of allostasis in biology and biomedicine. Hormones and behavior 43:2–15.

McLaughlin JP, Li S, Valdez J, Chavkin TA, Chavkin C (2006) Social defeat stress-induced behavioral responses are mediated by the endogenous kappa opioid system. Neuropsychopharmacology 31:1241–1248.

Meaney MJ, Diorio J, Francis D, Widdowson J, LaPlante P, Caldji C, Sharma S, Seckl JR, Plotsky PM (1996) Early Environmental Regulation of Forebrain Glucocorticoid Receptor Gene Expression: Implications for Adrenocortical Responses to Stress; pp. 61–72.

Menard J, Champagne D, Meaney MJ (2004) Maternal care alters behavioral and neural activity patterns in the defensive burying paradigm. Neuroscience 129:297-308.

Menzaghi F, Heinrichs SC, Pich EM (1993) The Role of Limbic and Hypothalamic Corticotropin-Releasing Factor in Behavioral Responses to Stress. Ann N Y Acad Sci 697:142- 154.

Mereu G, Yoon KW, Boi V, Gessa GL, Naes L, Westfall TC (1987) Preferential stimulation of ventral tegmental area dopaminergic neurons by nicotine. European Journal of Pharmacology 141:395–399.

Milagro FI, Campión J, García-Díaz DF, Goyenechea E, Paternain L, Martínez JA (2009) High fat diet-induced obesity modifies the methylation pattern of leptin promoter in rats. Journal of physiology and biochemistry 65:1–9.

Milekic MH, Xin Y, O’Donnell A, Kumar KK, Bradley-Moore M, Malaspina D, Moore H, Brunner D, Ge Y, Edwards J, Paul S, Haghighi FG, Gingrich JA (2015) Age-related sperm DNA methylation changes are transmitted to offspring and associated with abnormal behavior and dysregulated gene expression. Molecular Psychiatry 20:995–1001.

Mill J, Petronis A (2008) Pre‐ and peri‐natal environmental risks for attention‐deficit hyperactivity disorder (ADHD): the potential role of epigenetic processes in mediating susceptibility. Journal of Child Psychology and Psychiatry 49:1020–1030.

194

Moffitt TE, Caspi A, Harrington H, Milne BJ, Melchior M, Goldberg D, Poulton R (2007) Generalized anxiety disorder and depression: childhood risk factors in a birth cohort followed to age 32. Psychological medicine 37:441–452.

Mohammad F, Pandey GK, Mondal T, Enroth S, Redrup L, Gyllensten U, Kanduri C (2012) Long noncoding RNA-mediated maintenance of DNA methylation and transcriptional gene silencing. Development (Cambridge, England) 139:2792–2803.

Monteiro S, Roque S, de Sá-Calçada D, Sousa N, Correia-Neves M, Cerqueira JJ (2015) An efficient chronic unpredictable stress protocol to induce stress-related responses in C57BL/6 mice. Frontiers in psychiatry 6:6.

Moreau JL, Jenck F, Martin JR, Mortas P, Haefely WE (1992) Antidepressant treatment prevents chronic unpredictable mild stress-induced anhedonia as assessed by ventral tegmentum self- stimulation behavior in rats. European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology 2:43–49.

Morgan CA, Southwick SM, Grillon C, Davis M, Krystal JH, Charney DS (1993) Yohimbine- facilitated acoustic startle reflex in humans. Psychopharmacology 110:342–346.

Morgan CP, Bale TL (2011) Early prenatal stress epigenetically programs dysmasculinization in second-generation offspring via the paternal lineage. The Journal of Neuroscience 31:11748– 11755.

Mousseau TA, Fox CW (1998) The adaptive significance of maternal effects. Trends in ecology & evolution 13:403–407.

Mueller BR, Bale TL (2008) Sex-Specific Programming of Offspring Emotionality after Stress Early in Pregnancy. The Journal of Neuroscience 28:9055–9065.

Muramatsu Y, Sugino N, Suzuki T, Totsune K, Takahashi K, Tashiro A, Hongo M, Oki Y, Sasano H (2001) Urocortin and corticotropin-releasing factor receptor expression in normal cycling human ovaries. The Journal of clinical endocrinology and metabolism 86:1362–1369.

Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, Gerstein M, Snyder M (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320:1344– 1349.

Nappi RE, Rivest S (1995) Stress-induced genetic expression of a selective corticotropin- releasing factor-receptor subtype within the rat ovaries: an effect dependent on the ovulatory cycle. Biology of reproduction 53:1417–1428.

Neigh GN, Gillespie CF, Nemeroff CB (2009) The neurobiological toll of child abuse and neglect. Trauma, violence & abuse 10:389–410.

Nestler EJ (2001) Molecular basis of long-term plasticity underlying addiction. Nature reviews neuroscience 2:119–128.

195

Ng S-F, Lin RCY, Laybutt DR, Barres R, Owens JA, Morris MJ (2010) Chronic high-fat diet in fathers programs β-cell dysfunction in female rat offspring. Nature 467:963–966.

Ng TK, Carballosa CM, Pelaez D, Wong HK, Choy KW, Pang CP, Cheung HS (2013) Nicotine alters MicroRNA expression and hinders human adult stem cell regenerative potential. Stem cells and development 22:781–790.

Nielsen DA, Utrankar A, Reyes JA, Simons DD, Kosten TR (2012) Epigenetics of drug abuse: predisposition or response. Pharmacogenomics 13:1149–1160.

Nielsen DA, Yuferov V, Hamon S, Jackson C, Ho A, Ott J, Kreek MJ (2008) Increased OPRM1 DNA Methylation in Lymphocytes of Methadone-Maintained Former Heroin Addicts. Neuropsychopharmacology 34:867–873.

Niknazar S, Nahavandi A, Najafi R, Danialy S, Zare Mehrjerdi F, Karimi M (2013) Parents’ adulthood stress induces behavioral and hormonal alterations in male rat offspring. Behavioural brain research 252:136–143.

Nikolova YS, Koenen KC, Galea S, Wang C-M, Seney ML, Sibille E, Williamson DE, Hariri AR (2014) Beyond genotype: serotonin transporter epigenetic modification predicts human brain function. Nature neuroscience 17:1153–1155.

Njung’e K, Handley SL (1991) Evaluation of marble-burying behavior as a model of anxiety. Pharmacology Biochemistry and Behavior 38:63–67.

Novak G, Fan T, O’Dowd BF, George SR (2013) Postnatal maternal deprivation and pubertal stress have additive effects on dopamine D2 receptor and CaMKII beta expression in the striatum. International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience 31:189–195.

Nyman E, Miettunen J, Freimer N, Joukamaa M, Mäki P, Ekelund J, Peltonen L, Järvelin M-R, Veijola J, Paunio T (2011) Impact of temperament on depression and anxiety symptoms and depressive disorder in a population-based birth cohort. Journal of affective disorders 131:393– 397.

Omotoso GO, Ibitolu JO, Femi-Akinlosotu OM, Akinola OB, Enaibe BU (2013) Morphological and neurohistological changes in adolescent rats administered with nicotine during intrauterine life. Nigerian journal of physiological sciences : official publication of the Physiological Society of Nigeria 28:147–151.

Orozco LD, Rubbi L, Martin LJ, Fang F, Hormozdiari F, Che N, Smith AD, Lusis AJ, Pellegrini M (2014) Intergenerational genomic DNA methylation patterns in mouse hybrid strains. Genome Biology 15:R68.

Pacchierotti F, Spanò M (2015) Environmental Impact on DNA Methylation in the Germline: State of the Art and Gaps of Knowledge. BioMed research international 2015:123484.

Palacios-García I, Lara-Vásquez A, Montiel JF, Díaz-Véliz GF, Sepúlveda H, Utreras E, Montecino M, González-Billault C, Aboitiz F (2015) Prenatal stress down-regulates Reelin 196 expression by methylation of its promoter and induces adult behavioral impairments in rats. PloS one 10:e0117680.

Pelcovitz D, Kaplan S, Goldenberg B, Mandel F, Lehane J, Guarrera J (1994) Post-traumatic stress disorder in physically abused adolescents. Journal of the American Academy of Child and Adolescent Psychiatry 33:305–312.

Pembrey ME (2010) Male-line transgenerational responses in humans. Human fertility (Cambridge, England) 13:268–271.

Pembrey ME, Bygren LO, Kaati G, Edvinsson S, Northstone K, Sjöström M, Golding J, ALSPAC Study Team (2006) Sex-specific, male-line transgenerational responses in humans. European journal of human genetics : EJHG 14:159–166.

Perroud N, Salzmann A, Prada P, Nicastro R, Hoeppli ME, Furrer S, Ardu S, Krejci I, Karege F, Malafosse A (2013) Response to psychotherapy in borderline personality disorder and methylation status of the BDNF gene. Translational psychiatry 3:e207.

Petronis A (2003) Epigenetics and bipolar disorder: New opportunities and challenges. American Journal of Medical Genetics Part C: Seminars in Medical Genetics 123C:65–75.

Petropoulos S, Matthews SG, Szyf M (2014) Adult glucocorticoid exposure leads to transcriptional and DNA methylation changes in nuclear steroid receptors in the hippocampus and kidney of mouse male offspring. Biology of reproduction 90:43.

Philibert RA, Beach SRH, Gunter TD, Brody GH, Madan A, Gerrard M (2010) The effect of smoking on MAOA promoter methylation in DNA prepared from lymphoblasts and whole blood. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 153B:619–628.

Philibert RA, Gunter TD, Beach SRH, Brody GH, Madan A (2008) MAOA methylation is associated with nicotine and alcohol dependence in women. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 147B:565–570.

Picciotto MR, Brunzell DH, Caldarone BJ (2002) Effect of nicotine and nicotinic receptors on anxiety and depression. Neuroreport 13:1097–1106.

Picciotto MR, Caldarone BJ, King SL, Zachariou V (2000) Nicotinic Receptors in the Brain: Links between Molecular Biology and Behavior. Neuropsychopharmacology 22:451–465.

Pierce RC, Kalivas PW (1997) A circuitry model of the expression of behavioral sensitization to amphetamine-like psychostimulants. Brain research Brain research reviews 25:192–216.

Plotsky PM, Thrivikraman KV, Nemeroff CB, Caldji C, Sharma S, Meaney MJ (2005) Long- term consequences of neonatal rearing on central corticotropin-releasing factor systems in adult male rat offspring. Neuropsychopharmacology 30:2192–2204.

Pothion S, Bizot J-C, Trovero F, Belzung C (2004) Strain differences in sucrose preference and in the consequences of unpredictable chronic mild stress. Behavioural brain research 155:135–146.

197

Radford EJ, Ito M, Shi H, Corish JA, Yamazawa K, Isganaitis E, Seisenberger S, Hore TA, Reik W, Erkek S, Peters AHFM, Patti M-E, Ferguson-Smith AC (2014) In utero effects. In utero undernourishment perturbs the adult sperm methylome and intergenerational metabolism. Science 345:1255903.

Rahman Z, Schwarz J, Gold SJ, Zachariou V, Wein MN, Choi K-H, Kovoor A, Chen CK, DiLeone RJ, Schwarz SC, Selley DE, Sim-Selley LJ, Barrot M, Luedtke RR, Self D, Neve RL, Lester HA, Simon MI, Nestler EJ (2003) RGS9 modulates dopamine signaling in the basal ganglia. Neuron 38:941–952.

Rainnie DG, Bergeron R, Sajdyk TJ, Patil M, Gehlert DR, Shekhar A (2004) Corticotrophin Releasing Factor-Induced Synaptic Plasticity in the Amygdala Translates Stress into Emotional Disorders. The Journal of Neuroscience 24:3471–3479.

Rampp C, Binder EB, Provençal N (2014) Epigenetics in posttraumatic stress disorder. Progress in molecular biology and translational science 128:29–50.

Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I, Cuzin F (2006) RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441:469–474.

Ratcliffe JM, Gladen BC, Wilcox AJ, Herbst AL (1992) Does early exposure to maternal smoking affect future fertility in adult males? Reproductive toxicology 6:297–307.

Rattazzi L, Piras G, Ono M, Deacon R, Pariante CM, D’Acquisto F (2013) CD4+ but not CD8+ T cells revert the impaired emotional behavior of immunocompromised RAG-1-deficient mice. Translational psychiatry 3:e280.

Razin A, Riggs AD (1980) DNA methylation and gene function. Science 210:604–610.

Rehan VK, Liu J, Naeem E, Tian J, Sakurai R, Kwong K, Akbari O, Torday JS (2012) Perinatal nicotine exposure induces asthma in second generation offspring. BMC medicine 10:129.

Reid MS, Ho LB, Berger SP (1996) Effects of environmental conditioning on the development of nicotine sensitization: behavioral and neurochemical analysis. Psychopharmacology 126:301– 310.

Reul J (2002) Corticotropin-releasing factor receptors 1 and 2 in anxiety and depression. Current opinion in pharmacology 2:23–33.

Richards EJ (2006) Inherited epigenetic variation--revisiting soft inheritance. Nature Reviews Genetics 7:395–401.

Rikhye K, Tyrka AR, Kelly MM, Gagne GG, Mello AF, Mello MF, Price LH, Carpenter LL (2008) Interplay between childhood maltreatment, parental bonding, and gender effects: impact on quality of life. Child abuse & neglect 32:19–34.

Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics (Oxford, England) 26:139– 140. 198

Robinson TE, Becker JB (1986) Enduring changes in brain and behavior produced by chronic amphetamine administration: a review and evaluation of animal models of amphetamine psychosis. Brain Research 396:157–198.

Robinson TE, Berridge KC (1993) The neural basis of drug craving: an incentive-sensitization theory of addiction. Brain research Brain research reviews 18:247–291.

Rodgers AB, Bale TL (2015) Germ cell origins of PTSD risk: the transgenerational impact of parental stress experience. Biological Psychiatry 77:653–660.

Rodgers AB, Morgan CP, Bronson SL, Revello S, Bale TL (2013) Paternal stress exposure alters sperm microRNA content and reprograms offspring HPA stress axis regulation. The Journal of Neuroscience 33:9003–9012.

Rodgers AB, Morgan CP, Leu NA, Bale TL (2015) Transgenerational epigenetic programming via sperm microRNA recapitulates effects of paternal stress. Proceedings of the National Academy of Sciences of the United States of America 112:13699–13704.

Rodrigues SM, LeDoux JE, Sapolsky RM (2009) The influence of stress hormones on fear circuitry. Annual review of neuroscience 32:289–313.

Romano E, Fuso A, Laviola G (2013) Nicotine restores Wt-like levels of reelin and GAD67 gene expression in brain of heterozygous reeler mice. Neurotoxicity research 24:205–215.

Roth TL, Lubin FD, Funk AJ, Sweatt JD (2009) Lasting epigenetic influence of early-life adversity on the BDNF gene. Biological Psychiatry 65:760–769.

Roux F, Colomé-Tatché M, Edelist C, Wardenaar R, Guerche P, Hospital F, Colot V, Jansen RC, Johannes F (2011) Genome-wide epigenetic perturbation jump-starts patterns of heritable variation found in nature. Genetics 188:1015–1017.

Russo VC, Gluckman PD, Feldman EL, Werther GA (2011) The Insulin-Like Growth Factor System and Its Pleiotropic Functions in Brain. Endocrine reviews 26:916–943.

Saavedra-Rodríguez L, Feig LA (2013) Chronic social instability induces anxiety and defective social interactions across generations. Biological Psychiatry 73:44–53.

Sadakierska-Chudy A, Filip M (2015) A comprehensive view of the epigenetic landscape. Part II: Histone post-translational modification, nucleosome level, and chromatin regulation by ncRNAs. Neurotoxicity research 27:172–197.

Sadakierska-Chudy A, Kostrzewa RM, Filip M (2015) A comprehensive view of the epigenetic landscape part I: DNA methylation, passive and active DNA demethylation pathways and histone variants. Neurotoxicity research 27:84–97.

Sadri-Vakili G, Kumaresan V, Schmidt HD, Famous KR, Chawla P, Vassoler FM, Overland RP, Xia E, Bass CE, Terwilliger EF, Pierce RC, Cha J-HJ (2010) Cocaine-induced chromatin remodeling increases brain-derived neurotrophic factor transcription in the rat medial prefrontal

199 cortex, which alters the reinforcing efficacy of cocaine. The Journal of Neuroscience 30:11735– 11744.

Satta R, Maloku E, Zhubi A, Pibiri F, Hajos M, Costa E, Guidotti A (2008) Nicotine decreases DNA methyltransferase 1 expression and glutamic acid decarboxylase 67 promoter methylation in GABAergic interneurons. Proceedings of the National Academy of Sciences of the United States of America 105:16356–16361.

Schindler CW, Carmona GN (2002) Effects of dopamine agonists and antagonists on locomotor activity in male and female rats. Pharmacology Biochemistry and Behavior 72:857–863.

Schmidt HD, Duman RS (2010) Peripheral BDNF produces antidepressant-like effects in cellular and behavioral models. Neuropsychopharmacology 35:2378–2391.

Schmidt MV, Scharf SH, Sterlemann V, Ganea K, Liebl C, Holsboer F, Müller MB (2010) High susceptibility to chronic social stress is associated with a depression-like phenotype. Psychoneuroendocrinology 35:635–643.

Schoenborn CA, Gindi RM (2015) Electronic Cigarette Use Among Adults: United States, 2014. NCHS data brief:1–8.

Selit I, Basha M, Maraee A, El-Naby SH, Nazeef N, El-Mehrath R, Mostafa T (2013) Sperm DNA and RNA abnormalities in fertile and oligoasthenoteratozoospermic smokers. Andrologia 45:35–39.

Servatius RJ, Ottenweller JE, Bergen MT, Soldan S, Natelson BH (1994) Persistent stress- induced sensitization of adrenocortical and startle responses. Physiology & behavior 56:945–954.

Shepherd JK, Grewal SS, Fletcher A, Bill DJ, Dourish CT (1994) Behavioural and pharmacological characterisation of the elevated ‘zero-maze’ as an animal model of anxiety. Psychopharmacology 116:56–64.

Shiffman S (1986) A cluster-analytic classification of smoking relapse episodes. Addictive Behaviors 11:295–307.

Silva EJR, Queiróz DBC, Rodrigues A, Honda L, Avellar MCW (2011) Innate immunity and glucocorticoids: potential regulatory mechanisms in epididymal biology. Journal of andrology 32:614–624.

Sipos ML, Bauman RA, Widholm JJ, Kant GJ (2000) Behavioral Effects Of 8-OH-DPAT in Chronically Stressed Male and Female Rats. Pharmacology Biochemistry and Behavior 66:403– 411.

Skinner MK (2008) What is an epigenetic transgenerational phenotype? Reproductive toxicology 25:2–6.

Skinner MK (2011) Environmental epigenetic transgenerational inheritance and somatic epigenetic mitotic stability. Epigenetics 6:838–842. 200

Skinner MK (2014) Environmental stress and epigenetic transgenerational inheritance. BMC medicine 12:153.

Skinner MK (2015) Environmental Epigenetics and a Unified Theory of the Molecular Aspects of Evolution: A Neo-Lamarckian Concept that Facilitates Neo-Darwinian Evolution. Genome biology and evolution 7:1296–1302.

Skinner MK, Guerrero-Bosagna C (2009) Environmental signals and transgenerational epigenetics. Epigenomics 1:111-117.

Smallwood SA, Kelsey G (2012) De novo DNA methylation: a germ cell perspective. Trends in genetics : TIG 28:33–42.

Smith JS, Schindler AG, Martinelli E, Gustin RM, Bruchas MR, Chavkin C (2012) Stress- induced activation of the dynorphin/κ-opioid receptor system in the amygdala potentiates nicotine conditioned place preference. The Journal of Neuroscience 32:1488–1495.

Spear LP (2000) The adolescent brain and age-related behavioral manifestations. Neuroscience and biobehavioral reviews 24:417–463.

Speybroeck L (2006) From Epigenesis to Epigenetics. Annals of the New York Academy of Sciences 981:61–81.

Starkman BG, Sakharkar AJ, Pandey SC (2012) Epigenetics-beyond the genome in alcoholism. Alcohol research : current reviews 34:293–305.

Steimer T (2011) Animal models of anxiety disorders in rats and mice: some conceptual issues. Dialogues in clinical neuroscience 13:495–506.

Steketee JD, Kalivas PW (2011) Drug Wanting: Behavioral Sensitization and Relapse to Drug- Seeking Behavior. Pharmacological Reviews 63:348–365.

Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403:41–45.

Strekalova T, Couch Y, Kholod N, Boyks M, Malin D, Leprince P, Steinbusch HM (2011) Update in the methodology of the chronic stress paradigm: internal control matters. Behavioral and brain functions : BBF 7:9.

Strekalova T, Spanagel R, Bartsch D, Henn FA, Gass P (2004) Stress-induced anhedonia in mice is associated with deficits in forced swimming and exploration. Neuropsychopharmacology 29:2007–2017.

Stuwe E, Tóth KF, Aravin AA (2014) Small but sturdy: small RNAs in cellular memory and epigenetics. Genes & Development 28:423–431.

Swerdlow NR, Geyer MA, Vale WW, Koob GF (1986) Corticotropin-releasing factor potentiates acoustic startle in rats: blockade by chlordiazepoxide. Psychopharmacology 88:147–152.

201

Szutorisz H, DiNieri JA, Sweet E, Egervari G, Michaelides M, Carter JM, Ren Y, Miller ML, Blitzer RD, Hurd YL (2014) Parental THC exposure leads to compulsive heroin-seeking and altered striatal synaptic plasticity in the subsequent generation. Neuropsychopharmacology 39:1315–1323.

Szyf M (2015) Nongenetic inheritance and transgenerational epigenetics. Trends in molecular medicine 21:134–144.

Takahashi K, Yokota S-I, Tatsumi N, Fukami T, Yokoi T, Nakajima M (2013) Cigarette smoking substantially alters plasma microRNA profiles in healthy subjects. Toxicology and applied pharmacology 272:154–160.

Tambuyzer BR, Ponsaerts P, Nouwen EJ (2009) Microglia: gatekeepers of central nervous system immunology. Journal of Leukocyte Biology 85:352–370.

Tang F, Kaneda M, O’Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA (2007) Maternal microRNAs are essential for mouse zygotic development. Genes & Development 21:644–648.

Tapper AR, McKinney SL, Nashmi R, Schwarz J, Deshpande P, Labarca C, Whiteaker P, Marks MJ, Collins AC, Lester HA (2004) Nicotine Activation of α4* Receptors: Sufficient for Reward, Tolerance, and Sensitization. Science 306:1029–1032.

Teicher MH, Andersen SL, Hostetter JC (1995) Evidence for dopamine receptor pruning between adolescence and adulthood in striatum but not nucleus accumbens. Brain research Developmental brain research 89:167–172.

Toledo Rodriguez M, Lotfipour S, Leonard G, Perron M, Richer L, Veillette S, Pausova Z, Paus T (2010) Maternal smoking during pregnancy is associated with epigenetic modifications of the brain‐derived neurotrophic factor‐6 exon in adolescent offspring. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 153B:1350–1354.

Tsoory M, Cohen H, Richter-Levin G (2007) Juvenile stress induces a predisposition to either anxiety or depressive-like symptoms following stress in adulthood. European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology 17:245–256.

Turner RJ, Lloyd DA (2004) Stress burden and the lifetime incidence of psychiatric disorder in young adults: racial and ethnic contrasts. Archives of General Psychiatry 61:481–488.

Tweedie-Cullen RY, Reck JM, Mansuy IM (2009) Comprehensive mapping of post-translational modifications on synaptic, nuclear, and histone proteins in the adult mouse brain. Journal of proteome research 8:4966–4982.

Uller T (2008) Developmental plasticity and the evolution of parental effects. Trends in ecology & evolution 23:432–438.

202

Vanderschuren LJMJ, Kalivas PW (2000) Alterations in dopaminergic and glutamatergic transmission in the induction and expression of behavioral sensitization: a critical review of preclinical studies. Psychopharmacology 151:99–120.

Vassoler FM, Johnson NL, Byrnes EM (2013a) Female adolescent exposure to cannabinoids causes transgenerational effects on morphine sensitization in female offspring in the absence of in utero exposure. Journal of psychopharmacology (Oxford, England) 27:1015–1022.

Vassoler FM, White SL, Schmidt HD, Sadri-Vakili G, Pierce RC (2013b) Epigenetic inheritance of a cocaine-resistance phenotype. Nature neuroscience 16:42–47..

Veenendaal MVE, Painter RC, de Rooij SR, Bossuyt PMM, van der Post JAM, Gluckman PD, Hanson MA, Roseboom TJ (2013) Transgenerational effects of prenatal exposure to the 1944-45 Dutch famine. BJOG : an international journal of obstetrics and gynaecology 120:548–553.

Verma M, Rogers S, Divi RL, Schully SD, Nelson S, Joseph Su L, Ross SA, Pilch S, Winn DM, Khoury MJ (2014) Epigenetic research in cancer epidemiology: trends, opportunities, and challenges. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 23:223–233.

Volk N, Paul ED, Haramati S, Eitan C, Fields BKK, Zwang R, Gil S, Lowry CA, Chen A (2014) MicroRNA-19b associates with Ago2 in the amygdala following chronic stress and regulates the adrenergic receptor beta 1. The Journal of Neuroscience 34:15070–15082.

Wahlsten D (2010) Mouse Behavioral Testing :304.

Walf AA, Paris JJ, Frye CA (2009) Chronic estradiol replacement to aged female rats reduces anxiety-like and depression-like behavior and enhances cognitive performance. Psychoneuroendocrinology 34:909–916.

Walker DL, Davis M (1997) Anxiogenic effects of high illumination levels assessed with the acoustic startle response in rats. BPS 42:461–471.

Wang X, Gao W, Ma X, Wang X, Song C, Huang X, Liu H (2014) Dot1L mediated histone H3 lysine79 methylation is essential to meiosis progression in mouse oocytes. Neuro endocrinology letters 35:523–530.

Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nature Reviews Genetics 10:57–63.

Weaver ICG, Cervoni N, Champagne FA, D’Alessio AC, Sharma S, Seckl JR, Dymov S, Szyf M, Meaney MJ (2004) Epigenetic programming by maternal behavior. Nature neuroscience 7:847– 854.

Weiss IC, Franklin TB, Vizi S, Mansuy IM (2011) Inheritable Effect of Unpredictable Maternal Separation on Behavioral Responses in Mice. Frontiers in Behavioral Neuroscience 5:3.

203

Whitaker-Azmitia PM (1991) Role of serotonin and other neurotransmitter receptors in brain development: basis for developmental pharmacology. Pharmacological Reviews 43:553–561.

Wiersma A, Baauw AD, Bohus B, Koolhaas JM (1995) Behavioural activation produced by CRH but not alpha-helical CRH (CRH-receptor antagonist) when microinfused into the central nucleus of the amygdala under stress-free conditions. Psychoneuroendocrinology 20:423–432.

Willner P, Towell A, Sampson D, Sophokleous S, Muscat R (1987) Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology 93:358–364.

Wu L, Lu Y, Jiao Y, Liu B, Li S, Li Y, Xing F, Chen D, Liu X, Zhao J, Xiong X, Gu Y, Lu J, Chen X, Li X (2016) Paternal Psychological Stress Reprograms Hepatic Gluconeogenesis in Offspring. Cell metabolism 23:735–743.

Wu X-F, Yuan H-J, Li H, Gong S, Lin J, Miao Y-L, Wang T-Y, Tan J-H (2015) Restraint stress on female mice diminishes the developmental potential of oocytes: roles of chromatin configuration and histone modification in germinal vesicle stage oocytes. Biology of reproduction 92:13.

Wu YQ, Lin X, Liu CM, Jamrich M, Shaffer LG (2001) Identification of a human brain-specific gene, calneuron 1, a new member of the calmodulin superfamily. Molecular genetics and metabolism 72:343–350.

Wykes SM, Krawetz SA (2003) The structural organization of sperm chromatin. The Journal of biological chemistry 278:29471–29477.

Yehuda R, Bell A, Bierer LM, Schmeidler J (2008) Maternal, not paternal, PTSD is related to increased risk for PTSD in offspring of Holocaust survivors. Journal of Psychiatric Research 42:1104–1111.

Yehuda R, Daskalakis NP, Lehrner A, Desarnaud F, Bader HN, Makotkine I, Flory JD, Bierer LM, Meaney MJ (2014) Influences of maternal and paternal PTSD on epigenetic regulation of the glucocorticoid receptor gene in Holocaust survivor offspring. American Journal of Psychiatry 171:872–880.

Yehuda R, Schmeidler J, Wainberg M, Binder-Brynes K, Duvdevani T (1998) Vulnerability to posttraumatic stress disorder in adult offspring of Holocaust survivors. American Journal of Psychiatry 155:1163–1171.

Yochum C, Doherty-Lyon S, Hoffman C, Hossain MM, Zelikoff JT, Richardson JR (2014) Prenatal cigarette smoke exposure causes hyperactivity and aggressive behavior: Role of altered catecholamines and BDNF. Experimental Neurology 254:145–152.

Yohn NL, Bartolomei MS, Blendy JA (2015) Multigenerational and transgenerational inheritance of drug exposure: The effects of alcohol, opiates, cocaine, marijuana, and nicotine. Progress in biophysics and molecular biology 118:21-33.

204

Youngson NA, Whitelaw E (2008) Transgenerational epigenetic effects. Annual review of genomics and human genetics 9:233–257.

Yu B, Qi Y, Liu D, Gao X, Chen H, Bai C, Huang Z (2014) Cigarette smoking is associated with abnormal histone-to-protamine transition in human sperm. Fertility and Sterility 101:51–57.

Zachariou V, Georgescu D, Sanchez N, Rahman Z, DiLeone R, Berton O, Neve RL, Sim-Selley LJ, Selley DE, Gold SJ, Nestler EJ (2003) Essential role for RGS9 in opiate action. Proceedings of the National Academy of Sciences 100:13656–13661.

Zaidan H, Leshem M, Gaisler-Salomon I (2013) Prereproductive stress to female rats alters corticotropin releasing factor type 1 expression in ova and behavior and brain corticotropin releasing factor type 1 expression in offspring. Biological Psychiatry 74:680–687.

Zhu J, Lee KP, Spencer TJ, Biederman J, Bhide PG (2014) Transgenerational Transmission of Hyperactivity in a Mouse Model of ADHD. The Journal of Neuroscience 34:2768–2773.

Zhu J, Zhang X, Xu Y, Spencer TJ, Biederman J, Bhide PG (2012) Prenatal nicotine exposure mouse model showing hyperactivity, reduced cingulate cortex volume, reduced dopamine turnover, and responsiveness to oral methylphenidate treatment. The Journal of Neuroscience 32:9410–9418.

Zhu PJ, Stewart RR, McIntosh JM, Weight FF (2005) Activation of Nicotinic Acetylcholine Receptors Increases the Frequency of Spontaneous GABAergic IPSCs in Rat Basolateral Amygdala Neurons. Journal of Neurophysiology 94:3081–3091.

205