КАРАНТИН РАСТЕНИЙ СЕНТЯБРЬ НАУКА И ПРАКТИКА 3/25/2018 РУССКО-АНГЛИЙСКИЙ ЖУРНАЛ

ВОЗБУДИТЕЛЬ ПРОЛИФЕРАЦИИ ЯБЛОНИ CANDIDATUS PHYTOPLASMA MALI стр. 4 ФИТОСАНИТАРНЫЙ РИСК РАСТИТЕЛЬНОЯДНЫХ КЛЕЩЕЙ (ARACHNIDA: ACARIFORMES) стр. 13 ИДЕНТИФИКАЦИЯ ВОЗБУДИТЕЛЯ РАКА КАРТОФЕЛЯ SYNCHYTRIUM ENDOBIOTICUM С ПРИМЕНЕНИЕМ МОЛЕКУЛЯРНЫХ МЕТОДОВ ДИАГНОСТИКИ стр. 27 ДИАГНОСТИКА НЕПОВИРУСА КОЛЬЦЕВОЙ ПЯТНИСТОСТИ ТОМАТА (ToRSV) МЕТОДОМ КЛАССИЧЕСКОЙ ПЦР стр. 41

CANDIDATUS PHYTOPLASMA MALI APPLE PROLIFERATION PATHOGEN page 9 PHYTOSANITARY RISK OF HERBIVOROUS MITES (ARACHNIDA: ACARIFORMES) page 20 IDENTIFICATION OF THE AGENT OF POTATO WART DISEASE SYNCHYTRIUM ENDOBIOTICUM USING MOLECULAR DIAGNOSTIC METHODS page 35 TOMATO RINGSPOT VIRUS DIAGNOSIS (ToRSV) USING CONVENTIONAL PCR page 46

RUSSIAN-ENGLISH JOURNAL PLANT HEALTH SEPTEMBER ISSN 2306-9767 ISSN RESEARCH AND PRACTICE 3/25/2018 «КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА» ДВУЯЗЫЧНЫЙ НАУЧНЫЙ ЖУРНАЛ №3 (25) 2018 г.

Главный редактор: Мартин Уорд — РЕДАКЦИЯ: А.Я. Сапожников, Генеральный директор ЕОКЗР Волкова Е.М. — кандидат директор ФГБУ «ВНИИКР» биологических наук, Ханну Кукконен — директор заведующая лабораторией Шеф-редактор: подразделения фитосанитарного сорных растений Светлана Зиновьева, надзора, EVIRA (Финляндия) начальник отдела по связям Волков О.Г. — начальник с общественностью Сагитов А.О. — доктор отдела биометода и СМИ ФГБУ «ВНИИКР» биологических наук, Кулинич О.А. — доктор Генеральный директор ТОО биологических наук, Выпускающий редактор: «Казахский НИИ защиты начальник отдела лесного карантина Ольга Лесных и карантина растений» e-mail: [email protected] Приходько Ю.Н. — кандидат сельскохозяйственных наук, Сорока С.В. — кандидат Редакционная коллегия начальник научно-методического сельскохозяйственных наук, журнала «Карантин растений. отдела фитопатологии директор РУП «Институт Наука и практика»: защиты растений» НАН Скрипка О.В. — кандидат Швабаускене Ю.А. — заместитель Республики Беларусь биологических наук, ведущий Руководителя Россельхознадзора научный сотрудник лаборатории Джалилов Ф.С. — доктор микологии Долженко В.И. — академик РАН, биологических наук, Федотова А.Г. — переводчик доктор сельскохозяйственных профессор, заведующий отдела фитосанитарных рисков наук, заместитель директора лабораторией защиты растений и международного взаимодействия Всероссийского МСХА им. К.А. Тимирязева НИИ защиты растений Быков И.И. — переводчик Абасов М.М. — доктор отдела фитосанитарных рисков Надыкта В.Д. — академик РАН, биологических наук, и международного взаимодействия доктор технических наук, заместитель директора Беломестнова А.А. —переводчик директор Всероссийского НИИ ФГБУ «ВНИИКР» отдела фитосанитарных рисков биологической защиты растений и международного взаимодействия Шероколава Н.А. — заместитель Орлинский А.Д. — доктор директора ФГБУ «ВНИИКР», Красовский Г.С. — переводчик биологических наук, вице-президент ЕОКЗР отдела фитосанитарных рисков научный советник ЕОКЗР и международного взаимодействия Яковлева В.А. — кандидат Павлюшин В.А. — академик РАН, Дизайн и верстка: доктор биологических наук, биологических наук, начальник Ирина Гюнтнер директор Всероссийского отдела фитосанитарной биологии ФГБУ «ВНИИКР» Корректоры: НИИ защиты растений Татьяна Артемьева Санин С.С. — академик РАН, Камаев И.О. — кандидат Ольга Тренева доктор биологических наук, биологических наук, старший Менеджер по подписке профессор, заведующий научный сотрудник научно- и дистрибуции: отделом Всероссийского экспериментального отдела Павел Сафронов НИИ фитопатологии ФГБУ «ВНИИКР» +7 903 505 33 23

Журнал «Карантин растений. Наука и практика» зарегистрирован в Федеральной службе по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор), свидетельство о регистрации ПИ № ФС77-52594 от 25 января 2013 г. Учредитель: ООО «Успех», выпускается по заказу Федерального государственного бюджетного учреждения «Всероссийский центр карантина растений» (ФГБУ «ВНИИКР») Издатель: ООО «У-Строй» (105122, г. Москва, Щелковское шоссе, д. 13, оф. 402) Адрес редакции: 105122, г. Москва, Щелковское шоссе, д. 13, оф. 402 Типография: ООО «РИММИНИ», 603104, г. Нижний Новгород, ул. Краснозвездная, д. 7а, офис 3 Дата выхода 29.06.2018 г. Тираж 3000 экземпляров. Подписной индекс 70195 в Каталоге Агентства «Роспечать» СОДЕРЖАНИЕ CONTENT

Об участии ФГБУ «ВНИИКР» в VII заседании Participation of FGBU «VNIIKR» in the VII Meeting Координационного совета по карантину растений of the Coordination Council on Plant Quarantine государств – участников СНГ of the CIS Member States А.А. Улумиев, научный сотрудник отдела фитосанитарных рисков A.A. Ulumiev, Researcher оf the Pest Risk и международного взаимодействия ФГБУ «ВНИИКР» and International Cooperation Department, FGBU “VNIIKR” 2 3

Возбудитель пролиферации яблони Candidatus Phytoplasma mali Candidatus Phytoplasma mali Apple Proliferation Pathogen Е.В. Каримова, старший научный сотрудник E.V. Karimova, Senior Researcher of Phytopathology Research and Methodology НМОФ ФГБУ «ВНИИКР» Department of FGBU “VNIIKR” Ю.Н. Приходько, ведущий научный сотрудник Y.N. Prikhodko, Leading Researcher of Phytopathology Research and Methodology НМОФ ФГБУ «ВНИИКР» Department of FGBU “VNIIKR” Ю.А. Шнейдер, заведующий лабораторией вирусологии Y.A. Shneider, Deputy Head of Virology Laboratory of Laboratory Testing Centre ИЛЦ ФГБУ «ВНИИКР» of FGBU “VNIIKR” И.П. Смирнова, профессор Медицинского института РУДН I.P. Smirnova, Professor of the Institute for Medicine of PFUR 4 9

Фитосанитарный риск растительноядных клещей Phytosanitary Risk of Herbivorous Mites (Arachnida: Acariformes) (Arachnida: Acariformes) И.О. Камаев, старший научный сотрудник I.O. Kamayev, Senior Researcher of the Research and Testing Department научно-экспериментального отдела ФГБУ «ВНИИКР» of FGBU “VNIIKR” М.К. Миронова, ведущий научный сотрудник M.K. Mironova, Leading Researcher of the Entomological Research научно-методического отдела энтомологии ФГБУ «ВНИИКР» and Methodology Department of FGBU “VNIIKR” 13 20

Идентификация возбудителя рака картофеля Synchytrium endobioticum Identification of the Agent of Potato Wart Disease Synchytrium с применением молекулярных методов диагностики endobioticum Using Molecular Diagnostic Methods М.Б. Копина, начальник научно-методического отдела M.B. Kopina, Head of the Phytopathology Research and Methodology фитопатологии ФГБУ «ВНИИКР» Department of FGBU “VNIIKR” О.В. Скрипка, ведущий научный сотрудник научно-методического отдела О.V. Skripka, Leading Researcher of the Phytopathology Research фитопатологии ФГБУ «ВНИИКР» and Methodology Department of FGBU “VNIIKR” Г.Н. Матяшова, заведующая лабораторией ГМО ФГБУ «ВНИИКР» G.N. Matyashova, Head of the GMO Laboratory of FGBU “VNIIKR” И.П. Дудченко, старший научный сотрудник лаборатории I.P. Dudchenko, Senior Researcher of the Mycology Laboratory микологии ФГБУ «ВНИИКР» of FGBU “VNIIKR” 27 35

Диагностика неповируса кольцевой пятнистости томата (ToRSV) Tomato Ringspot Virus Diagnosis (ToRSV) методом классической ПЦР Using Conventional PCR Ю.Н. Приходько, ведущий научный сотрудник научно-методического Y.N. Prikhodko, Leading Researcher of the Phytopathology Research отдела фитопатологии ФГБУ «ВНИИКР» and Methodological Department of FGBU “VNIIKR” Т.С. Живаева, научный сотрудник научно-методического T.S. Zhivaeva, Research Associate, Phytopathology Research отдела фитопатологии ФГБУ «ВНИИКР» and Methodological Department of FGBU “VNIIKR” 41 46

Экспедиция по изучению щитовок и паутинных клещей Expedition to Study Scales and Spider Mites Крымского полуострова of the Crimean Peninsula А.В. Шипулин, младший научный сотрудник A.V. Shipulin, Junior Researcher of the Research научно-экспериментального отдела ФГБУ «ВНИИКР» and Testing Department of FGBU “VNIIKR” И.О. Камаев, старший научный сотрудник I.O. Kamayev, Senior Researcher of the Research научно-экспериментального отдела ФГБУ «ВНИИКР» and Testing Department of FGBU “VNIIKR” 51 56

Амброзия трехраздельная (Ambrosia trifida L.) Great Ragweed (Ambrosia trifida L.) на территории Новосибирской области in the Territory of the Novosibirsk Region А.В. Каждан, старший государственный инспектор отдела надзора A.V. Kazhdan, Chief State Inspector в области карантина растений Управления Россельхознадзора of the Surveillance Department for Plant Quarantine по Новосибирской области of Rosselkhoznadzor Directorate for the Novosibirsk Region И.В. Заверткина, руководитель отдела фитосанитарной экспертизы и I.V. Zavertkina, Head of the Phytosanitary Analysis and Plant Quarantine карантина растений ФГБУ «Новосибирская МВЛ» Department of FGBU “Novosibirsk IVL” А.А. Коренев, руководитель отдела фитосанитарной экспертизы и карантина A.A. Korenev, Head of the Phytosanitary Analysis and Plant Quarantine растений ФГБУ «Новосибирская МВЛ» Department of FGBU “Novosibirsk IVL” О.С. Жирова, ведущий инженер Лаборатории Гербарий ЦСБС СО РАН O.S. Zhirova, Leading Engineer of the Laboratory Herbarium CSBG SB RAS 61 63

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 1 ОБ УЧАСТИИ ФГБУ «ВНИИКР» В VII ЗАСЕДАНИИ КООРДИНАЦИОННОГО СОВЕТА ПО КАРАНТИНУ РАСТЕНИЙ ГОСУДАРСТВ – УЧАСТНИКОВ СНГ

А.А. Улумиев, научный сотрудник отдела фитосанитарных рисков и международного взаимодействия ФГБУ «ВНИИКР»

С 5 по 6 июля 2018 года в г. Ду- шанбе, Республика Таджикистан, состоялось VII заседание Коорди- национного совета по карантину растений государств – участников СНГ. В совещании приняли участие представители НОКЗР Республики Беларусь, Кыргызской Республи- ки, Республики Молдова, Россий- ской Федерации, Республики Тад- жикистан, а также специалисты Исполнительного комитета СНГ и Секретариата Координационного совета СНГ. В соответствии с утвержденной повесткой дня VII заседания Коор- динационного совета по карантину растений государств – участников СНГ состоялись выборы председа- теля Совета. Новым председателем Совета, в соответствии с Положе- нием, был избран руководитель - о согласовании проекта Поло- Национального агентства по безо- НОКЗР Республики Таджикистан жения о проведении межлаборатор- пасности пищевых продуктов Рес- Фарход Вохид Камолзода. ных сличительных испытаний, и др. публики Молдова Георгия Семено- На заседании Совета в соответ- Большой интерес вызвал доклад вича Габеря о проведении очеред- ствии с повесткой дня обсужда- М.М. Абасова о распространении ного заседания Совета во втором лись вопросы: опыта ФГБУ «ВНИИКР» по про- полугодии 2019 года в городе Ки- - о карантинном фитосанитар- блемам изучения и применения шиневе, Республика Молдова. ном состоянии территорий госу- феромонов карантинных объектов. В соответствии с принятыми дарств – участников СНГ; Координационный совет по решениями материалы заседания - о проекте Перечня карантин- карантину растений государств – были представлены в Исполни- ных объектов государств – участ- участников СНГ единогласно ре- тельный комитет СНГ для рассмо- ников СНГ и проекте порядка его шил принять предложение члена трения высшими органами СНГ в применения; Совета, Генерального директора установленном порядке.

2 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА PARTICIPATION OF FGBU “VNIIKR” IN THE VII MEETING OF THE COORDINATION COUNCIL ON PLANT QUARANTINE OF THE CIS MEMBER STATES

A.A. Ulumiev, Researcher оf the Pest Risk and International Cooperation Department, FGBU “VNIIKR”

From 5 to 6 July 2018 Kamolzoda, head of the NPPO of the experience of FGBU “VNIIKR” and in Dushanbe, Republic of Republic of Tajikistan, was elected on problems of studying and using of Tajikistan, the VII meeting of the the new chairman of the Council in pest pheromones. Coordinating Council on Plant accordance with its Regulations. The Coordinating Council for Quarantine of the CIS member At the meeting of the Council, in plant Quarantine of the CIS member states took place. accordance with the approved agenda, states unanimously decided to The meeting was attended the following issues were discussed: accept the proposal of the Director by NPPO representatives of the - quarantine phytosanitary General of the National Food Safety Republic of Belarus, the Kyrgyz condition of the territories of the CIS Agency of the Republic of Moldova – Republic, the Republic of Moldova, member states; Georgy Gaber about holding the the Russian Federation, the Republic - the draft list of quarantine pests next meeting of the Council in the of Tajikistan, as well as experts of the of the CIS member states and the second half of 2019 in Chisinau, CIS Executive Committee and the CIS draft order of its implementation; Moldova. Coordinating Council Secretariat. - coordination of the draft of According to the decisions made In accordance with the agenda of the Provision on carrying out materials of a meeting have been the VII Meeting of the Coordination interlaboratory comparative tests, etc. submitted to the Executive Committee Council on Plant Quarantine, the The participants of the meeting of the CIS for review by the supreme election of the chairman of the were very interested in the report authority of the CIS in accordance with Council took place. Farhod Vokhid of Muzafar Abasov on sharing the the established procedure.

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 3 УДК 632.3.01/.08, 632.27

ВОЗБУДИТЕЛЬ ПРОЛИФЕРАЦИИ ЯБЛОНИ CANDIDATUS PHYTOPLASMA MALI

Е.В. Каримова, старший научный сотрудник НМОФ ФГБУ «ВНИИКР» Ю.Н. Приходько, ведущий научный сотрудник НМОФ ФГБУ «ВНИИКР» Ю.А. Шнейдер, заведующий лабораторией вирусологии ИЛЦ ФГБУ «ВНИИКР» И.П. Смирнова, профессор Медицинского института РУДН

Аннотация. Плодовые культу- ников не позволяют в полной мере силу их морфологических особен- ры широко возделываются на тер- осуществлять данную программу, ностей и длительного отсутствия ритории Российской Федерации. в связи с чем возникает необхо- методов диагностики. В настоящее К числу опасных заболеваний димость в импорте посадочного время в ряде стран, в том числе в плодовых культур, в частности материала. Российской Федерации, пытаются яблони и айвы, относится про- Международная торговля явля- ликвидировать этот пробел, ведут- лиферация яблони (Candidatus ется важным средством развития ся научные работы по изучению, Phytoplasma mali). Экономический национальной экономики. Однако а также разработке и совершен- ущерб от возбудителя данного за- при увеличении объемов импорта ствованию методов диагностики болевания выражается не только саженцев, черенков и другого поса- разных видов фитоплазм. в снижении урожайности культур, дочного материала возрастает опас- Фитоплазмы являются специ- но и в ухудшении качества плодов, ность завоза карантинных вредных фической группой фитопатоген- а также в затратах на работы по организмов, в частности, возбуди- ных микроорганизмов, занимаю- ликвидации плодовых насаждений телей вирусных, бактериальных и щих промежуточное положение при эпифитотии. В настоящее фитоплазменных заболеваний из между бактериями и вирусами. время Ca. Phytoplasma mali входит зараженных зон на территорию К числу наиболее опасных фито- в Список А2 Единого перечня ка- Российской Федерации (Каримова плазменных заболеваний плодо- рантинных объектов Евразийско- и др., 2013а; Шнейдер и др., 2017). вых культур можно отнести про- го экономического союза. В статье Возбудители фитоплазменных, лиферацию яблони, вызываемую кратко рассмотрены особенности вирусных и бактериальных забо- микроорганизмом, который, со- Ca. Phytoplasma mali, растения- леваний растений опасны прежде гласно современной номенклатуре, хозяева, симптомы заболевания и всего потому, что: называется Candidatus Phytoplasma ущерб, наносимый возбудителем - ослабляют или вызывают ги- mali. Термин «Candidatus» был в странах его распространения. бель зараженных растений-хозяев; предложен в 2004 году для обозна- - сильно снижают количество и чения всех предполагаемых видов Ключевые слова. Карантин качество продукции; фитоплазм. Исследователями опи- растений, фитоплазма, плодовые - отсутствуют или только нахо- сано уже более 40 видов Candidatus культуры, пролиферация яблони, дятся в разработке прямые эффек- phytoplasma. здоровый посадочный материал. тивные меры борьбы (Каримова и Впервые пролиферация яблони др., 2013б; Смирнова и др., 2016); была описана в 1950 году в Ита- Государственная программа - заболевание длительное вре- лии, в регионе Венето. В 1954 году развития сельского хозяйства и мя может протекать в латентной о похожих симптомах сообща- регулирования рынков сельскохо- форме; лось из Трентино, одного из круп- зяйственной продукции, сырья и - пораженные растения явля- нейших районов возделывания продовольствия предусматривает ются постоянными источниками яблони в Европе. Поэтому можно увеличение объемов производства инфекции (Smirnova et al., 2017). предположить, что пролиферация плодово-ягодной продукции. В на- По сравнению с бактериальны- яблони была ограниченно распро- стоящее время производственные ми и вирусными возбудителями, странена в Европе в течение долго- мощности отечественных питом- фитоплазмы меньше изучены в го времени, прежде чем появились

4 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Fig. 1. Witches' broom on Golden Delicious apple variety Fig. 2. Witches' broom on Golden Delicious apple variety (EPPO Global Database, 2017) (EPPO Global Database, 2017)

Рис. 1. «Ведьмины метлы» на яблоне сорта Golden Delicious Рис. 2. «Ведьмины метлы» на яблоне сорта Golden Delicious (EPPO Global Database, 2017) (EPPO Global Database, 2017)

первые сообщения о ней. В на- Основным растением – хозяи- В Молдавии пролиферация так- стоящее время распространение ном данного возбудителя заболе- же была описана на айве (Cydonia возбудителя Ca. Phytoplasma mali вания является яблоня домашняя oblonga). В Италии было обнару- официально подтверждено неко- (Malus domestica), большинство жено, что Ca. Phytoplasma mali, торыми странами Европы, Азии сортов которой восприимчиво к помимо яблони, поражает фундук и Африки. По данным Канадского заражению. (Corylus avellana), в Германии – агентства продовольственной ин- Сорта яблони, поражаемые воз- боярышник (Crataegus monogyna) спекции (CFIA), возбудитель про- будителем Candidatus Phytoplasma (Tedeschi et al., 2009). лиферации яблони был обнаружен mali, можно разделить на: Зарубежными исследователями в апреле 2013 года на территории - высоко восприимчивые: было установлено, что возбудитель Канады (ЕРРО, 2017). Florina, Prima, Priscilla (Loi et al., пролиферации яблони поражает Согласно сведениям, опублико- 1995); также другие виды растений, не ванным в научных литературных - восприимчивые: Belle de относящиеся к роду Malus: Prunus источниках, на территории РФ Booskop, Gravestein, Golden salicina (сливу японскую), Prunus возбудитель пролиферации ябло- Delicious, Winter Banana (Anon., avium (черешню), Prunus armeniaca ни был отмечен в Волгоградской 2004); (абрикос), Prunus domestica (сли- и Московской областях, в Красно- - средне восприимчивые: Idared, ву), Prunus persica (персик), Pyrus дарском крае (Вердеревская, Ма- McIntosh, Starking Starkrimson communis (грушу европейскую), ринеску, 1985). Имеются личные (Németh, 1986); Vitis vinifera (виноград), Dahlia х сообщения о современном распро- - толерантные: Roja de Benejama cultorum (георгин), Lilium spp. (ли- странении Ca. Phytoplasma mali на (Anon., 2004), Антоновка, Cortland, лию), Rosa spp. (розу) и др. (Mehle территории РФ, но эта информа- Spartan, Yellow transparent, Wealthy et al., 2007; Tedeschi et al., 2009; ция не опубликована официально. (Németh, 1986). Seemüller et al., 2011, 2013). Стоит

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 5 чашелистики увеличены и зазуб- рены (EPPO, 2017). Важнейшим симптомом проли- ферации, определяющим высокую вредоносность этого заболевания, является образование мелких, плохо окрашенных, безвкусных плодов несколько уплощенной формы. В некоторых случаях, в особенности при выращивании деревьев на почвах плохого каче- ства, масса плодов сокращается до 75% от массы здорового плода. Семена и семенные камеры у зара- женных плодов также уменьшены. Плодоножки тонкие и длинные, а углубление вокруг плодоножки и чашелистиков мельче и шире, чем на здоровых плодах, поэтому они Fig. 3. Enlarged stipulae on apple leaves – the symptom выглядят сплющенными. of Ca. Phytoplasma mali pathogen; a healthy apple tree leaf is given for comparison (right) Кроме снижения урожая, возбу- (EPPO Global Database, 2017) дитель заболевания также вызывает Рис. 3. Увеличенные прилистники на листьях яблони – симптом заражения ухудшение товарного качества пло- возбудителем Ca. Phytoplasma mali; для сравнения представлен лист здорового дов: уменьшается содержание орга- дерева яблони (справа) (EPPO Global Database, 2017) нических кислот и сахаров в плодах, соответственно, ухудшаются их отметить, что на данный момент не рост верхушечных почек. В конце вкус и аромат (Каримова, 2011). было определено, являются ли изо- сезона вместо нормальной зимую- Корневая система у заражен- ляты, выделенные из перечислен- щей почки развивается розетка ных деревьев редуцирована вслед- ных выше растений, патогенными верхушечных листьев, которые час- ствие недоразвития скелетных для яблони (Seemüller et al., 2013). то поражаются мучнистой росой корней и образования большого Деревья, пораженные возбуди- (Приходько, Матяшова, 2015). количества мелких придаточных телем пролиферации яблони, часто Весной листья на зараженных мочковатых корней. растут вместе, группами, и пло- деревьях распускаются раньше, При высокой концентрации фи- щади под этими группами с каж- чем на здоровых. Листья тонкие, с топлазмы в проводящей системе дым годом расширяются. Симп- неправильными острыми зубчика- возможна полная гибель деревьев томы на растениях распределены ми, не характерными для культур- (Приходько, Матяшова, 2015). неравномерно. Стоит отметить, ных сортов яблони. Они меньшего Ca. Phytoplasma mali был выяв- что подтипы Ca. Phytoplasma mali размера, закручиваются краями лен на ряде растений рода Prunus, значительно различаются по ви- вниз, ломкие, имеют укороченные зараженные растения имели свои рулентности. черешки и увеличенные прилист- характерные симптомы. В частно- Симптомы возбудителя забо- ники (количество прилистников сти, на зараженных деревьях че- левания условно разделяют на ха- может достигать четырех на один решни Prunus avium можно было рактерные (достоверные) и сомни- лист). Достаточно часто, особен- наблюдать увядание, некрозы цвет- тельные (недостоверные). Наибо- но если деревья растут на почвах, ков, флоэмы, однолетних побегов и лее характерным симптомом забо- богатых кальцием, появляются скелетных ветвей, а также общую левания является образование во признаки хлороза и покраснение гибель дерева (Mehle et al., 2007). второй половине лета (июль – ав- листьев, тогда как для здоровых Симптомы возбудителя про- густ) на штамбе, скелетных ветвях деревьев характерна желтая окрас- лиферации яблони на абрикосе и апикальных побегах «ведьминых ка листьев осенью. Часто у зара- Prunus armeniaca включают некроз метел» – тонких жировых ветвя- женных деревьев можно наблю- побегов и увядание листьев (Mehle щихся побегов красно-коричне- дать раннее сбрасывание листьев et al., 2007). вого цвета, растущих под острым (Каримова, 2012). Первичный симптом Ca. Phy- углом (Каримова, 2011). На зараженных деревьях на- toplasma mali на сливе Prunus В целом деревья, пораженные блюдается запоздалое цветение, domestica – позднее цветение (Mehle фитоплазмой пролиферации ябло- иногда до конца лета – начала et al., 2007). ни, выглядят слабыми, чахлыми, осени, но большинство цветков, Возбудитель пролиферации ябло- снижаются окружность ствола и как правило, нормальные. Иногда ни Ca. Phytoplasma mali поражает диаметр кроны по сравнению со у некоторых сортов развивается также ряд цветочных растений. здоровыми деревьями. филлодия цветков: тычинки пере- На растениях георгина Dahlia х Также к достоверным симптомам рождаются в лепестки, а лепестки cultorum в результате совместной следует отнести поздний осенний иногда перерождаются в листья; инфекции Ca. Phytoplasma mali и

6 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Fig. 4. Small apple fruits with elongated pedicels – the symptom of Ca. Phytoplasma mali. A healthy fruit to the left (http://www.cabi.org, 2017) Рис. 4. Мелкие плоды яблони с удлиненными плодоножками – симптом Ca. Phytoplasma mali. Здоровый плод слева (http://www.cabi.org, 2017)

Ca. Phytoplasma asteris можно было mali может сохраняться в тече- ние возбудителей фитоплазменных наблюдать интенсивный рост, со- ние продолжительного времени в заболеваний растений, разрабаты- провождаемый пролиферацией латентном состоянии в саженцах, ваются и совершенствуются мето- побегов, узколистностью и слабым подвоях и привоях яблони и дру- ды их выявления и идентификации. цветением (Kaminska, Sliwa, 2008). гих плодовых культур. Для выявления возбудителя При заражении растений розы В садах возбудитель заболе- пролиферации яблони обследова- Rosa spp. совместной инфекци- вания распространяется через ния насаждений необходимо про- ей Ca. Phytoplasma mali и Ca. срастание корней здоровых и ин- водить в конце лета – начале осе- Phytoplasma asteris симптомы вклю- фицированных деревьев. ни, когда титр фитоплазмы в над- чали отмирание побегов, «ведьми- Распространение возбудителя земных органах растений яблони ны метлы», пролиферацию почек, Ca. Phytoplasma mali естественным наиболее высок. Дополнительным побегов и цветков, угнетение ро- путем, с помощью насекомых-пе- сроком обследований является ста растения, деформацию листьев реносчиков, доказано для листо- ранняя весна (до распускания по- и цветков (Kaminska, Sliwa, 2004). блошек Cacopsylla picta (синоним чек), когда выявляют симптомы При поражении фитоплазмой Cacopsylla сostalis), Cacopsylla типа «ведьминых метел» (При- пролиферации яблони лилий melanoneura и цикадки Fieberiella ходько, Матяшова, 2015). Lilium spp. на растении можно на- florii (Mehle et al., 2011). Для выявления и идентифи- блюдать ожог, деформацию и не- Экономический ущерб от про- кации Ca. Phytoplasma mali при кроз листьев, опадение цветочных лиферации яблони возникает необходимости тестирования почек (Kaminska, Sliwa, 2008). вследствие уменьшения урожай- большого количества образцов Главным путем, которым Ca. ности и последующей гибели используют метод иммунофер- Phytoplasma mali может проникнуть деревьев. Плоды не достигают ментного анализа (ИФА), однако и распространиться на территории товарного размера, и, как отме- молекулярно-генетические методы Российской Федерации, является чалось выше, их вес значительно идентификации возбудителя име- международная торговля посадоч- уменьшается, они безвкусные и ют значительное преимущество ным материалом растений – хозяев имеют не характерную для сорта из-за своей быстроты и высокой пролиферации яблони, а именно – окраску. При поражении деревьев чувствительности. Для получе- плодовых культур родов Malus, пролиферацией яблони более 80% ния более подробной информа- Prunus, Dahlia х cultorum (георгин), плодов не пригодны для продажи, ции о современной диагностике Lilium spp. (лилия), Rosa spp. (роза), в них снижается содержание са- возбудителя Ca. Phytoplasma mali Pyrus communis (груша европей- харов и аминокислот. Кроме того, рекомендуем ознакомиться с «Ме- ская), Vitis vinifera (виноград). заболевание в целом ослабляет де- тодическими рекомендациями Такой путь проникновения и рево и способствует поражению по выявлению и идентификации распространения, как перемеще- его мучнистой росой (Podosphaera возбудителя пролиферации ябло- ние зараженного посадочного ма- leucotricha), млечным блеском, или ни Candidatus phytoplasma mali» териала растений – хозяев возбу- серебрянкой (Каримова, 2012). (Приходько, Матяшова, 2015), а дителя, является очень важным и Во Всероссийском центре каран- также с диагностическим прото- опасным, так как Ca. Phytoplasma тина растений проводится изуче- колом ЕОКЗР РМ 7/62 (2).

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 7 Наличие благоприятных клима- Российской Федерации. М.: ФГБУ 12. Kaminska M., Sliwa H. First тических условий, широкое возде- «ВНИИКР», 2012. report of phytoplasma belonging to лывание растений-хозяев на тер- 4. Каримова Е.В., Шнейдер Ю.А., apple proliferation group in roses in ритории Российской Федерации, Заец В.Г., Смирнова И.П. Микро- Poland // Plant Disease, 2004. Vol. 88. способность возбудителя быстро организмы, вызывающие каран- P. 1283. размножаться, а также оставаться тинные для Российской Федерации 13. Loi N., Carraro L., Musetti R., незамеченным в латентном состоя- бактериальные болезни растений // Firrao G., Osler R. Apple proliferation нии в течение длительного перио- Вестник Российского университе- epidemics detected in scab-resistant да времени являются факторами, та дружбы народов. Серия «Агро- apple trees // Journal of Phytopathology, способствующими акклиматиза- номия и животноводство», 2013а. 1995, 143 (10): 581-584; 9 ref. ции Ca. Phytoplasma mali на тер- № 2. С. 27-37 14. Mehle N., Ravnikar M., Seljak G., ритории РФ. 5. Каримова Е.В., Шнейдер Ю.А., Knapic V., Dermastia M. The most В настоящее время возбу- Смирнова И.П. Изучение эффек- widespread phytoplasmas, vectors дитель пролиферации яблони тивности L-лизин-α-оксидазы и and measures for disease control Ca. Phytoplasma mali входит в биологических пестицидов в от- in Slovenia // Phytopathogenic Список А2 карантинных вредных ношении возбудителей бактери- Mollicutes, 2011. 1 (2): 1-12. организмов, ограниченно распро- альных болезней // Научно-прак- 15. Mehle N., Brzin J., Boben J., страненных на территории ЕАЭС, тический журнал «Проблемы Hren M., Frank J., Petrovič N., Gruden K., Единого перечня карантинных медицинской микологии», 2013б. Dreo T., Žežlina I., Seljak G., Ravnikar M. объектов Евразийского экономи- Т. 15. № 2. С. 82-83. First report of ‘Candidatus Phytoplasma ческого союза. 6. Приходько Ю.Н., Матяшо- mali’ in Prunus avium, P. armeniaca and Для предотвращения распро- ва Г.Н. Методические рекоменда- P. domestica // Plant Pathology, 2007. странения возбудителя пролифе- ции по выявлению и идентифика- Vol. 56. Issue 4. P. 721-721. рации яблони на территории Рос- ции возбудителя пролиферации 16. Németh M. Virus, Mycoplasma сийской Федерации необходимо яблони Candidatus Phytoplasma and Rickettsia Diseases of Fruit соблюдение карантинных фитоса- mali. М.: ФГБУ «ВНИИКР», 2015. Trees. Lancaster, Boston, USA / нитарных мероприятий в очагах 7. Смирнова И.П., Каримо- Dordrecht, Netherlands: M. Nijhoff возбудителя и при импорте расти- ва Е.В., Шнейдер Ю.А. Некото- Publishers, 1986. тельной продукции. Посадочный рые перспективы использования 17. Seemüller E., Carraro L., материал растений – хозяев воз- метаболитов рода Trichoderma // Jarausch W., Schneider B. Apple будителя должен быть произведен Вестник Российского университе- proliferation phytoplasma // Virus согласно общепризнанной схеме та дружбы народов. Серия «Агро- and virus-like diseases of pome and сертификации, гарантирующей номия и животноводство», 2016. stone fruits, 2011. P. 67-73. получение посадочного материа- № 3. С. 22-29. 18. Seemüller E., Sule S., Kube M., ла, свободного от Ca. Phytoplasma 8. Шнейдер Ю.А., Каримова Е.В., Jelkmann W., Schneider B. The mali. Учитывая возможный им- Приходько Ю.Н., Смирнова И.П., AAA+ATPases and HfIB/FtsH порт саженцев растений – хозяев Шероколава Н.А., Мазурин Е.С., proteases of Candidatus Phytoplasma возбудителя из стран с широким Абасов М.М., Магомедов Р.К., mali: Phylogenetic diversity, распространением фитоплазмы Орцханов Б.Г., Астарханова Т.С. membrane topology, and relationships необходимо проводить систе- Candidatus Liberibacter sola- to strain virulence // Plant- матические обследования для nacearum – опасный патоген, вы- Microbe Interaction, 2013. Vol. 26. уточнения распространения Ca. зывающий полосатость чипсов P. 367-376. Phytoplasma mali на территории картофеля // Защита и карантин 19. Smirnova I.P., Karimova E.V., Российской Федерации. растений, 2017. № 9. С. 39-42. Shneider Y.A. Antibacterial 9. Anon. ‘Candidatus Phyto- activity of L-lysine-α-oxidase Литература plasma’, a taxon for the wall- from the Тrichoderma / Bulletin of 1. Вердеревская Т.Д., Мари- less, non-helical prokaryotes that Experimental Biology and Medicine, неску В.Г. Вирусные и микоплаз- colonize plant phloem and insects // October, 2017. Vol. 163. № 6. менные заболевания плодовых International Journal of Systematic P. 777-779. культур и винограда. Кишинев: and Evolutionary Microbiology, 20. Tedeschi R., Lauterer P., Bru- Штиинца, 1985. С. 151-157. 2004, 54 (4): 1243-1255. setti L., Tota F., Alma A. Composition, 2. Каримова Е.В. Apple pro- 10. EPPO. Standard PM 7/62 (2). abundance and phytoplasma liferation phytoplasma – опасное за- Candidatus Phytoplasma mali, Ca. infection in the hawthorn psyllid болевание, поражающее яблони / P. pyri and Ca. P. prunorum // Bulletin fauna of northwestern Italy // Материалы научно-практической OEPP/EPPO Bulletin (2017), 47 (2): European Journal of Plant Pathology, конференции «Интегрированная 146-163. 2009. Vol. 123. P. 301-310. защита растений: стратегия и так- 11. Kaminska M., Sliwa H. First 21. [Электронный ресурс] https:// тика». Минск, 2011. С. 703-706. report of ‘Candidatus Phytoplasma gd.eppo.int (дата обращения: 3. Каримова Е.В. Анализ фито- mali’ in oriental lilies and its 20.12.2017). санитарного риска возбудителя association with leaf scorch in Poland // 22. [Электронный ресурс] http:// пролиферации яблони Candidatus Plant Pathology, 2008. Vol. 57. www.cabi.org (дата обращения: Phytoplasma mali для территории P. 363. 20.12.2017).

8 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА UDC 632.3.01/.08, 632.27

CANDIDATUS PHYTOPLASMA MALI APPLE PROLIFERATION PATHOGEN E.V. Karimova, Senior Researcher of Phytopathology Research and Methodology Department of FGBU “VNIIKR” Y.N. Prikhodko, Leading Researcher of Phytopathology Research and Methodology Department of FGBU “VNIIKR” Y.A. Shneider, Deputy Head of Virology Laboratory of Laboratory Testing Centre of FGBU “VNIIKR” I.P. Smirnova, Professor of the Institute for Medicine of PFUR

Abstract. It is common International trade is significant Phytoplasmas are a specific group practice to grow fruits in Russia. for the development of the national of phytopathogenic microorganisms Some dangerous fruit diseases, economy. However, as the imports between bacteria and viruses. One particularly apple and quince, of saplings, cuttings and other of the most harmful phytoplasmal may include apple proliferation propagative material grow the diseases of fruits is apple proliferation, (Candidatus Phytoplasma mali). probability to introduce quarantine caused by a microorganism called This pathogen causes significant pests such as bacterial, viral and Candidatus Phytoplasma mali as per economic harm, reducing both phytoplasmal pathogens, from the modern nomenclature. The term yields and fruit quality. It also Russian contaminated areas increases Candidatus was suggested in 2004 increases costs for the elimination as well (Karimova et al., 2013а; to define all potential phytoplasma of epiphytoty-affected fruit plants. Shneider et al., 2017). species. The researchers have Nowadays Ca. Phytoplasma mali is These bacterial, viral and already described over 40 species of in the A2 List of Quarantine Pests phytoplasmal pathogens are Candidatus phytoplasma. of the Eurasian Economic Union. principally harmful because: Apple proliferation was first This article briefly describes the - pathogens weaken the host plants described in Italy in the Veneto properties of Ca. Phytoplasma and cause them to die, region in 1950. The similar symptoms mali, its host plants, symptoms of - pathogens greatly reduce product were reported in Trentino in 1954, the disease and harm, caused by quantity and quality, one of the largest apple growing the pathogen in the countries of its - direct measures of effective areas in Europe. It may, therefore, presence. control are missing or under be assumed that apple proliferation development (Karimova et al., 2013b; had somewhat been distributed Keywords. Plant quarantine, Smirnova et al., 2016), across Europe for a long time before phytoplasma, fruits, apple - the decease may stay latent for a the first reports about it. At present, proliferation, healthy propagative long time, the pathogen Ca. Phytoplasma material. - affected plants are continually mali is officially registered in some infectious (Smirnova et al., 2017). European, Asian, and African The government-funded pro- Phytoplasma is studied less than countries. According to the Canadian gramme for the development of the bacterial and viral pathogens for Food Inspection Agency (CFIA) the agriculture and control of markets its morphologic characteristics and apple proliferation pathogen was of agricultural products, stock, and due to the fact that there have been reported in Canada in April 2013 food aims to increase the overall no diagnostic procedures for a long (EPPO, 2017). fruits and berries production. time. Nowadays some countries along As described in published research The domestic nurseries lack the with Russia attempt to fill this gap. papers the apple proliferation production capacities to implement There are many research activities pathogen was registered in the the programme to its full extent now. underway to study, develop and Krasnodar Kray, Moscow and Therefore, more propagative material enhance the diagnostic procedures Volgograd regions of Russia must be imported. for various phytoplasma species. (Verderevskaia, Marinesku, 1985).

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 9 reliable symptoms. At the end of the season, instead of a normal wintering bud, a rosette of apical leaves develops, which are often affected by powdery mildew (Prikhodko, Matyashova, 2015). In the spring the leaves of the affected trees sprout earlier than those of the healthy ones. The leaves are thin, have abnormal sharp serrature that is not typical of the apple cultural varieties. They are smaller, with curved edges downwards, brittle, have shorter leafstalks and bigger stipulae (the number of stipulae may amount to four per leaf). Quite often, especially if the Рис. 5. Симптомы пролиферации яблони на плодах: зараженные плоды по сравнению trees grow on soils rich in calcium, there со здоровыми меньшего размера, с не характерной для сорта окраской. are signs of chlorosis and reddening of Здоровый плод слева (https://www.cabi.org, 2017) the leaves, whereas the leaves of the Fig. 5. Symptom of apple proliferation of fruits: infected fruits are smaller and have healthy trees are yellow in the fall. One a colour which is not typical of the variety compared to the healthy ones. A healthy fruit may also see the affected trees defoliate to the left (https://www.cabi.org, 2017) earlier (Karimova, 2012). The affected trees blossom later, There are individual reports about common pear Pyrus communis, sometimes by the end of summer or Ca. Phytoplasma mali in Russia, common grapewine Vitis vinifera, beginning of autumn, however, their but this information has not been Dahlia х cultorum, lily Lilium spp., flowers are decent as a rule. Sometimes published officially. rose Rosa spp., etc. (Mehle et al., some varieties have phyllody in The principal host plant of this 2007; Tedeschi et al., 2009; Seemüller flowers – the stamina transform into pathogen is apple Malus domestica et al., 2011, 2013). It should be noted petals and the petals turn into leaves whose cultivars are susceptible to that for now it is not known whether at times. The sepals are enlarged and contamination. the isolates obtained from the plants crenate (EPPO, 2017). The apple cultivars affected by mentioned above are pathogenic for The most important symptom of Candidatus Phytoplasma mali may the apple (Seemüller et al., 2013). proliferation, which determines the be divided into: The trees affected by the apple great harmfulness of this disease, - highly susceptible: Florina, proliferation pathogen often grow is the formation of small, poorly Prima, Priscilla (Loi et al., 1995), together in groups, and the acreages coloured, tasteless fruits, somewhat - susceptible: Belle de Booskop, for these groups expand year by year. flattened. In some cases, especially Gravestein, Golden Delicious, Winter The symptoms plants are distributed when growing trees on soils of poor Banana (Anon., 2004), unevenly on the plants. It should quality, the mass of fruit reduces - medium susceptible: Idared, be mentioned, that subtypes of to 75% of the mass of a healthy McIntosh, Starking Starkrimson Ca. Phytoplasma mali have one. Seeds and seed cavities of the (Németh, 1986), significantly different virulence. affected fruits are also reduced. The - resistant: Roja de Benejama The symptoms of the disease pedicels are thin and long, and the (Anon., 2004), Antonovka, Cortland, are conditionally be divided depressions around them and sepals Spartan, Yellow transparent, Wealthy into characteristic (reliable) and are smaller and broader compared to (Németh, 1986). controversial (non-reliable). The the ones of the healthy fruits that is In Moldova, the proliferation most characteristic symptom of the why they look flattened. has also been detected on quince disease is the formation of witches' The pathogen reduces the crop (Cydonia oblonga). Ca. Phytoplasma broom – thin fat branching shoots yield and worsens the commercial mali has been reported to affect of red-brown colour growing at an quality of the fruits – the level of hazelnut Corylus avellana in Italy acute angle – on tree trunks, skeletal organic acids and sugars in fruits and common hawthorn Crataegus branches and apical shoots in the decreases, respectively, their taste and monogyna in Germany besides apple second half of the summer (July – aroma deteriorate (Karimova, 2011). (Tedeschi et al., 2009). August) (Karimova, 2011). The root system in infected Foreign researches established In general, the apple proliferation trees is reduced as a result of that the apple proliferation pathogen phytoplasma causes the affected trees underdevelopment of skeletal roots contaminates other plant species that to look weak and sickly, reduces the and the formation of a large number are not related to the Malus genus: circumference of the tree trunk and of small additional fibrous roots. Chinese plum Prunus salicina, the canopy diameter compared to The trees may die entirely if cherry Prunus avium, apricot Prunus healthy trees. the level of phytoplasma in the armeniaca, garden plum Prunus Also, the late autumn growth of conductive system is high (Prikhodko, domestica, peach Prunus persica, apical buds should be attributed to Matyashova, 2015).

10 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Рис. 6. Симптомы пролиферации яблони: увеличенный цветок яблони с большим количеством лепестков (https://www.cabi.org, 2017) Fig. 6. Apple proliferation symptoms: enlarged apple flower with many petals (https://www.cabi.org, 2017)

Ca. Phytoplasma mali has been When the apple proliferation detected on some plants of the phytoplasma affects Lilium spp. Prunus genus; the infected plants plants, one can observe blights, had their characteristic symptoms. deformation and necrosis of leaves, In particular, wilting and necrosis of the fall of flower buds (Kaminska, flowers, phloem, annual shoots, and Sliwa, 2008). skeletal branches, as well as complete The main potential pathway of tree death (Mehle et al., 2007), could Ca. Phytoplasma mali to Russian Рис. 7. Некроз цветков (сверху) и флоэмы be observed on infected Prunus is the international trade with the (снизу) деревьев черешни, пораженных avium cherry trees. propagative material of the host plants Ca. Phytoplasma mali (Mehle et al., 2007) Symptoms of the apple proliferation that may harbour apple proliferation Fig. 7. Flower necrosis (top) pathogen on Prunus armeniaca pathogen, namely fruits of Malus, and phloem (bottom) of cherry trees apricot include shoot necrosis and leaf Prunus, Dahlia х cultorum, Lilium affected by Ca. Phytoplasma mali wilt (Mehle et al., 2007). spp., Rosa spp., Pyrus communis, and (Mehle et al., 2007) The primary symptom of Ca. Phy- Vitis vinifera plants. toplasma mali on Prunus domestica Such a pathway as the movement is not characteristic of the variety. plum is its late blossoming (Mehle et al., of infected propagative material of When trees are infected by the apple 2007). the host plants is very important proliferation, more than 80% of the The apple proliferation pathogen and dangerous as Ca. Phytoplasma fruits are not suitable for sale, they Ca. Phytoplasma mali affects some mali may preserve in apple saplings, have reduced level of sugars and flowering plants as well. rootstock, graft, and other fruit crops. amino acids. Besides the decease On Dahlia х cultorum as the In gardens, the pathogen spreads weakens the trees in general and may result of combined infection through the natural root-grafting of cause powdery mildew (Podosphaera by Ca. Phytoplasma mali and healthy and infected trees. leucotricha), and some silverleaf Ca. Phytoplasma asteris one could It is established that Ca. Phy- symptoms (Karimova, 2012). see accelerated growth with the toplasma mali pathogen naturally The experts of the All-Russian proliferation of shoots, narrow leaves spreads with the help of insect vectors, Plant Quarantine Center study the and weak blossoming (Kaminska, such as Cacopsylla picta (synonym phytoplasmal pathogens, develop Sliwa, 2008). of Cacopsylla сostalis), Cacopsylla and improve the methods for their On Rosa spp. plants as the melanoneura, and Fieberiella florii detection and identification. result of combined infection leafhopper (Mehle et al., 2011). To detect the apple proliferation by Ca. Phytoplasma mali and The apple proliferation damages pathogen, plantations should be Ca. Phytoplasma asteris the symptoms the economy causing crop yield examined at the end of summer or included the death of shoots, witches’ reduction and consequent death of beginning of autumn, when the broom, the proliferation of buds, trees. Fruits do not reach the market phytoplasma titer in the above- shoots and flowers, the inhibition of size, and, as noted above, their ground organs of apple plants is plant growth, deformation of leaves weight is significantly reduced, they highest. Additional examinations and flowers (Kaminska, Sliwa, 2004). are tasteless and have a colour that may be held in early spring (before

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 11 bud blossoming) when such and Tactics of Complex Plant 12. Kaminska M., Sliwa H. First symptoms as witches' brooms reveal Protection Research and Practice report of phytoplasma belonging to (Prikhodko, Matyashova, 2015). Conference. Minsk, 2011. P. 703-706. apple proliferation group in roses To detect and identify Ca. Phy- 3. Karimova E.V. Phytosanitary in Poland // Plant Disease, 2004. toplasma mali in a large number of Risk Analysis of Apple Proliferation Vol. 88. P. 1283. samples, the immunofluorescent Pathogen Candidatus Phytoplasma 13. Loi N., Carraro L., Musetti R., assay (IFA) is used, however mali for Russia. M.: FGBU Firrao G., Osler R. Apple pro- molecular and genetic methods “VNIIKR”, 2012. liferation epidemics detected in of identification of this pathogen 4. Karimova E.V., Shneider Y.A., scab-resistant apple trees // Journal have a significant advantage being Zaets V.G., Smirnova I.P., Micro- of Phytopathology, 1995, 143 (10): more quick and sensitive. More organisms causing quarantine 581-584; 9 ref. details about advanced diagnostics bacterial diseases of plants in the 14. Mehle N., Ravnikar M., Se- of Ca. Phytoplasma mali may be Russian Federation // Herald of ljak G., Knapic V., Dermastia M. found in Guidelines to Detection People's Friendship University of The most widespread phytoplasmas, and Identification of Candidatus Russia. Agronomy and Livestock vectors and measures for disease phytoplasma mali Apple Proliferation Production series, 2013a. № 2. P. 27-37. control in Slovenia // Phytopathogenic Pathogen (Prikhodko, Matyashova, 5. Karimova E.V., Shneider Y.A., Mollicutes, 2011. 1 (2): 1-12. 2015) and in EPPO РМ 7/62 (2) Smirnova I.P. Research on the 15. Mehle N., Brzin J., Boben J., Diagnostic Protocol. efficiency of L-lysine-α-oxidase Hren M., Frank J., Petrovič N., Favourable climatic conditions, biological pesticides for bacterial Gruden K., Dreo T., Žežlina I., widespread cultivation of host pathogens // Medicine Mycology Seljak G., Ravnikar M. First report plants on the territory of the Issues research and practice magazine, of ‘Candidatus Phytoplasma mali’ Russian Federation, the ability of the 2013b. Vol. 15. № 2. P. 82-83. in Prunus avium, P. armeniaca and pathogen to multiply rapidly, and to 6. Prikhodko Y.N., Matyashova G.N. P. domestica // Plant Pathology, 2007. remain unnoticed in the latent state Guidelines to Detection and Vol. 56. Issue 4. P. 721-721. for a long period of time are factors Identification of Candidatus 16. Németh M. Virus, Mycoplasma contributing to the establishment of phytoplasma mali Apple Proliferation and Rickettsia Diseases of Fruit Ca. Phytoplasma mali in the territory Pathogen. M.: FGBU “VNIIKR”, 2015. Trees. Lancaster, Boston, USA/ of the Russian Federation. 7. Smirnova I.P., Karimova E.V., Dordrecht, Netherlands: M. Nijhoff Currently, the apple proliferation Shneider Y.A. Some prospects for the Publishers, 1986. pathogen Ca. Phytoplasma mali is use of metabolites of the Trichoderma 17. Seemüller E., Carraro L., on the A2 List of Quarantine Pests genus // Herald of People’s Friendship Jarausch W., Schneider B. Apple of the Eurasian Economic Union for University of Russia. Agronomy and proliferation phytoplasma // Virus pests that have limited distribution Livestock Production series, 2016. № 3. and virus-like diseases of pome and in the territory of EAEU. P. 22-29. stone fruits, 2011. P. 67-73. To prevent the spread of the 8. Shneider Y.A., Karimova E.V., 18. Seemüller E., Sule S., Kube M., pathogen in the territory of Russia, Prikhodko Y.N., Smirnova I.P., Jelkmann W., Schneider B. The quarantine phytosanitary measures Sherokolava N.A., Mazurin E.S., AAA+ATPases and HfIB/FtsH must be observed in the outbreaks of Abasov M.M., Magomedov R.K., proteases of Candidatus Phytoplasma the pathogen and when importing plant Ortskhanov B.G., Astarkhanova T.S. mali: Phylogenetic diversity, products. The propagative material of Candidatus Liberibacter sola- membrane topology, and relationships the host plants should be produced nacearum – dangerous pathogen to strain virulence // Plant-Microbe according to the generally recognised causing streaking of potato chips // Interaction, 2013. Vol. 26. P. 367-376. certification scheme, which guarantees Plant Quarantine, 2017. № 9. P. 39-42. 19. Smirnova I.P., Karimova E.V., the production of propagative material 9. Anon. ‘Candidatus Phyto- Shneider Y.A. Antibacterial activity free from Ca. Phytoplasma mali. plasma’, a taxon for the wall-less, of L-lysine-α-oxidase from the Considering the possible import of non-helical prokaryotes that colo- Тrichoderma / Bulletin of Experimental host plant saplings of the pathogen nize plant phloem and insects // Biology and Medicine, October, 2017. from countries with a wide spread International Journal of Systematic Vol. 163. № 6. P. 777-779. of phytoplasma, systematic surveys and Evolutionary Microbiology, 20. Tedeschi R., Lauterer P., Bru- should be carried out to clarify the 2004, 54 (4): 1243-1255. setti L., Tota F., Alma A. Compo- distribution of Ca. Phytoplasma mali 10. EPPO. Standard PM 7/62 (2). sition, abundance and phytoplasma in Russia. Candidatus Phytoplasma mali, infection in the hawthorn psyllid Ca. P. pyri and Ca. P. prunorum // fauna of northwestern Italy // References Bulletin OEPP/EPPO Bulletin (2017), European Journal of Plant Pathology, 1. Verderevskaia T.D., Marinesku V.G. 47 (2): 146-163. 2009. Vol. 123. P. 301-310. Viral and mycoplasmal diseases of 11. Kaminska M., Sliwa H. First 21. [Electronic resource]. fruit crops and grapes. Chisinau: report of ‘Candidatus Phytoplasma https://gd.eppo.int (access mode: Shtiintsa, 1985. P. 151-157. mali’ in oriental lilies and its 20.12.2017). 2. Karimova E.V. Apple pro- association with leaf scorch in Poland // 22. [Electronic resource]. http:// liferation phytoplasma – harmful Plant Pathology, 2008. Vol. 57. www.cabi.org (access mode: apple disease / Materials of Strategy P. 363. 20.12.2017).

12 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА УДК 632.654

ФИТОСАНИТАРНЫЙ РИСК РАСТИТЕЛЬНОЯДНЫХ КЛЕЩЕЙ (ARACHNIDA: ACARIFORMES)

И.О. Камаев, старший научный сотрудник научно-экспериментального отдела ФГБУ «ВНИИКР» М.К. Миронова, ведущий научный сотрудник научно-методического отдела энтомологии ФГБУ «ВНИИКР»

Аннотация. В статье рассма- 22 вида клещей (http://extranet. вельниковый паутинный клещ триваются особенности расти- agricultura.gov.br), для Турции – (Oligonychus perditus Pritchard & тельноядных клещей, определяющие 3 вида (всего 5 карантинных Baker, 1955); в списке ограниченно их потенциальный фитосанитар- Acariformes; https://www.ippc.int). распространенных (А2) – галло- ный риск. Рассмотрены примеры Для Австралии в качестве каран- вый клещ фуксии (Aculops fuchsiae фитосанитарного риска, который тинных предложены Tetranychidae Keifer, 1972), цитрусовый коричне- может быть связан с клещами, (по меньшей мере 14 видов рода вый клещ (Eutetranychus orientalis подробно рассмотрены виды, имею- Tetranychus) и Tenuipalpidae, (Klein, 1936)), красный томатный щие карантинный статус для Рос- а также 3 рода Tarsonemidae: паутинный клещ (Tetranychus сийской Федерации: галловый клещ Phytonemus, Polyphagotarsonemus, evansi Baker & Pritchard, 1960). фуксии (Aculops fuchsiae), красный Stenotarsonemus (http://www. В связи с вступлением в дей- томатный (Tetranychus evansi) и comlaw.gov.au; Seeman, Beard, 2005, ствие Единого перечня карантин- можжевельниковый (Oligonychus 2011). В Перечне карантинных ных объектов ЕАЭС с 1 июля 2017 perditus) паутинные клещи. вредных организмов ЕОКЗР ука- года (в ред. от 30.03.2018) крас- заны 4 вида Acariformes: в спис- ный томатный паутинный клещ Ключевые слова. Фитосанита- ке отсутствующих (А1) – можже- (Tetranychus evansi) (рис. 1), мож- рия, карантин растений, инвазии, жевельниковый паутинный клещ клещи, галловые клещи, паутин- (Oligonychus perditus) и галловый ные клещи, клещи-плоскотелки, клещ фуксии (Aculops fuchsiae) яв- Acari, Tetrapodili, Tenuipalpidae, ляются карантинным объектами Tetranychidae. для стран – участниц Евразийско- го экономического союза. Растительноядные клещи имеют Растительноядные клещи ха- значение для практики сельского хо- рактеризуются целым рядом осо- зяйства в качестве вредителей, пред- бенностей, которые способствуют ставляющих потенциально высокий их успешному распространению фитосанитарный риск. Эта эколо- (Бэкер, Уартон, 1955; Ланге, 1969; гическая группа паукообразных Navajas, Ochoa, 2013; Morphological объединяет по сходству питания Identification.., 2014): представителей акариформных кле- 1) мелкие размеры и крайняя щей (Acariformes): Tetranychoidea, степень редукции морфологиче- Eriophyoidea, Tarsonemidae, Acaridae ских структур (особенно показа- и др. (Лившиц, Митрофанов, 1975)1. тельны в этом отношении четы- Экономическое значение рас- Fig. 1. Female red tomato spider mite рехногие клещи – Eriophyoidea). Tetranychus evansi (photo by I.O. Kamayev) тительноядных клещей определя- В результате этого при существую- ет их регуляционный (карантин- Рис. 1. Внешний вид самки красного щих фитосанитарных процедурах ный) статус. Например, в Переч- томатного паутинного клеща снижается вероятность выявления не отсутствующих карантинных Tetranychus evansi вредителя, особенно при его низ- объектов Бразилии приводится (фото И.О. Камаева) кой численности. Особи могут рас-

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 13 пространяться и на стадии яйца. Японии (Pritchard & Baker, 1955). гена COI с праймерной системой Кроме того, точная идентификация Визуальный осмотр растительной LCO1490/ChR2 (Folmer et al., 1994; клещей требует наличия соответ- продукции, основанный на выяв- Barrett, Hebert, 2005) и последую- ствующего оборудования и уровня лении симптомов заражения рас- щим подтверждением результатов квалификации специалистов; тений клещами, не всегда может методом секвенирования (рис. 3). 2) редукция жизненного цикла быть эффективен, т. к. выражен- 2) Срезанные ветви и части по- при достаточно быстром развитии ные симптомы наблюдаются чаще бегов растений, включая срезку и малой продолжительности жиз- всего при высокой численности цветов, из мест распространения ни поколений. В случае инвазии вредителя. Однако в такой ситуа- вредителя. Этим путем особи мо- численность популяции вредите- ции продукция теряет товарные гут легко попадать на другие рас- ля может быстро увеличиваться в свойства и в большинстве слу- тения-хозяева, распространяясь короткие сроки; чаев такой товар отбраковыва- естественными путями. Регулярно 3) партеногенез (Olivier, 1971; ется еще на этапе производства. при проведении лабораторных ис- Weeks, Breeuwer, 2001; Normark, А при транспортировке и хране- следований встречаются заражен- Kirkendall, 2009). В этом случае нии товаров, как правило, условия ные паутинными клещами ветви достаточно одной самки-основа- не являются благоприятными для хвойных растений. В частности, на тельницы для формирования по- массового размножения вредите- ветвях ели (Picea sp.), которые были пуляции вредителя-инвайдера; лей. Кроме того, обитающие в тка- направлены в ФГБУ «ВНИИКР» 4) широкая полифагия, благо- нях галловые клещи при раннем для изучения, были выявлены яйца даря чему многие виды клещей заражении растения могут быть и живые особи Oligonychus ununguis способны обитать также на дико- и вовсе не выявлены при досмот- (Jacobi, 1905). В дальнейшем поме- растущих видах и сорной расти- ре или лабораторном исследова- щение зараженной клещом ветви тельности; нии, особенно на бессимптомном на саженец ели в лабораторных 5) формирование устойчивости растительном материале. Следует условиях привело к формирова- к действию акарицидов (Messing, отметить, что размещение зара- нию многочисленной популяции Croft, 1996; Dermauw et al., 2013). женного посадочного материала Oligonychus ununguis (рис. 4). С инвазией клещей связана с незараженным без соблюдения 3) Плоды растений-хозяев. Зна- проблема переноса сопутствую- правил карантина может приве- чение данного пути в первую оче- щих им фитопатогенов (Slykhuis, сти к заражению вредителем всего редь определяется вегетационным 1965; Stenger et al., 2005; Rodrigues, посадочного материала, напри- сезоном, в который плодовая про- Childers, 2013), которые могут вы- мер в питомнике или местах его дукция поступает на территорию зывать ослабление растений-хозя- временного хранения. Подобное страны. При этом исследователями ев, что также создает благоприят- наблюдалось с саженцами сосны, может недооцениваться данный ные условия для развития вредите- используемой в экспериментах путь в ходе проведении анализа ля и, возможно, способствует его с заражением данных растений фитосанитарного риска (АФР). последующей акклиматизации. нематодами, в боксе карантин- Примером может служить АФР Инвазия растительноядных кле- ной теплицы ФГБУ «ВНИИКР»; красного пальмового клеща-пло- щей, вероятнее всего, происходит на саженцах произошло массовое скотелки Raoiella indica Hirst, при перемещении растительной развитие клеща Oligonychus piceae 1924, выполненный для региона продукции (и в этом случае вели- (Reck, 1953), как показано на рис. 2, ЕОКЗР (PRA record for Raoiella ка роль антропогенного фактора), в результате чего, несмотря на об- indica, 08-14675), где было указа- тогда как случайный перенос без работки, погибли все растения, но, что плоды кокоса и бананов связи с растениями-хозяевами, включая контрольные, т. е. не за- не считаются релевантным путем например с транспортными сред- раженные нематодами. В этом слу- распространения вредителя. Од- ствами, маловероятен. На основа- чае представляется необходимым нако показателен пример из прак- нии проведенных анализов фито- прибегать к такой фитосанитарной тики. В частности, Министерство санитарного риска (АФР) расти- мере, как выдерживание посадоч- сельского хозяйства Бразилии тельноядных клещей представля- ного и горшечного материала в установило карантинные требова- ется, что основными путями про- условиях карантина (карантинной ния к внутреннему перемещению никновения данных вредителей в теплицы) для проявления симпто- растительной продукции, включая зависимости от типа растительной мов и обнаружения вредителей. плоды кокоса и банана, для пре- продукции являются: Для лабораторных исследований дотвращения расселения каран- 1) Посадочный и горшечный (экспертизы) в случае подозрения тинного красного пальмового кле- материал из мест распростране- на возможное заражение клеща- ща в регионе и минимизации ри- ния вредителя – один из наиболее ми материала может иметь зна- сков для производства (Rodrigues, вероятных путей инвазии клещей. чение отбор растительных тканей Antony, 2011). Связь раститель- Интересным примером может слу- для выявления ДНК карантинных ноядных клещей с плодами под- жить то, что можжевельниковый клещей. В наших экспериментах из черкивается в соответствующем паутинный клещ был описан по зараженного обыкновенным пау- стандарте Североамериканской образцам, обнаруженным каран- тинным клещом растительного ма- организации по защите растений тинной службой США на расте- териала2 была выделена ДНК дан- (Morphological Identification.., ниях можжевельника Juniperus из ного вида вредителя по фрагменту 2014). Наглядным примером мо-

14 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Fig. 2. A pine seedling affected by the mite Oligonychus piceae (the photo by the Department on public relations of the FGBU “VNIIKR”) Рис. 2. Саженец сосны, пораженный клещом Oligonychus piceae (фото отдела по связям с общественностью ФГБУ «ВНИИКР»)

жет служить тот факт, что в нашей сложным предметом исследова- article-5927). В 2004 году красный практике на импортной продукции ния. Отмечается, что при суще- пальмовый клещ был обнаружен «яблоки свежие» были выявлены ствующих торговых отношениях, в Западном полушарии, на Марти- жизнеспособные яйца Tetranychus транспортных перевозках распро- нике и Св. Люсии, в последующем urticae, из которых в лабораторных странение клещей происходит до- он быстро распространился на условиях были выведены взрослые статочно быстро (Navajas, Ochoa, территорию островов Карибского особи клещей. 2013). Ситуация усугубляется тем, бассейна, оказывая негативное воз- Кроме того, возможно распро- что в случае инвазии естествен- действие на плантации кокосовой странение растительноядных кле- ное распространение вредителя пальмы и бананов. С 2007 года вре- щей с насекомыми и клещами – чрезвычайно сложно ограничить. дитель отмечен в Венесуэле и США агентами биологической борьбы Наиболее ярким примером служит (Флорида), по меньшей мере на 25 (биоагентами). Растительноядные исследование и документация ин- видах растений-хозяев (Gutierrez виды клещей могут быть использо- вазии красного пальмового клеща et al., 2007; Welbourn, 2007). В США ваны в качестве кормовой базы для Raoiella indica (Dowling et al., 2010, проводится поиск биоагентов для биоагентов или случайно попасть в 2012). Вид был описан из Индии подавления негативной активно- их культуры, например, приводят- в 1924 году и позже обнаружен в сти красного пальмового клеща ся сведения о случаях заражения странах Старого Света, включая (Carillo et al., 2010). В 2009 году культур хищного клеща Phytoseiulus Переднюю Азию. Первоначально этот вид обнаружен в Бразилии карантинным для ЕАЭС Tetranychus выдвигалась гипотеза, что этот вид (Rodrigues, Antony, 2011). Таким об- evansi (https://agroinfo.com.., 2016). имеет происхождение из Передней разом, данный пример показывает, При успешной инвазии клещей Азии, но в последующем анализ что применение превентивных фи- дальнейшее их распространение про- молекулярно-генетических дан- тосанитарных мер по отношению к исходит как при внутреннем переме- ных позволил предположить, что клещам более эффективно для пре- щении растительной продукции, так скорее всего красный пальмовый дотвращения их распространения, и с инвентарем, спецодеждой и др., клещ происходит с австралийско- чем попытки локализации возника- а также естественными путями, к го континента (Roda et al., 2008). В ющих очагов. числу которых относятся: перенос период с 2004 по 2010 гг. красный Ниже рассмотрим несколько при- ветром, водой, насекомыми-опылите- пальмовый клещ распространился меров растительноядных клещей, лями, в редких случаях птицами и др. в Бенине и Танзании (CABI, 2017), представляющих фитосанитарный Инвазионная активность клещей а в 2016 году выявлен в Намибии и риск для территории Российской Фе- является важным и одновременно ЮАР (https://gd.eppo.int/reporting/ дерации (здесь и далее – зона АФР).

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 15 Красный томатный паутинный (Bonato, 1999). В случае обработок точно для обоснования популя- клещ (Tetranychus evansi) плодов сохраняется возможность ции, так как у них очень высокая Семейство Паутинные клещи – сохранения жизнеспособных яиц плодовитость и они спаривают- Tetranychidae. вредителя. С учетом размеров вре- ся, как правило, сразу после от- Таксономический статус и дителя при досмотре сохраняется рождения (Bonato, 1999; Moraes возможность идентификации: риск проникновения клещей, в том & McMurtry, 1987). Вид может вид считается самостоятельным числе на стадии яйца. Наиболее распространиться повсеместно и может быть идентифицирован высокий риск представляет зара- в условиях защищенного грунта. (Baker & Pritchard, 1960; Seeman, женная продукция, поставляемая Сорные растения будут являться Beard, 2011; Камаев, Миронова, в вегетационный период, так как резерватами клещей на террито- 2016). сохраняется возможность про- риях с благоприятным климатом. Регуляционный статус: ЕАЭС, должения развития клеща и его На основании того, что для разви- Российская Федерация – в списке переноса естественным путем на тия вредителя в закрытом грунте отсутствующих организмов А1; растения-хозяева. требуется 148 градусо-дней при ЕОКЗР – А2. 2) Посадочные растения семей- пороге выше 13,2 °C (Moraes & Географическое распростране- ства Пасленовые. Данный путь McMurtry, 1987), можно предпо- ние: Европа: Греция, Испания, Ита- имеет значение в случае распро- ложить, что T. evansi может очень лия, Португалия, Франция, Сербия; странения вредителя в страны, из легко выжить на протяжении Азия: Израиль, Иордания, Тайвань, которых возможны поставки по- всего года, с возможным разви- Турция, Сирия, Япония3; Африка: садочного материала – растений тием 10-15 поколений в отап- Алжир, Бенин, Гамбия, Замбия, пасленовых в зону АФР. ливаемой теплице за год. Растения – Зимбабве, Кения, Конго, Республи- 3) Биоагенты – насекомые и хозяева красного томатного кле- ка Конго, Маврикий, Малави, Ма- клещи. Продукция, имеющая про- ща широко распространены в рокко, Мозамбик, Намибия, Нигер, исхождение из стран, где распро- зоне АФР, по климатическим усло- Сенегал, Сейшелы, Сомали, Уганда, странен вредитель. виям для вредителя наиболее бла- Танзания, Тунис, ЮАР; Америка: Случаи инвазии: предполагает- гоприятны Южный и Северо-Кав- США, Бразилия; Австралия. ся, что вид происходит из Южной казский федеральные округа. Растения-хозяева: T. evansi Америки, откуда он широко рас- Оценка потенциального эконо- является полифагом. Он заре- пространился по миру. В странах мического воздействия: высокая, гистрирован на растениях из 33 Африки (Марокко, ЮАР) красный так как вид будет наносить вред семейств. Большинство расте- томатный клещ известен с сере- такой экономически значимой ний-хозяев принадлежат к семей- дины 1980-х гг., в последующие сельскохозяйственной культуре, ству Solanaceae. годы вид был отмечен во многих как томат, повсеместно в условиях Главными повреждаемыми куль- странах африканского континен- защищенного грунта и на терри- турами из пасленовых являются та, являющихся производителями тории Южного и Северо-Кавказ- томат (Lycopersicon esculentum), плодов томата (в частности, в Се- ского федеральных округов, где баклажан (Solanum melongena), негале). В Европе инвазия крас- сконцентрировано производство картофель (S. tuberosum), табак ного томатного клеща достоверно томатов открытого грунта (состав- (Nicotiana tabacum) и в меньшей зарегистрирована с начала 2000-х. ляющее более 70% от всего про- степени перец (Capsicum annuum). В 2013 году вид впервые выявлен изводства томатов; https://www. Фасоль (Phaseolus vulgaris) явля- на территории Австралии (окр. openbusiness.ru). Отмечается, что ется экономически значимой по- Сиднея), а в 2017 году поступи- стандартные методы биологиче- вреждаемой культурой не из пас- ли сообщения о находках вида из ского контроля (хищные клещи леновых. окрестностей Брисбена, что может Phytoseiulus persimilis и Neoseiulus Пути проникновения: свидетельствовать о постепенном californicus) против обсуждаемого 1) На плодах томата, баклажа- распространении вида по террито- вида неэффективны (Escudero & на и перца. Наличие зеленых ча- рии материка. В 2017 году вид за- Ferragut, 2005). стей на плодах увеличивает риск регистрирован в Сербии и Турции переноса большего числа особей (https://gd.eppo.int/taxon/TETREV; Можжевельниковый паутин- вредителя, присутствия разных Kazak et al., 2017). ный клещ (Oligonychus perditus) жизненных стадий (яйцо, личинка, Вероятность проникновения Семейство Паутинные клещи – взрослые особи). С учетом боль- вредителя: оценивается как вы- Tetranychidae. ших объемов импортирования сокая, наиболее вероятный путь Таксономический статус и плодов томата в Россию из стран, проникновения – плоды томата из возможность идентификации: вид где вредитель распространен, риск стран распространения вредителя. считается самостоятельным и может проникновения клеща возрастает. В условиях существующих фитоса- быть идентифицирован (Pritchard & Условия хранения и транспорти- нитарных процедур сохраняется Baker, 1955; Митрофанов и др., 1975; ровки продукции не будут сказы- риск не выявить вредителя (на раз- Камаев, 2017) (рис. 5). ваться негативно, T. evansi может ных онтогенетических стадиях). Регуляционный статус: Рос- выживать при пониженной тем- Вероятность акклиматизации: сийская Федерация, Турция, ЕС, пературе, но при этом не может оценивается как высокая. Одной ЕОКЗР – А1; Израиль – карантин- развиваться или размножаться самки паутинного клеща доста- ный список.

16 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Fig. 3. Experiment with the spider mite Tetranychus urticae DNA detection from infected plants of Bidens sp. (1-10), uninfected Bidens sp. (11); DNA of uninfected plants Bidens sp., combined with the DNA of the mites Tetranychus urticae (12-13), the DNA of Tetranychus urticae (14-15), negative control (16). Two primer systems are used (18s/28s and LCO1490/ChR2), derived fragments were sequenced to confirm the results (photo of the plants by A.B. Yaremko)

Рис. 3. Эксперимент с выявлением ДНК паутинного клеща Tetranychus urticae из зараженных растений Bidens sp. (1-10), незараженных растений Bidens sp. (11), ДНК незараженных растений Bidens sp., смешанная с ДНК клещей Tetranychus urticae (12-13), ДНК клещей Tetranychus urticae (14-15), отрицательный контроль (16). Использованы две праймерные системы (18s/28s и LCO1490/ChR2), полученные фрагменты были секвенированы для подтверждения результатов (фото растения А.Б. Яремко)

Географическое распростране- Taxaceae: тис остроконечный (Taxus Японии. Включение данного вида ние: Азия: Китай, Республика Ко- cuspidata). в Перечень карантинных вредных рея, Япония. Следует отметить, что в Нидерлан- организмов ЕС последовало в ре- Растения-хозяева4: сем. Кипари- дах в лабораторных экспериментах зультате обнаружений вредителя совые (Cupressaceae): кипарисовик клещ успешно развивался на рас- на сильно зараженных растениях (Chamaecyparis), кипарис плакучий тениях можжевельника видов можжевельника Juniperus (бон- (Chamaecyparis funebris), кипарисо- J. communis, J. x media, J. sabina, сай) карантинной службой Ни- вик туполистный (Chamaecyparis J. virginiana и плосковеточника дерландов. Можжевельниковый obtusa), кипарисовик горохоплод- Platycladus orientalis (EPPO, 1997), клещ выявлялся на продукции – ный (Chamaecyparis pisifera), фо- однако следующие виды расте- растениях можжевельника, по- киения (Fokienia hodginsii), мож- ний клещом не поражались: ки- ставляемой в Нидерланды в 1992 жевельник китайский (Juniperus парисовик Лоусона Chamaecyparis году и в Германию в 1991-1992 гг. chinensis), можжевельник формоз- lawsoniana, ель обыкновенная Picea С 1999 по 2007 год в базе EUROPHYT ский (Juniperus formosana), можже- abies, сосна стланиковая европей- отмечено 8 случаев выявления кле- вельник твердый (Juniperus rigida), ская Pinus mugo, тис ягодный Taxus ща O. perditus на импортируемой в можжевельник казацкий (Juniperus baccata и др. страны ЕС продукции – растениях sabina), можжевельник виргин- Пути проникновения: можжевельника (бонсай) из Япо- ский (Juniperus virginiana), плоско- 1) Посадочный материал и нии (Pest categorisation.., 2017). веточник восточный (Platycladus горшечные растения. В США в 2) Срезанные ветви. Достовер- orientalis); сем. таксодиевые 1950-е гг. этот вид был выявлен ных находок вредителя пока за- (Taxodiaceae): криптомерия япон- на посадочном материале расте- регистрировано не было, однако ская (Cryptomeria japonica); сем. ний можжевельника Juniperus из с учетом имеющихся данных этот

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 17 путь представляет потенциальный Таксономический статус и жизнеспособность и остаться не- риск, особенно в период вегетации. возможность идентификации: обнаруженным. Случаи инвазии: достоверных вид считается самостоятельным Вероятность акклиматизации: сведений об инвазии вредителя нет. и может быть идентифицирован низкая, так как отсутствует подхо- Вероятность проникновения (Keifer, 1972). дящая кормовая база для форми- вредителя: оценивается как высо- Регуляционный статус: Рос- рования устойчивой популяции кая, так как в условиях существу- сийская Федерация, Турция – А1; вредителя. ющих фитосанитарных процедур ЕОКЗР – А2. Оценка потенциального эконо- можжевельниковый клещ может Географическое распростра- мического воздействия: низкая, выживать, сохранять жизнеспо- нение: Америка: Бразилия, США, в связи с характером распростра- собность и оставаться необнару- Чили; Европа: Франция Велико- нения растений – хозяев клеща. женным; имеются сведения о пе- британия, Германия. Данный вид вредителя может на- рехватах вредителя на продукции; Растения-хозяева: вид до- носить ограниченный вред оран- предполагается, что движение гру- стоверно повреждает растения жерейным и комнатным растени- зов (посадочного материала и гор- рода Fuchsia, включая по мень- ям, в большинстве своем фуксии, а шечных растений – хозяев клеща) шей мере три вида (F. arborescens, также рассаде фуксии при контак- из региона распространения вре- F. magellanica, F. procumbens) и бо- те растений друг с другом. дителя в зону АФР существенное; лее 30 сортов. вид способен переживать неблаго- Этот экзотический род расте- Литература приятные условия (поэтому время ний натурализован в ряде регио- 1. Бэкер Э., Уартон Г. Введение прибытия грузов не будет иметь нов Европы как в открытом, так и в акарологию. М.: Изд-во ин. лит- первостепенного значения). в закрытом грунте. Информации о ры, 1955. 476 с. Вероятность акклиматизации: натурализации растений фуксии в 2. Камаев И.О. Идентифика- высокая, так как вредитель мо- России не найдено. Горшечные рас- ция можжевельникового паутин- жет легко попасть на подходящие тения различных видов и сортов ного клеща Oligonychus perditus растения, которые широко рас- фуксии выращиваются преимуще- Pritchard & Baker, 1955 (Arachnida: пространены в зоне АФР, кроме ственно в помещениях (комнатных Trombidiformes: Tetranychidae) // того, вид отмечен на культурах условиях, оранжереях и теплицах). Карантин растений. Наука и прак- защищенного грунта (например, Пути проникновения: посадоч- тика, 2017. № 3 (21). С. 36-48. бонсай); дикорастущие растения ные и горшечные растения фуксии. 3. Камаев И.О., Миронова М.К. могут служить резерватами вреди- Случаи инвазии: известны дан- Характеристика трофического теля; на территории России имеют- ные об инвазионной активности спектра и диагностических при- ся климатические зоны (особенно галлового клеща. Предположи- знаков красного томатного паутин- территория Южного федерального тельно клещ происходит с терри- ного клеща Tetranychus evansi Baker округа), сходные с теми, в которых тории Южной Америки. Вид был & Pritchard, 1960 (Acariformes: встречается вредитель в своем случайно ввезен в Сан-Франциско Tetranychidae) // Карантин расте- естественном ареале. (США) в 1981 году, откуда стал бы- ний. Наука и практика, 2016. № 2 Оценка потенциального эконо- стро распространяться в Калифор- (16). С. 12-19. мического воздействия: средняя. нии (Ostojá-Starzewski et al., 2007). 4. Ланге А.Б. Трилобиты и хели- Следует заметить, что в настоящее Имеются следующие сведения церовые // Жизнь животных. Т. 3. время потери от можжевельниково- об инвазии клеща на территорию Членистоногие. М.: Просвещение, го клеща в его современном ареале Европы: впервые галловый клещ 1969. С. 7-134. не оценены, хотя сведения о серьез- фуксии был отмечен в 2002-2003 гг. 5. Лившиц И.З., Митрофанов В.И. ном вреде растениям-хозяевам из- во Франции и, несмотря на при- Растениеобитающие клещи // вестны (Pest categorisation.., 2017). нятые меры по ликвидации оча- Тр. Гос. Никитского бот. сада, 1975. Предполагается, что прямой вред гов, стал распространяться по Т. 66. С. 1-183. может быть нанесен питомникам, северо-западной Франции. В 2007 6. Митрофанов В.И., Босенко Л.И., выращивающим декоративные ки- году вид зарегистрирован в Гер- Бическис М.Я. Определитель те- парисовые. Вред может проявляться мании, в районе Касселя. Первая траниховых клещей хвойных по- в ухудшении внешнего вида (рис. 6), регистрация клеща в Великобри- род // Latvijas Entomolog. Suppl., а при сильном заражении вплоть до тании произошла летом 2007 года, 1975. C. 1-42. гибели деревьев, используемых в са- отмечена перезимовка клеща и 7. МСФМ 5. https://www.ippc.int/ довом дизайне и городском озелене- постепенное его распространение ru/publications/621. нии. Локализация очагов возможна по территории южной Англии, а 8. Перечень регулируемых объ- лишь при невысоком заражении, при также на островах Гернси и Джер- ектов А1 Бразилии. http://extranet. сплошном заселении возможно толь- си (Ostojá-Starzewski et al., 2007; agricultura.gov.br/sislegis-consulta/ ко замедлить расширение ареала. https://gd.eppo.int/taxon/ACUPFU). servlet/VisualizarAnexo?id=14532. Вероятность проникновения 9. Список регулируемых объ- Галловый клещ фуксии (Aculops вредителя: оценивается как сред- ектов Турции. https://www.ippc. fuchsiae) няя, так как в условиях существу- int/static/media/files/ Семейство Четырехногие клещи – ющих фитосанитарных процедур reportingobligation/2017/02/20/Entry_ Eriophyidae. клещ может выживать, сохранять into_force_1_4_2016_Annexes.pdf.

18 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 10. Australia. Quarantine 19. Folmer O., Black M., Hoeh W., 28. Normark B.B., Kirkendall L.R. Proclamation 1998. http://www. Lutz R., Vrijenhoek R. DNA primers Parthenogenesis in Insects and Mites // comlaw.gov.au /Details/F2011 for amplification of mitochondrial Encyclopedia of Insects (Second C00906/80ddb542-9e7c-4366-b6b7- cytochrome c oxidase subunit I from Edition), 2009. P. 753-757. b500f095ba58. diverse metazoan invertebrates // 29. Oliver Jr.J.H. Parthenogenesis 11. Baker E.W., Pritchard A.E. Molecular Marine Biology and in Mites and Ticks (Arachnida: The tetranychoid mites of Africa // Biotechnology, 1994. Vol. 3. P. 294-299. Acari) // Am. Zoologist, 1971. Hilgardia, 1960. Vol. 29. P. 455-574. 20. Gotoh T., Araki R., Boubou A., Vol. 11. P. 283-299. 12. Barrett R.D.H., Hebert P.D.N. Migeon A., Ferragut F. and Navajas M. 30. Ostojá-Starzewski J.C., Eyre D. Identifying spiders through DNA Evidence of co-specificity between Fuchsia gall mite. Aculops fuchsiae. barcodes // Canadian Journal of Tetranychus evansi and Tetranychus Plant Pest Factsheet. The Food and Zoology, 2005. 83. P. 481-491. takafujii (Acari: Prostigmata, Environment Research Agency 13. Bonato O. The effect of Tetranychidae): comments on (FERA), York, UK. 2012. 4 pp. temperature on life history parameters taxonomic and agricultural aspects // 31. Pest categorisation of of Tetranychus evansi (Acari: International Journal of Acarology, Oligonychus perditus / EFSA Tetranychidae) // Experimental & 2009. 35. 6. P. 485-501. Panel on Plant Health (PLH), Applied Acarology, 1999. Vol. 23 (1). 21. Gutierrez B., Nohelia N., Gar- Michael Jeger, Claude Bragard, P. 11-19. cia A. Situacion actual del cocotero in David Caffier, Thierry Candresse, 14. Carrillo D., Peña J.E., Hoy M.A., al municipio Valdez del estado Sucre. Elisavet Chatzivassiliou, Katharina Frank J.H. Development and In: Produccion y Negocio. Available Dehnen‐Schmutz, Gianni Gilioli, reproduction of Amblyseius largoensis via DIALOG. 2007. http://www. Josep Anton Jaques Miret, Alan (Acari: Phytoseiidae) feeding on pollen, produccionynegocio.com/edicion_20/ MacLeod, et al. // EFSA journal. Raoiella indica (Acari: Tenuipalpidae), cocotero.htm. Accessed 29 Sept 2009. First Published: 27 November and other microarthropods inhabiting 22. Kazak C., Döker I., Karut K. 2017. 20 p. DOI: 10.2903/j. coconuts in Florida, USA // First record of invasive tomato efsa.2017.5075. Experimental and Applied Acarology, spider mite Tetranychus evansi 32. PRA record for Raoiella indica, 2010. Vol. 52 (2). P. 119-129. (Acari: Tetranychidae) in Turkey // 08-14675. 39 p. https://gd.eppo.int/ 15. Dermauw W., Wybouw N., International Journal of Acarology, taxon/RAOIIN/documents. Rombauts S., Menten B., Vontas J., 2017. 43 (4), 325-328. 33. Pritchard A.E., Baker E.W. Grbic M., Clark R.M., Feyereisen R., 23. Keifer H.H. Eriophyid A revision of the spider mite Van Leeuwen T. A link between studies C-6. 1972. P. 1-24. A spe- family Tetranychidae // Memoirs host plant adaptation and pesticide cial publication of the Bureau of Series, San Francisco, Pacific Coast resistance in the polyphagous spider Entomology, California Department Entomological Society, 1955. № 2. mite Tetranychus urticae // Proc. of Agriculture, with funding from P. 1-472. Natl. Acad. Sci. USA, 2013. Vol. 110 the Agricultural Research Service, 34. Roda A., Dowling A., Wel- (2). P. 113-122. US Department of Agriculture. bourn C., Pena J., Rodrigues J.C.V., 16. Dowling A., Ochoa R., Онлайн-доступ: http://www.cdfa. Hoy M., Ochoa R., Duncan R.A., Welbourn W., Beard J. Raoiella ca.gov/plant/ppd/publications/ Wayne D.Ch. Red palm mite situation indica: (Acari: Tenuipalpidae): eriophyid_studies.html. in the Caribbean and Florida // a rapidly expanding generalist 24. Messing R.H., Croft B.A. Proceedings of the Caribbean Food among specialist congeners // XIII Pesticide resistance in eriophyoid Crops Society, 2008. Vol. 44 (1). International Congress of Acarology, mites, their competitors and P. 80-87. Recife, Brazil, 23-27 August 2010. predators // World Crop Pests, 1996. 35. Rodrigues J.C.V., Anto- P. 72-73. Vol. 6. P. 689-694. ny L.M.K. First Report of Raoiella 17. Dowling A.P.G., Ochoa R., 25. Moraes G.J. de, McMurtry J.A. indica (Acari: Tenuipalpidae) in Beard J.J., Welbourn W.C., Effect of temperature and sperm Amazonas State, Brazil // Florida Ueckermann E.A. Phylogenetic supply on the reproductive potential Entomologist, 2011. Vol. 94 (4). investigation of the genus Raoiella of Tetranychus evansi (Acari P. 1073-1074. (Prostigmata: Tenuipalpidae): Tetranychidae) // Experimental and 36. Rodrigues J.C.V., Chil- diversity, distribution, and world Applied Acarology, 1987. Vol. 3 (2). ders C.C. Brevipalpus mites invasions // Experimental and P. 95-108. (Acari: Tenuipalpidae): vectors of Applied Acarology, 2012. Vol. 57 26. Morphological Identification invasive, non-systemic cytoplasmic (3/4). P. 257-269. of Spider Mites (Tetranychidae) and nuclear viruses in plants // 18. Escudero L.A., Ferragut F. Life- affecting Imported Fruits. DP 03. Exp. Appl. Acarol., 2013. Vol. 59. history of predatory mites Neoseiulus Prepared by the members of the P. 165-175. californicus and Phytoseiulus NAPPO Expert Group (previous 37. Seeman O., Beard J. National persimilis (Acari: Phytoseiidae) on Technical Advisory Group) on Fruit diagnostic standards for Tetranychus four spider mite species as prey, Tetranychus Mites, 2014. 30 p. spider mites // Plant Health Australia, with special reference to Tetranychus 27. Navajas M., Ochoa R. 2005. 128 p. evansi (Acari: Tetranychidae) // Integrating ecology and genetics to 38. Seeman O.D., Beard J.J. Biological Control, 2005. Vol. 32 (3). address Acari Invasions // Exp. Appl. Identification of exotic pest and P. 378-384. Acarol., 2013. № 59. P. 1-10. Australian native and naturalised

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 19 species of Tetranychus (Acari: html and http://www.doacs.state. их связи с зерном и продуктами Tetranychidae) // Zootaxa, 2011. fl.us/pi/caps/rpm_maps/ RPM_ его переработки. Vol. 2961. P. 1-72. Base_Map_34x44.pdf. 2 Исследования проводили с 39. Slykhuis J.T. Mite Transmission 43. https://agroinfo.com/ Tetranychus urticae C.L. Koch, 1836. of Plant Viruses // Advances in Virus biologicheskij-metod-zashhity- Растительный материал был пред- Research, 1965. Vol. 11. P. 97-137. rastenij-legendy-i-mify-preimush- варительно очищен от особей и 40. Stenger D.C., Hein G.L., hestva-i-aktualnost-0402201602. следов жизнедеятельности данно- Gildow F.E., Horken K.M., French R. 44. https://gd.eppo.int/reporting/ го вида вредителя. Plant Virus HC-Pro Is a Determinant article-5927. 3 Вид для Японии описан как of Eriophyid Mite Transmission // 45. https://gd.eppo.int/taxon/ T. takafujii Ehara & Ohashi, 2002, J. Virol., 2005. Vol. 79 (14). P. 9054- ACUPFU. впоследствии было установлено, 9061. 46. https://gd.eppo.int/taxon/ что это младший синоним T. evansi 41. Weeks A.R., Breeuwer J.A. TETREV. (Gotoh et al., 2009). Wolbachia-induced parthenogenesis 47. https://www.cabi.org/isc/ 4 В списке растений-хозяев так- in a genus of phytophagous mites // datasheet/46792. же приведены следующие виды: Proc. Biol. Sci., 2001. Vol. 268 (1482). 48. https://www.openbusiness.ru/ черешня Prunus avium, слива P. 2245-2251. biz/business/obzor-rynka-tomatov- китайская Prunus salicina и чай 42. Welbourn C. Pest Alert: Red v-rossii. Camellia sinensis, однако они при- palm mite, Raoiella indica Hirst ведены как растения, на которых (Acari: Tenuipalpidae). In: Florida 1 Особую группу составляют вид был отмечен, но нет инфор- Department of Agriculture and клещи – вредители запасов из се- мации о том, что они поврежда- Consumer Services. Available via мейств Acaridae и Glycyphagidae, ются вредителем, и поэтому не DIALOG. 2007. http://www.doacs. которые не будут рассмотрены в рассматриваются как растения- state.fl.us/pi/enpp/ento/ r.indica. данной работе в силу специфики хозяева.

UDC 632.654

PHYTOSANITARY RISK OF HERBIVOROUS MITES (ARACHNIDA: ACARIFORMES)

I.O. Kamayev, Senior Researcher of the Research and Testing Department of FGBU “VNIIKR” M.K. Mironova, Leading Researcher of the Entomological Research and Methodology Department of FGBU “VNIIKR”

Abstract. The article discusses the Keywords. Phytosanitary, (Acariformes) with similar feeding features of the herbivorous mites, which plant quarantine, invasions, mites, types: Tetranychoidea, Eriophyoidea, determine their potential phytosanitary gall mites, spider mites, flat mites, Tarsonemidae, Acaridae and others risk. Examples of phytosanitary risks Acari, Tetrapodili, Tenuipalpidae, mites (Livshits, Mitrofanov, 1975)1. that may be associated with the mites Tetranychidae. The economic importance of are observed; the quarantine species for herbivorous mites determines their the Russian Federation are discussed in Herbivorous mites are important quarantine status. For example, the detail: the fuchsia gall mite (Aculops agricultural pests with a high List of Quarantine Pests absent from fuchsiae), the red tomato spider mite potential phytosanitary risk. This Brazil includes 22 species of mites (Tetranychus evansi) and the juniper ecological group of arachnids (http://extranet.agricultura.gov.br), spider mite (Oligonychus perditus). incorporates acariform mites the same List of Turkey includes 3

20 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Рис. 4. Саженец ели, погибший в результате заражения Oligonychus ununguis (фото И.О. Камаева) Fig. 4. The fir-tree seedling, died due to infestation by Oligonychus ununguis (photo by I.O. Kamayev) species (5 quarantine Acariformes in perditus), and the fuchsia gall mite for population formation of the pest total; https://www.ippc.int). (Aculops fuchsiae) are included into invader; Tetranychidae (at least 14 this List. 4) polyphagy, due which many species of the genus Tetranychus) Herbivorous mites are mite species are able live on wide and Tenuipalpidae, as well characterized by a number of features range of plants, including wild and as 3 genera of Tarsonemidae: that contribute to their successful weed species; Phytonemus, Polyphagotarsonemus, distribution (Becker, Wharton, 1955; 5) the development of acaricide Stenotarsonemus (http://www. Lange, 1969; Navajas, Ochoa, 2013; resistance (Messing, Croft, 1996; comlaw.gov.au; Seeman, Beard, Morphological Identification.., 2014): Dermauw et al., 2013). 2005, 2011) are included into the 1) small size and extreme Invasion of mites is connected with List of absent quarantine objects of reduction of morphological the transmitting of phytopathogens Australia. 4 Acariformes species are structures (the most illustrative (Slykhuis, 1965; Stenger et al., 2005; presented in the EPPO List of pests example is four-legged mites of Rodrigues, Childers, 2013), which can recommended for regulation as Eriophyoidea superfamily). As a cause a weakening of host plants, that quarantine pests: the juniper spider result, the existing phytosanitary creates favorable conditions for the mite (Oligonychus perditus Pritchard procedures are not effective enough pest development and may contribute & Baker, 1955) is in the A1 List of for detecting the pest, especially to its subsequent establishment. pests are absent from the EPPO when their population is low. They Invasion of herbivorous mites region; the fuchsia gall mite (Aculops can spread with eggs as well. In highly likely occurs during fuchsiae Keifer, 1972), the citrus addition, accurate identification transferring plant products (in this brown mite (Eutetranychus orientalis of mites requires appropriate case the role of human activity is very (Klein, 1936)) and the red tomato equipment and high qualification significant), whereas random carry spider mite (Tetranychus evansi Baker level of specialists; for example by vehicles, without & Pritchard, 1960) are in the A2 List 2) reduction of the life cycle and link with the host plants, is unlikely. of pests are locally present in the a sufficiently rapid development According to the pest risk analyses EPPO region. and short generation time. In the (PRA) of herbivorous mites it seems In accordance with of the Common case of invasion, the pest population that the main pathways for entry of list of quarantine objects for the can increase rapidly within a short these pests depending on the type of Eurasian Economic Union (EAEU) period of time; plant products are: since 1 July 2017 (as amended from 3) parthenogenesis (Olivier, 1971; 1) Plants for planting and potted 30.03.2018), the red tomato spider Weeks, Breeuwer, 2001; Normark, plants from the places of the pest mite (Tetranychus evansi) (Fig. 1), Kirkendall, 2009). In this case, a distribution are one of the most the juniper spider mite (Oligonychus single founder-female is sufficient probable pathways of the mite entry.

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 21 An interesting example of such 2) Cut branches and sapling pieces, Upon successful invasion the invasion is that the juniper spider including flower cutting, from the mites continue its spread both with mite was described by the quarantine pest areas. This is an easy transfer domestic movement of the plant service of the USA from samples to other host plants due the natural products and with equipment, of Juniperus that came from Japan spread. Regularly during laboratory protective clothing and naturally: (Pritchard & Baker, 1955). Visual studies spider mites are found on transmitting by wind, water, insects- examination of plant products based branches of coniferous plants. In pollinators and sometimes birds. on symptoms identification of mite particular, eggs and live individuals of Invasive activity of mites is an infestation is not always effective, Oligonychus ununguis (Jacobi, 1905) important and difficult research because symptoms often are visible were detected on branches of a spruce subject. It should be noted that when the population of the pests (Picea sp.), which were sent to the within the framework of the is high. However, in this situation, FGBU “VNIIKR” for the study. Later existing trade relations and the products lose commercial value the branch infested by the mite was transport situation the distribution and in most cases they are already placed on the spruce sapling that led of mites is rather fast (Navajas, culled out at the production stage. to a formation of a large population of Ochoa, 2013). The situation is Transportation and storage conditions Oligonychus ununguis (Fig. 4). even more complicated because usually are not favorable for increase 3)Fruits of host plants. The the natural spread of the pest is in prevalence of pests. In addition, significance of this pathway is extremely difficult to be controlled gall mites that live in the plant tissues, primarily determined by the growing in case of invasion. The most can be overlooked during inspection season, when fruit products come to illustrative example is the study or laboratory examination at the the country. During pest risk analysis and documentation of the red palm early stage of infestation, especially (PRA) researchers can underestimate mite Raoiella indica (Dowling et al., with asymptomatic plant material. this way. An example is PRA of the 2010, 2012) invasion. The species It should be noted that the placing red palm flat mite Raoiella indica was described in 1924 from India of the infested plants for planting Hirst, 1924, performed for EPPO and later was discovered in the Old together with uninfected plants region (PRA record for Raoiella World, including Western Asia. for planting without following the indica, 08-14675) which stated that Initially a hypothesis was made quarantine requirements may lead to fruit of coconut and banana are not a that this species originates from the the pest infestation of all plants for relevant pathway. However, example Western Asia, but the subsequent planting, for example in a nursery from practice is very illustrative. In analysis of molecular genetic data or places of temporary storage. The particular, the Ministry of Agriculture led to perceptions that most likely similar situation was observed in of Brazil has established quarantine the red palm mite originates from the experiments with the infested requirements for internal movement the Australian continent (Roda et by nematodes pine seedlings, in the of plant products, including fruit al., 2008). Within the period from quarantine greenhouse box of the of coconut and banana, in order to 2004 to 2010 the red palm mite has FGBU “VNIIKR”; on the seedlings prevent the spread of the red palm spread over the territory of Benin there was a massive population of mite in the region and minimize the and Tanzania (CABI, 2017), and in the mite Oligonychus piceae (Reck, production risks (Rodrigues, Antony, 2016 was detected in Namibia and 1953), as shown in Fig. 2. As a result, 2011). The links of herbivorous mites South Africa (https://gd.eppo.int/ despite the treatment procedures, with the fruit are highlighted in the reporting/article-5927). In 2004, the all plants died, including control relevant standard of North American red palm mite was discovered in the group, i.e. seedlings not infested organization for plant protection Western hemisphere in Martinique by nematodes. In this case, it is (Morphological Identification.., and Saint Lucia, and then it spread necessary to use such a phytosanitary 2014). An illustrative example was the quickly over the Islands of the measure, as keeping plants for case in our practice when imported Caribbean and negatively influenced planting and potted material in products “fresh apples” had viable on plantations of coconut palms quarantine conditions (quarantine eggs of Tetranychus urticae on them and bananas. Since 2007 the pest greenhouse conditions) to define from which adult mites emerged later has been detected in Venezuela and the symptoms and detect the pests. in laboratory. the USA (Florida), on more than 25 The sampling of plant tissue for 4) Besides the above mentioned, species of host plants (Gutierrez et quarantine mite DNA identification biological control agents – insects al., 2007; Welbourn, 2007). In the may be important for laboratory and mites – can become a pathway USA the search of bioagents for investigation in case of potential for herbivorous mites as well. suppressing the negative activity mite infestation of the material. In Herbivorous mite species can be used of the red palm mite (Carillo et our experiments DNA of this pest as fodder for the bioagents or they can al., 2010) is being conducted. In was extracted from plant material2 accidentally present in their cultures, 2009 this species was discovered in infested by the common mite for example, there is information Brazil (Rodrigues, Antony, 2011). according to the gene COI fragment about the cases of the presence of Thus, this example shows that the with primer system LCO1490/ChR2 the red tomato spider mite T. evansi use of phytosanitary measures (Folmer et al., 1994; Barrett, Hebert, in the culture of the predatory mite against mites is more effective 2005) and later the results were Phytoseiulus sp. (https://agroinfo. for prevention their spread than validated by sequencing. com.., 2016). attempts to contain new outbreaks.

22 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА remaining possibility of further mite development and their natural transmitting to host plants. 2) Plants for planting of the Solanaceae family. This pathway is relevant in the case of the pest spreading in the countries that may provide PRA area with plants for planting: Solanaceae family plants. 3) Biological control agents – insects and mites. Products originating from countries where the pest is present. Cases of invasion: it is assumed that the species has its origin in South America – the country from which it has spread all around the world. In Africa (Morocco, South Africa) the red tomato spider mite is known since the mid-1980s, in subsequent years the species was detected in many African countries, which produce tomatoes (particularly Senegal). In Europe, the invasion of the red Рис. 5. Внешний вид самки Oligonychus perditus tomato mite was reliably registered (фото И.О. Камаева) since the early 2000s. In 2013, the Fig. 5. Female of Oligonychus perditus species was detected for the first time (photo by I.O. Kamayev) in Australia (vicinity of Sydney) and in 2017 information about findings of the Below we will analyze some The most vulnerable crops species from the vicinity of Brisbane examples of herbivorous mites that of Solanaceae family are tomato appeared, which may indicate the pose a phytosanitary risk on the (Lycopersicon esculentum), eggplant gradual spread of the species over the territory of the Russian Federation (Solanum melongena), potato mainland territory. In 2017 the species (hereinafter – the area of PRA). (S. tuberosum), tobacco (Nicotiana was registered in Serbia and Turkey tabacum) and to a lesser extent (https://gd.eppo.int/taxon/TETREV; Red tomato spider mite pepper (Capsicum annuum) . Kazak et al., 2017). (Tetranychus evansi) Beans (Phaseolus vulgaris) is an The probability of entry: is The family of Spider mites – economically important vulnerable estimated as high, the most probable Tetranychidae. crop of non-solanaceae plants. way of introduction – with fruits of Taxonomic status and Pathways for entry: tomato from the countries of the pest identification: the species is 1) On fruits of tomato, eggplant presence. In the context of the existing considered as a single taxonomic and pepper. Green parts of plants phytosanitary procedures there is still entity and can be identified (Baker increase the risk of transmitting of a risk of non-detection of the pest & Pritchard, 1960; Seeman, Beard, a greater number of pest species, (with different ontogenetic stages). 2011; Kamayev, Mironova, 2016). and presence of different life stages The probability of establishment: Categorization: the list of the (egg, larva, imago). Given the large is estimated as high. One female absent organisms A1 of the EAEU, volumes of tomato fruits that are spider mite is sufficient to found the Russian Federation; EPPO – A2. imported from countries where the population, as they have a very Geographical distribution: Europe: pest is present into Russia, the risk of high fecundity and they copulate, Greece, Spain, Italy, Portugal, France, the mite invasion increases. Storage as a rule, immediately after Serbia; Asia: Israel, Jordan, Taiwan, and transportation conditions of emerging (Bonato, 1999; Moraes & Turkey, Syria, Japan3; Africa: Algeria, products will not have any negative McMurtry, 1987). The species can Benin, Gambia, Zambia, Zimbabwe, effect because, T. evansi can survive at spread throughout the territory of Kenya, Congo, Republic of the low temperatures, but cannot develop protected cultivation. Weeds will Congo, Malawi, Mauritius, Morocco, or reproduce (Bonato, 1999). In the be the reservation for mites in areas Mozambique, Namibia, Niger, Senegal, case of fruit treatment there is still with favorable climate. Based on the Seychelles, Somalia, Uganda, Tanzania, a chance that viable eggs of the pest fact that the development of the pest Tunisia, South Africa; America: USA, will remain. Given the size of the pest in greenhouses requires 148 degree Brazil, Australia. there is still introduction risk of the days at a threshold above 13.2 °C Host plants: T. evansi is a mite and its eggs on the fruits after (Moraes & McMurtry, 1987), we polyphage. It was detected on plants the inspection. The highest risk is can assume that T. evansi can easily from 33 families. Most host plants posed by infested products supplied survive throughout the year, with belong to the Solanaceae family. during the growing season, due to the possible development of 10-15

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 23 Host plants4 : Cypress family (Cupressaceae): cypress (Chamaecyparis), Chinese weeping cypress (Chamaecyparis funebris), Japanese cypress, hinoki cypress (Chamaecyparis obtusa), sawara cypress (Chamaecyparis pisifera), Fujian cypress (Fokienia hodginsii), Chinese juniper (Juniperus chinensis), Formosan juniper (Juniperus formosana), temple juniper (Juniperus rigida), savin juniper (Juniperus sabina), Virginian juniper (Juniperus virginiana), oriental thuja (Platycladus orientalis); taxodium family (Taxodiaceae): Japanese red-cedar (Cryptomeria japonica); Taxaceae family: Japanese yew (Taxus cuspidata). It should be noted that in the Netherlands during laboratory experiments the mite successfully developed on juniper plants J. communis, J. x media, J. sabina, J. virginiana and biota Platycladus orientalis (EPPO, 1997), however, the following types were not damaged by the mite: Lawson cypress Chamaecyparis lawsoniana, Norway spruce Picea abies, dwarf mountain pine Pinus mugo, English yew Taxus baccata, etc. Pathways for entry: 1) Plants for planting and potted plants. In the United States in the 1950s, this species was detected on plants for planting of juniper plant Juniperus from Japan. The reason Рис. 6. Побеги можжевельника, зараженного Oligonychus perditus why this species was included into the (фото Г.С. Красовского) List of quarantine harmful organisms Fig. 6. Saplings of a juniper, infested by the Oligonychus perditus of EU, was the fact that this pest was (photo by G.S. Krasovsky) detected on heavily infested juniper plants Juniperus (bonsai) by the generations in a heated greenhouse californicus) against the above quarantine service of the Netherlands. per year. Plant hosts of tomato red mentioned species are inefficient Juniper mite was detected on the mites are widely distributed in the (Escudero & Ferragut, 2005). production: juniper plants which were PRA area; The Southern Federal supplied to the Netherlands in 1992 district and the North Caucasian Juniper spider mite (Oligonychus and Germany in 1991-1992. From 1999 Federal district are the most favorable perditus) to 2007 the EUROPHYT database has ones for the pest in terms of climate. The family of Spider mites – information about 8 detection cases of The potential economic impact: Tetranychidae. the mite O. perditus in juniper plants is estimated as high as the species Taxonomic status and (bonsai), imported from Japan to the will damage such economically identification: the species is EU (Pest categorization.., 2017). important crop as tomato, throughout considered to be a single taxonomic 2) Cut branches. Reliable finds greenhouses and in the Southern and entity and can be identified (Pritchard of the pest haven't been registered the North Caucasian Federal districts, & Baker, 1955; Mitrofanov et al., yet, but given the available data where production of tomatoes is 1975; Kamayev, 2017) (Fig. 5). this pathway poses a potential risk, concentrated (which accounts for more Categorization: R u s s i a n especially during the growing season. than 70% of the total production of Federation, Turkey, EPPO – A1 Cases of invasion: reliable tomatoes; https://www.openbusiness. list, EU – Annex II/A1; Israel – information about the pest invasion ru). It is noted that standard methods Quarantine pest. is absent. of biological control (predatory mites Geographical distribution: Asia: The probability of entry: is Phytoseiulus persimilis and Neoseiulus China, Republic of Korea, Japan. estimated as high, as under the

24 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА existing phytosanitary procedures (F. arborescens, F. magellanica, 2. Kamayev I.O. Identification of juniper mite can survive, remains F. procumbens) and more than 30 cultivars. the juniper spider mite Oligonychus viable and undetected; there is This exotic plant genus is perditus Pritchard & Baker, 1955 information about interceptions of naturalized in several European (Arachnida: Trombidiformes: the pest on products; it is assumed regions, both in open and Tetranychidae) // Plant Quarantine. that the movement of consignments protected ground. Information on Science and practice, 2017. No. 3 (planting material and potted host naturalization of fuchsia plants in (21). P. 36-48. plants of the mite) from the region of Russia is not found. Various species 3. Kamayev I.O., Mironova M.K. the pest distribution to the PRA area and cultivars of fuchsia potted plants Characterization of the trophic is significant; the species is able to are cultivated mainly in premises spectrum and diagnostic features outlast adverse conditions (therefore, (indoors and greenhouses). of the red tomato spider mite the arrival time of consignment will Pathways for entry: plants for Tetranychus evansi Baker & Pritchard, not play important role). planting and potted plants of fuchsia. 1960 (Acariformes: Tetranychidae) // The probability of establishment: Cases of invasion: there is Plant Quarantine. Science and is estimated as high as the pest can information on the invasive activity practice, 2016. No. 2 (16). P. 12-19. easily get to suitable plants, which of the gall mite. Presumably the mite 4. Lange A.B. Trilobites and are widely distributed in the PRA originates from the territory of South chelicerata // The Life of animals. Vol. 3. area, in addition, the species has America. The species was accidentally Arthropods. M.: Prosvescheniye, been detected on the greenhouse introduced to San Francisco (USA) 1969. P. 7-134. cultures (e.g. bonsai); wild plants in 1981, where it quickly began its 5. Livshits I.Z., Mitrofanov V.I. can be reservations for the pest; spread over California (Ostojá- Plant mites. The Works of the State the territory of Russia has climatic Starzewski et al., 2007). Nikita Botanical Garden. 1975. zones (especially the territory of the There is the following information Vol. 66. P. 1-183. Southern Federal district) which are on the mite invasion into the 6. Mitrofanov V., Bosenko L., similar to natural habitat of the pest. territory of Europe: first Fuchsia gall Bicheskis M. The determinant The potential economic impact: mite was observed in 2002-2003 in of Tetranychoidea spider mites is estimated as medium. It should France and, despite the measures of coniferous species // Latvijas be noted that currently, the damage taken to eradicate the outbreaks, it Entomolog. Suppl., 1975. P. 1-42. of the juniper mite in its present began to spread over the North-West 7. ISPM 5. https://www.ippc.int/ habitat is not assessed, although the of France. In 2007, the species was ru/publications/621. information about significant harm detected in Germany, near Kassel. 8. The list of regulated objects A1 to the host plants is known (Pest The first detection of the mite in of Brazil. http://extranet. agricultura. categorization.., 2017). It is assumed the UK occurred in the summer gov.br/sislegis-consulta/servlet/ that direct harm can be caused to of 2007. Experts marked the mite VisualizarAnexo?id=14532. nurseries where ornamental cypress overwintering and its gradual 9. The list of regulated is grown. The harm may apparent in spread over the Southern part of objects of Turkey. https://www. deterioration of the plant appearance England and the Guernsey and ippc.int/static/media/files/ (Fig. 6), and in case of significant Jersey Islands (Ostojá-Starzewski et reportingobligation/2017/02/20/ infestation it can be the reason of the al., 2007; https://gd.eppo.int/taxon/ Entry_into_force_1_4_2016_ death of trees used in garden design ACUPFU). Annexes.pdf. and urban landscaping. Containment The probability of entry: is 10. Australia. Quarantine of the outbreaks is only possible with estimated as medium, as under the Proclamation 1998. http:// low infestation level and in case of existing phytosanitary procedures www.comlaw.gov.au /Details/ complete population it is only possible the mite can survive, remain viable F2011C00906/80ddb542-9e7c-4366- to slow the expansion of the area. and undetected. b6b7-b500f095ba58. The probability of establishment: 11. Baker E.W., Pritchard A.E. Fuchsia gall mite (Aculops is low, as there is no suitable fodder The tetranychoid mites of Africa // fuchsiae) base for the establishing of stable pest Hilgardia, 1960. Vol. 29. P. 455-574. The family of four-legged mites – populations. 12. Barrett R.D.H., Hebert P.D.N. Eriophyidae. The potential economic impact: is Identifying spiders through DNA Taxonomic status and low, due to the distribution pattern barcodes // Canadian Journal of identification:the species is considered of host plants of the mite. This type Zoology, 2005. 83. P. 481-491. to be a single taxonomic entity and can of the pest can slightly damage 13. Bonato O. The effect of be identified (Keifer, 1972). greenhouse and indoor plants, temperature on life history parameters Categorization: Russian Federation, mostly fuchsia and fuchsia seedlings of Tetranychus evansi (Acari: Turkey – A1; EPPO, EU – A2. by contact of the plants with each Tetranychidae) // Experimental & Geographical distribution: other. Applied Acarology, 1999. Vol. 23 (1). America: Brazil, USA, Chile; Europe: P. 11-19. France, UK, Germany. References 14. Carrillo D., Peña J.E., Hoy M.A., Host plants: the species causes 1. Becker E., Wharton G. Frank J.H. Development and credible damage to Fuchsia genus Introduction to acarology. M.: reproduction of Amblyseius plants, including at least three species Foreign literature pub., 1955. 476 p. largoensis (Acari: Phytoseiidae)

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 25 feeding on pollen, Raoiella indica www.produccionynegocio.com/ Jaques Miret, Alan MacLeod et al. // (Acari: Tenuipalpidae), and other edicion_20/cocotero.htm. Accessed EFSA journal. First Published: 27 microarthropods inhabiting coconuts 29 Sept 2009. November 2017. 20 p. DOI: 10.2903/j. in Florida, USA // Experimental and 22. Kazak C., Döker I., Karut K. efsa.2017.5075. Applied Acarology, 2010. Vol. 52 (2). First record of invasive tomato 32. PRA record for Raoiella indica, P. 119-129. spider mite Tetranychus evansi 08-14675. 39 p. https://gd.eppo.int/ 15. Dermauw W., Wybouw N., (Acari: Tetranychidae) in Turkey. taxon/RAOIIN/documents. Rombauts S., Menten B., Vontas J., International Journal of Acarology, 33. Pritchard A.E., Baker E.W. Grbic M., Clark R.M., Feyereisen R., 2017. 43 (4), 325-328. A revision of the spider mite Van Leeuwen T. A link between 23. Keifer H.H. Eriophyid family Tetranychidae // Memoirs host plant adaptation and pesticide studies C-6. 1972. P. 1-24. A spe- Series, San Francisco, Pacific Coast resistance in the polyphagous spider cial publication of the Bureau of Entomological Society, 1955. № 2. mite Tetranychus urticae // Proc. Entomology, California Department P. 1-472. Natl. Acad. Sci. USA, 2013. Vol. 110 of Agriculture, with funding from 34. Roda A., Dowling A., Wel- (2). P. 113-122. the Agricultural Research Service, bourn С., Pena J., Rodrigues J.C.V., 16. Dowling A., Ochoa R., US Department of Agriculture. Hoy M., Ochoa R., Duncan R.A., Welbourn W., Beard J. Raoiella Online access: http://www.cdfa. Wayne D.Ch. Red palm mite situation indica: (Acari: Tenuipalpidae): ca.gov/plant/ppd/publications/ in the Caribbean and Florida // a rapidly expanding generalist eriophyid_studies.html. Proceedings of the Caribbean Food among specialist congeners // XIII 24. Messing R.H., Croft B.A. Crops Society, 2008. Vol. 44 (1). International Congress of Acarology, Pesticide resistance in eriophyoid P. 80-87. Recife, Brazil, 23-27 August 2010. mites, their competitors and 35. Rodrigues J.C.V., Antony L.M.K. P. 72-73. predators // World Crop Pests, 1996. First Report of Raoiella indica (Acari: 17. Dowling A.P.G., Ochoa R., Vol. 6. P. 689-694. Tenuipalpidae) in Amazonas State, Beard J.J., Welbourn W.C., 25. Moraes G.J. de, McMurtry J.A. Brazil // Florida Entomologist, 2011. Ueckermann E.A. Phylogenetic Effect of temperature and sperm Vol. 94 (4). P. 1073-1074. investigation of the genus Raoiella supply on the reproductive potential 36. Rodrigues J.C.V., Childers C.C. (Prostigmata: Tenuipalpidae): of Tetranychus evansi (Acari Brevipalpus mites (Acari: diversity, distribution, and world Tetranychidae) // Experimental and Tenuipalpidae): vectors of invasive, invasions // Experimental and Applied Acarology, 1987. Vol. 3 (2). non-systemic cytoplasmic and Applied Acarology, 2012. Vol. 57 P. 95-108. nuclear viruses in plants // Exp. Appl. (3/4). P. 257-269. 26. Morphological Identification Acarol., 2013. Vol. 59. P. 165-175. 18. Escudero L.A., Ferragut F. Life- of Spider Mites (Tetranychidae) 37. Seeman O., Beard J. National history of predatory mites Neoseiulus affecting Imported Fruits. DP 03. diagnostic standards for Tetranychus californicus and Phytoseiulus Prepared by the members of the spider mites // Plant Health Australia, persimilis (Acari: Phytoseiidae) on NAPPO Expert Group (previous 2005. 128 p. four spider mite species as prey, Technical Advisory Group) on Fruit 38. Seeman O.D., Beard J.J. with special reference to Tetranychus Tetranychus Mites, 2014. 30 p. Identification of exotic pest and evansi (Acari: Tetranychidae) // 27. Navajas M., Ochoa R. Australian native and naturalised Biological Control, 2005. Vol. 32 (3). Integrating ecology and genetics to species of Tetranychus (Acari: P. 378-384. address Acari Invasions // Exp. Appl. Tetranychidae) // Zootaxa, 2011. 19. Folmer O., Black M., Hoeh W., Acarol., 2013. № 59. P. 1-10. Vol. 2961. P. 1-72. Lutz R., Vrijenhoek R. DNA primers 28. Normark B.B., Kirkendall L.R. 39. Slykhuis J.T. Mite Transmission for amplification of mitochondrial Parthenogenesis in Insects and Mites // of Plant Viruses // Advances in Virus cytochrome c oxidase subunit I from Encyclopedia of Insects (Second Research, 1965. Vol. 11. P. 97-137. diverse metazoan invertebrates // Edition), 2009. P. 753-757. 40. Stenger D.C., Hein G.L., Molecular Marine Biology and 29. Oliver Jr.J.H. Parthenogenesis Gildow F.E., Horken K.M., French R. Biotechnology, 1994. Vol. 3. P. 294-299. in Mites and Ticks (Arachnida: Plant Virus HC-Pro Is a Determinant 20. Gotoh T., Araki R., Boubou A., Acari) // Am. Zoologist, 1971. Vol. of Eriophyid Mite Transmission // Migeon A., Ferragut F. and Navajas M. 11. P. 283-299. J. Virol., 2005. Vol. 79 (14). P. 9054-9061. Evidence of co-specificity between 30. Ostojá-Starzewski J.C., Eyre D. 41. Weeks A.R., Breeuwer J.A. Tetranychus evansi and Tetranychus Fuchsia gall mite. Aculops fuchsiae. Wolbachia-induced parthenogenesis takafujii (Acari: Prostigmata, Plant Pest Factsheet. The Food and in a genus of phytophagous mites // Tetranychidae): comments on Environment Research Agency Proc. Biol. Sci., 2001. Vol. 268 (1482). taxonomic and agricultural aspects // (FERA), York, UK. 2012. 4 pp. P. 2245-2251. International Journal of Acarology, 31. Pest categorization of 42. Welbourn C. Pest Alert: Red 2009. 35. 6. P. 485-501. Oligonychus perditus / EFSA Panel palm mite, Raoiella indica Hirst 21. Gutierrez B., Nohelia N., Garcia A. on Plant Health (PLH), Michael (Acari: Tenuipalpidae). In: Florida Situacion actual del cocotero in Jeger, Claude Bragard, David Department of Agriculture and al municipio Valdez del estado Caffier, Thierry Candresse, Elisavet Consumer Services. Available via Sucre. In: Produccion y Negocio. Chatzivassiliou, Katharina Dehnen‐ DIALOG. 2007. http://www.doacs. Available via DIALOG. 2007. http:// Schmutz, Gianni Gilioli, Josep Anton state.fl.us/pi/enpp/ento/ r.indica.

26 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА html and http://www.doacs.state. 48. https://www.openbusiness.ru/ excrements, mite exuvia and silk fl.us/pi/caps/rpm_maps/ RPM_ biz/business/obzor-rynka-tomatov- webs of the pest. Base_Map_34x44.pdf. v-rossii. 3 The species for Japan is described 43. https://agroinfo.com/ as T. takafujii Ehara & Ohashi, 2002, it biologicheskij-metod-zashhity-rastenij- 1 Storage pests from the families was subsequently found that it is a junior legendy-i-mify-preimushhestva-i- Acaridae and Glycyphagidae synonym of T. evansi (Gotoh et al., 2009). aktualnost-0402201602. represent a special group of mites. 4 The list of host plants also has the 44. https://gd.eppo.int/reporting/ They will not be discussed in this following types: sweet cherry Prunus article-5927. article due to the nature of their avium, Japanese plum Prunus salicina and 45. https://gd.eppo.int/taxon/ relationship with grain and products tea plant Camellia sinensis, but they are ACUPFU. of its processing. listed as the plants on which the species 46. https://gd.eppo.int/taxon/ 2 The object of research was was detected, but there is no information TETREV. Tetranychus urticae C.L. Koch, 1836. about the fact that they have been 47. https://www.cabi.org/isc/ The plant material was preliminary damaged by the pest, and they therefore datasheet/46792. cleared from the individuals and are not considered as host plants.

УДК 632.4.01/.08

ИДЕНТИФИКАЦИЯ ВОЗБУДИТЕЛЯ РАКА КАРТОФЕЛЯ SYNCHYTRIUM ENDOBIOTICUM с применением молекулярных методов диагностики

М.Б. Копина, начальник научно-методического отдела фитопатологии ФГБУ «ВНИИКР» О.В. Скрипка, ведущий научный сотрудник научно-методического отдела фитопатологии ФГБУ «ВНИИКР» Г.Н. Матяшова, заведующая лабораторией ГМО ФГБУ «ВНИИКР» И.П. Дудченко, старший научный сотрудник лаборатории микологии ФГБУ «ВНИИКР»

Аннотация. В статье пред- Synchytrium endobioticum на осно- фитопатогенов картофеля, ко- ставлены результаты исследо- ве гена 16S рибосомальной ДНК. торый проявляется в виде наро- ваний по разработке и усовер- стов на клубнях, столонах, кор- шенствованию молекулярных ме- Ключевые слова. Рак картофе- невой шейке, ростках. Иногда, тодов диагностики возбудителя ля, патотип, диагностика, выделе- при сильном развитии заболева- рака картофеля. Авторами пред- ние ДНК, специфичные праймеры, ния, симптомы можно обнару- ложен модифицированный способ классическая ПЦР. жить на стебле, листьях и цветках получения свежих наростов на (рис. 1). S. endobioticum отно- клубнях картофеля. Разработа- Вид Synchytrium endobioticum сится к отделу Chytridiomycota, ны праймеры для идентификации (Schilb.) Perc. – один из опасных классу Chytridiomycetes, порядку

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 27 Fig. 1. Stem and tuberous form of S. endobioticum appearance (photo by G.N. Dudchenko)

Рис. 1. Стеблевая и клубневая форма проявления S. endobioticum (фото Г.Н. Дудченко)

Chytridiales. Гриб является почвен- включен в Единый перечень ка- (европейская раса 1) широко рас- ным облигатным внутриклеточ- рантинных объектов Евразийского пространен в регионе ЕОКЗР и ным паразитом, не образующим экономического союза как ограни- является преобладающим во мно- мицелия. Патоген характеризуется ченно распространенный вредный гих странах. Также в Европе ши- высокой пластичностью и измен- организм, а также в Список А2 роко распространены патотипы 1 чивостью. Покоящиеся толсто- ЕОКЗР и других региональных ор- (D1), 2 (G1), 6 (O1), 8 (F1) и 18 (T1) стенные спорангии возбудителя ганизаций по карантину и защите (Franc, 2007) (рис. 4). способны сохранять свою жизне- растений. В настоящее время в России рас- способность более 40 лет (Laidlaw, На территории РФ вид пространен только далемский (D1) 1985) (рис. 2). Возделывание вос- S. endobioticum встречается огра- патотип 1 возбудителя (Яковлева, приимчивых сортов картофеля в ниченно, при этом основное ко- 1975; Мироненко, Хютти, Афана- очагах может привести к потерям личество очагов сосредоточено в сенко, 2009). В связи с большим 50-95% урожая (Кирюхина, Кузь- личных подсобных хозяйствах. По объемом ввоза в РФ семенного и мина, 1969; Bojnansky, 1984). данным Россельхознадзора, в 2017 продовольственного картофеля из В конце XIX века болезнь рас- году очаги рака картофеля выяв- стран распространения патогена пространилась из своего первона- лены в 13 субъектах Российской нельзя исключить возможности чального ареала в районе Анд Юж- Федерации на площади 194,9 га. формирования новых патотипов ной Америки в некоторые районы Известно много патотипов S. endobioticum с повышенной Северной Америки и Европы. Спу- S. endobioticum. Появление новых агрессивностью, что наблюдается стя несколько лет S. endobioticum патотипов рака картофеля объяс- в ряде стран. был обнаружен в странах, выра- няется многими факторами, вклю- Для дифференциации патоти- щивающих картофель, включая чая возделывание устойчивых пов S. endobioticum, распростра- Азию, Африку и Океанию. В насто- сортов, а также наличие сорной ненных в странах ЕОКЗР, в рам- ящее время очаги рака картофеля растительности сем. Solanaceae на ках общеевропейского проекта зарегистрированы в 36 странах, полях картофеля (Melnik, 1998). EUPHRESCO II – SENDO (2012- а патоген является карантинным В мире выявлено 43 патотипа 2014 гг.) был подобран набор сор- объектом более чем в 30 странах S. endobioticum, которые диффе- тов-дифференциаторов и разра- мира (www.gd.eppo.int) (рис. 3). ренцируются на разных сортах кар- ботаны молекулярные методы Возбудитель рака картофеля тофеля (Хютти, 2017). Патотип 1 разделения патотипов (рис. 5).

28 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Таблица 1 Олигонуклеотиды, использованные для идентификации Synchytrium endobioticum

№ Мишень Авторы Название/последовательность 5’-3’ П.о. п/п

S.E.585 F 1 TTTACTTGGGGAATCCAGGTGCT (Мазурин, Копина, 16S рДНК 600 неопубл. данные) S.E.585R 2 GCACCACCACCCATAGAATCAAG

Mus 714F 3 CTTCTGGCGTTTCAGAGAC (Мазурин, Копина, 1700042G15 714 Шероколава, 2012) Mus714R 4 GGCTCCTCTTGTGCAGATTC

F49 5 CAACACCATGTGAAC TG ITS (Lеvesque et al., 2002) 472 R502 6 ACATACACAATTCGAGTT T

SendoITS2F 7 TTTTTACGCTCACTTTTTTTAGAATGTT

SendoITS2R 8 ITS (van Gent-Pelzer et al., 2010) 84 CTGCCTCACACACCACATACA

Sendo probe 9 AATTCGAGTTTGTCAAAAGGTGTTTGTTGTGG-FAM

Специалисты ФГБУ «ВНИИКР» В настоящее время методы пря- менение хлорорганических ядови- приняли участие в ринг-тесте мого тестирования почвы на вы- тых веществ. Так, например, в Рос- (TPS) «Диагностические мето- явление зимних зооспорангиев сии используют метод флотации в ды идентификации патотипов S. endobioticum основаны на фло- четыреххлористом углероде или в S. endobioticum» (EUPHRESCO II – тации в различных жидкостях или смеси четыреххлористого углерода SENDO) в разделе «Диагностика промывании на ситах. Все эти мето- и серного эфира. зимних зооспорангиев рака карто- ды довольно трудоемки, длительны Способность возбудителя дли- феля молекулярными методами». в исполнении и предполагают при- тельное время сохраняться в поч-

Таблица 2 Концентрация ДНК, выделенной из наростов картофеля с применением автоматической станции НК TECAN и с помощью набора «ДНК Экстран-2»

ДНК, выделенная ДНК, выделенная Масса на автоматической станции с использованием набора № навески НК TECAN «ДНК Экстран-2» п/п нароста, мг концентрация, концентрация, А 260/280 А 260/280 нг/мкл нг/мкл

1 0,5 12,0 1,86 12,2 1,92

2 1 19,5 1,87 38,4 1,51

3 2 39,7 1,91 79,5 1,35

4 3 41,3 1,78 175,3 1,46

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 29 ве, наличие агрессивных патоти- SENDO были получены образцы с «ВНИИКР» через 8-10 недель на пов за рубежом, возможность их инактивированными зимними зоо- некоторых клубнях образовались завоза на территорию РФ объяс- спорангиями S. endobioticum нео- свежие наросты, которые исполь- няет целесообразность проведе- пределенных патотипов, а также зовали для дальнейших исследо- ния исследований по совершен- положительные (патотип 1) и от- ваний (рис. 6). Получение свежих ствованию методов диагностики рицательные (отличные от патоти- наростов в колбе по сравнению с Synchytrium endobioticum. па 1) контроли. Участники прово- «классическими» методами ино- дили выделение ДНК с использо- куляции облегчает дальнейшее Материалы и методы ванием набора DNeasyPlantMiniKit проведение исследований, т. к. об- Для получения свежего инфек- (Qiagen). Образцы ДНК исполь- разцы пораженной ткани не кон- ционного материала использова- зовали для проведения класси- тактируют с почвой, тем самым ли клубни картофеля сорта Лорх, ческой ПЦР (идентификация снижается возможность зараже- которые поверхностно обеззара- S. еndobioticum) (Lеvesque et al., ния сопутствующими почвенными живали мыльным водным раство- 2002) и ПЦР «в реальном времени» микромицетами. ром, раствором сулемы (0,01%) (идентификация S. еndobioticum) Для определения оптималь- и промывали стерильной водой. (van Gent-Pelzer et al., 2010). ного метода выделения ДНК В дальнейшем подготовленные S. endobioticum из наростов про- клубни с ростками искусственно Результаты исследований водили экстракцию ДНК двумя заспоряли небольшим количеством Получение клубней картофеля, разными методами. При этом учи- компоста, полученным по методу искусственно зараженных воз- тывали количество и качество по- Спикермана, и помещали на голод- будителем S. еndobioticum, – до- лученных образцов ДНК. ный агар (0,5%) в стерильные колбы. вольно длительный и трудоемкий Чистоту образца ДНК оцени- Инокулированные клубни инкуби- процесс. Методики, широко при- вали по отношению величины ровали при температуре 12-14 оC и меняющиеся в настоящее время, оптической плотности (ОП) рас- высокой относительной влажности. основаны на инокуляции воспри- твора нуклеиновой кислоты при По мере высыхания содержимое имчивых сортов картофеля зара- 260 нм к величине ОП ДНК при колбы увлажняли мелким распыле- женным почвенным компостом, 280 нм. Препарат ДНК считается нием. Каждые 10-14 дней основные содержащим более 5 зооспоран- чистым, если отношение значений и боковые побеги обрезали. гиев S. endobioticum в 1 г почвы. 260 нм/280 нм приблизительно 1,8. Для выделения ДНК использо- Такие методы лежат в основе В случае меньших значений данно- вали следующие навески расти- биологического тестирования поч- го показателя препарат содержит тельной ткани: 0,5 мг; 1,0 мг; 2,0 г вы на выявление возбудителя рака большое количество примесей и 3,0 г. Выделение ДНК из наростов картофеля. белка, фенола или иных ингиби- проводили следующими метода- В проводимых исследовани- торов, имеющих значительное по- ми: на автоматической станции ях в результате искусственного глощение при 280 нм (таблица 2). выделения НК TECAN с исполь- заражения картофеля изолятом В проведенных исследовани- зованием набора «М-Сорб-Туб» S. endobioticum из коллекции ФГБУ ях установлено, что использова- (ЗАО «Синтол», Москва) и с по- мощью набора реактивов «ДНК Экстран-2» (ЗАО «Синтол», Мос- ква). Измерение концентрации ДНК проводили с помощью спек- трофотометра NanoDropND-2000. Для проведения классической ПЦР были подобраны специфичные праймеры S.E.585F/S.E.585R на ос- нове гена 16S рДНК, которые ам- плифицировали продукт размером 600 п.о. (таблица 1). При постановке классической ПЦР в качестве внутреннего по- ложительного контроля исполь- зовали фрагмент гена мыши 1700042G15 (www.ncbi.nlm.nih. gov) некодирующей РНК (714 п.о.) (Мазурин, Копина, Шероколава, 2012). Были оптимизированы со- став реакционной смеси и темпе- ратурно-временные параметры Fig. 2. Zoosporangia of S. endobioticum ПЦР-амплификации (таблица 1). (photo by G.N. Dudchenko) В рамках ринг-теста междуна- Рис. 2. Зооспорангии S. endobioticum родного проекта ЕUPHRESCO II – (фото Г.Н. Дудченко)

30 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Fig. 3. The spread of potato wart disease agent Synchytrium endobioticum Рис. 3. Распространение возбудителя рака картофеля Synchytrium endobioticum

ние автоматической станции НК указывает на высокое качество ская область, Люберецкий р-н TECAN позволяет получать ДНК вносимой ДНК. Московской области, также были возбудителя с соотношением Из электрофореграммы (рис. 7 Б) включены инактивированные зоо- 260/280 в пределах от 1,78 до 1,92. видно, что применение набора спорангии из TPS EUPHRESCO – При выделении ДНК согласно на- «ДНК Экстран-2» не привело к SENDO (S. endobiotiсum патотип 1, бору «ДНК Экстран-2» качество образованию ампликонов вну- S. endobiotiсum патотип 18). Из образцов ДНК значительно ниже треннего контроля, что говорит о всех образцов проводили выделе- (соотношение 260/280 варьиро- наличии ингибиторов ПЦР в ис- ние ДНК указанным выше методом вало от 1,35 до 1,92). При этом следуемых образцах. с последующей постановкой клас- экстракция ДНК с помощью авто- Выделение ДНК на станции НК сической ПЦР со специфичными матической станции НК TECAN TECAN позволило обнаружить праймерами S.E.585F/S.E.585R. Ре- позволяет получить образцы ДНК возбудителя рака картофеля во зультаты представлены на рисунке 8. более низкой концентрации, в от- всех исследуемых навесках. Одна- Из электрофореграммы видно, личие от набора «ДНК Экстран-2». ко при применении набора «ДНК что со всеми исследуемыми образ- Результаты проведения клас- Экстран-2» не удалось обнаружить цами получены ампликоны разме- сической ПЦР представлены на ДНК S. endobiotiсum в наростах ром 600 п.о. Было установлено, что рисунке 7 (А, Б). Несмотря на то, рака картофеля. подобранные праймеры позволяют что концентрация выделенной Проведенные исследования по- идентифицировать возбудителя ДНК при использовании станции казали, что выделение ДНК возбу- рака картофеля в образцах разного НК TECAN значительно мень- дителя S. endobiotiсum на автомати- происхождения, а также выявлять ше по сравнению с применением ческой станции НК TECAN позво- разные патотипы S. endobiotiсum набора «ДНК Экстран-2», при ляет получать ДНК более высокого (в наших исследованиях это 1 и 18). постановке ПЦР были получе- качества. Можно рекомендовать Это свидетельствует о возможно- ны положительные результаты. данный метод для пробоподготов- сти применения данных маркеров Из электрофореграммы видно, ки в дальнейших исследованиях. для идентификации возбудителя что при добавлении образцов Следующей задачей проводи- рака картофеля вне зависимо- ДНК, выделенных на станции мых исследований была оценка сти от места его происхождения. НК TECAN, в реакционную смесь возможности применения подо- Многие исследователи отмечают, образуются продукты, специфич- бранных праймеров для иденти- что выявление внутривидово- ные для S. endobiotiсum, разме- фикации генетически различных го генетического разнообразия ром 600 п.о. Наличие ампликонов образцов ДНК S. endobiotiсum. Для S. endobiotiсum не представляется внутреннего контроля размером этого был создан набор изолятов сложным, в отличие от разделения 714 п.о. свидетельствует об от- S. endobiotiсum разного происхож- патотипов рака картофеля. Соглас- сутствии ингибиторов ПЦР, что дения: Тамбовская область, Перм- но Gagnon с соавторами (2016),

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 31 при изучении 22 изолятов разного впервые был предложен Levesque с ция по двум красителям регистри- географического происхождения соавторами (2002), позднее он был ровалась только в образцах 2, 8 и 10, (Европа и Северная Америка) с модифицирован (Boogert et al., 2005). что подтвердило результаты, полу- использованием 21 SSR-праймера В 2013 году метод был валидирован ченные методом классической ПЦР. не было установлено взаимосвязи как международный ринг-тест. между генотипами и патотипами: Для выявления S. endobioticum Выводы изоляты одного и того же патотипа при постановке классической ПЦР 1. В лабораторных условиях относились к разным генотипам. использовали ДНК, выделенные возможно получение свежих на- Идентификация S. endobiotiсum из набора TPS десяти шифрован- ростов S. endobiotiсum при выра- и дифференциация патотипов с ных образцов, состоящих из зим- щивании клубней восприимчи- применением молекулярно-гене- них зооспорангиев Synchytrium вых сортов в колбах на питатель- тических методов являлась одной endobioticum. Результаты представ- ных средах. из задач международного проекта лены на рисунке 9. 2. Оптимальным методом выде- EUPHRESCO II – SENDO. Органи- Из электрофореграммы следует, ления ДНК S. endobioticum из наро- заторы разработали классическую что продукты амплификации раз- стов является пробоподготовка с ПЦР и ПЦР «в реальном време- мером 472 п.о. внутреннего транс- помощью автоматической станции ни» для идентификации возбу- крибируемого спейсера (ITS) были НК TECAN, что было подтвержде- дителя рака картофеля. ПЦР-РВ получены с положительными кон- но постановкой классической ПЦР. на основе SNP (single nucleotide трольными образцами и исследуе- 3. Масса нароста картофеля для polymorphism – однонуклеотид- мыми образцами 2, 8 и 10. Это сви- выделения ДНК должна быть не ный полиморфизм) была разрабо- детельствует о наличии возбудите- менее 0,5 мг. тана для дифференциации патоти- ля рака картофеля в трех из десяти 4. Подобранные праймеры пов. Тест основан на обнаружении образцов, при этом в образцах 2 и S.E.585F/S.E.585R позволяют про- различий в единичных нуклео- 8 отмечена низкая концентрация водить идентификацию возбуди- тидах последовательности гено- возбудителя. теля рака картофеля различного ма S. endobioticum патотипа 1 по Кроме того, с образцами ДНК географического происхождения. сравнению с аналогичной частью проводили постановку ПЦР «в ре- 5. В рамках проекта EUPHRESCO генома других патотипов возбу- альном времени» для идентифика- II – SENDO были отработаны ме- дителя, т. е. в однонуклеотидном ции S. endobioticum. Полученные ре- тоды выделения ДНК из суспензии полиморфизме. зультаты представлены в таблице 3. зимних зооспорангиев с использо- Метод классической ПЦР для Из таблицы видно, что из десяти ванием набора DNeasyPlantMiniKit идентификации рака картофеля исследуемых образцов флуоресцен- (Qiagen).

Fig. 4. New galls on tubers of susceptible varieties of potatoes (photo by G.N. Dudchenko) Рис. 4. Свежие наросты на клубнях восприимчивого сорта картофеля (фото Г.Н. Дудченко)

32 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Таблица 3

Значение порогового цикла Ct при идентификации S. endobioticum методом ПЦР «в реальном времени»

C Результат t C Образец FAM-специфичный t S. endobioticum НЕХ-ВПК S. endobioticum +/-

К- (вода) – отрицательный контроль амплификации N/A 38,78 -

К+ (ДНК S. endobioticum Р1) 23,53 23,47 +

К- (вода) – отрицательный контроль выделения N/A 40,52 -

К+ (зимние зооспорангии S. endobioticum) – положительный контроль выделения 34,97 37,47 +

Образец 01 N/A 38,56 -

Образец 02 35,92 40,23 +

Образец 03 N/A 39,06 -

Образец 04 N/A 38,45 -

Образец 05 N/A 39,32 -

Образец 06 N/A 37,75 -

Образец 07 N/A 39,75 -

Образец 08 36,77 40,42 +

Образец 09 N/A 37,56 -

Образец 10 33,29 37,98 +

Примечание: Ct FAM и Ct НЕХ – значения порогового цикла по красителям FAM и НЕХ соответственно.

6. Применение классической нитарной экспертизы при исполь- теля рака картофеля в СССР, их ПЦР и ПЦР «в реальном време- зовании молекулярных методов ди- вирулентность и ареал // Пробле- ни» позволило идентифициро- агностики / Е.С. Мазурин, М.Б. Ко- мы онкологии и тератологии рас- вать возбудителя рака картофеля пина, Н.А. Шероколава // Вестник тений. Л., 1975. С. 384-387. S. endobioticum в исследуемых об- РУДН, серия Агрономия и живот- 5. Яковлева В.А., Дьяченко А.А. разцах. новодство, 2012. № 3. С. 31-38. Анализ фитосанитарного ри- 3. Мироненко Н.В., Хютти А.В., ска возбудителя рака картофеля Литература Афанасенко О.С. Структура популя- Synchytrium endobioticum (Schilb.) 1. Кирюхина Р.К., Кузьмина Л.П. ций возбудителя рака картофеля по Perc. для территории Российской Гетерогенность возбудителя популя- вирулентности и ДНК маркерам // Федерации. М.: ФГУ «ВНИИКР», ций рака картофеля. М., 1969. С. 112. Микология и фитопатология, 2009. 2007. 2. Мазурин Е.С. Контроль до- Т. 43. Вып. 5. С. 92-101. 6. Хютти А.В. Устойчивость стоверности результатов фитоса- 4. Яковлева В.А. Расы возбуди- картофеля к карантинным болез-

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 33 Fig. 5. Identification of S. endobioticum pathotype on susceptible varieties of potato (photo by G.N. Dudchenko) Рис. 5. Определение патотипа S. endobioticum на восприимчивых сортах картофеля (фото Г.Н. Дудченко)

ням / А.В. Хютти, О.Ю. Антонова, apsnetfeatures/Pages/PotatoWart. (Schilbersky) Percival. EPPO Н.В. Мироненко, Т.А. Гавриленко, aspx. Technical documents 1032, Paris. О.С. Афанасенко // Вавиловский 11. Gagnon M.C., van der Lee T.A., 15. Van den Boogert P.H.J.F., van журнал генетики и селекции, 2017. Bonants P.J., Smith D.S., Li X., Gent-Pelzer M.P.E., Bonants P.J.M., Т. 21 (1). С. 51-61. Levesque C.A., Bilodeau G.J. 2016. De Boer S.H., Wander J.G.N., Le- 7. Baayen R.P., Cochius G., Development of polymorphic vesque C.A., van Leeuwen G.C.M., Hendriks H., Meffert J.P., Bakker J., microsatellite loci for potato wart Baayen R.P., 2005. Development Bekker M., Boogert P.H.J.F., from next-generation sequence data // of PCR-based detection methods Stachewicz H. and Leeuwen G.C.M. Phytopathology, 106 (6): 636- for the quarantine phytopathogen 2006. History of potato wart 644. DOI 10.1094/PHYTO-12-15- Synchytrium endobioticum, causal disease in Europe – a proposal 0317-R. agent of potato wart disease // for harmonisation in defining 12. Laidlaw W.M.R. 1985. European Journal of Plant Pathology, pathotypes // European Journal of A method for the detection of the 113: 47-57. Plant Pathology, 116: 21-31. resting sporangia of potato wart 16. Van Gent-Pelzer M.P.E., Krij- 8. Bojnansky V. 1984. Potato disease (Synchytrium endobioticum) ger M., Bonants P.J.M. 2010. Improved wart pathotypes in Europe from the in the soil of old outbreak sites // real-time PCR assay for detection ecological point of view // EPPO Potato Res., 28: 223-232. of the quarantine potato pathogen, Bull., 14 (2): 141-146. 13. Levesque C.A., Ward L.J., de Synchytrium endobioticum, in zonal 9. EPPO. 2008. Report of the 15th Jong S.N., De Boer S.H., van den centrifuge extracts from soil and in meeting of the Panel on Phytosanitary Boogert P.H.J.F., and Baayen R.P. plants // Eur. J. Plant Pathol., 126 (1): Measures for Potato, Chernovtsy, 2002. A new soil assay for Synchytrium 129-133. Ukraine. endobioticum, the causal agent of 17. EPPO Global Database (www. 10. Franc G.D. 2007. Potato Wart. potato wart // Phytopathology, 92: 46. gd.eppo.int). APSnet Features. Last accessed Publication № P-2002-0334-AMA. 18. National Center for Bio- October 31, 2012, from: http:// 14. Melnik P.A. 1998. Wart disease technology Information Search www.apsnet.org/publications/ of potato, Synchytrium endobioticum database (www.ncbi.nlm.nih.gov).

34 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА UDC 632.4.01/.08

IDENTIFICATION OF THE AGENT OF POTATO WART DISEASE SYNCHYTRIUM ENDOBIOTICUM Using Molecular Diagnostic Methods

M.B. Kopina, Head of the Phytopathology Research and Methodology Department of FGBU “VNIIKR” О.V. Skripka, Leading Researcher of the Phytopathology Research and Methodology Department of FGBU “VNIIKR” G.N. Matyashova, Head of the GMO Laboratory of FGBU “VNIIKR” I.P. Dudchenko, Senior Researcher of the Mycology Laboratory of FGBU “VNIIKR”

Abstract. The results of research Keywords. Wart disease of of the disease, the symptoms can on development and improvement of potato pathotype, diagnostics, be detected on the stem, leaves and the molecular diagnostic methods of DNA purification, specific primers, flowers (Fig. 1). S. endobioticum (wart potato wart disease are presented in conventional PCR. disease of potato) refers to the the article. The modified method for division Chytridiomycota, class Chy- producing new galls on the potato The species Synchytrium endo- tridiomycetes, order Chytridiales. tuber has been proposed by the bioticum (Schilb.) Perc. is one of the Fungus is a soil subsurface obligate authors. Primers for identification dangerous pathogens of potato, which parasite, which does not form of Synchytrium endobioticum on the manifests itself in the form of galls on a mycelium. The pathogen is basis of 16s rRNA gene have been tubers, stolons, root collar, and sprouts. characterized by the high flexibility developed. Sometimes, with a strong development and variability. Thick-walled resting

Рис. 6. Заражение клубня картофеля в колбе на питательной среде летними зооспорангиями S. endobioticum (photo by O.V. Skripka) Fig. 6. Infection of the potato tuber in the flask on a nutrient medium summer zoosporangia of S. endobioticum (фото О.В. Скрипка)

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 35 Table 1 The oligonucleotides used for the identification of Synchytrium endobioticum Base pair № Target Authors The name/sequence 5’-3’ (b.p.) S.E.585 F 1 (Mazurin, Kopina, TTTACTTGGGGAATCCAGGTGCT 16S rDNA 600 data on file) S.E.585R 2 GCACCACCACCCATAGAATCAAG Mus 714F 3 (Mazurin, Kopina, CTTCTGGCGTTTCAGAGAC 1700042G15 714 Sherokolava, 2012) Mus714R 4 GGCTCCTCTTGTGCAGATTC F49 5 (Lévesque CAACAC CATGTGAAC TG ITS 472 et al., 2002) R502 6 ACATACACAATTCGAGTT T SendoITS2F 7 TTTTTACGCTCACTTTTTTTAGAATGTT (van Gent-Pelzer SendoITS2R 8 ITS 84 et al., 2010) CTGCCTCACACACCACATACA Sendo probe 9 AATTCGAGTTTGTCAAAAGGTGTTTGTTGTGG-FAM sporangia of the agent are able to quarantine objects of the Eurasian the world there are 43 identified retain its viability for over 40 years Economic Union as a locally presented pathotypes of S. endobioticum, which (Laidlaw, 1985) (Fig. 2). The cultivation pest, and in the List A2 of EPPO are differentiated at different varieties of susceptible potato varieties in the and other regional organizations for of potatos (Hutti, 2017). Pathotype 1 injury hotspots can lead to losses quarantine and plant protection. (European race 1) is widely distributed of 50-95% of the yield (Kiryukhina, On the territory of the Russian in the EPPO region and is predominant Kuzmina, 1969; Bojnansky, 1984). Federation species of S. endobioticum in many countries. Moreover, In the late nineteenth century, occurs locally, meanwhile, the pathotypes 1 (D1), 2 (G1), 6 (O1), 8 the disease spread from its original principal amount of the focalities (F1) and 18 (T1) are widespread in area in the Andean region of South is concentrated in a private farms. Europe (Franc, 2007) (Fig. 4). America to some parts of North According to Rosselkhoznadzor, Currently in Russia only dalemsky America and Europe. A few years later, in 2017, the focalities of potato (D1) pathotype of the 1 agent S. endobioticum was detected in the wart disease were revealed in 13 is distributed (Yakovleva, 1975; countries growing potatoes, including constituent entities of the Russian Mironenko, Hutti, Afanasenko, Asia, Africa and Oceania. Currently, Federation on the square 194.9 ha. 2009). Due to the large volume of the focalities of wart disease of potato There are numerous pathotypes of seed import and ware potatoes from have registered in 36 countries, and S. endobioticum. The emergence of countries spread of a pathogen to the pathogen is a quarantine object in new pathotypes of potato wart disease the Russian Federation, we cannot more than 30 countries of the world is caused by many factors, including exclude the possibility of forming (www.gd.eppo.int) (Fig. 3). cultivation of resistant varieties, and the new pathotypes of S. endobioticum The agent of potato wart disease presence of weeds of family Solanaceae with increased aggressiveness that is is included in a Common list of in a potato field (Melnik, 1998). In observed in a number of countries.

Table 2 The concentration of the DNA isolated from the potato galls with the use of the automatic station HK TECAN and using sets of “DNA Extran-2” DNA, purify DNA, purify Sample automatic station NA TECAN using a set of “DNA Extran-2” № weight of concentration, concentration, gall, mg А 260/280 А 260/280 ng/mql ng/mql 1 0.5 12.0 1.86 12.2 1.92

2 1 19.5 1.87 38.4 1.51

3 2 39.7 1.91 79.5 1.35

4 3 41.3 1.78 175.3 1.46

36 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА For differentiation of pathotypes Materials and methods In the formulation of the conventional S. endobioticum common in countries Potato tubers of varieties Lorch, PCR as an internal positive control of the EPPO, in the framework of which were superficially disinfected a fragment of the gene of the mouse the European project EUPHRESCO with water and soap solution, 1700042G15 (www.ncbi.nlm.nih.gov) II – SENDO (2012-2014) a set of solution of mercuric chloride non-coding RNAS (714 b.p.) (Mazurin, varieties-differentiators was selected (0.01%) and washed with a sterile Kopina, Sherokolava, 2012) was used. and molecular methods of separation water have been used to obtain new The proportion of the reaction mixture of pathotypes (Fig. 5) have been infectious material. Further prepared and temperature-time parameters of developed. The specialists of FGBU tubers with sprouts were artificially the PCR amplification (Table 1) have “VNIIKR” participated in the ring contaminated with a small amount been optimized. test – test performance study (TPS) of compost obtained by the method Within the framework of the “Diagnostic methods for identification of Spikerman, and were placed on an ring-test of the international of S. endobioticum pathotypes” empty agar (0.5%) in a sterile flask. project ЕUPHRESCO II – SENDO (EUPHRESCO II – SENDO) in the Inoculated tubers were incubated at samples with inactivated winter section “Diagnostics of the winter a temperature of 12-14 ºC and high zoosporangia of S. endobioticum of zoosporangia of potato wart disease relative humidity. After drying, the unclassified pathotypes, and positive using molecular methods”. contents of the flask were moistened (pathotype1) and negative (other Currently, the direct soil testing fine spray. Every 10-14 days the main than pathotype 1) controls were methods for winter zoosporangia of and side shoots have been cut off. obtained. The participants carried S. endobioticum identification based For DNA purification used the out DNA purification using a set of on flotation in various liquids or following sample plant tissue: 0.5 mg; DNeasyPlantMiniKit (Qiagen). DNA washing in sieves. All these methods 1.0 mg; 2.0 g and 3.0 g DNA probes used for the conventional PCR are quite time-consuming, long-term purification from galls was carried (identification of S. еndobioticum) to perform and they involve the use of out by the following methods: at (Lévesque et al., 2002) and RT-PCR organochlorine toxicant substances. the automatic station selection HK (identification S. еndobioticum) (van For example, the method of flotation TECAN using a set of “M-Sorb-Tub” Gent-Pelzer et al., 2010). in carbon tetrachloride or in a mixture (ZAO “Synthol”, Moscow) and using a of carbon tetrachloride and sulphuric set of reagents “DNA Extran-2” (ZAO Research results ether are used in Russia. “Synthol”, Moscow). Measurement Obtaining potato tubers The ability of the pathogen to of the concentration of DNA was artificially infected with the agent of remain in soil a long time, the presence conducted using spectrophotometer S. еndobioticum, is a rather long of aggressive pathotypes abroad, the NanoDropND-2000. For the and labour-intensive process. The possibility of their importation into conventional PCR were selected methods widely used at the present the territory of the Russian Federation specific primers 585FS.E./S.E.585R time, are based on inoculation of explains the usefulness of conducting based on the gene 16S rDNA, which susceptible varieties of potatoes research to improve diagnostic amplificated product with the size of infected with soil compost containing methods of Synchytrium endobioticum. 600 b.p. (Table 1). more than 5 zoosporangia of

A) B)

Рис. 7. Электрофореграмма продуктов амплификации ПЦР S. endobiotiсum с праймерами S.E.585F/S.E.585R: А – образцы ДНК, выделенные на автоматической станции НК TECAN; Б – с использованием набора «ДНК Экстран-2»: дорожка 1 – 0,5 мг, дорожка 2 – 1 мг, дорожка 3 – 2 мг, дорожка 4 – 3 мг, дорожка 5 – К-, дорожка 6 – К+, М – маркер молекулярного веса Fig. 7. The electrophoretogram of the amplification products PCR S. endobiotiсum with primers 585FS.E./S.E585R: A – DNA samples allocated to the automatic station NA TECAN; B – using a set of “DNA Extran-2”: track 1 – 0.5 mg, track 2 – 1 mg, track 3 – 2 mg, track 4 – 3 mg, track 5 – K-, track 6 – K+, M – marker of molecular weight

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 37 Рис. 8. Электрофореграмма продуктов амплификации ПЦР S. endobiotiсum с праймерами S.E.585F/S.E.585R: дорожки 1-2 – Люберецкий изолят, дорожка 3 – Тамбовский изолят, дорожки 4-5 – Пермский изолят, дорожка 6 – S. endobiotiсum патотип 1 (ринг-тест EUPHRESCO II – SENDO), дорожка 7 – S. endobiotiсum патотип 18 (ринг-тест EUPHRESCO II – SENDO), М – маркер молекулярного веса, K - (вода), K+ (S. endobioticum, коллекция ФГБУ "ВНИИКР")

Fig. 8. The electrophoretogram of the amplification products PCR S. endobiotiсum with primers 585FS.E./S.E.585R: tracks 1-2 – Lyuberetsky isolate, track 3 – Tambovsky isolate, tracks 4-5 – Permsky isolate, track 6 – S. endobiotiсum pathotype 1 (ring test EUPHRESCO II – SENDO), track 7 – S. endobiotiсum pathotype 18 (ring test EUPHRESCO II – SENDO), M – marker of molecular weight, K- (water), Рис. 9. Электрофореграмма продуктов амплификации K+ (S. endobioticum, a collection of FGBU “VNIIKR”) ITS-участка S. endobioticum: дорожки 1-10 – образцы 1-10 соответственно S. endobioticum in 1 g of soil. Such other inhibitors, with significant (ринг-тест EUPHRESCO II – SENDO), methods underlie the biological soil absorbance at 280 nm (Table 2). дорожка 11 – отрицательный контроль testing to identify the agent of potato The carried out investigations have выделения, дорожка 12 – отрицательный контроль амплификации, дорожка 13 – wart disease. shown that the use of the automatic положительный контроль выделения (зимние In ongoing studies due to artificial station HK TECAN allows to obtain the зооспорангии S. endobioticum), дорожка 14 – К+ contamination of potato with isolates DNA of the agent with a 260/280 ratio (S. endobioticum, патотип 1), дорожка 15 – of S. endobioticum from the collection in the range of 1.78 to 1.92. According К- (вода), дорожка 16 – К+ (S. endobioticum, of FGBU “VNIIKR” in 8-10 weeks on to the set “DNA Extran-2” during коллекция ФГБУ «ВНИИКР») some of the tubers have formed new DNA purification the quality of DNA galls, which were used for further samples is much lower (ratio 260/280 Fig. 9. The electrophoretogram of the amplification products studies (Fig. 6). Getting new galls ranged from 1.35 to 1.92). Besides the ITS-region of S. endobioticum: in the flask in comparison with extraction of DNA by the automatic tracks 1-10 – probes 1-10, respectively (the “classical” methods of inoculation station HK TECAN allows to obtain ring test EUPHRESCO II – SENDO), track facilitates further studies, because DNA samples of lower concentration, 11 – negative DNA extraction control, track the probes of diseased tissue are in contrast to the set of “DNA Extran-2”. 12 – negative amplification control, track not in contact with the soil, thereby The results of the conventional 13 – positive negative DNA extraction control the possibility of accompanying soil PCR is shown on the Fig. 7 (A, B). (winter zoosporangia of S. endobioticum), track micromycetes infection reduces. Despite the fact that the concentration 14 – K+ (S. endobioticum, pathotype 1), track To determine the optimal method of the isolated DNA when using 15 – K- (water), track 16 – K+ (S. endobioticum, for DNA purification S. endobioticum the HK TECAN significantly less in a collection of FGBU “VNIIKR”) from galls the DNA extraction by two comparison with the use of a set of different methods was carried out. “DNA Extran-2”, when a performing Extran-2” did not lead to the This takes into account the quantity PCR positive results have been formation of amplicons of the internal and quality of obtained DNA probes. achieved. Elektoroforegramm shows control indicates the presence of PCR The purity of DNA probe was that when adding DNA samples inhibitors in the probes. estimated by the ratio of the allocated in the station HK TECAN DNA purification at the station magnitude of optical density (OD) of to the reaction mixture, products HK TECAN has allowed to detect a solution of nucleic acids at 260 nm specific to S. endobiotiсum, which size the agent of potato wart disease in to the value of OD DNA at 280 nm. of 600 b.p. are formed. THe presence of all studied batches. However, when DNA preparation is considered pure amplicons of the internal control which using sets of “DNA Extran-2” DNA if the ratio of the values of 260 nm/ size of 714 b.p. indicates the absence of S. endobiotiсum in the galls of potato 280 nm is approximately 1.8. In the PCR inhibitors, and it points to a high wart disease was unable to detect. case of smaller values of this index quality of introduced DNA. Studies have shown that the the product contains large quantity Elektoroforegramm (Fig. 7 B) DNA purification of the agent of impurities of protein, phenol or shows that the use of a set of “DNA S. endobiotiсum on the automatic

38 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Table 3 The value of threshold cycle Ct in identifying of S. endobioticum (wart disease of potato) by RT-PCR

Ct FAM- Result specific Ct S. endobioticum Probe S. endobioticum НЕХ-IPC (wart disease of potato) (wart disease of potato) +/-

К- (water) – negative amplification control N/A 38.78 -

К+ (DNA S. endobioticum Р1) 23.53 23.47 +

К- (water) – negative DNA extraction control N/A 40.52 - K+ (winter zoosporangia of S. endobioticum) is a positive DNA extraction control 34.97 37.47 + Probe 01 N/A 38.56 -

Probe 02 35.92 40.23 +

Probe 03 N/A 39.06 -

Probe 04 N/A 38.45 -

Probe 05 N/A 39.32 -

Probe 06 N/A 37.75 -

Probe 07 N/A 39.75 -

Probe 08 36.77 40.42 +

Probe 09 N/A 37.56 -

Probe 10 33.29 37.98 +

Note: Ct FAM and Ct HEX – value of the threshold cycle for FAM and HEX colourants, respectively. station HK TECAN allows to obtain Elektoroforegramm shows isolates of the same pathotype DNA of higher quality. This method that with all investigated samples belonged to different genotypes. for sample preparation can be amplicons with the size of 600 b.p. Identification of S. endobiotiсum recommended in further studies. were obtained. It was found that the and differentiation of pathotypes with The next task of the studies was selected primers allowed to identify the use of molecular genetic methods to assess the possibility of using the agent of potato wart disease in has been one of the objectives of the selected primers for identification of the probes of different origins, and international project EUPHRESCO genetically different DNA samples to identify different pathotypes of II – SENDO. The organizers have of S. endobiotiсum. For this purpose S. endobiotiсum (in our studies they developed a conventional PCR and a set of isolates of S. endobiotiсum are 1 and 18). This demonstrates the RT-PCR to identify the agent of potato of different origins was created: possibility of using these markers wart disease. RT-PCR based on SNP Tambovskya oblast, Permskya oblast, to identify the agent of potato wart (single nucleotide polymorphism) Lyuberetsky district of Moscow disease, regardless of its place of was developed for differentiation region, inactivated zoosporangia origin. Many researchers note that the of pathotypes. The test is based on from TPS EUPHRESCO – identification of intraspecific genetic detection of differences in the single SENDO (S. endobiotiсum pathotype 1, diversity of S. endobiotiсum is not nucleotides of the sequence of genome S. endobiotiсum pathotype 18) were difficult, in contrast to the separation S. endobioticum of pathotype 1 also included. From all of the probes of pathotypes of potato wart disease. compared to the same part of the there was DNA purification with the According to Gagnon with co-authors genome of other pathotypes of help of method mentioned above, (2016), when studying 22 isolates of the agent, i.e., single-nucleotide followed by a performing of the different geographical origins (Europe polymorphism. conventional PCR with the specific and North America) with the use of 21 Conventional PCR method to primers 585FS.E./S.E.585R. The SSR-primers there was no correlation identify potato wart disease was results are presented in the Fig. 8. between genotypes and pathotypes: firstly proposed by Lévesque with

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 39 co-authors (2002), and later it was 6. The application of the Measures for Potato, Chernovtsy, modified (Boogert et al., 2005). In conventional PCR and RT-PCR Ukraine. 2013 the method has been validated allowed us to identify the agent of 10. Franc G.D. 2007. Potato Wart. as an international ring test. potato wart disease S. endobioticum APSnet Features. Last accessed October DNA extracted from a set of ten in the test probes. 31, 2012, from: http://www.apsnet.org/ encrypted TPS probes consisting of publications/apsnetfeatures/Pages/ winter zoosporangia Synchytrium References PotatoWart. aspx. endobioticum. was used to detect 1. Kiryukhina R.K., Kuzmina L.P. 11. Gagnon M.C., van der Lee T.A., S. endobioticumin performing the The heterogeneity of the populations Bonants P.J., Smith D.S., Li X., conventional PCR. The results are of the agent of potato wart disease. Lévesque C.A., Bilodeau G.J. 2016. presented in the Fig. 9. М., 1969. P. 112. Development of polymorphic Elektoroforegram shows that the 2. Mazurin E.S. Control of reliability microsatellite loci for potato wart amplification products with a size of of the results of phytosanitary expertise from next-generation sequence data // 472 b.p. of the internal transcribed in the use of molecular diagnostic Phytopathology, 106 (6): 636-644. spacer (ITS) were obtained with methods / E.S. Mazurin, M.B. Kopina, DOI 10.1094/PHYTO-12-15-0317-R. the positive samples control and N.A. Sherokolava // Vestnik of RUDN, 12. Laidlaw W.M.R. 1985. A investigated samples 2, 8 and 10. This series of agronomy, and animal method for the detection of the indicates the presence of the agent of breeding, 2012. № 3. P. 31-38. resting sporangia of potato wart potato wart disease in three of the ten 3. Mironenko N.V., Hutti A.V., disease (Synchytrium endobioticum) probes, while in the probes 2 and 8 there Afanasenko O.S. Structure of the in the soil of old outbreak sites // is a low concentration of the agent. population of the agent of potato Potato Res., 28: 223-232. In addition, there was a performing wart disease for virulence and 13. Lévesque C.A., Ward L.J., de RT-PCR with DNA sample to identify DNA markers // Mycology and Jong S.N., De Boer S.H., van den S. endobioticum. Obtained results are Phytopathology, 2009. Т. 43. Pub. 5. Boogert P.H.J.F., and Baayen R.P. presented in the Table 3. P. 92-101. 2002. A new soil assay for Synchytrium The table shows that of the ten 4. Yakovleva V.A. Races of the endobioticum, the causal agent of investigated probes the fluorescence agent of potato wart disease in the potato wart // Phytopathology, 92: 46. for the two colourants was recorded USSR, their virulence and range // Publication № P-2002-0334-AMA. only in probes 2, 8 and 10, which Problems of Oncology and teratology 14. Melnik P.A. 1998. Wart disease confirmed the results obtained by of plants. L., 1975. P. 384-387. of potato, Synchytrium endobioticum conventional PCR. 5. Yakovleva V.A., Dyachenko A.A. (Schilbersky) Percival. EPPO Pest risk analysis of the agent of Technical documents 1032, Paris. Conclusions potato wart disease Synchytrium 15. Van den Boogert P.H.J.F., van 1. In laboratory conditions it endobioticum (Schilb.) Perc. for the Gent-Pelzer M.P.E., Bonants P.J.M., is possible to obtain new galls territory of the Russian Federation. De Boer S.H., Wander J.G.N., S. endobiotiсum in the cultivation M.: FGBU “VNIIKR”, 2007. Lévesque C.A., van Leeuwen G.C.M., of tubers of susceptible varieties in 6. Hutti A.V. Resistance of potatoes Baayen R.P. 2005. Development flasks on nutrient media. to quarantine diseases / A.V. Hutti, of PCR-based detection methods 2. The optimal method of DNA O.Y. Antonova, N.V. Mironenko, for the quarantine phytopathogen purification S. endobioticum from T.A. Gavrilenko, O.S. Afanasenko // Synchytrium endobioticum, causal galls is sample preparation using the Vavilovsky journal of genetics and plant agent of potato wart disease // auto station, HK TECAN, which was selection, 2017. Т. 21 (1). P. 51-61. European Journal of Plant Pathology, confirmed by the production of the 7. Baayen R.P., Cochius G., 113: 47-57. conventional PCR. Hendriks H., Meffert J.P., Bakker J., 16. Van Gent-Pelzer M.P.E., Krijger M., 3. Mass gall of potato for DNA Bekker M., Boogert P.H.J.F., Bonants P.J.M. 2010. Improved purification should be less than 0.5 mg. Stachewicz H. and Leeuwen G.C.M. real-time PCR assay for detection 4. Selected primers 585FS.E./ 2006. History of potato wart disease in of the quarantine potato pathogen, S.E.585R allow identification of the Europe – a proposal for harmonisation Synchytrium endobioticum, in zonal agent of potatoes from different in defining pathotypes // European centrifuge extracts from soil and in geographical origin. Journal of Plant Pathology, 116: 21-31. plants // Eur. J. Plant Pathol., 126 (1): 5. Within the framework of the 8. Bojnansky V. 1984. Potato 129-133. project EUPHRESCO II – SENDO wart pathotypes in Europe from the 17. EPPO Global Database (www. there were proven methods of DNA ecological point of view // EPPO gd.eppo.int). purification from the suspension of Bull., 14 (2): 141-146. 18. National Center for winter zoosporangia using a set of 9. EPPO. 2008. Report of the 15th Biotechnology Information Search DNeasyPlantMiniKit (Qiagen). meeting of the Panel on Phytosanitary database (www.ncbi.nlm.nih.gov).

40 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА УДК 632.38

ДИАГНОСТИКА НЕПОВИРУСА КОЛЬЦЕВОЙ ПЯТНИСТОСТИ ТОМАТА (TORSV) методом классической ПЦР

Ю.Н. Приходько, ведущий научный сотрудник научно-методического отдела фитопатологии ФГБУ «ВНИИКР» Т.С. Живаева, научный сотрудник научно-методического отдела фитопатологии ФГБУ «ВНИИКР»

Начало статьи можно прочитать в предыдущем номере журнала.

Результаты исследований и праймером Random dN6 (рис. 1, При испытании набора реаген- Серия экспериментов была прове- фото 1). Этот набор содержит при- тов для обратной транскрипции дена с праймерами D1/U1 (Rott et al., родную форму обратной транскрип- Sensiscript RT Kit фирмы Qiagen 1991), рекомендованными в диа- тазы M-MuLV. Использование с на- (Нидерланды), который содер- гностическом протоколе ЕОКЗР. бором First Strand cDNA Synthesis Kit жит рекомбинантную ревертазу

При отработке реакции обрат- праймера Oligo(dT)18 позволило син- Sensiscript Reverse Transcriptase, ной транскрипции констатировано тезировать кДНК лишь четырех из в комбинировании с прайме-

существенное влияние используе- шести испытуемых изолятов ToRSV рами Random dN6, Oligo(dT)18,

мых реагентов и праймеров на эф- (рис. 1, фото 2). Random dN6 + dT8G, Random dN6 +

фективность синтеза кДНК ToRSV. кДНК пяти изолятов ToRSV по- Oligo(dT)16 кДНК была синтези- Лучший результат получен с набо- лучена с комплектом реагентов для рована всего для 2-3 изолятов ром для обратной транскрипции проведения обратной транскрипции ToRSV (рис. 1, фото 10-13). Одна- Maxima First Strand cDNA Synthesis фирмы ООО «Агродиагностика» ко при использовании совмест- Kit (ThermoScientific, США) (рис. 1, (Россия) (рис. 1, фото 4), содержа- но с набором Sensiscript RT Kit

фото 3), с помощью которого кДНК щим праймер Random. смеси праймеров Random dN6 +

была получена для всех шести испы- Реагенты для обратной транс- Oligo(dT)18 кДНК была синтези- туемых положительных образцов крипции фирмы Диалат (Россия) рована для пяти изолятов ToRSV. (изолятов ToRSV PV-0049, PV-0380, были испытаны с несколькими уни- Аналогичные результаты были по- PV-0381) и положительных контролей версальными праймерами для синте- лучены при комбинировании дан-

к ToRSV фирм Bioreba, Adgen и Loewe. за кДНК: Random dN6, Random dN10, ной смеси праймеров с реагентами

Данный набор также очень удобен для Random dN12, Oligo(dT)17 и dT8G. наборов для обратной транскрип- применения, т.к. все его реагенты объ- Эти реагенты (5х буфер для обрат- ции First Strand cDNA Synthesis Kit единены всего в два микса: Maxima ной транскрипции, смесь dNTPs, и MMLV RT Kit. Синтез кДНК не Enzyme Mix (содержащий обратную ревертаза MMLV, RNase inhibitor) не был достигнут при комбинирова-

транскриптазу Maxima и ингиби- входят в состав конкретного набора, нии смеси праймеров Random dN6 +

тор РNаз Ribolock RNase inhibitor) и а поставляются в виде отдельных Oligo(dT)18 с реагентами для об- 5х реакционную смесь (содержащую лотов. При использовании этих ре- ратной транскрипции фирм Диа-

реакционный буфер, смесь dNTPs, агентов и праймеров Random dN10 и лат и Агродиагностика.

праймеры Oligo(dT)18 и Random dN6). Random dN12 была получена кДНК После измерения концентра- Набор содержит обратную транс- для пяти изолятов ToRSV (рис. 1, ции кДНК на спектрофотометре криптазу Maxima, которая представ- фото 8-9). При использовании для микрообъемов «Nanodrop

ляет собой искусственную модифика- праймеров dT8G и Random dN6 ND-2000» констатировано, цию природной ревертазы M-MuLV. была синтезирована кДНК четырех что для успешной амплифика- Несколько более слабая реакция изолятов ToRSV (рис. 1, фото 5, 6), ции концентрация кДНК долж- была получена с кДНК, синтезирован- а при использовании праймера на быть не менее 1100 нг/мкл,

ной с реагентами набора First Strand Oligo(dT)17 синтез кДНК не был по- что имело место в вариантах с на- cDNA Synthesis Kit (ThermoScientific) лучен (рис. 1, фото 7). борами Maxima First Strand cDNA

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 41 Fig. 1. Effect of reagents and primers for reverse transcription on ToRSV detection by RT-PCR Рис. 1. Влияние реагентов и праймеров для обратной транскрипции на выявление ToRSV методом RT-PCR

Synthesis Kit, First Strand cDNA и зарубежных фирм-производите- и MasDDTaqMix-2025 (Диалат), Synthesis Kit, Sensiscript RT Kit и лей, специфичность данных прай- AccuPrime Taq DNA Polymerase MMLV RT Kit (таблица 3). меров и воспроизводимость тестов. High Fidelity Kit (LifeTechnologies), При использовании для обрат- Реакция праймеров D1/U1 со Platinum Taq DNA Polymerase Kit ной транскрипции антисмысло- всеми изучаемыми изолятами (Life Technologies) и AmpliTaq вого (обратного) специфичного ToRSV была получена только с на- Gold DNA Polymerase (Applied праймера D1 кДНК была получе- бором реагентов Dream TaqGreen Biosystems) (рис. 2, фото 6-10). на для всех испытуемых изолятов PCR Master Mix (ThermoScientific) В вариантах с этими наборами ToRSV (PV-0049, PV-0380, PV-0381 (рис. 2, фото 1). При использова- специфичные продукты были и положительного контроля для нии наборов Dream Taq PCR Master получены лишь для изолятов ИФА к ToRSV фирмы Loewe), но Mix (ThermoScientific) и Emerald PV-0049 и PV-0380, а также для для изолята PV-0381 концентра- Amp GT PCR Master Mix (TaKaRa положительных контролей фирм ция кДНК была очень низкой. Bio Inc.) была получена реак- Adgen и Loewe. При испытании на- Таким образом, установлено, ция с изолятами ToRSV PV-0049, бора HotStar HiFidelity Polymerase что для синтеза кДНК ToRSV и PV-0380, PV-0381 и положительны- Kit (Qiagen) реакция была получена последующего проведения ПЦР с ми контролями для ИФА к ToRSV лишь для изолятов PV-0049, PV-0380 праймерами D1/U1 однозначное фирм Adgen и Loewe, но не с по- и положительного контроля фирмы преимущество имеет набор реа- ложительным контролем для ИФА Adgen, а при использовании набора гентов для обратной транскрипции фирмы Bioreba (рис. 2, фото 2-3). Multiplex PCR Kit (Qiagen) – лишь Maxima First Strand cDNA Synthesis При испытании наборов Tersus PCR для изолята PV-0380. Kit фирмы ThermoScientific (США), Kit (Евроген) и Screen Mix HS (Ев- При использовании набора содержащий смесь универсальных роген) наблюдалась реакция с изо- ScrinMix (Евроген) специфичный

праймеров Oligo(dT)18 и Random лятами PV-0049 и PV-0380, а также продукт был амплифицирован для dN6. Синтез кДНК эффективен так- со всеми положительными кон- всех 6 изолятов ToRSV, но при этом же с антисмысловым (обратным) тролями для ИФА, но для изолята в большинстве вариантов имело праймером ToRSV-D1. PV-0381 специфичный продукт не место также образование высо- В последующих экспериментах с был получен (рис. 2, фото 4-5). комолекулярного неспецифично- праймерами D1/U1 оценивали эф- Одинаковые результаты были го продукта амплификации. При фективность комплектов реагентов получены для наборов Screen испытании набора Encyclo PCR для ПЦР различных отечественных Mix HS (Евроген), MagMIX-2025 Kit (Евроген) также наблюдалось

42 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Таблица 3 Концентрация кДНК изолятов ToRSV, синтезированной различными комплектами реагентов для обратной

транскрипции со смесью праймеров Oligo(dT)18 и Random dN6

Концентрация кДНК, синтезированной с наборами (нг/мкл)

№ Изолят Набор Комплект Maxima First п/п ToRSV First Strand cDNA реагентов реагентов для Sensiscript MMLV Strand cDNA synthesis Kit для ОТ ОТ фирмы RT Kit RT Kit synthesis Kit (ThermoScientific) фирмы Агро- (Qiagen) (Евроген) (ThermoScientific) Диалат диагностика ToRSV 2719,5 1023,6 199,9 1146,1 2274,8 1 PV-0049 1812,0 ToRSV 2626,9 1009,8 229,7 1156,1 2349,6 1734,0 2 PV-0380 ToRSV 2624,4 1011,6 279,3 1145,1 2260,5 1747,4 3 PV-0381 ToRSV+K, 2678,0 927,7 147,4 1136,7 2270,0 1747,3 4 Bioreba ToRSV+K, 2732,5 1049,0 337,3 1177,2 2208,2 1774,9 5 Adgen ToRSV+K, 2519,3 991,1 321,1 1187,5 1606,5 1690,6 6 Loewe

образование многочисленных не- пятнистости табака (TRSV), чер- агентов 2,5x MasST Mix Green-1525 специфичных продуктов, что мо- ной кольчатости томата (TBRV), (Диалат) – при разведении в 10-6. жет затруднить достоверную диа- кольцевой пятнистости малины Таким образом, нами кон- гностику целевого объекта. (RpRSV) и черной кольцевой пят- статировано, что праймеры D1/ Таким образом, установлено, что нистости картофеля (PBRSV). Не U1 характеризуются высокой для проведения ПЦР с праймерами наблюдалось также неспецифич- специфичностью и чувствительно- D1/U1 однозначное преимущество ной реакции этих праймеров с сад- стью, но их надежное применение имеет использование набора реаген- вавирусом латентной кольцевой из числа 15 испытанных комплектов тов Dream TaqGreen PCR Master Mix пятнистости земляники (SLRSV), реагентов для ПЦР было возможным фирмы ThermoScientific. При этом ис- триховирусом хлоротической пят- лишь с набором Dream TaqGreen PCR пользование данного набора обеспе- нистости листьев яблони (ACLSV), Master Mix фирмы ThermoScientific. чивало высокую воспроизводимость капилловирусом бороздчатости При испытании праймеров результатов вне зависимости от ис- древесины яблони (ASGV), поти- ToRSV-С/ToRSV-Н (Rowhani et al., пользуемого амплификатора: «Тер- вирусом шарки слив (PPV), аль- 1998), комплементарных участку цик» фирмы ДНК-Технология или фамовирусом мозаики люцерны гена белка оболочки РНК-2 ToRSV, «Veriti» фирмы Applied Biosystems. (AlMV), иларвирусами мозаики специфичный продукт был получен Удовлетворительная воспро- яблони (AрMV), американского лишь для положительного контро- изводимость результатов при ис- линейного узора сливы (APLPV), ля для ИФА к ToRSV фирмы Loewe, пользовании данных амплифика- некротической кольцевой пятни- но не для референтных изолятов торов констатирована также для стости косточковых (PNRSV) и этого вируса. Одинаковый резуль- наборов MagMIX-2025 (Диалат) и карликовости сливы (PDV). тат был получен вне зависимости Tersus PCR Kit (Евроген). Для ма- Не отмечено неспецифичной ре- от способа синтеза кДНК этих изо- стер-миксов MasDDTaqMix-2025, акции праймеров D1/U1 с препара- лятов, который осуществлялся с

ScrinMix HS, ScrinMix, Encyclo PCR тами нуклеиновых кислот, выделен- праймерами Oligo(dT)16, Random

Kit и Emerald Amp GT PCR Master ных из здоровых растений герберы, dN6 и ToRSV-С и комплектом реа- Mix воспроизводимость результа- хризантемы, вишни, алычи и мали- гентов для обратной транскрипции тов была неудовлетворительной, ны, но при анализе нуклеиновых MMLV RT Kit фирмы Евроген. а использование амплификатора кислот, выделенных из растений При использовании для диагно- «Терцик» в большинстве случаев пеларгонии и сливы, наблюдалась стики ToRSV праймеров ToRSV- способствовало более эффектив- амплификация неспецифичных rdp-R/ToRSV-rdp-F (Fuchs et al., ной амплификации по сравнению продуктов в низкой концентрации. 2010), разработанных к участку гена с использованием амплификатора Установлено, что при исполь- РНК-зависимой РНК-полимеразы «Veriti». зовании комплекта реагентов этого вируса, специфичный продукт При проведении оценки специ- Dream TaqGreen PCR Master Mix планируемой величины был полу- фичности установлено, что прай- (ThermoScientific) выявление ToRSV чен лишь для референтных изоля- меры D1/U1 не реагируют с дру- методом классической ПЦР с прай- тов PV-0049, PV-0381 и положитель- гими неповирусами: скручивания мерами D1/U1 возможно при разве- ного контроля для ИФА к ToRSV листьев черешни (CLRV), мозаи- дении инфекционного сока в 10-7, а фирмы Loewe. Во всех вариантах ки резухи (ArMV), кольцевой при использовании комплекта ре- (включая отрицательный контроль)

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 43 Fig. 2. Effect of reagent kits for PCR on ToRSV detection by RT-PCR using ToRSV-D1/ToRSV-U1 primers Рис. 2. Влияние комплектов реагентов для ПЦР на выявление ToRSV методом RT-PCR с использованием праймеров ToRSV-D1/ToRSV-U1

наблюдались также многочислен- продуктов планируемой величины При оценке воспроизводимости те- ные неспецифичные продукты. всех испытуемых изолятов ToRSV стов с праймерами TorRS-cp-F/ToRSV- Ввиду несомненной штаммспеци- была получена при использовании cp-R установлено, что тип исполь- фичности праймеров ToRSV-С/ двух наборов фирмы ThermoScientific зуемого амплификатора («Терцик» ToRSV-Н (Rowhani et al., 1998) и – Dream TaqGreen PCR Master Mix и или «Veriti») не имел существенного ToRSV-rdp-R/ToRSV-rdp-F (Fuchs et Dream Taq PCR Master Mix. Несколь- значения при использовании наборов al., 2010), дальнейшие эксперименты ко менее эффективным был набор Tersus PCR Kit (Евроген), Encyclo PCR с ними было решено не проводить. Screen Mix фирмы Евроген. Kit (Евроген) и MaqMix-2025, тогда Праймеры TorRS-cp-F/ToRSV- При испытании набора Screen как при испытании наборов Dream cp-R (Jossey, Babadoost, 2008) раз- Mix HS фирмы Евроген продукты TaqGreen PCR Master Mix, Screen работаны к участку гена белка обо- амплификации были получены для Mix и Screen Mix HS полимеразная лочки РНК-2 ToRSV и использова- четырех изолятов ToRSV: PV-0049 цепная реакция более успешно про- лись в США для диагностики этого и положительных контролей для ходила на амплификаторе «Терцик», вируса на овощных культурах. ИФА фирм Bioreba, Adgen и Loewe. а набора MasDDTaqMix-2025 – на ам- Для отработки диагностики Эффективность 8 других набо- плификаторе «Veriti». ToRSV с использованием данных ров для ПЦР: MagMIX-2025 (Диа- Низкая воспроизводимость праймеров нами были испытаны лат), MasDDTaqMix-2025 (Диалат), результатов при использовании 12 комплектов реагентов для ПЦР AmpliTaq Gold DNA Polymerase Kit праймеров TorRS-cp-F/ToRSV-cp-R нескольких отечественных и за- (Applied Biosystems), Tersus PCR Kit констатирована также во времен- рубежных фирм-производителей, (Евроген), Encyclo PCR Kit (Евро- ном плане для трех мастер-миксов оценена специфичность этих прай- ген), AccuPrime Taq DNA Polymerase из четырех испытуемых. меров и воспроизводимость тестов. High Fidelity Kit (LifeTechnologies), В то же время установлено, что Во всех экспериментах ПЦР прово- Maxima Hot Start Green PCR Master праймеры TorRS-cp-F/ToRSV-cp-R дили с кДНК, синтезированной с на- Mix (ThermoScientific) и HotStar Taq характеризуются высокой специ- бором для обратной транскрипции Master Mix Kit (Qiagen) была равной фичностью, т. к. не реагируют с Maxima First Strand cDNA Synthesis и невысокой. При использовании изолятами близкородственных Kit, который был признан наиболее этих наборов специфичные продук- неповирусов (TRSV, ArMV, TBRV, эффективным набором для синтеза ты амплификации были получены CLRV, RpRSV, PBRSV), а также с первой цепи кДНК ToRSV по итогам лишь для трех изолятов ToRSV: PV- другими вирусами, встречающи- предварительных испытаний. 0049 и положительных контролей мися на плодовых и декоративных Амплификация специфичных для ИФА фирм Adgen и Loewe. культурах в смешанной инфекции с

44 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА ToRSV (SLRSV, ACLSV, ASGV, AlMV, Специфичность праймеров болезни древесных растений. ApMV, PPV, APLPV, PNRSV, PDV). ToRSV-P3F/ToRSV-P3R не вызывает М.: Наука, 1985. 133 с. Наиболее эффективная диагности- сомнений, так как они не реагиру- 3. Bitterlin M.W., Gonsalves D. ка изучаемых изолятов ToRSV была ют с изолятами близкородственных Serological grouping of tomato достигнута с использованием прай- неповирусов (TRSV, ArMV, TBRV, ringspot virus isolates: Implication меров ToRSV-P3F/P3R, разработан- CLRV, RpRSV, PBRSV) и садвавируса for diagnosis and cross-protection // ных в научно-методическом отделе латентной кольцевой пятнистости Phytopathology, 1988. Vol. 78. Р. 278-285. фитопатологии ФГБУ «ВНИИКР» к земляники (SLRSV), а также с други- 4. Dunez J. Exotic virus and virus- участку 3'-NTR генома этого вируса. ми вирусами, которые могут встре- like disease of fruit trees // Bull. Для постановки ПЦР с этими чаться на плодовых и декоративных OEPP/EPPO Bull., 1981. Vol. 11, праймерами была пригодна кДНК, культурах в смешанной инфекции с № 3. P. 251-258. синтезированная наборами реа- ToRSV (ACLSV, ASGV, AlMV, ApMV, 5. Fuchs M., Abawi G.S., Marsella- гентов для обратной транскрипции PPV, APLPV, PNRSV, PDV). Herrick P., Cox R., Cox K.D., фирмы Агродиагностика (Россия), Не отмечено неспецифичной Carroll J.E., Martin R.R. Occurrence MMLV RT Kit (Евроген, Россия), реакции праймеров ToRSV-P3F/ of Tomato ringspot virus and Tobacco First Strand cDNA Synthesis Kit и ToRSV-P3R с препаратами нуклеи- ringspot virus in highbush blueberry Maxima First Strand cDNA Synthesis новых кислот, выделенных из рас- in New York state // J. Plant Pathol., Kit (оба – ThermoScientific, США). тений различных косточковых и 2010. Vol. 92. P. 451-459. Специфичные продукты плани- декоративных культур. 6. Gilmer R.M., Uyemoto J.K. руемой величины (601 п.н.) были При использовании прайме- Tomato ringspot virus in Baco noir получены ко всем изучаемым изо- ров ToRSV-P3F/ToRSV-P3R (ФГБУ grapevines in New York // Plant Dis. лятам ToRSV практически со всеми «ВНИИКР») с комплектами реа- Rep., 1972. Vol. 56. P. 133-135. испытуемыми наборами реагентов гентов Dream TaqGreen PCR Master 7. Gordejchuk O.G., Krylov O.V., для ПЦР различных фирм-про- Mix (ThermoScientific) и 2,5x MasST Kyloba L.V., Samonina I.N. // изводителей: MasDDTaqMix-2025 и Mix Green-1525 (Диалат) выявление Zentralblatt Bakt. Parasit. Infect. und MagMix-2025 фирмы Диалат (Рос- ToRSV возможно при разведении Hygiene, 1977. Vol. 132. P. 686-707. сия) (рис. 3, фото 1-2), Screen Mix, инфекционного сока соответствен- 8. Griesbach J.A. Detection of Screen Mix HS, Tersus PCR Kit и но в 10-6 и 10-7. tomato ringspot virus by polymerase Encyclo PCR Kit фирмы Евроген Таким образом, установле- chain reaction // Plant Disease, 1995. (Россия) (рис. 3, фото 3; рис. 4, фото но, что праймеры ToRSV-P3F/ Vol. 79. P. 1054-1056. 7-9), Dream TaqGreen PCR Master ToRSV-P3R, разработанные нами 9. Jossey S., Babadoost M. Mix, Dream Taq PCR Master Mix и к консервативному участку генома Occurrence and distribution of Maxima Hot Start Green PCR Master ToRSV (3'-UTR РНК-1 и РНК-2), pumpkin and squash viruses in Illinois // Mix фирмы ThermoScientific (США) реагировали со всеми испытанными Plant Disease, 2008. Vol. 92. P. 61-68. (рис. 3, фото 4; рис. 4, фото 5-6), изолятами этого вируса, характери- 10. Li R., Mock R., Fushs M., AmpliTaq Gold DNA Polymerase Kit зуются высокой специфичностью, Halbrendt J., Howell B., Liu J. фирмы Applied Biosystems (США) чувствительностью и обеспечива- Characterization of the partial RNA1 (рис. 3, фото 5), HotStar Taq Master ют высокую воспроизводимость and RNA2 3'-untranslated region Mix Kit фирмы Qiagen (Нидерлан- результатов при их использовании of Tomato ringspot virus isolates ды) (рис. 4, фото 2), AccuPrime Taq с различными комплектами реа- from North America // Can. J. Plant DNA Polymerase High Fidelity Kit и гентов для ПЦР отечественных и Pathol., 2011. Vol. 33. P. 94-99. Platinum Taq DNA Polymerase фир- иностранных фирм-производите- 11. Martin R.R., Pinkerton J.N., мы Life Technologies (США) (рис. лей. Эти праймеры рекомендуются Kraus J. The use of collagenase 4, фото 3-4). Исключение составил нами для проведения скрининговых to improve the detection of plant набор HotStar HiFidelity Polymerase тестов подкарантинной продукции viruses in vector nematodes by Kit фирмы Qiagen (рис. 4, фото 1), на наличие ToRSV. Для проведения RT-PCR // J. Virol. Methods, 2009. с использованием которого не была последующих подтверждающих те- Vol. 155. P. 91-95. достигнута амплификация с поло- стов целесообразно использовать 12. Mayo M.A., Robinson D.J. жительным контролем для ИФА к праймеры D1/U1 (Rott et al., 1991) Nepoviruses: molecular biology and ToRSV фирмы Loewe. Для наборов и TorRS-cp-F/ToRSV-cp-R (Jossey, replication // The Plant Viruses. New Tersus PCR Kit, Encyclo PCR Kit и Babadoost, 2008), которые специ- York, Plenum Press, 1996. P. 139-185. Screen Mix HS констатировано обра- фичны для других участков генов 13. Mircetich S.M., Hoy J.W. зование неспецифичных продуктов этого вируса – генов РНК-зависимой Brownline of prune trees, a disease амплификации (рис. 4, фото 7-9). РНК-полимеразы и белка оболочки. associated with tomato ringspot virus На примере семи испытанных infection of Myrobalan and peach мастер-миксов и двух используе- Литература rootstocks // Phytopathology, 1981. мых амплификаторов – «Терцик» 1. Келдыш М.А. Особенности рас- Vol. 71. P. 30-35. (ДНК-Технология) и «Veriti» (Applied пространения неповирусов в антро- 14. OEPP/EPPO (2005). EPPO Biosystems) в тестах с праймерами погенных экосистемах // Бюллетень Standard PM 7/49 (1) Diagnostic ToRSV-P3F/ToRSV-P3R констатиро- ГБС РАН, 1994. Вып. 169. С. 132-136. protocol for Tomato ringspot вана возможность получения резуль- 2. Келдыш М.А., Помазков Ю.И. nepovirus // Bulletin OEPP/EPPO татов воспроизводимости. Вирусные и микоплазменные Bulletin. Vol. 35. P. 313-318.

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 45 15. Rott M.E., Tremaine J.H., on Chadonel, Vidal Blanc and Grove D.S. Development of a real- Rochon D.M. Nucleotide sequence Cabernet Sauvignon in Missouri // time RT-PCR SYBR Green assay for of Tomato ringspot virus RNA2 // Proc. Symp. Advanced in Vineyard Tomato ringspot virus in grape // J. General Virology, 1991a. Vol. 72. Pest Management, 2010. P. 75-86. Plant Disease, 2007. Vol. 91. P. 1083- P. 1505-1514. 19. Sokhansany Y., Rakh- 1088. 16. Rott M.E., Gilchrist A., Lee L., shandehroo F., Pourrahim R. First 22. Stouffer R.F., Soulen D.M., Rochon D.M. Nucleotide sequence of report of Tomato ringspot virus Smith S.H. Spread and control of Tomato ringspot virus RNA1 // J. General infecting pepper in Iran // Plant Prunus stem pitting // Acta Hort., Virology, 1995. Vol. 76. P. 465-473. Disease, 2012. Vol. 96. P. 1828. 1975. № 44. Р. 107-112. 17. Rowhani A., Biardi L., Routh G., 20. Stace-Smith R. Tomato 23. Wang A., Sanfaçon H. Daubert S., Golino D. Development of ringspot nepovirus. CMI/AAB Diversity in the coding regions a sensitive colorimetric-PCR assay for Descriptions of Plant Viruses for the coat protein, VPg, protease detection of viruses in woody plants // No. 290. Association of Applied and putative RNA-dependent RNA Plant Disease, 1998. Vol. 82. P. 880-884. Biologists, Wellesbourne, UK, 1984. polymerase among Tomato ringspot 18. Qiu W., Lunden S., Wang L., 21. Stewart E.L., Qu X., Over-ton virus isolates // Can. J. Plant Pathol., Wang Y. Emerging virus-like diseases B.E., Gildow F.E., Wenner N.G., 2000. Vol. 22. P. 145-149.

UDC 632.38

TOMATO RINGSPOT VIRUS DIAGNOSIS (TORSV) Using Conventional PCR

Y.N. Prikhodko, Leading Researcher of the Phytopathology Research and Methodological Department of FGBU “VNIIKR” T.S. Zhivaeva, Research Associate, Phytopathology Research and Methodological Department of FGBU “VNIIKR”

The beginning of the article was published in the previous issue of the journal.

Results of investigation This kit is also very handy, The use of Oligo(dT)18 primer with A series of experiments was because all its reagents are combined the First Strand cDNA Synthesis Kit performed using D1/U1 primers in two mixes: Maxima Enzyme allowed the synthesis of cDNA from (Rott et al., 1991), recommended in Mix (containing Maxima reverse only four of the six test isolates of the EPPO Diagnostic Protocol. transcriptase and Ribolock RNase ToRSV (Fig. 1, photo 2). Significant effect of the reagents inhibitor) and a 5x reaction mixture cDNA of five ToRSV isolates was and primers on the synthesis (containing a reaction buffer, dNTPs obtained using the reagents from efficiency of ToRSV cDNA was mixture, Oligo(dT)18 and Random reverse transcription kit of OOO noted during the test of reverse dN6 primers). The kit contains “Agrodiagnostika” (Russia) (Fig. 1, transcription reaction. The best result Maxima reverse transcriptase, which is photo 4) containing primer Random. was obtained with Maxima First an artificial modification of the natural Reagents for the reverse Strand cDNA Synthesis Kit for reverse M-MuLV reverse transcriptase. transcription of Dialat (Russia) transcription (ThermoScientific, A slightly weaker reaction was were tested with several universal USA) (Fig. 1, photo 3), using it cDNA obtained with cDNA synthesized using primers for cDNA synthesis: Random was obtained for all the six positive the reagents of First Strand cDNA dN6, Random dN10, Random dN12, samples (ToRSV isolates PV-0049, Synthesis Kit (ThermoScientific) and Oligo(dT)17 and dT8G. These reagents

PV-0380, PV-0381) and positive Random primer dN6 (Fig. 1, photo 1). (5x reverse transcription buffer, controls for ToRSV produced by This kit contains the natural form dNTPs mixture, MMLV revertase, Bioreba, Adgen and Loewe. of M-MuLV reverse transcriptase. RNase inhibitor) are not included

46 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Table 3 Concentration of ToRSV cDNA isolates synthesized using different kits of reagents for reverse transcription with a mixture of primers Oligo(dT)18 and Random dN6

Concentration of cDNA synthesized with the kits (ng/mkl)

Kit of № Isolate Kit of reagents Maxima First ToRSV First Strand cDNA reagents for RT Sensiscript MMLV Strand cDNA synthesis Kit for RT produced by RT Kit RT Kit synthesis Kit (ThermoScientific) produced (Qiagen) (Eurogen) (ThermoScientific) by Dialat Agrodiagnostica ToRSV 2719.5 1023.6 199.9 1146.1 2274.8 1812.0 1 PV-0049 ToRSV 2626.9 1009.8 229.7 1156.1 2349.6 1734.0 2 PV-0380 ToRSV 2624.4 1011.6 279.3 1145.1 2260.5 1747.4 3 PV-0381 ToRSV+K, 2678.0 927.7 147.4 1136.7 2270.0 1747.3 4 Bioreba ToRSV+K, 2732.5 1049.0 337.3 1177.2 2208.2 1774.9 5 Adgen ToRSV+K, 2519.3 991.1 321.1 1187.5 1606.5 1690.6 6 Loewe in the specific kit, but are supplied should be at least 1100 ng/mkl as was PCR Master Mix (ThermoScientific) as separate lots. cDNA was obtained the case with Maxima First Strand and Emerald Amp GT PCR Master for five ToRSV isolates using these cDNA Synthesis Kit, First Strand Mix (TaKaRa Bio Inc.), but not with reagents and Random dN10 and cDNA Synthesis Kit, Sensiscript RT Kit a Bioreba positive control for ELISA

Random dN12 primers (Fig. 1, photo and MMLV RT Kit (Table 3). (Fig. 2, photo 2-3). In the context of 8-9). cDNA of four ToRSV isolates cDNA was obtained for all the test Tersus PCR Kit (Eurogen) and Screen was synthesized using the primers isolates of ToRSV (PV-0049, PV-0380, Mix HS (Eurogen) testing, reaction dT8G and Random dN6 (Fig. 1, photo PV-0381 and positive ToRSV control with isolates PV-0049 and PV-0380 5, 6), but no cDNA was obtained using for ELISA (Loewe)) using antisense was observed, as well as with all primer Oligo(dT)17 (Fig. 1, photo 7). (reverse) specific primer D1 for reverse positive controls for ELISA, but no During testing of Sensiscript transcription, but for PV-0381 isolate specific product was obtained for RT Kit for reverse transcription, cDNA concentration was very low. isolate PV-0381 (Fig. 2, photo 4-5). company Qiagen (Netherlands), Consequently, it has been Similar results were obtained which contains Sensiscript Reverse established that Maxima First for Screen Mix HS (Eurogen), Transcriptase, in combination with Strand cDNA Synthesis Kit from MagMIX-2025 and MasDDTaqMix-2025 primers Random dN6, Oligo(dT)18, ThermoScientific (USA), containing (Dialat), AccuPrime Taq DNA Poly-

Random dN6 + dT8G, Random dN6 a mixture of universal primers merase High Fidelity Kit (Life

+ Oligo(dT)16 cDNA was synthesized Oligo(dT)18 and Random dN6 offers Technologies), Platinum Taq DNA for only 2-3 isolates of ToRSV (Fig. 1, a decisive advantage for cDNA Polymerase Kit (Life Technologies) photo 10-13). However, cDNA was synthesis of ToRSV and subsequent and AmpliTaq Gold DNA Polymerase synthesized for five ToRSV isolates PCR with the use of D1/U1 primers. (Applied Biosystems) (Fig. 2, photo using mixture of primers Random cDNA synthesis is also effective with 6-10), with these kits, specific products dN6 + Oligo(dT)18 with Sensiscript antisense (reverse) primer ToRSV-D1. were obtained only for isolates PV-0049 RT Kit. Similar results were obtained Effectiveness of reagent kits and PV-0380, as well as for positive combining this mixture of primers of different local and foreign controls of Adgen and Loewe. Whereas with following kit reagents for manufacturers, the specificity of with HotStar HiFidelity Polymerase Kit reverse transcription: First Strand these primers and repeatability of the (Qiagen), the reaction was obtained cDNA Synthesis Kit and MMLV tests were evaluated in subsequent only for isolates PV-0049, PV-0380 and RT Kit. Synthesis of cDNA was not experiments with D1/U1 primers. Adgen positive control; and using the achieved combining the mixture The reaction of D1/U1 primers Multiplex PCR Kit (Qiagen) – only for of primers Random dN6 + Oligo with all the studied ToRSV isolates PV-0380 isolate.

(dT)18 with reagents for reverse was obtained only with the reagent A specific product was amplified transcription produced by Dialat and kit Dream TaqGreen PCR Master for all 6 ToRSV isolates using ScrinMix Agrodiagnostika. Mix (ThermoScientific) (Fig. 2, (Eurogen) kit, but in the majority of After measuring the cDNA photo 1). Reaction with ToRSV PV- cases a highly molecular non-specific concentration on a Nanodrop ND-2000 0049, PV-0380, PV-0381 isolates and amplification product also occurred. micro-volume spectrophotometer, positive ToRSV controls for ELISA Numerous non-specific products it was stated that for successful (Adgen and Loewe companies) was were also observed with the use of amplification the cDNA concentration obtained with the use of Dream Taq Encyclo PCR Kit (Eurogen), which

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 47 Рис. 3. Влияние наборов для амплификации на выявление ToRSV методом RT-PCR с использованием праймеров ToRSV-P3F/ToRSV-P3R Fig. 3. Effect of reagent kits on ToRSV detection by RT-PCR using ToRSV-P3F/ToRSV-P3R primers could make the reliably diagnose of Alfalfa mosaic virus (AlMV), Apple of cDNA synthesis method of these target product difficult. mosaic virus (ApMV), American plum isolates, which was performed

Consequently, it has been line pattern virus (APLPV), Prunus with Oligo(dT)16, Random dN6 and established that Dream TaqGreen necrotic ringspot virus (PNRSV) and ToRSV-C primers and MMLV RT Kit PCR Master Mix reagent kit Prune dwarf virus (PDV). for reverse transcription (Eurogen). (ThermoScientific) offers a decisive No unspecific reaction of primers Specific product of the planned advantage for PCR conducting with D1/U1 was noted with nucleic acid value was obtained only for reference the use of D1/U1 primers. At the same preparations isolated from healthy isolates PV-0049, PV-0381 and time, the use of this kit offered high gerbera, chrysanthemum, cherry, ToRSV positive control for ELISA repeatability of the results regardless plum and raspberry plants, but (Loewe) using ToRSV-rdp-R/ToRSV- of the thermocycler used: “Terzik” amplification of non-specific products rdp-F primers (Fuchs et al., 2010), by DNA Technology or “Veriti” by in low concentration was observed developed for the region of the RNA- Applied Biosystems. analyzing nucleic acids isolated from dependent RNA polymerase gene of Working repeatability of the pelargonium and plum plants. this virus. In all cases (including results using these thermocyclers was It was established that the negative control), numerous non- also noted for MagMIX-2025 (Dialat) detection of ToRSV by conventional specific products were also observed. and Tersus PCR Kit (Eurogen) kits. PCR with D1/U1 primers using Considering undoubted strain- For MasDDTaqMix-2025, ScrinMix Dream TaqGreen PCR Master Mix specificity of ToRSV-C/ToRSV-H HS, ScrinMix, Encyclo PCR Kit and (ThermoScientific) reagent kit is (Rowhani et al., 1998) and ToRSV- Emerald Amp GT PCR Master Mixes, possible with dilution of infectious rdp-R/ToRSV-rdp-F (Fuchs et al., the repeatability of the results was juice to10-7, and using a 2.5x MasST 2010) primers, further experiments unsatisfying, and the use of “Terzik” Mix Green-1525 reagent kit (Dialat) – were not carried out. thermocycler in most cases enabled with a dilution to 10-6. Primers TorRS-cp-F/ToRSV- more effective amplification than Therefore, we stated that D1/U1 cp-R (Jossey, Babadoost, 2008) were using of “Veriti” thermocycler. primers are characterized by high designed for the region of ToRSV During specificity assessment it specificity and sensitivity, but their RNA-2 coat protein gene and were was found that D1/U1 primers did not reliable use was possible only with used in the USA for the diagnostics react with other nepoviruses: Cherry Dream TaqGreen PCR Master Mix of this virus in vegetable crops. leaf roll virus (CLRV), Arabis mosaic by ThermoScientific from among 15 To test ToRSV diagnostics using virus (ArMV), Tobacco ringspot virus tested kits of PCR reagents. these primers, we tested 12 kits of (TRSV), Tomato black ring virus Specific product was obtained PCR reagents of several local and (TBRV), Raspberry ringspot virus only for ToRSV positive control foreign manufacturers, evaluated (RpRSV) and Potato black ringspot for ELISA (Loewe), but not for specificity of these primers and virus (PBRSV). There was neither no the reference isolates of the virus, reproducibility of the tests. In all nonspecific reaction of these primers during testing ToRSV-C/ToRSV-H experiments, PCR was performed with Strawberry latent ringspot virus primers (Rowhani et al., 1998) with cDNA synthesized using (SLRSV), Apple chlorotic leafspot complementary to the region of the Maxima First Strand cDNA Synthesis virus (ACLSV), Apple stem grooving RNA-2 ToRSV coat protein gene. The Kit, which was recognized as the most virus (ASGV), Plum pox virus (PPV), same result was obtained regardless effective kit for the synthesis of the

48 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Рис. 4. Влияние комплектов реагентов для ПЦР на выявление ToRSV методом RT-PCR с использованием праймеров ToRSV-P3F/ToRSV-P3R Fig. 4. Effect of reagent kits for PCR on ToRSV detection by RT-PCR using ToRSV-P3F/ToRSV-P3R primers first strand of ToRSV cDNA following for ELISA from Adgen and Loewe. The most effective diagnosis of the previous tests. When evaluating the repeatability of studied ToRSV isolates was achieved Specific products amplification the tests with TorRS-cp-F/ToRSV-cp-R using ToRSV-P3F/P3R primers, of the planned value for all the test primers, the type of the thermocycler developed in the Phytopathology isolates of ToRSV was obtained used (“Terzik” or “Veriti”) was not Research and Methodology using two kits produced by significant when using the Tersus PCR Department of FGBU “VNIIKR” to the ThermoScientific – Dream TaqGreen Kit (Eurogen), Encyclo PCR Kit Eurogen) region of 3'-NTR genome of this virus. PCR Master Mix and Dream Taq PCR and MaqMix-2025, whereas in the cDNA synthesized using reverse Master Mix. Screen Mix kit (Eurogen) testing of Dream TaqGreen PCR Master transcription reagent kits produced was somewhat less effective. Mix, Screen Mix and Screen Mix-HS, by Agrodiagnostika (Russia), MMLV When testing the Screen Mix the polymerase chain reaction was more RT Kit (Eurogen, Russia), First Strand HS kit (Eurogen), amplification successful on the “Terzik” thermocycler, cDNA Synthesis Kit and Maxima First products were obtained for four and the MasDDTaqMix-2025 kit on the Strand cDNA Synthesis Kit (both of ToRSV isolates: PV-0049 and positive “Veriti” thermocycler. ThermoScientific, USA) was suitable controls for ELISA from Bioreba, Low repeatability of the results with for PCR with these primers. Adgen and Loewe. Efficiency of the use of the primers TorRS-cp-F/ Specific products of the planned 8 other PCR kits: MagMIX-2025 ToRSV-cp-R was also established value (601 b.p.) were obtained for all (Dialat), MasDDTaqMix-2025 (Dialat), temporally for three master mixes the studied ToRSV isolates with almost AmpliTaq Gold DNA Polymerase Kit from four subjects. all of the tested PCR reagent kits of (Applied Biosystems), Tersus PCR Kit At the same time, it has been various manufacturing companies: (Eurogen), Encyclo PCR Kit (Eurogen), found that the primers TorRS-cp-F/ MasDDTaqMix-2025 and MagMix-2025 AccuPrime Taq DNA Polymerase ToRSV-cp-R are highly specific as (Dialat, Russia) (Fig. 3, photo 1-2), High Fidelity Kit (LifeTechnologies), they do not react with closely related Screen Mix, Screen Mix HS, Tersus Maxima Hot Start Green PCR Master nepovirus isolates (TRSV, ArMV, PCR Kit and Encyclo PCR Kit Mix (ThermoScientific) and HotStar TBRV, CLRV, RpRSV, PBRSV), as (Eurogen, Russia) (Fig. 3, photo 3; Fig. Taq Master Mix Kit (Qiagen) were equal well as with other viruses found in 4, photo 7-9), Dream TaqGreen PCR and not high. With the use of these fruit and ornamental cultures in a Master Mix, Dream Taq PCR Master kits, specific amplification products mixed infection with ToRSV (SLRSV, Mix and Maxima Hot Start Green PCR were obtained for only three isolates of ACLSV, ASGV, AlMV, ApMV, PPV, Master Mix (ThermoScientific, USA) ToRSV: PV-0049 and positive controls APLPV, PNRSV, PDV). (Fig. 3, photo 4; Fig. 4, photo 5-6),

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 49 AmpliTaq Gold DNA Polymerase Kit advisable to use primers D1/U1 (Rott 12. Mayo M.A., Robinson D.J. (Applied Biosystems, USA) (Fig 3, et al., 1991) and TorRS-cp-F/ToRSV- Nepoviruses: molecular biology and photo 3-5), HotStar Taq Master Mix cp-R (Jossey, Babadoost, 2008), replication // The Plant Viruses. New Kit (Qiagen, Netherlands) (Fig. 4, photo which are specific for other regions York, Plenum Press, 1996. P. 139-185. 2), AccuPrime Taq DNA Polymerase of the genome of this virus – RNA- 13. Mircetich S.M., Hoy J.W. High Fidelity Kit and Platinum Taq dependent RNA-polymerase and coat Brownline of prune trees, a disease DNA Polymerase (Life Technologies, protein genes. associated with tomato ringspot virus USA) (Fig. 4, photo 3-4). The exception infection of Myrobalan and peach was the Qiagen HotStar HiFidelity References rootstocks // Phytopathology, 1981. Polymerase Kit (Fig. 4, photo 1), which 1. Keldysh M.A. Osobennosti Vol. 71. P. 30-35. did not achieve amplification with rasprostraneniya nepovirusov v 14. OEPP/EPPO (2005). EPPO positive control for ELISA of ToRSV antropogennyh ehkosistemah // Standard PM 7/49 (1) Diagnostic produced by Loewe. For the Tersus Bulletin of the RAS MBG, 1994. Is. protocol for Tomato ringspot PCR Kit, Encyclo PCR Kit and Screen 169. P. 132-136. nepovirus // Bulletin OEPP/EPPO Mix HS, the formation of nonspecific 2. Keldysh M.A., Pomazkov Y.I. Bulletin. Vol. 35. P. 313-318. amplification products was noted (Fig. 4, Virusnye i mikoplazmennye bolezni 15. Rott M.E., Tremaine J.H., Rochon photo 7-9). drevesnyh rastenij. M.: Nauka, 1985. 133 p. D.M. Nucleotide sequence of Tomato Using seven tested master mixes and 3. Bitterlin M.W., Gonsalves D. ringspot virus RNA2 // J. General two thermocyclers – “Terzik” (DNA Serological grouping of tomato Virology, 1991a. Vol. 72. P. 1505-1514. Technology) and “Veriti” (Applied ringspot virus isolates: Implication 16. Rott M.E., Gilchrist A., Lee L., Biosystems) the possibility to achieve for diagnosis and cross-protection // Rochon D.M. Nucleotide sequence high reproducible results was found Phytopathology, 1988. Vol. 78. of Tomato ringspot virus RNA1 // with ToRSV-P3F/ToRSV-P3R primers. Р. 278-285. J. General Virology, 1995. Vol. 76. The specificity of ToRSV-P3F/ToRSV- 4. Dunez J. Exotic virus and virus- P. 465-473. P3R primers is in no doubt, since they do like disease of fruit trees // Bull. 17. Rowhani A., Biardi L., Routh G., not react with isolates of closely related OEPP/EPPO Bull., 1981. Vol. 11, № 3. Daubert S., Golino D. Development nepoviruses (TRSV, ArMV, TBRV, P. 251-258. of a sensitive colorimetric-PCR assay CLRV, RpRSV, PBRSV) and Strawberry 5. Fuchs M., Abawi G.S., Marsella- for detection of viruses in woody latent ringspot sadvavirus (SLRSV), as Herrick P., Cox R., Cox K.D., plants // Plant Disease, 1998. Vol. 82. well as with other viruses which may Carroll J.E., Martin R.R. Occurrence P. 880-884. occur in fruit and ornamental crops in of Tomato ringspot virus and Tobacco 18. Qiu W., Lunden S., Wang L., mixed infection with ToRSV (ACLSV, ringspot virus in highbush blueberry Wang Y. Emerging virus-like diseases ASGV, AlMV, ApMV, PPV, APLPV, in New York state // J. Plant Pathol., on Chadonel, Vidal Blanc and PNRSV, PDV). 2010. Vol. 92. P. 451-459. Cabernet Sauvignon in Missouri // The nonspecific reaction of 6. Gilmer R.M., Uyemoto J.K. Proc. Symp. Advanced in Vineyard ToRSV-P3F/ToRSV-P3R primers Tomato ringspot virus in Baco noir Pest Management, 2010. P. 75-86. with nucleic acid preparations grapevines in New York // Plant Dis. 19. Sokhansany Y., Rakhshan- isolated from various stone and Rep., 1972. Vol. 56. P. 133-135. dehroo F., Pourrahim R. First report ornamental crops was not observed. 7. Gordejchuk O.G., Krylov O.V., of Tomato ringspot virus infecting Using ToRSV-P3F/ToRSV- Kyloba L.V., Samonina I.N. // pepper in Iran // Plant Disease, 2012. P3R (“VNIIKR”) primers with Zentralblatt Bakt. Parasit. Infect. und Vol. 96. P. 1828. Dream TaqGreen PCR Master Mix Hygiene, 1977. Vol. 132. P. 686-707. 20. Stace-Smith R. Tomato ringspot (ThermoScientific) and 2.5x MasST 8. Griesbach J.A. Detection of nepovirus. CMI/AAB Descriptions of Mix Green-1525 (Dialat) reagents, tomato ringspot virus by polymerase Plant Viruses No. 290. Association the detection of ToRSV is possible chain reaction // Plant Disease, 1995. of Applied Biologists, Wellesbourne, when the infectious juice is diluted Vol. 79. P. 1054-1056. UK, 1984. to 10-6 and 10-7, respectively. 9. Jossey S., Babadoost M. 21. Stewart E.L., Qu X., Overton B.E., Thus, it was found that ToRSV- Occurrence and distribution of pum- Gildow F.E., Wenner N.G., Grove D.S. P3F/ToRSV-P3R primers, developed pkin and squash viruses in Illinois // Development of a real-time RT-PCR by us for the conserved region of Plant Disease, 2008. Vol. 92. P. 61-68. SYBR Green assay for Tomato ringspot the ToRSV genome (3'-UTR RNA-1 10. Li R., Mock R., Fushs M., virus in grape // Plant Disease, 2007. and RNA-2), reacted with all tested Halbrendt J., Howell B., Liu J. Vol. 91. P. 1083-1088. isolates of this virus, are characterized Characterization of the partial RNA1 22. Stouffer R.F., Soulen D.M., by high specificity, sensitivity and and RNA2 3'-untranslated region Smith S.H. Spread and control of ensure high reproducibility of the of Tomato ringspot virus isolates Prunus stem pitting // Acta Hort., results in combination with different from North America // Can. J. Plant 1975. № 44. Р. 107-112. sets of reagents for PCR, produced by Pathol., 2011. Vol. 33. P. 94-99. 23. Wang A., Sanfaçon H. Diversity in domestic and foreign manufacturers. 11. Martin R.R., Pinkerton J.N., the coding regions for the coat protein, We recommend these primers for Kraus J. The use of collagenase to VPg, protease and putative RNA- screening tests of regulated products improve the detection of plant viruses dependent RNA polymerase among for the presence of ToRSV. For in vector nematodes by RT-PCR // J. Tomato ringspot virus isolates // Can. J. subsequent confirmatory tests, it is Virol. Methods, 2009. Vol. 155. P. 91-95. Plant Pathol., 2000. Vol. 22. P. 145-149.

50 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА УДК 632.752.3+632.654 Экспедиция по изучению ЩИТОВОК И ПАУТИННЫХ КЛЕЩЕЙ Крымского полуострова

А.В. Шипулин, младший научный сотрудник научно-экспериментального отдела ФГБУ «ВНИИКР» И.О. Камаев, старший научный сотрудник научно-экспериментального отдела ФГБУ «ВНИИКР»

Аннотация. Публикация посвя- Крымский полуостров харак- нийскую щитовку (Diaspidiotus щена предварительным результа- теризуется многообразием форм (Quadraspidiotus) perniciosus) 1, там экспедиционного исследова- рельефа (рис. 1), формирующих имеется подходящая пищевая ния щитовок (Insecta: Hemiptera: благоприятные природно-клима- база для обоснования популяций. Diaspididae) и паутинных клещей тические условия для развития Известно по меньшей мере 37 ви- (Acari: Prostigmata: Tetranychidae), целого ряда карантинных и близ- дов щитовок с территории Крым- проведенного специалистами ФГБУ ких к ним видов. Обширную часть ского полуострова (Данциг, 1993; «ВНИИКР» на территории Крым- полуострова занимают степные García Morales et al., 2016), из них ского полуострова в насаждениях равнины, которые в настоящее 21 вид – вредители сельскохозяй- плодовых культур и хвойных рас- время отведены под сельскохозяй- ственных культур. Здесь встреча- тений. ственные угодья. Здесь также рас- ется 9 близких к калифорнийской пространено производство пло- щитовке видов рода Diaspidiotus: Ключевые слова. Щитовки, пау- довых культур (рис. 2), заложены D. ostreaeformis (Curtis, 1843); тинные клещи, биоразнообразие, сады косточковых и семечковых, D. caucasicus Borchsenius, 1935; карантинный объект, калифор- поэтому для многих видов кокцид D. gigas (Ferris, 1941); D. pyri нийская щитовка, плодовые куль- (Coccoidea), включая карантин- (Lichtenstein, 1881); D. zonatus туры, можжевельник. ные объекты, например калифор- Frauenfeld, 1868; D. labiatarum

Fig. 1. The view from the Beshik-Tau mountain in the Bakhchisaray district (photo by I.O. Kamayev)

Рис. 1. Вид с горы Бешик-Тау на Бахчисарайский район (фото И.О. Камаева)

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 51 нообразная, особенно богат вида- ми род Oligonychus. Исследования акарофауны проводили известные специалисты по клещам И.З. Лив- шиц и В.И. Митрофанов, работав- шие в Никитском ботаническом са- ду-институте (Митрофанов, 1967; Митрофанов и др., 1975, 1987). Большое разнообразие щитовок, паутинных клещей и благоприят- ные условия для инвазии новых видов данных групп определили необходимость проведения акаро- кокцидологической экспедиции на территории Крымского полуостро- ва (с 2 по 11 июля 2018 г.), в которой приняли участие сотрудники науч- Fig. 2. Peach, the Simferopol district но-экспериментального отдела при (photo by I.O. Kamayev) содействии сотрудников филиала Рис. 2. Персик, Симферопольский район ФГБУ «ВНИИКР». Основной целью (фото И.О. Камаева) настоящей поездки был сбор мате- риала щитовок (Insecta: Hemiptera: Marchal, 1909; D. lenticularis тинный клещ (Oligonychus perditus Diaspididae) и паутинных клещей Lindinger, 1912; D. sulci (Balachowsky, Pritchard & Baker, 1955). В Крыму (Acari: Prostigmata: Tetranychidae) 1950); D. danzigae Kuznetsov, 1976 достоверно известно 5 видов мож- в насаждениях плодовых культур (Данциг, 1993). жевельников2, все они занесены в и хвойных растений. В данной пуб- Горная часть, расположенная Красную книгу региона. На юж- ликации мы приводим некоторые на юге полуострова (рис. 3), за- ном побережье Крыма произрас- предварительные результаты. крывает побережье с севера и тем тают редкие можжевеловые леса, Маршрут экспедиции охваты- самым формирует благоприятные образованные можжевельником вал степную, предгорную, горную условия для произрастания многих высоким Juniperus excelsa M. Beib. и южнобережную части Крымско- субтропических культур, где также (рис. 4). Они имеют статус охраня- го полуострова. В первую очередь распространяются инвазионные емых территорий, как, например, специалисты исследовали забро- вредители. В горной части встреча- Государственный природный за- шенные сады абрикоса в Симфе- ются различные виды можжевель- поведник «Мыс Мартьян» в соста- ропольском районе, в результате ников Juniperus spp. Растения этого ве Никитского ботанического са- чего была выявлена калифорний- рода предпочитает заселять отсут- да-института. На можжевельниках ская щитовка (Quadraspidiotus ствующий в России карантинный и других хвойных растениях фауна perniciosus, рис. 5). Отличить дан- объект – можжевельниковый пау- паутинных клещей достаточно раз- ный вид от близкородственных можно по нескольким признакам строения пигидия (рис. 6): отсут- ствие циркумгенитальных желез, которые, однако, также не разви- ты у обитающей на можжевельнике Diaspidiotus danzigae. Кроме того, для калифорнийской щитовки ха- рактерно наличие трех зазубрен- ных гребешков кпереди от третьей вырезки пигидия. Плодовые деревья в Кры- му также повреждаются пау- тинными клещами, из которых были обнаружены боярышнико- вый (Amphitetranychus viennensis (Zacher, 1920)) и обыкновенный (Tetranychus urticae Koch, 1836). Боя- рышниковый клещ – один из серь- езнейших вредителей плодовых Fig. 3. The mountainous region of Crimea, Bakhchisaray district, direction to the Luky village культур, при массовом размноже- (photo by I.O. Kamayev) нии которого симптомы (пожел- Рис. 3. Горная часть Крыма, Бахчисарайский район, в сторону д. Лаки тение центральной части листо- (фото И.О. Камаева) вой пластинки и ее сворачивание)

52 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Fig. 6. Pygidium structure of Californian scale Quadraspidiotus perniciosus (photo by I.O. Kamayev) Fig. 4. Greek juniper (Juniperus excelsa), growing in near the village of Novy Svet (photo by I.O. Kamayev) Рис. 6. Строение пигидия Рис. 4. Можжевельник высокий (Juniperus excelsa), произрастающий калифорнийской щитовки в окрестностях поселка Новый Свет Quadraspidiotus perniciosus (фото И.О. Камаева) (фото И.О. Камаева)

чен близкий к карантинному вид – Oligonychus lagodechii Livshits & Mitrofanov, 1969. Необходимо под- черкнуть, что в данном регионе на можжевельниках широко встре- чается полупаразитическое расте- ние можжевельника Arceuthobium oxycedri (DC.) M. Bieb. (рис. 13); аналогичная ситуация с широким распространением этого вида на- блюдается и на южном побережье Крымского полуострова (подроб- нее см. Krasylenko et al., 2017). Ин- тересно отметить, что в горно-лес- Fig. 5. Appearance of the Californian scale colony Quadraspidiotus perniciosus ном поясе рядом с заброшенным (photo by A.V. Shipulin) участком плодовых растений на Рис. 5. Внешний вид щитков колонии калифорнийской щитовки терне степном (Prunus spinosa L.) Quadraspidiotus perniciosus были обнаружены особи калифор- (фото А.В. Шипулина) нийской щитовки и клеща подсе- мейства Bryobiinae. становятся хорошо заметны (рис. 7). плодожорки (Grapholita funebrana На плато Ай-Петри в услови- Повреждая паренхиму листа, клещ (Treitschke, 1835)), которая чаще ях горно-луговых степей (рис. 14) способствует ослаблению дерева всего (но не всегда!) характеризу- произрастают можжевельник путем снижения содержания пи- ется стойкой красноватой окрас- обыкновенный Juniperus communis тательных веществ, синтезируемых кой после кипячения и фиксации (ранее выделявшийся как само- листьями, приводя к последую- в этаноле, чем хорошо отличает- стоятельный вид можжевельник щим потерям урожая. Несмотря ся от большинства других видов полушаровидный J. hemisphaerica) на определенное морфологическое Grapholitini (Справочник-опре- и стланиковая форма можжевель- сходство с обыкновенным паутин- делитель.., 1999). Осмотр забро- ника колючего (рис. 15). Однако ным клещом (Tetranychus urticae), шенного сада персика позволил щитовки и паутинные клещи на который также может сильно вре- выявить поврежденные восточной этих растениях выявлены не были. дить плодовым, оба вида могут плодожоркой (Grapholita molesta На южном побережье Крыма быть дифференцированы по окрас- (Busck, 1916)) молодые неодревес- изучали декоративные насажде- ке (хотя у обыкновенного клеща невающие побеги (рис. 11). Этот ния, участки естественной расти- она может варьировать в широких материал был собран и гербаризи- тельности – низкоствольный лес пределах, см. Auger et al., 2013), а на рован для учебных целей. с преобладанием дуба пушисто- микропрепаратах (окраска в жид- В горно-крымской области ос- го и насаждения олив в районе кости Хойера исчезает) – по фор- новное внимание уделялось мож- Мисхора. Декоративные растения ме дистальной части перитремы жевельникам (Juniperus spp.). данного района Крыма из-за бла- (ср. рис. 8-10). В Бахчисарайском районе на мож- гоприятных условий подвержены Кроме того, в плодах были об- жевельнике колючем (Juniperus широкому заселению различны- наружены гусеницы сливовой deltoides R.P. Adams3, рис. 12) отме- ми видами кокцид, прежде всего

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 53 ложнощитовками и червецами. Среди последних наиболее заме- тен такой инвазионный вид, как австралийский желобчатый червец Icerya purchasi (Maskell, 1879), отли- чающийся достаточно крупными размерами и в массе покрывающий декоративные деревья (рис. 16). На можжевельнике высоком (Juniperus excelsa) в районе Ни- китского ботанического сада и п. Новый Свет (рис. 4) отмечен дру- гой близкий к карантинному объ- екту космополитический клещ – Oligonychus ununguis (Jacobi, 1905). Этот вид встречается на сходных растениях вместе с O. lagodechii и отличается от последнего формой булавы на хетофоре педипальп Fig. 7. Leaves of apple tree damaged hawthorn spider mite Amphitetranychus (ср. рис. 17-18). На дубе пушистом viennensis. The red points on the leaf are mites найден характерный для рода (photo by I.O. Kamayev) Quercus клещ Amphitetranychus Рис. 7. Поврежденные боярышниковым клещом Amphitetranychus viennensis savenkoae (Reck, 1956), близкий листья яблони. Красные точки на листе – особи клеща вид к боярышниковому клещу (фото И.О. Камаева) (A. viennensis). Их отличительный признак – характер строения дис- не были. Гусеница непарного шел- разработки методов идентифика- тальной части перитремы – пока- копряда (Lymantria dispar (Linnaeus, ции, в том числе на основе моле- зан на рис. 9-10. 1758), рис. 22) была обнаружена на кулярно-генетических методов, Исследование фауны щито- дереве кедра (Cedrus sp.). Согласно учебным материалом для курсов вок олив с целью обнаружения базе данных CABI (www.cabi.org) повышения квалификации в обла- Diaspidiotus lenticularis позволило этот вид древесных растений ука- сти карантина растений. выявить, что данные растения, зывается в качестве второстепен- Авторы выражают благодар- высаживаемые в парках и дво- ного пищевого растения для не- ность за помощь в проведении рах Ялты в декоративных целях, парного шелкопряда. экспедиции сотрудникам филиа- поражает щитовка Parlatoria olea Таким образом, результаты про- ла ФГБУ «ВНИИКР» в Республике (Colvee, 1880) (рис. 19-20), тогда веденной экспедиции послужат для Крым: директору Н.В. Вандышевой, как в Мисхоре Diaspididae на де- пополнения научных коллекций заместителю директора И.П. Тру- ревьях оливы (рис. 21) встречены ФГБУ «ВНИИКР» материалом для фановой, начальнику научно-

Fig. 8. Shape of peritreme distal part of common spider Fig. 9. Shape of peritreme distal part of hawthorn spider mite mite Tetranychus urticae Amphitetranychus viennensis (photo by I.O. Kamayev) (photo by I.O. Kamayev)

Рис. 8. Форма дистальной части перитремы Рис. 9. Форма дистальной части перитремы обыкновенного паутинного клеща Tetranychus urticae боярышникового клеща Amphitetranychus viennensis (фото И.О. Камаева) (фото И.О. Камаева)

54 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Крым. Приложение № 2 к приказу Министерства экологии и природ- ных ресурсов Республики Крым от 08 апреля 2015 года № 252. https:// cicon.ru/spisok-rastenij-zanesennyx- kk-krym.html. Онлайн-доступ на 17 августа 2018 г. 9. Справочник-определитель карантинных и других опасных вредителей сырья, продуктов за- паса и посевного материала. М.: Колос, 1999. 384 с. 10. Adams R.P. Morphological comparison and key to Juniperus deltoides and J. oxycedrus // Fig. 10. Shape of peritreme distal part of Amphitetranychus savenkoae Phytologia, 2014. 96 (2). P. 58-62. (photo by O. I. Kamayev) 11. Auger P., Migeon A., Рис. 10. Форма дистальной части перитремы клеща Amphitetranychus savenkoae Ueckermann E.A., Tiedt L., Navajas M. (фото И.О. Камаева) Evidence for synonymy between Tetranychus urticae and Tetranychus cinnabarinus (Acari, Prostigmata, Tetranychidae): review and new data // Acarologia, 2013. 53 (4). P. 383-415. 12. García Morales M., Den- no B.D., Miller D.R., Miller G.L., Ben- Dov Y., Hardy N.B. 2016. ScaleNet: A literature-based model of scale insect biology and systematics. Database. doi: 10.1093/database/ bav118. http://scalenet.info. 13. Krasylenko Y.A., Janošíková K., Kukushkin O.V. Juniper dwarf mistletoe (Arceuthobium oxycedri) in the Crimean Peninsula: novel insights into its morphology, hosts, Fig. 11. Green shoot of peach damaged by Grapholita molesta larvae and distribution // Botany, 2017. (photo by I.O. Kamayev) 95. P. 897-911. Рис. 11. Молодой неодревесневающий побег персика, поврежденный гусеницей 14. https://www.cabi.org/isc/ восточной плодожорки Grapholita molesta datasheet/31807. (фото И.О. Камаева) 1 В настоящее время Com- методического отдела Н.М. Стрю- 4. Митрофанов В.И. Тетрани- stockaspis perniciosa Comstock, 1881 ковой, м.н.с. Н.В. Цинкевичу. Про- хоидные клещи фауны СССР, по- (García Morales et al., 2016). верку результатов идентификации вреждающие хвойные породы // 2 Эта цифра варьирует в зави- материала щитовок проводила Труды Никитского ботанического симости от источника: Голубев, с.н.с. Н.А. Гура, за что авторы вы- сада, 1967. Т. XXXIX. C. 111-130. 1996; Ена, 2012 приводят 5 видов; ражают свою признательность. 5. Митрофанов В.И., Босен- Krasylenko et al., 2017 – 9 видов, ко Л.И., Бическис М.Я. Определи- что, по-видимому, связано с раз- Литература тель тетраниховых клещей хвой- личным пониманием объема рода 1. Голубев В.Н. Биологическая ных пород // Latvijas Entomolog. Juniperus. флора Крыма. Ялта: НБС-ННЦ, Suppl., 1975. C. 1-42. 3 Этот вид близок и слож- 1996. 126 с. 6. Митрофанов В.И., Струн- но отличим от J. oxycedrus L. 2. Данциг Е.М. Подотряд кок- кова З.И., Лившиц И.З. Определитель (см. Ена, 2012; Adams, 2014), кото- циды (Coccinea). Семейства тетраниховых клещей фауны СССР рый обычно приводили для Кры- Phoenicoccidae и Diaspididae // Фау- и сопредельных стран (Tetranychidae, ма как можжевельник колючий на России и сопредельных стран. Bryobiidae). Душанбе, 1987. 224 с. (Определитель.., 1972; Голубев, № 144. Насекомые хоботные. Т. 10. 7. Определитель высших расте- 1996). Однако в статье Krasylenko СПб: Наука, 1993. 453 с. ний Крыма. Под ред. Н.И. Рубцова. et al., 2017 приводятся оба вида 3. Ена А.В. Природная флора Л., 1972. для территории Крыма, что, Крымского полуострова. Симфе- 8. Список растений, занесен- по-видимому, нуждается в под- рополь, 2012. 232 с. ных в Красную книгу Республики тверждении.

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 55 UDC 632.752.3+632.654 Expedition to Study SCALES AND SPIDER MITES of the Crimean Peninsula

A.V. Shipulin, Junior Researcher of the Research and Testing Department of FGBU “VNIIKR” I.O. Kamayev, Senior Researcher of the Research and Testing Department of FGBU “VNIIKR”

Abstract. The publication is devoted The Crimean Peninsula is pests, such as Californian scale to preliminary results of the expedition characterized by the variety of (Diaspidiotus (Quadraspidiotus) studies of scales (Insecta: Hemiptera: relief features (Fig. 1), creating perniciosus)1, there is a suitable fodder Diaspididae) and spider mites favorable climate conditions for base for population establishment. (Acari: Prostigmata: Tetranychidae), the development of a number of We know at least 37 species of conducted by specialists of FGBU quarantine and related species. A scale insects from the territory of “VNIIKR” in the territory of the large part of the Peninsula is a steppe the Crimean Peninsula (Danzig, Crimean Peninsula in plantings of fruit plain, which is currently reserved 1993; García Morales et al., 2016), crops and conifers. for farmland. Production of fruit 21 species of which damage agricultural crops is also widespread (Fig. 2), crops. 9 species of genus Diaspidiotus Keywords. Scales, spider mites, there are gardens of stone and pome related to Californian scale are found biodiversity, quarantine object, fruits, and for many species of scales here: D. ostreaeformis (Curtis, 1843); Californian scale, fruit crops, juniper. (Coccoidea), including quarantine D. caucasicus Borchsenius, 1935;

Рис. 12. Можжевельник колючий Juniperus deltoides (фото И.О. Камаева) Fig. 12. Prickly juniper Juniperus deltoides (photo by I.O. Kamayev)

56 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА D. gigas (Ferris, 1941); D. pyri (Lichtenstein, 1881); D. zonatus Frauenfeld, 1868; D. labiatarum Marchal, 1909; D. lenticularis Lindinger, 1912; D. sulci (Balachowsky, 1950); D. danzigae Kuznetsov, 1976 (Danzig, 1993). The mountainous part, located in the South of the Peninsula (Fig. 3), covers the coast from the North, and thereby creates favorable conditions for growing of several subtropical crops and spread of invasive pests. In the mountainous part there are various species of junipers of Juniperus spp. Plants of this genus are hosts for the quarantine object absent in Russia – juniper spider mite (Oligonychus Рис. 13. Полупаразитическое растение Arceuthobium oxycedri perditus Pritchard & Baker, 1955). на можжевельнике колючем Juniperus deltoides 5 species of junipers are known in (фото И.О. Камаева) Crimea2, they are all listed in the Red Fig. 13. Semiparasitic plant Arceuthobium oxycedri book of the region. Rare juniper forests on prickly juniper Juniperus deltoides formed by Greek juniper Juniperus (photo by I.O. Kamayev) excelsa M. Beib. grow on the southern coast of Crimea (Fig. 4). They are protected areas, such as the State natural “Cape Martyan Reserve” of the Nikitsky Botanical Garden-Institute. Junipers and other coniferous plants are damaged by diverse spider mites, especially genus Oligonychus is rich in species. Acarofauna research was performed by well-known experts I.Z. Livshits and V.I. Mitrofanov, who Рис. 14. Вид на плато Ай-Петри worked in the Nikitsky Botanical (фото И.О. Камаева) Garden-Institute (Mitrofanov, 1967; Fig. 14. The view of the Ai-Petri plateau Mitrofanov et al., 1975, 1987). (photo by I.O. Kamayev) The variety of scale insects and spider mites as well as favorable conditions for invasion of new species of these groups justified the acaro-coccidologic expedition to the Crimean Peninsula (July 2 to 11 of 2018), which was attended by members of the research and testing Department, with the assistance of the employees of the FGBU “VNIIKR” branch. The main purpose of this trip was collecting material of scale insects (Insecta: Hemiptera: Diaspididae) and spider mites (Acari: Prostigmata: Tetranychidae) in plantings of fruit crops and conifers. In this publication we present some preliminary results. The route of the expedition covered the steppe, foothill and mountain regions as well as the southern coast of the Crimean Peninsula. First Рис. 15. Стланиковая форма можжевельника колючего Juniperus deltoides and foremost, experts examined (фото И.О. Камаева) the abandoned apricot orchards in the Simferopol district, resulting Fig. 15. Creeping form of prickly juniper Juniperus deltoides in detection of Californian scale (photo by I.O. Kamayev)

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 57 Рис. 17. Форма булавы на хетофоре педипальпы Oligonychus ununguis (фото И.О. Камаева) Fig. 17. Shape of palp spinneret Oligonychus ununguis (photo by I.O. Kamayev)

Рис. 18. Форма булавы на хетофоре педипальпы Рис. 16. Австралийский желобчатый червец Icerya purchasi Oligonychus lagodechii (фото И.О. Камаева) (фото И.О. Камаева) Fig. 16. Australian bug Icerya purchasi Fig. 18. Shape of palp spinneret Oligonychus lagodechii (photo by I.O. Kamayev) (photo by I.O. Kamayev)

(Quadraspidiotus perniciosus, Fig. 5). tree by reducing nutrients synthesized (Grapholita molesta (Busck, 1916)) This species can be distinguished in leaves, and leading to further (Fig. 11). This material was collected from closely related by few features crop losses. Despite morphological and herborized for training purposes. of the pygidium structure (Fig. 6): similarity with common red spider In the mountainous region of the lack perivulvar pores, which, mite (Tetranychus urticae) which also Crimea, special attention was devoted however, are neither not developed can severely damage fruit species, to junipers (Juniperus spp.). In the in Diaspidiotus danzigae colonizing these two mites can be distinguished Bakhchisaray district, species related juniper. In addition, Californian scale by color (though for common red to quarantine one – Oligonychus is characterized by presence of three spider mite it can vary, see Auger et lagodechii Livshits & Mitrofanov, serrated plates in front of the third al., 2013) or on the slide (color fades 1969 was detected on prickly juniper pygidium notches. out in Hoyer’s medium) – by the shape (Juniperus deltoides R.P. Adams3, Fruit trees in Crimea are also of distal part of peritreme (Fig. 8-10). Fig. 12). It is interesting to note damaged by spider mites, hawthorn In addition, larvae of plum that semiparasitic plant of juniper spider mite (Amphitetranychus fruit moth (Grapholita funebrana Arceuthobium oxycedri (DC.) M. viennensis (Zacher, 1920)) and (Treitschke, 1835)) were detected Bieb. occurs in this region (Fig. 13); common red spider mite (Tetranychus in fruits, this moth is often (but not the similar situation with a wide urticae Koch, 1836) were detected. always!) characterized by persistent spread of this species is observed on Hawthorn spider mite is one of the carmine-red color after boiling and the southern coast of Crimean (see most harmful pests of fruit crops, fixation in ethanol, which differs it Krasylenko et al., 2017). Specimens mass reproduction of which causes from most other species of Grapholitini of the Californian scale and mites of evident symptoms (yellowing of the (Spravotchnik.., 1999). Visual the subfamily Bryobiinae were found central part of the leaf blade and examination of the abandoned peach on blackthorn (Prunus spinosa L.) in leaf rolling) (Fig. 7). Damaging leaf garden enabled detection of green the mountain forest zone near the parenchyma, the mite weakens the shoots damaged by oriental fruit moth abandoned fruit garden.

58 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА soft scales and mealybugs. Among mealybugs, the most noticeable is such invasive species as Australian bug Icerya purchasi (Maskell, 1879), which is rather large and colonizes ornamental trees en masse (Fig. 16). Other cosmopolitan mite, related to quarantine object – Oligonychus ununguis (Jacobi, 1905) was detected on Greek juniper (Juniperus excelsa) near the Nikitsky Botanical Garden and the village of Novy Svet (Fig. 4). This species occurs on similar plants as O. lagodechii and differs from it in the shape of spinneret on palp (compare Fig. 17-18). The mite, typical for the genus Quercus – Amphitetranychus savenkoae (Reck, 1956), was detected on downy oak, this species is related to hawthorn spider mite (A. viennensis). The Рис. 19. Щитки колонии Parlatoria olea distinguishing feature is the structure (фото А.В. Шипулина) of the distal part of peritreme, shown Fig. 19. Scale of the Parlatoria olea colony in Fig. 9-10. (photo by A.V. Shipulin) The study of scale fauna on olive trees in order to detect Diaspidiotus lenticularis allowed to reveal that these plants, planted in parks and yards of Yalta as ornamental, are damaged by the scale Parlatoria olea (Colvee, 1880) (Fig. 19-20), whereas in Miskhor Diaspididae was not detected on olive trees (Fig. 21). Larvae of Gypsy moth (Lymantria dispar (Linnaeus, 1758), Fig. 22) was detected on the cedar tree (Cedrus sp.). According to the CABI database (www.cabi.org) this species of woody plants is secondary host plant for Gypsy moth. Thus, the expedition results will contribute to the replenishment of the research collections of FGBU “VNIIKR”, and will be used as a material for the development of identification methods, including those based on molecular genetic methods, and as a material for trainings in the field of plant quarantine. Рис. 20. Строение пигидия Parlatoria olea The authors express their gratitude (фото И.О. Камаева) to the employees of the FGBU Fig. 20. Pygidium structure of Parlatoria olea “VNIIKR” branch in the Republic of (photo by I.O. Kamayev) Crimea for their help in organization and conducting the expedition: The Ai-Petri plateau with its alpine- On the southern coast of Crimea, N.V. Vandysheva – Director, meadow steppe conditions (Fig. 14) ornamental plants, natural vegetation – I.P. Trufanova – Deputy Director, is an area where common juniper low forest with predominance of N.M. Stryukova – Head of Research Juniperus communis (previously downy oak, and plantings of olive trees and Methodology Department, considered as separate species were surveyed in the Miskhor area. N.V. Tsinkevich – Junior Researcher. J. hemisphaerica) and creeping form of Because of the favorable conditions, The verification of scale identification prickly juniper (Fig. 15) are growing. ornamental plants of this Crimean results was carried out by Senior However, scales and spider mites were area are strongly colonized by various Researcher N.A. Gura, the authors not detected there on these plants. Coccidae species, especially by express their gratitude for this work.

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 59 Рис. 21. Деревья оливы в районе Мисхора (фото И.О. Камаева) Fig. 21. Olive trees near Miskhor (photo by I.O. Kamayev)

11. Auger P., Migeon A., Uecker- mann E.A., Tiedt L., Navajas M. Evidence for synonymy between Tetranychus urticae and Tetranychus cinnabarinus (Acari, Prostigmata, Tetranychidae): review and new data // Acarologia, 2013. 53 (4). P. 383-415. 12. García Morales M., Denno B.D., Miller D.R., Miller G.L., Ben-Dov Y., Hardy N.B. 2016. ScaleNet: A literature- based model of scale insect biology and systematics. Database. doi: 10.1093/ database/bav118. http://scalenet.info. 13. Krasylenko Y.A., Janošíková K., Kukushkin O.V. Juniper dwarf Рис. 22. Гусеница непарного шелкопряда Lymantria dispar mistletoe (Arceuthobium oxycedri) (фото И.О. Камаева) in the Crimean Peninsula: novel Fig. 22. Gypsy moth larvae Lymantria dispar insights into its morphology, hosts, (photo by I.O. Kamayev) and distribution // Botany, 2017. 95. P. 897-911. References kleshchej fauny SSSR i sopredelnyh 14. https://www.cabi.org/isc/ 1. Golubev V.N. Biologicheskaya flora stran (Tetranychidae, Bryobiidae). datasheet/31807. Kryma. Yalta: NBG-NSC, 1996. 126 p. Dushanbe, 1987. 224 p. 2. Danzig E.M. Podotryad kokcidy 7. Opredelitel vysshih rastenij 1 Currently Comstockaspis (Coccinea). Semejstva Phoenicoccidae Kryma. Edited by Rubtsov N.I. L., 1972. perniciosa Comstock, 1881 (García i Diaspididae // Fauna Rossii i 8. The list of plants listed in the Morales et al., 2016). sopredel'nyh stran. № 144. Nasekomye Red book of the Republic of Crimea. 2 This figure varies depending on hobotnye. T. 10. SPb.: Nauka, 1993. 453 s. Appendix № 2 to the Order of the source: Golubev, 1996; Ena, 2012 3. Еna A.V. Prirodnaya flora Ministry of ecology and natural name 5 species; Krasylenko et al., Krymskogo poluostrova. Simferopol, resources of the Republic of Crimea 2017 – 9 species, which is apparently 2012. 232 p. dated April 08 2015 No. 252. https:// because of different understanding of 4. Mitrofanov V.I. Tetranihoidnye cicon.ru/spisok-rastenij-zanesennyx- the scope of genus Juniperus. kleshchi fauny SSSR, povrezhdayushchie kk-krym.html. Online access from 3 This species is related and difficult hvojnye porody // Proceedings of August 17 2018. to distinguish from J. oxycedrus L. the Nikita Botanical garden, 1967. 9. Spravochnik-opredelitel (see Ena, 2012; Adams, 2014), which T. XXXIX. P. 111-130. karantinnyh i drugih opasnyh vreditelej was usually named prickly juniper in 5. Mitrofanov V.I., Bosenko L.I., syrya, produktov zapasa i posevnogo Crimea (Opredelitel.., 1972; Golubev, Bicheskis M.Y. Opredelitel tetranihovyh materiala. M.: Kolos, 1999. 384 p. 1996). However, in the article of kleshchej hvojnyh porod // Latvijas 10. Adams R.P. Morphological Krasylenko et al., 2017 both species Entomolog. Suppl., 1975. P. 1-42. comparison and key to Juniperus are reported in the territory of 6. Mitrofanov V.I., Strunkova Z.I., deltoides and J. oxycedrus // Phytologia, Crimea, which is, apparently, to be Livshits I.Z. Opredelitel tetranihovyh 2014. 96 (2). P. 58-62. confirmed.

60 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА УДК 632.51

АМБРОЗИЯ ТРЕХРАЗДЕЛЬНАЯ (AMBROSIA TRIFIDA L.) на территории Новосибирской области

А.В. Каждан, старший государственный инспектор отдела надзора в области карантина растений Управления Россельхознадзора по Новосибирской области И.В. Заверткина, руководитель отдела фитосанитарной экспертизы и карантина растений ФГБУ «Новосибирская МВЛ» А.А. Коренев, руководитель отдела фитосанитарной экспертизы и карантина растений ФГБУ «Новосибирская МВЛ» О.С. Жирова, ведущий инженер Лаборатории Гербарий ЦСБС СО РАН

Аннотация. Приведены дан- произрастания родительских осо- ганов растения. Популяция была ные о распространении на тер- бей (Гельтман, 2006). многочисленной и образовывала ритории Новосибирской об- Расселение по Евразии в вос- монодоминантные заросли. Пред- ласти карантинного объек- точном направлении опасных ка- положительно плоды амброзии та – амброзии трехраздельной рантинных сорняков североаме- трехраздельной попали в окружа- (Ambrosia trifida L.), ранее от- риканского происхождения – ам- ющую среду с остатками кормов. сутствовавшей в данном регионе. брозий (род Ambrosia семейства Крайние точки географических Описан комплекс мероприятий, Сложноцветные (Asteraceae)) – уже координат засоренных амбро- направленных на локализацию оча- давно носит глобальный характер. зией участков – 54.984263 с.ш., га, и показана эффективность их Амброзии – не только злостные 83.338620 в.д. применения. конкуренты культурных растений, Климат Новосибирской области но и источник массовых аллерги- континентальный, с большими ко- Ключевые слова. Амброзия ческих заболеваний населения. лебаниями среднесуточных темпе- трехраздельная, Ambrosia trifida L., Несмотря на применение широко- ратур воздуха, значительно суро- карантинные фитосанитарные го арсенала средств борьбы, амбро- вее климата районов европейского обследования, очаг, карантин- зии продолжают захватывать все и американского континентов, на- ные фитосанитарные меропри- новые и новые территории. ходящихся на той же географиче- ятия, карантинная фитосани- Амброзия трехраздельная ской широте. тарная зона. (Ambrosia trifida L.) в Новосибир- Самый холодный месяц – январь, Занос и внедрение агрессивных ской области была впервые обна- со средней температурой -17 оС, инвазивных видов в раститель- ружена инспекторами отдела над- самый теплый месяц – июль, со ные сообщества – одна из главных зора в области карантина растений средней температурой +19 оС. современных экологических про- Управления Россельхознадзора по Среднегодовое количество осадков блем, которая приводит не только Новосибирской области в августе в Новосибирске составляет око- к снижению биологического разно- 2014 года. Очаг площадью 0,016 га ло 425 мм, максимум приходится образия, но и к трудностям экологи- был выявлен на обочине дороги в на июль – август, а минимум – на ческого и экономического характера. населенном пункте у железнодо- февраль – март (Климат Новоси- Инвазивные виды – это аллоген- рожной станции Шелковичиха Бе- бирска, 1979). ные (чужеземные) виды, занесен- резовского сельсовета Новосибир- Почвы в очаге расположены в ные с других территорий, экспан- ского района, в левобережье реки пределах почвенного контура се- сия которых происходит за счет че- Иня (правый приток реки Оби). рых лесных оподзоленных средне- ловеческого фактора. Часть таких Принадлежность к карантинному мощных слабосмытых почв (Почвы видов способна давать потомство в виду была установлена на основе совхоза Железнодорожный.., 1983). огромном количестве и расселять- морфологических особенностей Для распространения амброзии ся на большие расстояния от мест вегетативных и генеративных ор- трехраздельной как однолетнего

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 61 ленных на истощение запаса семян в почве и, как следствие, предотвращение дальнейшего распространения амброзии и лик- видацию популяции. При проведении карантинно- го фитосанитарного контроля за- раженных участков в 2017 году в дополнение к скашиванию была рекомендована обработка хими- ческим препаратом. Гербицидная обработка была проведена си- стемным гербицидом сплошного действия «Грейдер», активным компонентом которого является имазапир. Препарат относится к 3 классу опасности, мало опасен для человека, млекопитающих, птиц, почвенной фауны, а также прак- тически не токсичен для пчел, что позволяет использовать его вблизи населенных пунктов. В 2018 году на территории очага и прилегающей к нему буферной зоны наличия растений амбро- Fig. 1. Plants of Ambrosia trifida L., зии трехраздельной отмечено не st. Shelkovichiha, Novosibirsk district, Novosibirsk region, 2014 было. Благодаря слаженной рабо- Рис. 1. Растения амброзии трехраздельной (Ambrosia trifida L.), те специалистов, правильно орга- ст. Шелковичиха, Новосибирский район Новосибирской области, 2014 г. низованной системе карантинных мероприятий очаг опаснейшего ка- растения и формирования устой- лены границы очага и буферной рантинного сорняка на территории чивой популяции одним из основ- зоны. Был предписан комплекс мер, Новосибирской области в настоя- ных факторов является образова- направленных на создание условий щее время локализован. ние жизнеспособных семян. для локализации очага, предотвра- В будущем предполагается еже- Специалистами отдела фитоса- щения дальнейшего распростране- годный мониторинг территории нитарной экспертизы и карантина ния и ликвидации популяции. От очага и буферной зоны с учетом растений ФГБУ «Новосибирская гербицидной обработки очага в возможного прорастания плодов МВЛ» было проведено исследо- 2014 году решено было отказать- амброзии, находящихся в почве. вание верхних горизонтов почвы ся в связи с его непосредственной на территории очага на наличие близостью к населенному пункту. Литература односемянных плодов амброзии Согласно предписанию, очаг с 1. Гельтман Д.В. О понятии «ин- трехраздельной. Найденные плоды карантинным растением был выко- вазионный вид» в применении к изучали на жизнеспособность. За- шен, скошенная масса высушена и сосудистым растениям // Ботани- родыши окрашивали 1% раствором сожжена на месте произрастания. ческий журнал. 2006, Т. 91. № 8. тетразолия хлористого. Было уста- В 2015 году при проведении С. 1222-1232. новлено, что все выделенные одно- контрольного обследования очага 2. Климат Новосибирска / под семянные плоды имеют жизнеспо- наличие амброзии было зафикси- ред. С.Д. Кошинского, К.Ш. Хайру- собный зародыш. Таким образом, ровано снова: растения хорошо лина, Ц.А. Швер. Л.: Гидрометео- было обнаружено, что в почве на отрастали после однократного и издат, 1979. 223 с. территории очага имеется запас двукратного подрезания, соцветия 3. Почвы совхоза Железнодо- жизнеспособных плодов амброзии формировались в нижних междо- рожный Новосибирского района трехраздельной, приводящий к ее узлиях растения, в нескольких сан- Новосибирской области и реко- дальнейшему возобновлению. тиметрах от уровня почвы. В этом мендации по их использованию. При первичном выявлении сор- случае механизированное скаши- Новосибирск: ВППО РОСЗЕМ- няка было отмечено, что к сере- вание травянистой массы в очаге ПРОЕКТ ЗАПСИБГИПРОЗЕМ, дине августа некоторые растения трактором с навесной роторной 1983. 49 с. прошли полный цикл развития и косилкой было неэффективным. 4. Есина А.Г. Ambrosia trifida L. имели сформированные плоды. Поэтому многократное скашива- в Предуралье Республики Башкор- Приказом Управления Россель- ние проводили по уровню почвы тостан: распространение, эколо- хознадзора по Новосибирской об- бензиновым триммером с леской. го-фитоценотическая и популяци- ласти была установлена карантин- В 2016 году был проведен ана- онная характеристика: дис… канд. ная фитосанитарная зона, опреде- логичный комплекс мер, направ- биол. наук. Уфа, 2009. 185 с.

62 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА UDC 632.51

GREAT RAGWEED (AMBROSIA TRIFIDA L.) in the Territory of the Novosibirsk Region

A.V. Kazhdan, Chief State Inspector of the Surveillance Department for Plant Quarantine of Rosselkhoznadzor Directorate for the Novosibirsk Region I.V. Zavertkina, Head of the Phytosanitary Analysis and Plant Quarantine Department of FGBU “Novosibirsk IVL” A.A. Korenev, Head of the Phytosanitary Analysis and Plant Quarantine Department of FGBU “Novosibirsk IVL” O.S. Zhirova, Leading Engineer of the Laboratory Herbarium CSBG SB RAS

Abstract. The data given on the Introduction and establishment The spread over Eurasia to the distribution of the quarantine object of aggressive invasive species in the eastward of dangerous quarantine great ragweed (Ambrosia trifida L.) plant communities is one of the major weeds of North American origin – in the territory of the Novosibirsk modern environmental issues, which Ambrose (genus Ambrosia of the region, which was previously absent leads not only to a decrease in biological family Asteraceae) – is a global one for in the district. The described set of diversity, but also to the difficulties of a while. Ambrosia – not just hard-core measures is aimed at the localization environmental and economic nature. competitors of cultivated plants, but of the outbreak and the effectiveness of Invasive species are allogenic they are also a source of mass allergic their application. (alien) species introduced from the diseases. Despite the use of a broad other areas, which expansion is due arsenal of combating means, Ambrosia Keywords. Great ragweed, to the human factor. Some of these continue to seize new and new territory. Ambrosia trifida L., quarantine species can produce offspring in Great ragweed (Ambrosia trifida L.) phytosanitary examinations, outbreak, large numbers and spread over a in the Novosibirsk region was first quarantine phytosanitary measures, great distances from the habitats of discovered by the inspectors of the quarantine phytosanitary zone. the parent animals (Geltman, 2006). Surveillance Department for Plant Quarantine of the Rosselkhoznadzor Directorate for the Novosibirsk Region in August 2014. The outbreak of 0.016 ha was identified on the side of the road in the residential place close to the train station Shelkovichiha of Berezovsky selsoviet of the Novosibirsk region, in the left bank of Inya river (the right tributary of the Ob river). Belonging to the quarantine species was set on the basis of morphological characteristics of vegetative and generative plants’ organs. The population was numerous and formed monodominant thickets. Presumably the fruits of Ambrosia trifida got into the environment with Fig. 2. Plants of Ambrosia trifida L., the fodder remnants. st. Shelkovichiha, Novosibirsk district, Novosibirsk region, 2014 The extreme points of geographical Рис. 2. Растения амброзии трехраздельной (Ambrosia trifida L.), coordinates of infested areas with ст. Шелковичиха, Новосибирский район Новосибирской области, 2014 г. Ambrosia – 54.984263 n.l., 83.338620 e.l.

КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА 3| 25| 2018 63 The climate in the Novosibirsk region is continental, with wide fluctuations of average daily temperature, much more harshly than the local climate of the European and American continents under the same latitude. The coldest month is January with an average temperature of -17 оС, the warmest month is July, with an average temperature of +19 оС. The average annual precipitation in Novosibirsk is about 425 mm, the maximum is in July – August, and minimum – in February – March (Klimat Novosibirska, 1979). The soils in the outbreak are located within the soil contour of the gray forest podsolized weakly washed medium-thick soils (Pochvy sovhoza Zheleznodorozhnyj, 1983). One of the main factors for the distribution of great ragweed as an annual plant and for the formation of stable populations is the formation Рис. 3. Растения амброзии трехраздельной (Ambrosia trifida L.), of viable seeds. ст. Шелковичиха, Новосибирский район Новосибирской области, 2014 г. The specialists of the Department Fig. 3. Plants of Ambrosia trifida L., for Phytosanitary Analysis and Plant st. Shelkovichiha, Novosibirsk district, Novosibirsk region, 2014 Quarantine of FGBU “Novosibirsk IVL” studied the upper soil level within In 2015, when carrying out the In 2018 in the territory of the outbreak the outbreak territory in order to find outbreak control tests, the presence and its surrounding buffer zone there one-seeded fruit of great ragweed. of great ragweed was recorded again: were no the presence of Аmbrosia Experts studied viability of found the plants grew well after single and trifida. Thanks to the coordinated work fruits. Embryos were stained with 1% double cutting, inflorescences were of the specialists, well-organized system solution of tetrazolium chloride. It was formed in the lower internodes of of quarantine measures the outbreak of established that all selected one-seeded the plant, a few centimeters from the the most dangerous quarantine weed in fruits have a viable embryo. Thus, it was soil level. In this case, the mechanized the territory of the Novosibirsk region found out that the soil on the territory cutting of herbaceous mass in the is currently localized. of the outbreak has a reserve of viable outbreak with the help of tractor Given the possible germination great ragweed fruits, which promotes with mounted rotary mower has of Ambrosia fruits in the soil, annual its further reproduction. been ineffective. Therefore, repeated monitoring of the outbreak territory and During the first detection of the mowing was carried out on the soil the buffer zone are expected in the future. weed, it was noted that by mid-August, level with the help of petrol grass some plants had had a full development trimmer with a line. References cycle and already had formed fruit. In 2016, a similar set of measures 1. Geltman D.V. O ponyatii In the Novosibirsk region the aimed at depletion of stock of “invazionnyj vid” v primenenii k quarantine phytosanitary zone was seeds in the soil and, consequently, sosudistym rasteniyam // Botanical established, and also the borders of prevention from the further spread of journal, 2006. Vol. 91. № 8. P. 1222-1232. the outbreak and the buffer zone great ragweed and elimination of the 2. Klimat Novosibirska / Ed. by were defined by the order of the population was conducted. S.D. Koshinsky, K.Sh. Khairulin, Rosselkhoznadzor Directorate. A set When conducting quarantine Ts. A. Shver. L.: Gidrometeoizdat, 1979. of measures focused on the creation phytosanitary control of contaminated 223 p. of conditions for the outbreak sites in 2017 chemical treating has 3. Pochvy sovhoza Zhelezno-dorozhnyj localization, prevention from been recommended in addition to the Novosibirskogo rajona Novosibirskoj the further spread and eliminate mowing processing. The herbicidal oblasti i rekomendacii po ih ispol'zova-niyu. populations was prescribed. In 2014 it treatment was carried out by the Novosibirsk: VPPO ROSZEMPROEKT was decided to abandon the outbreak systemic herbicide of continuous action ZAPSIB-GIPROZEM, 1983. 49 p. herbicide treatment in connection “Grader”, which active component is 4. Esina A.G. Ambrosia trifida L. v with its proximity to the locality. imazapyr. The preparation belongs to 3 Predural'e Respubliki Bashkortostan: According to the instruction, the class of hazard, it poses very little risk to rasprostranenie, ehkologo- outbreak with the quarantine plant human, mammals, birds, soil fauna, and fitocenoticheskaya i populyacionnaya was mowed down and then dried, is practically non-toxic to bees, which harakteristika: dis... Cand. Sc. (Biology). and burned at the place of growth. allows its using near human settlements. Ufa, 2009. 185 p.

64 3| 25| 2018 КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА Тел./факс: 8 (499) 707-22-27 Зиновьева Светлана Георгиевна +7 967 294 90 61