Global Analysis of O-Glcnac Glycoproteins in Activated Human T Cells Peder J
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Universidade Estadual De Campinas Instituto De Biologia
UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso. -
The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D
© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail. -
14-3-3Sigma Negatively Regulates the Stability and Subcellular Localization of Cop1
The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2010 14-3-3SIGMA NEGATIVELY REGULATES THE STABILITY AND SUBCELLULAR LOCALIZATION OF COP1 Chun-Hui Su Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biology Commons Recommended Citation Su, Chun-Hui, "14-3-3SIGMA NEGATIVELY REGULATES THE STABILITY AND SUBCELLULAR LOCALIZATION OF COP1" (2010). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 101. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/101 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. 14-3-3SIGMA NEGATIVELY REGULATES THE STABILITY AND SUBCELLULAR LOCALIZATION OF COP1 By Chun-Hui Su, M.S. APPROVED: ______________________________ Mong-Hong Lee, Supervisory Professor ______________________________ Randy -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
Ahnaks Are a Class of Giant Propeller-Like Proteins That Associate with Calcium Channel Proteins of Cardiomyocytes and Other Cells
The AHNAKs are a class of giant propeller-like proteins that associate with calcium channel proteins of cardiomyocytes and other cells Akihiko Komuro*, Yutaka Masuda*, Koichi Kobayashi, Roger Babbitt, Murat Gunel, Richard A. Flavell, and Vincent T. Marchesi† Departments of Pathology and Immunobiology, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, CT 06510 Contributed by Vincent T. Marchesi, December 31, 2003 To explore the function of the giant AHNAK molecule, first de- mechanisms, one operating at the cell surface in collaboration with scribed in 1992 [Shtivelman, E., Cohen, F. E. & Bishop, J. M. (1992) calcium channels, and the second, PLC activation, which is a process Proc. Natl. Acad. Sci. USA 89, 5472–5476], we created AHNAK null that could potentially take place at multiple points throughout the mice by homologous recombination. Homozygous knockouts cell. showed no obvious phenotype, but revealed instead a second The arrangement of channel proteins at the cell surface is AHNAK-like molecule, provisionally designated AHNAK2. Like the believed to be controlled by multidomain polypeptides known as original AHNAK, AHNAK2 is a 600-kDa protein composed of a large scaffolding proteins that link together activated channels at specific number of highly conserved repeat segments. Structural predic- points on the membrane surface. Scaffolding proteins also coordi- tions suggest that the repeat segments of both AHNAKs may have nate the activities of multienzyme complexes by physically linking as their basic framework a series of linked, antiparallel -strands them together, and as in the case with AHNAK, they are often similar to those found in -propeller proteins. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
(ESI) for Toxicology Research
Electronic Supplementary Material (ESI) for Toxicology Research. This journal is © The Royal Society of Chemistry 2014 Supplementary data 1 Particle preparation and characterization 1.1 SWCNT preparation The purchased SWCNTs (P2-SWNTs, Carbon Solutions, Inc. CA, USA) have a poor dispersibility and colloidal stability in aqueous medium. To make well-dispersed SWCNTs in aqueous medium with a proper colloidal stability for the duration of the experiments, the purchased SWCNTs were accurately weighted and suspended in dimethyl sulfoxide (DMSO) to 0.125 mg/mL, followed by ultrasonication for 30 minutes in a water bath sonicator (B3510, Branson Ultrasonics, 40KHz). In the last minute of ultrasonication, the SWCNTs-DMSO suspension was rapidly diluted 5 times by injecting a stabilization buffer (5 mg/mL BSA and 10 mM NaCl in MilliQ water). The mixture, referred to as as-dispersed SWCNTs (AD-SWCNTs), resulted in a clear dark-brown suspension. No sedimentation of AD-SWCNTs was observed for weeks at room temperature indicating a good colloidal stability. To remove the majority of DMSO and free BSA, AD-SWCNTs were pelleted by centrifugation at 16,000 g, 4 °C for 30 min followed by three times wash with 10 mM NaCl in MilliQ water under the same conditions. The colloidal stability and surface charge of SWCNTs at each step were monitored by dynamic light scattering analysis (DLS) (see below). The depletion of DMSO and BSA was monitored by UV-Visible absorption analysis (see below). The SWCNTs aggregates and metallic impurities were characterized by TEM and TEM-EDX (see below). After the washing steps, SWCNTs were re-dispersed in MilliQ water with 10 mM NaCl to about 0.4 mg/mL, which was used in the experiments and here referred to as prepared SWCNTs. -
Transcriptional Control of Tissue-Resident Memory T Cell Generation
Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells. -
Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis
cells Article Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis Han-Yu Wang 1,2, Chun-Hsiang Lin 1, Yi-Ru Shen 1, Ting-Yu Chen 2,3, Chia-Yih Wang 2,3,* and Pao-Lin Kuo 1,2,4,* 1 Department of Obstetrics and Gynecology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] (H.-Y.W.); [email protected] (C.-H.L.); [email protected] (Y.-R.S.) 2 Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] 3 Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan 4 Department of Obstetrics and Gynecology, National Cheng-Kung University Hospital, Tainan 704, Taiwan * Correspondence: [email protected] (C.-Y.W.); [email protected] (P.-L.K.); Tel.: +886-6-2353535 (ext. 5338); (C.-Y.W.)+886-6-2353535 (ext. 5262) (P.-L.K.) Abstract: Septins are GTP-binding proteins that form heteromeric filaments for proper cell growth and migration. Among the septins, septin7 (SEPT7) is an important component of all septin filaments. Here we show that protein kinase A (PKA) phosphorylates SEPT7 at Thr197, thus disrupting septin filament dynamics and ciliogenesis. The Thr197 residue of SEPT7, a PKA phosphorylating site, was conserved among different species. Treatment with cAMP or overexpression of PKA catalytic subunit (PKACA2) induced SEPT7 phosphorylation, followed by disruption of septin filament formation. Constitutive phosphorylation of SEPT7 at Thr197 reduced SEPT7-SEPT7 interaction, but did not affect SEPT7-SEPT6-SEPT2 or SEPT4 interaction. -
Dissecting the Roles of WNT Signaling in Breast Cancer Using in Vitro and in Vivo Experimental Models
Dissecting the roles of WNT signaling in breast cancer using in vitro and in vivo experimental models INAUGURALDISSERTATION zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Yutaka Matsuda aus Aichi, Japan Basel, 2009 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Nancy E. Hynes und Prof. Dr. Gerhard Christfori Basel, den 17. Februar 2009 Prof. Dr. Eberhard Parlow Dekan Summary Canonical WNT pathway regulates expression of target genes by modulating intracellular amount of β-catenin. Without WNT pathway activation, a so-called “destruction complex” including APC and Axin facilitates the degradation of β-catenin. Upon binding of WNT ligand to its receptor Frizzled, the destruction complex is antagonized and β-catenin is stabilized. Stabilized β-catenin goes to the nucleus, binds to the TCF/LEF family of transcription factors and initiates the new gene expression program. De-regulation of the WNT signaling pathway via mutations in APC and Axin, proteins that target β-catenin for destruction, or in β-catenin itself have been linked to various types of human cancer. These genetic alterations rarely, if ever, are observed in breast tumors. However, various lines of evidence suggest that WNT signaling may also be de-regulated in breast cancer. Most breast tumors show hypermethylation of the promoter region of secreted Frizzled-related protein 1 (sFRP1), a WNT antagonist, leading to downregulation of its expression. As a consequence WNT signaling is enhanced. We hypothesized that autocrine activation of WNT signaling plays an important role in breast cancer and loss of sFRP1 expression is one of the critical events leading to constitutively active WNT signaling in breast cancer formation. -
A Missense Mutation in the RSRSP Stretch of Rbm20 Causes Dilated
www.nature.com/scientificreports OPEN A missense mutation in the RSRSP stretch of Rbm20 causes dilated cardiomyopathy and atrial fbrillation in mice Kensuke Ihara1,2*, Tetsuo Sasano2, Yuichi Hiraoka3, Marina Togo‑Ohno4, Yurie Soejima5, Motoji Sawabe5, Megumi Tsuchiya6, Hidesato Ogawa6, Tetsushi Furukawa1 & Hidehito Kuroyanagi4* Dilated cardiomyopathy (DCM) is a fatal heart disease characterized by left ventricular dilatation and cardiac dysfunction. Recent genetic studies on DCM have identifed causative mutations in over 60 genes, including RBM20, which encodes a regulator of heart‑specifc splicing. DCM patients with RBM20 mutations have been reported to present with more severe cardiac phenotypes, including impaired cardiac function, atrial fbrillation (AF), and ventricular arrhythmias leading to sudden cardiac death, compared to those with mutations in the other genes. An RSRSP stretch of RBM20, a hotspot of missense mutations found in patients with idiopathic DCM, functions as a crucial part of its nuclear localization signals. However, the relationship between mutations in the RSRSP stretch and cardiac phenotypes has never been assessed in an animal model. Here, we show that Rbm20 mutant mice harboring a missense mutation S637A in the RSRSP stretch, mimicking that in a DCM patient, demonstrated severe cardiac dysfunction and spontaneous AF and ventricular arrhythmias mimicking the clinical state in patients. In contrast, Rbm20 mutant mice with frame‑shifting deletion demonstrated less severe phenotypes, although loss of RBM20‑dependent alternative splicing was indistinguishable. RBM20S637A protein cannot be localized to the nuclear speckles, but accumulated in cytoplasmic, perinuclear granule‑like structures in cardiomyocytes, which might contribute to the more severe cardiac phenotypes. Dilated cardiomyopathy (DCM) is a fatal cardiac disease characterized by enlargement of the cardiac chambers and impaired systolic function1.