Microbial Associates of the Asian Citrus Psyllid and Its Two Parasitoids: Symbionts and Pathogens

MICROBIAL ASSOCIATES OF THE ASIAN CITRUS PSYLLID AND ITS TWO PARASITOIDS: SYMBIONTS AND PATHOGENS

JASON MICHAEL MEYER

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007

I dedicate this dissertation to my loving wife, Jennifer Lee Meyer.

ACKNOWLEDGMENTS

Foremost, I thank my advisor and chair of my graduate committee, Dr. Marjorie A. Hoy, for her professional advice, scientific guidance and financial support. I also thank the other members of my graduate committee, Dr. John L. Capinera, Dr. James J. Becnel, and Dr. Eric W.

Triplett for their contributions to my research proposal, preparing my qualifying examination and reviewing this dissertation. Additional recognition goes to Dr. Becnel and his laboratory for providing training in electron microscopy and assisting with a class project. I thank Dr. Drion G.

Boucias for his instruction and collaboration on projects involving entomopathogenic fungi.

Much appreciation is held for Dr. A. Jeyaprakash for his technical advice and assistance with phylogenetics. I acknowledge Lucy Skelley and Reggie Wilcox for their contributions involving insect rearing. Raguwinder Singh is thanked for his efforts during field collection of psyllids.

Verena Bläske is acknowledged for her technical assistance with scanning electron microscopy.

I thank Vernon Damsteegt for providing psyllids infected with the citrus greening pathogen and

Micki Kuhlmann for extracting DNA from these psyllids. I thank Jennifer Zaspel for providing theoretical guidance pertaining to phylogenetic analyses. Heather McAuslane and Karla

Addesso are thanked for statistical advice. I thank Mike Rogers and Tim Gast for arranging my trip to collect psyllids from citrus trees with symptoms of citrus greening disease. Lyle Buss,

Jane Medley and Mike Sanford are acknowledged for their contributions to photography and figure construction. I thank Dr. Lance Osborne for providing a fungal culture and Dr. James

Kimbrough for assistance with fungal morphology. I thank my family for their constant encouragement during my graduate experience. Finally, I wish to acknowledge my wife,

Jennifer L. Meyer, for her dedication, patience and unwavering support. This research was

funded, in part, by the Davies, Fischer, and Eckes Endowment to Marjorie A. Hoy in biological control.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES...... 9

LIST OF FIGURES ...... 10

ABSTRACT...... 11

CHAPTER

1 INTRODUCTION ...... 13

Literature Review ...... 13 Overview of Psyllids ...... 13 Biology of the Asian Citrus Psyllid...... 15 Citrus Greening Disease...... 17 Biology of Tamarixia radiata ...... 19 Biology of Diaphorencyrtus aligarhensis...... 20 Other Natural Enemies of D. citri ...... 21 Management of D. citri ...... 21 Overview of Microbe-Insect Associations ...... 22 Research Objectives...... 24

2 MICROBIAL ENDOSYMBIONTS OF THE ASIAN CITRUS PSYLLID Diaphorina citri KUWAYAMA [HEMIPTERA: PSYLLIDAE] AND ITS PARASITOIDS Tamarixia radiata (WATERSTON) [HYMENOPTERA: EULOPHIDAE] AND Diaphorencyrtus aligarhensis (SHAFEE, ALAM AND AGARWAL) [HYMENOPTERA: ENCYRTIDAE]...... 29

Introduction...... 29 Materials and Methods ...... 31 Insect Colonies ...... 31 Surface Sterilization ...... 32 Scanning Electron Microscopy...... 32 DNA Extraction...... 32 High Fidelity Polymerase Chain Reaction ...... 33 Cloning and Restriction Fragment Length Polymorphism Analysis...... 34 Phylogenetic Analysis ...... 34 Antibiotic Treatment and Detection of Wolbachia in D. aligarhensis...... 35 Results and Discussion ...... 37 Surface Sterilization...... 37 High-Fidelity PCR Amplification of Symbionts in D. citri and its Parasitoids ...... 40 Symbionts of D. citri ...... 40

Symbionts of T. radiata...... 44 Symbionts of D. aligarhensis...... 46 Antibiotic Treatment of D. aligarhensis ...... 47 Phylogenetic Analysis ...... 50 Conclusions...... 52

3 LOW INCIDENCE OF Candidatus Liberibacter asiaticus IN Diaphorina citri POPULATIONS BETWEEN NOVEMBER 2005 AND JANUARY 2006: RELEVANCE TO MANAGEMENT OF CITRUS GREENING DISEASE IN FLORIDA...... 66

Scientific Note ...... 66 Summary...... 70

4 MORPHOLOGICAL AND MOLECULAR CHARACTERIZATION OF A Hirsutella SPECIES INFECTING THE ASIAN CITRUS PSYLLID IN FLORIDA ...... 74

Introduction...... 74 Materials and Methods ...... 75 Insect Colony...... 75 Collection, Maintenance, and Cultivation of the D. citri Pathogen ...... 76 Microscopy...... 77 Bioassays ...... 77 Molecular Analyses...... 78 Phylogenetic Analysis ...... 79 Isolate-Specific PCR ...... 80 Results...... 81 Collection, Maintenance and Cultivation of the D. citri Pathogen ...... 81 Microscopy...... 82 Bioassays ...... 83 Molecular Analyses...... 84 Phylogenetic Analyses...... 86 Isolate-Specific PCR ...... 87 Discussion...... 87

5 ISOLATION AND CHARACTERIZATION OF A NOVEL STRAIN OF Paecilomyces fumosoroseus INFECTING THE ASIAN CITRUS PSYLLID...... 97

Introduction...... 97 Materials and Methods ...... 98 Insect Cultures...... 98 Collection and Cultivation of Pfr AsCP...... 99 Microscopy...... 101 Molecular Analyses...... 102 Results...... 104 Collection and Cultivation of Pfr AsCP...... 104 Molecular Analyses...... 108

Discussion...... 110

6 PERSPECTIVES ...... 123

LIST OF REFERENCES...... 130

BIOGRAPHICAL SKETCH ...... 144

LIST OF TABLES Table page

2-1 Evaluation of surface decontamination solutions to both kill external fungi and eliminate their DNA from a laboratory colony of adult D. citri...... 54

2-2 Primer sequences used in initial survey of microorganisms associated with D. citri, T. radiata, and D. aligarhensis...... 55

2-3 Results from high-fidelity PCR amplification of genomic DNA and endosymbiont DNA following bleach treatment from D. citri (adults and nymphs) and from the parasitoid of D. citri, D. aligarhensis...... 56

2-4 Summary of PCR results for the survey of microbial endosymbionts in D. citri and its two parasitoids...... 57

2-5 Species-specific forward and reverse primers used to detect bacterial sequences in DNA isolated from D. citri, T. radiata, and D. aligarhensis...... 58

3-1 Collection data for D. citri and results of the high-fidelity PCR assay for Ca. L. asiaticus and the endosymbiont Wolbachia during September 2005 and January 2006...... 71

4-1 Collection data and GenBank accessions for taxa used in phylogenetic analysis...... 91

4-2 Putative intron sequences for the Florida Hirsutella isolate from D. citri ARSEF 8315 (GenBank accession EF363706) and H. citriformis ARSEF 2346 (GenBank accession DQ079601)...... 92

5-1 Qualitative assessment of the infectivity of Pfr AsCP by a “touch test” against selected arthropods scored after one week at 24-25 °C with 70-100% relative humidity and a 16L:8D phtotoperiod...... 115

5-2 Total number of bands and unique bands (polymorphisms) produced by each primer in the AFLP analysis of DNA isolated from in vitro cultures of Pfr AsCP and Pfr 97...... 116

5-3 Primers designed from AFLP polymorphisms of Pfr AsCP and details relevant for use in the PCR...... 117

5-4 Putative ß-tubulin intron sequences of Pfr AsCP, Pfr 97, and Pfr ARSEF 3590 (GenBank accession DQ079604)...... 118

LIST OF FIGURES

Figure page

1-1 Illustrations of D. citri, its two parasitoids and symptoms of HLB...... 28

2-1 SEM of the ovipositor of adult female D. citri from a laboratory colony...... 60

2-2 Representative results of RFLP analysis using RsaI digestion of plasmid DNA containing inserts (approximately 1.4 kb) of the Eubacterial 16S rRNA gene amplified from DNA isolated from D. citri and its two parasitoids...... 61

2-3 Adult female compared to a male D. aligarhensis produced by tetracycline treatment....62

2-4 PCR amplification of the wsp gene of Wolbachia and the mitochondrial cytochrome c oxidase I (COI) gene from DNA isolated from female and male D. aligarhensis...... 63

2-5 Phylogenetic tree generated by ML analysis using 16S rRNA sequences from Eubacteria identified from D. citri, T. radiata, and D. aligarhensis compared to related sequences deposited in GenBank...... 64

3-1 Sensitivity analysis for high-fidelity PCR-amplification of plasmid DNA containing the nusG-rplK gene of Ca. L. asiaticus mixed with D. citri DNA...... 73

4-1 Light and electron micrographs of the Florida isolate of Hirsutella from D. citri...... 93

4-2 In vitro culture of the Florida Hirsutella isolate from D. citri on rice...... 94

4-3 Consensus phylogenetic tree using ML and MP for the Florida Hirsutella isolate from D. citri and related fungal species...... 95

5-1 Light and electron microgrpahs of Pfr AsCP...... 119

5-2 In vitro cultures of Pfr AsCP and Pfr 97 on quarter-strength SDY and MEA media photographed one week post-inoculation...... 120

5-3 Representative results of AFLP analysis using DNA isolated from Pfr AsCP and Pfr 97...... 122

5-4 PCR amplification of DNA isolated from psyllids killed by Pfr AsCP and Pfr 97 and from in vitro cultures of Pfr AsCP and Pfr 97 using AFLP primers...... 122

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

MICROBIAL ASSOCIATES OF THE ASIAN CITRUS PSYLLID AND ITS TWO PARASITOIDS: SYMBIONTS AND PATHOGENS

Jason Michael Meyer

May 2007

Chair: Marjorie A. Hoy Major: Entomology and Nematology

A molecular survey was conducted to characterize the microbial biota associated with

Diaphorina citri Kuwayama [Hemiptera: Psyllidae], which vectors citrus greening disease or

Huanglongbing (HLB), and its two parasitoids Tamarixia radiata (Waterston) [Hymenoptera:

Eulophidae] and Diaphorencyrtus aligarhensis (Shafee, Alam and Argarwal) [Hymenoptera:

Encyrtidae]. A series of surface-sterilization methods was evaluated to eliminate the DNA from

microbes living on the surface of these insects prior to the survey. Treatment with bleach

eliminated fungal DNA from the surface of D. citri and did not interfere with subsequent PCR amplification of insect genomic or endosymbiotic DNA. Using a high-fidelity polymerase chain

reaction (PCR), three eubacterial species each were detected in D. citri and in T. radiata and one

species was identified in D. aligarhensis. All eubacterial symbionts of D. citri were detected in

the eggs, indicating that they are transovarially transmitted. The eubacterial symbionts of T.

radiata were not detected in eggs and likely are transient associates. The eubacterial

endosymbiont Wolbachia was correlated with thelytokous reproduction in D. aligarhensis.

Eubacterial species were not shared by the host and its parasitoids, indicating that horizontal

transfer of these microbes did not occur. In 2005, HLB was detected in Florida, but little was

known about the epidemiology of the disease. To address this, D. citri were collected from

eleven counties and screened for Candidatus Liberibacter asiaticus, the bacterium that causes

HLB. All field-collected D. citri tested negative for Ca. L. asiaticus, including psyllids collected from trees with HLB symptoms. The removal of HLB-infected trees should be a high priority for HLB management so that the proportion of the vector population hosting Ca. L asiaticus does not increase. During this field survey, mycosed adult psyllids displaying two different phenotypes were collected. Morphological and molecular analyses were used to identify the two fungal pathogens as close relatives of Hirsutella citriformis Speare and of Paecilomyces fumosoroseus A. H. S. Brown and G. Smith. Healthy adult and immature D. citri from a laboratory colony died after exposure to both pathogens. Isolate-specific PCR primers were designed that distinguished both pathogens from related fungi. Future research is needed to determine the roles of these pathogens in the population dynamics of D. citri in Florida.

CHAPTER 1 INTRODUCTION

Literature Review

This chapter reviews the basic biology and pest status of psyllids with an emphasis on the

Asian citrus psyllid Diaphorina citri Kuwayama [Hemiptera: Psyllidae], which transmits citrus greening disease. The basic biology of the two parasitoids of D. citri, Tamarixia radiata

(Waterston) [Hymenoptera: Eulophidae] and Diaphorencyrtus aligarhensis (Shafee, Alam and

Agarwal) [Hymenoptera: Encyrtidae] is reviewed. Pest management practices and other natural enemies that suppress populations of D. citri are described. Finally, an overview of the diversity and importance of microbial interactions with insects is provided, including what currently is known about the microbial associates of D. citri and its two parasitoids. The final portion of this chapter introduces my research objectives and my hypotheses that were tested.

Overview of Psyllids

Members of the family Psyllidae (order Hemiptera, suborder Sternorrhyncha, superfamily

Psylloidea) are small (2-5 mm long), terrestrial, phytophagous insects that are commonly called psyllids or jumping plantlice (Triplehorn and Johnson, 2005). According to Gillot (2005), there are approximately 2200 species in the Psylloidea, including about 1400 species in the family

Psyllidae and about 650 species in the related family Triozidae. Members of the Sternorrhyncha first appeared in the fossil record of the Upper Permian (approximately 251-260 million years ago) (Gillott, 2005). Reports of psyllids have come from all biogeographical regions, but they are predominantly found in tropical and south-temperate regions (Burckhardt, 1994).

Psyllids have an opisthognathous head, a three-segmented beak and hold their wings over their body in a roof-like position (Gillott, 2005). The body of psyllids resembles miniature cicadas, and they have strong hind legs for jumping, two-segmented tarsi, a small pronotum, long

filiform antennae and two pairs of membranous wings (Gillott, 2005; Triplehorn and Johnson,

2005; Pedigo and Rice, 2006). Both males and females of some psyllid species produce acoustic

signals during mating (http://www.psyllids.org/psyllidsSOUND.htm). The life cycle of psyllids

includes an egg, multiple nymphal instars, and adult males and females, and metamorphosis is

hemimetabolous (Triplehorn and Johnson, 2005).

Many psyllid species are economically important plant pests and cause damage by both direct feeding and disease transmission. Most psyllids are monophagous or oligophagous and attack dicotyledonous plants (Burckhardt, 1994). Psyllids extract large quantities of plant

phloem and excrete the excess as honeydew and wax at the feeding site, which can facilitate

growth of sooty mold (Aubert, 1987; Triplehorn and Johnson, 2005). Feeding by some psyllids,

such as the potato or tomato psyllid Paratrioza cockerelli (Sulc) and the carrot psyllid Trioza

apicalis Förster, causes phytotoxemia in the host plant (Kainulainen et al., 2002; Liu and

Trumble, 2004). Extensive feeding by psyllids can result in defoliation (Geiger and Guiterrez,

2000). Some psyllid species are gall formers, such as Pachypsylla celtidisgemma Riley and

Pachypsylla celtidisvesiculum Riley, which attack hackberry (Houseman and Barrett, 1998;

http://www.forestryimages.org/browse/genus.cfm?id=Pachypsylla). Aubert (1987) reported that

seven psyllid species vector prokaryotic disease agents of plants, and some Cacopsylla species

transmit diseases such as pear decline and apple proliferation caused by phytoplasmas

(Frisinghelli et al., 2000; Tedeschi et al., 2002; Tedeschi and Alma, 2004)

The most economically important psyllid species include the Asian citrus psyllid D. citri,

the African citrus psyllid Trioza erytreae (Del Guercio), a complex of pear psyllids in the genus

Cacopsylla, the apple sucker C. mali (Schmidberger), and the potato or tomato psyllid, P.

cockerelli (Sulc) (Burckhardt, 1994; Liu and Trumble, 2004). Psyllids also attack other

economically important plants such as carrots (Kainulainen et al., 2002), apricots (Jarausch et al.,

2001), legumes (Finlay-Doney and Walter, 2005) and ornamental trees such as Eucalyptus

(Geiger and Gutierrez, 2000; Hodkinson et al., 2001; Purvis et al., 2002; Daane et al., 2005).

Although psyllids are generally regarded as plant pests, some species are used as biological control agents of invasive plants (Wineriter et al., 2003; Memmott et al., 2005). In Florida, the psyllid Boreioglycaspis melaleucae Moore was imported and released in a classical biological control effort to control the introduced tree Melaleuca quinquenervia (Cav.) S. T. Blake

(Myrtaceae) which is displacing native vegetation (Wineriter et al., 2003).

Biology of the Asian Citrus Psyllid

The Asian citrus psyllid Diaphorina citri Kuwayama [=Euphalerus citri (Crawford)] was first described in Taiwan (Kuwayama, 1908). Diaphorina citri is native to Asia, has spread throughout the citrus-growing regions of tropical and subtropical Asia, and has invaded the

Middle East, Central America, South America, the Caribbean and the islands of Reunión,

Mauritius, and Madagascar (Costa Lima, 1942; Wooler et al., 1974; Étienne and Aubert, 1980;

Burckhardt and Martinez, 1989; Bernal, 1991; Étienne et al., 2001; Halbert and Nunez, 2004;

Grafton-Cardwell et al., 2006). In the USA, D. citri was reported in Florida in 1998 (Halbert,

1998a, b; Knapp et al., 1998; Halbert et al., 2000) and in Texas (Grafton-Cardwell et al., 2006), but it has not been found in California to date.

A detailed description of the characteristics and life history of D. citri were provided by

Husain and Nath (1927). Adults of D. citri have a mottled brown body that ranges from 2-4 mm in length (Figure 1-1 A), whereas the nymphs (Figure 1-1 C) and eggs are yellow. The Asian citrus psyllid is a bisexual species, with male to female ratios of approximately 1:1. Adult female and male D. citri are distinguished by their abdominal features. The terminal abdominal segment of females is short and held horizontally to the abdomen, whereas males have a larger

terminal abdominal segment that is held perpendicular to the abdomen. The abdomen of males

and sexually immature adult females is blue-green, but the abdomen of sexually mature females is typically orange.

Adult females have a pre-ovipositional period of approximately 20 days (Husain and Nath,

1927) before they are able to lay eggs on the tender new flush produced by the host plant. After the eggs hatch, D. citri develops through five nymphal instars (Mead, 1977) that can be distinguished by their relative size and wing pad morphology (Chien et al., 1989). The entire life cycle of D. citri from egg to adult takes approximately 13 days at 25°C (Yang, 1989; Liu and

Tsai, 2000). Adult D. citri can live for several months and can lay up to 800 eggs in their lifetime (Mead, 1977). There is no diapause in D. citri, and populations decline when new flush is not readily available (Grafton-Cardwell et al., 2006).

Diaphorina citri attack multiple host plants in the family Rutaceae, including numerous

Citrus species (reviewed by Halbert and Manjunath, 2004) and the ornamental orange jasmine,

Murraya paniculata (L.) Jack (Halbert, 1998a; Tsai et al., 2000; 2002). In Florida, population densities of D. citri on M. paniculata were positively related to shoot flushes in the host plant, which correlated with minimum temperature and rainfall (Tsai et al., 2002). Annually, there are multiple generations of D. citri that overlap and are coordinated with the flush cycles in the host plant (Yang et al., 2006).

The following behavioral characteristics of D. citri were reviewed by Yang et al. (2006).

Adult D. citri usually feed on mature plant tissue including the leaf midveins, petioles, leafblades and stems. During feeding, the body of adult D. citri is typically positioned at a 45° angle relative to the plant surface (Figure 1-1 A). Activity in adults is temperature dependent; low activity is observed when temperatures are below 11°C, but adults are active when temperatures

reach 22°C and above, especially when they are in direct sunlight. The adults are not strong fliers, and dispersal is positively influenced by wind. Immature psyllids are relatively sedentary and feed on the tender new flush of their host plant as young instars, but later instars may disperse to feed on soft plant tissues nearby.

Feeding damage by D. citri can result in stunted and shriveled shoots, curled and notched leaves, defoliation, flower drop and branch death (die back), especially when psyllid densities are high (Shivankar et al., 2000). Diaphorina citri also damages citrus by vectoring citrus greening disease (Huang et al., 1984; Garnier et al., 2000).

Citrus Greening Disease

Diaphorina citri and T. erytreae are the vectors of citrus greening disease or

Huanglongbing (HLB). The Asian form of HLB and a South-American form of HLB are caused by the gram-negative bacterium, Candidatus Liberibacter asiaticus (Ca. L. asiaticus) (formerly referred to as Liberobacter asiaticum (L.) (Jack) and Candidatus Liberibacter americanus, respectively (Garnier et al., 2000; Teixeira et al., 2005), and both pathogens are transmitted by

D. citri. African greening disease is caused by Candidatus Liberibacter africanus, which is transmitted by T. erytreae. None of the greening pathogens have been cultured on artificial media (Halbert and Manjunath, 2004), so there remains a “Candidatus” designation associated with their taxonomy.

The greening pathogens are found exclusively in the sieve tubes of infected plants, and are acquired and transmitted by psyllid nymphs and adults during phloem feeding (Garnier and

Bové, 1983). Details regarding transmission of HLB by D. citri were reviewed by Halbert and

Manjunath (2004) as follows. In the field, adult D. citri can acquire the greening bacterium after feeding for as little as 30 minutes on an infected host plant. Each stage of immature D. citri can acquire the greening bacterium by phloem feeding, but only fourth- and fifth-instar nymphs can

transmit the disease. Transmission of HLB from D. citri to citrus is believed to occur in

association with the salivary secretions of D. citri (Aubert, 1987). HLB is also transmitted by vegetative propagation of infected plant material and dodder (Capoor et al., 1974; Roistacher,

1996). The distribution of HLB was reviewed by Halbert and Manjunath (2004) and includes

Florida, after its discovery near Homestead, FL in 2005 (Halbert, 2005; Bouffard, 2006).

HLB symptoms in citrus include yellowing of leaf veins, leaf mottling (Figure 1-1 D) and misshapen, poor-tasting fruit. Long-term infections can kill citrus trees (da Graça, 1991). At present, there is no cure for HLB in citrus, but some cultivars show tolerance to the infection

(Halbert and Manjunath, 2004). Young trees are particularly susceptible to HLB and can die within a few years after becoming infected. Citrus trees that are infected with HLB are often asymptomatic for years or show disease symptoms resembling zinc deficiency, making early detection and management of the disease problematic (Halbert and Manjunath, 2004). The advent of polymerase chain reaction (PCR)-based techniques allowed rapid detection of the greening bacterium in infected citrus and in the vector (Korsten et al., 1996; Hoy et al., 2001;

Hung et al., 2004).

In Florida, maintenance of clean nursery stocks and the removal of HLB-infected citrus trees will be essential to reduce the spread of HLB. The livelihood of the Florida citriculture industry is estimated to generate over $9 billion / yr, supports 98,000 employees (Woods, 2002), and relies on the long-term maintenance of HLB-free citrus. Due to the large and widely- distributed populations of D. citri in Florida, eradication of the vector is not feasible (Hoy and

Nguyen, 1998; Hoy et al., 1999), but chemical control and the maintenance of biological control

agents can reduce densities of D. citri (Browning et al., 2006; Rogers and Timmer, 2007).

Biology of Tamarixia radiata

Tamarixia radiata [=Tetrastichus radiatus (Waterston)] (Waterston, 1922) is an obligate

koinobiont ectoparasitoid that is specific to D. citri (Aubert and Quilici, 1984). The morphology

of T. radiata was described by Waterston (1922). Adult T. radiata have a black head and

thoracic region, a black and pale-yellow colored abdomen, pale-yellow legs and red eyes (Figure

1-1 E-F). Male and female T. radiata are distinguished by differences in size and characteristics

of their antennae and abdomens. Males are 1 mm in length and have a wingspan of

approximately 1 mm, whereas females are larger, averaging 1-3 mm in length and having a

wingspan of 2-6 mm. The male antennae are covered with long hairs, and they have a rounded

terminal abdominal segment. Females have shorter hairs on their antennae, and their terminal

abdominal segment is acute.

Chu and Chien (1991) provided a description of the life history of T. radiata. Sex

determination in T. radiata operates by arrhenotoky, where unfertilized eggs are haploid and

result in males, and fertilized eggs are diploid, producing females (Chien, 1995; Hoy, 2003).

The female: male ratio of T. radiata is approximately 1 female: 0.76 male (Chu and Chien, 1991;

Chien, 1995). Males can mate multiple times, but 93% of females mate only once (Chien et al.,

1991). Mated females deposit a single egg on second- to fifth-instar D. citri nymphs on the ventral side of the first abdominal segment near the hind coxae (Aubert and Quilici, 1984; Chu and Chien, 1991; Chien, 1995; Chien and Chu, 1996). Fifth-instar D. citri nymphs are preferred by T. radiata, and development on larger nymphs results in a higher survival rate and higher percentage of female production (Chu and Chien, 1991). After the egg hatches, the larva of T. radiata feeds, develops through 4 larval instars, and then glues the exoskeleton of its consumed host to the plant with silken threads before pupating (Aubert and Quilici, 1984; Chien et al.,

1991; Jinhan and Yuqing, 1993). Adult T. radiata emerge by penetrating the dorsum of the

thorax of its mummified host (Figure 1-1 B), typically in the morning (Chien, 1995). The entire

life cycle of T. radiata from egg to adult takes 12 days at 25°C, the optimal temperature for

development in this parasitoid (Chien et al., 1993; Chien, 1995). Adult females and males live

an average of 24 and 15 days, respectively (Chu and Chien, 1991). A single T. radiata can kill

up to 500 immature D. citri by a combination of parasitization and by host feeding on all

nymphal stages (Chu and Chien, 1991; Chien et al., 1991; Chien, 1995).

Biology of Diaphorencyrtus aligarhensis

Diaphorencyrtus aligarhensis [=Aphydencyrtus aligarhensis, Psyllaephagus harrisoni,

Psyllaephagus diaphorinae, and Diaphorencyrtus diaphorinae] is an obligate koinobiont endoparasitoid that is specific to D. citri (Aubert and Quilici, 1984; Aubert, 1987; Chien et al.,

1989). Sex determination in the Taiwan population of D. aligarhensis operates by thelytoky

(Chien, 1995; Hoy, 2003) where only females are produced. Bisexual populations of D. aligarhensis have been reported in Viet Nam (Nguyen and Hoy, unpublished).

The morphology of D. aligarhensis was described by Shafee et al. (1975). Adult females are small (1.2 mm long), have a black head and thoracic region and yellowish legs (Figure 1-1

G). Females have a yellowish-brown abdomen with an acute terminal abdominal segment.

Males have occasionally been reported in an Asian population of D. aligarhensis (Shafee et al.,

1975). The antennae of females are smooth and clubbed, but the male antennae are not clubbed and are covered with short hairs. No other morphological description of male D. aligarhensis was provided by Shafee et al. (1975).

The life cycle of D. aligarhensis takes 18 days from egg to adult at 25°C (Chien, 1995).

Larvae feed on D. citri nymphs and produce a dark reddish-brown colored mummy (Figure 1-1

B), and adults emerge through the dorsal portion of the abdomen of mummified D. citri nymphs.

Adult female D. aligarhensis can kill up to 280 D. citri nymphs by a combination of parasitizing

second-fourth instar nymphs and by host feeding (Chien, 1995; Chien and Chu, 1996; Skelley

and Hoy, 2004). In the laboratory, 10% of adult D. aligarhensis could survive for 50 days at

25°C, but females of this Taiwan population had an average of only 6.6 progeny in the laboratory (Skelley and Hoy, 2004).

Other Natural Enemies of D. citri

In addition to the specialist parasitoids described above, other natural enemies have been reported to attack D. citri in Florida. An unidentified fungal pathogen attacking D. citri was reported (Halbert and Manjunath, 2004), and predaceous lady beetles, green lacewings, and spiders also have been observed feeding on D. citri in Florida (Michaud, 2004).

Polyphagous predators of D. citri have been reported worldwide, including numerous species of coccinellids, green lacewings, syrphids in the genus Allographa, praying mantids, ants, spiders, and mites (Aubert,1987; Yang et al., 2006). Several species of entomopathogenic fungi, including Paecilomyces fumosoroseus (Wize) A. H. S. Brown and G. Smith (Samson,

1974; Subandiyah et al., 2000a), Hirsutella citriformis Speare (Rivero-Aragon and Grillo-

Ravelo, 2000; Subandiyah et al., 2000a; Étienne et al., 2001), Cephalosphorium lecanii Zimm

(Verticillium lecanii) (Xie et al., 1988; Rivero-Aragon and Grillo-Ravelo, 2000), Beauveria bassiana (Bals.) Vuill. (Rivero-Aragon and Grillo-Ravelo, 2000), Cladosporium sp. nr. oxysporum Berk. and M. A. Curtis (Aubert, 1987) and Capnodium citri Berk. and Desm.

(Aubert, 1987) have been found to infect D. citri worldwide, particularly during periods of high relative humidity.

Management of D. citri

Populations of D. citri can be suppressed by chemical control. Petroleum oil (Rae et al.,

1997) and the insecticides Danitol (fenpropathrin), Provado (imidacloprid), Lorsban

(chlorpyrifos) and Temik (aldicarb) are recommended for D. citri management in Florida

(Browning et al., 2006; Stansly and Rogers, 2006; Rogers and Timmer, 2007). The most cost- effective application of a foliar insecticide to reduce psyllid populations is during the early phase

of each flush (tender new growth) cycle. This is when densities of D. citri nymphs typically are

the highest, so the number of psyllids killed by the insecticide is maximized (Browning et al.,

2006; Stansly and Rogers, 2006; Rogers and Timmer, 2007). In India, the use of botanicals,

spray oils and insect growth regulators were encouraging alternatives to chemical insecticides for

D. citri management (Shivankar et al., 2000).

In Florida, a classical biological control program was initiated to reduce populations of D.

citri. Small populations of T. radiata and D. aligarhensis were imported from Taiwan and

Vietnam in 1998 and reared in a quarantine facility at the Division of Plant Industry in

Gainesville and at the University of Florida, Gainesville (Hoy and Nguyen, 1998, 2000; Hoy et al., 1999; Skelley and Hoy, 2004). To prevent an inadvertent introduction of HLB, DNA samples were isolated from psyllids and parasitoids in each colony and analyzed by a high- fidelity polymerase chain reaction (PCR) assay for Ca. L. asiaticus. All psyllids and parasitoids

that were screened for the HLB-causing bacterium tested negative (Hoy et al., 1999, 2001). Both

T. radiata and D. aligarhensis were released in Florida (McFarland and Hoy, 2001; Skelley and

Hoy, 2004), and T. radiata has established (Michaud, 2002). Tamarixia radiata was also used in the biological control of D. citri in Reunion and Taiwan (Étienne and Aubert, 1980; Aubert and

Quilici, 1984; Chien et al., 1988, 1989; Chien and Chu, 1996). Reports of numerous species of

hyperparasitoids of T. radiata and D. aligarhensis were provided by Chien et al. (1989), but no

incidence of hyperparasitoids attacking T. radiata have been reported in Florida.

Overview of Microbe-Insect Associations

The term “symbiosis” first was defined as “dissimilar organisms living together” (de Bary,

1879). Symbioses include interactions ranging from mutualism, where both organisms benefit

from the interaction, to parasitism, where survival of the pathogen comes at the expense of the host (Werren and O’Neill, 1997). Some scientists reserve the term symbiosis to describe mutualism; however, I will refer to symbiosis in a context that includes lasting or transient insect-microbe interactions that include parasitism, commensalism (neutral) and mutualism.

The number of surveys of arthropod endosymbionts has dramatically increased following the advent of molecular tools used to identify uncultivated microbes (Darby and Welburn, 2006).

A diverse microbiota is associated with arthropods including eubacteria, fungi, microsporidia

(Vossbrinck et al., 2004), helicosporida (Bläske and Boucias, 2005), protozoans, viruses and larger eukaryotes such as nematodes (Daly et al., 1998). Endosymbionts influence fundamental biological processes in arthropods including metabolism (Douglas, 2003), reproduction (O’Neill et al., 1997) and other fitness attributes (Grenier et al., 2002; Tagami et al., 2002; Huigens et al.,

2004). The role of many microbes in the biology of their insect host is not defined, particularly in forums where microbes are just “passers-by” and are associated due to their overlapping environments (Werren and O’Neill, 1997). Often microbes associated with insects are not amenable to culturing techniques because of their strict environmental requirements (Darby and

Welburn, 2006). The most economically important interactions between insects and microbes are related to the transmission of human, animal, and plant diseases (Daly et al., 1998).

Using molecular methods, five bacterial symbionts were identified in an Asian population of D. citri that included a primary symbiont, Candidatus Carsonella rudii, a secondary symbiont, related to species in the genera Oxalobacter and Herbaspirillum, Arsenophonus, Ca. L. asiaticus

(the pathogen that causes HLB) and Wolbachia (Subandiyah et al., 2000b). The primary and secondary symbionts were located in the mycetocyte of D. citri with in situ hybridization, but the other symbionts were not located with this technique (Subandiyah et al., 2000b). Primary and

secondary gut symbionts typically are found in psyllids and other insects in the Sternorrhyncha, and they are believed to be essential for host survival (Baumann, 2006). In the Florida population of D. citri, which is of unknown origin, Wolbachia was detected using molecular methods (Jeyaprakash and Hoy, 2000), but a survey was not conducted to detect symbionts other than Wolbachia. The transmission mechanisms and influence of these microbes on the biology of D. citri have not been determined.

Molecular surveys of the bacteria Wolbachia and Ca. L. asiaticus bacteria were conducted in the two parasitoids of D. citri (Jeyaprakash and Hoy, 2000; Hoy et al., 2001). Wolbachia was not detected in the T. radiata population that was imported and released in Florida, but it was found in D. aligarhensis. Numerous reports of Wolbachia-induced thelytoky have been provided in parasitoids (Stouthamer et al., 1990; Pintureau et al., 1999, Argov et al., 2000; De Barro and

Hart, 2001; Giorgini, 2001; Pintureau and Bolland, 2001; Stouthamer and Mak, 2002). It is possible that thelytoky is caused by Wolbachia in D. aligarhensis, but this has not been demonstrated. The HLB-casing bacterium Ca. L. asiaticus was not detected in D. aligarhensis or

T. radiata populations using a high-fidelity PCR assay, prior to their release in Florida (Hoy et al., 2001).

Research Objectives

Thorough analyses of microbial diversity in parasitoids and their hosts are lacking. Studies of the microbes associated with D. citri in Florida are warranted considering the economic importance of D. citri with regard to HLB transmission. Previous research investigating microbial interactions in this host-parasitoid system was limited to surveys of Eubacteria and did not address other microorganisms, even though there may be additional microbes that play significant roles in the biology of D. citri and its parasitoids in Florida.

In chapter II, a study was conducted to survey the diversity of microbes associated with D.

citri and its two parasitoids using molecular methods. Microbes, including Archaea, Eubacteria,

Fungi, Microsporidia, Helicosporidia and the bacteriophage WO of the endosymbiont

Wolbachia, were surveyed using a high-fidelity PCR assay. The interaction and overlapping

environments of D. citri with its parasitoids may facilitate the horizontal transmission of

microorganisms, so I analyzed the data to determine if any of the microorganisms were “shared”

between the host and parasitoids. I realized that studies limited to laboratory cultures may not

reflect naturally occurring microbial associations. Therefore, field-collected specimens were

analyzed with species-specific PCR primers that were developed for each microbe detected in

the survey to validate the laboratory data. The transmission mechanisms of the host and parasitoid-associated microbes were determined in D. citri and T. radiata with species-specific

PCR because essential endosymbionts often are transmitted via the eggs (Douglas, 2003). I

hypothesized that thelytokous sex determination in the Taiwan population of D. aligarhensis

may be correlated with infection with Wolbachia (Jeyaprakash and Hoy, 2000). To test this,

adult female D. aligarhensis were treated with tetracycline, and the sex of their offspring was

determined and screened with the PCR for Wolbachia.

Initially, further analyses of the endosymbionts identified in chapter II were proposed,

specifically concerning their role and location in D. citri and its parasitoids. However, HLB was

reported in citrus trees in south Florida in 2005 (Halbert, 2005; Bouffard, 2006), and my research

goals were amended. Little was known about the epidemiology of HLB relative to the vector in

Florida, and I wanted to conduct a project involving field research to add an applied component

to my dissertation research. This research remained under the framework of my original

proposal, which was, in part, to study the microbial associates of D. citri.

In chapter III, the prevalence of the HLB-causing bacterium was determined in D. citri populations of Florida. I hypothesized that, due to the recent detection of HLB in Florida’s citrus, a low proportion of the vector population, in the range of 1-2%, would host Ca. L. asiaticus. However, it seemed possible that, because HLB-infected citrus trees may not show obvious disease symptoms for many years, a higher-than-expected proportion of the vector population could harbor the plant pathogen. Furthermore, updated surveys of the distribution of

HLB in Florida showed that the disease is not limited to the southernmost counties of Florida, but is widespread throughout the major citrus growing regions

(http://www.doacs.state.fl.us/pi/chrp/greening/maps/cgsit_map.pdf). To address my hypothesis, psyllids were collected from eleven counties representing the major citrus-growing regions in

Florida, and they were screened for Ca. L. asiaticus using a high-fidelity PCR assay. The prevalence of the HLB-causing pathogen in the vector population likely will have implications for HLB and psyllid management strategies, and it will establish a benchmark for the infection status of the vector population relative to the sampling interval.

During the field survey for D. citri in central Florida, adult D. citri that were apparently killed by two different fungal pathogens were observed and collected. The discovery of these fungal pathogens was exciting because there had been no prior detailed reports of fungi attacking the invasive D. citri in Florida. In chapter IV and V, descriptive research was conducted to investigate various aspects of the biology of these two fungi and to determine their relationship with D. citri. The morphological characteristics of both fungi were characterized in the laboratory, using various microscopic techniques. Three genes were PCR-amplified, cloned and sequenced from both fungi and used, in combination with the morphological findings, for identification by DNA sequence and phylogenetic analyses. Each fungus was maintained on

artificial media and on the psyllid host, and various aspects of the host-pathogen interactions

were studied using these laboratory cultures. Isolate-specific PCR primers were designed for

each fungus so that the identity of these pathogens could be confirmed if cadavers of D. citri are

collected in Florida or elsewhere in the future. Amplified fragment length polymorphism

analysis was used to discriminate one of the pathogens from another closely-related Florida

isolate.

Throughout my Ph.D. experience, I have developed as a scientist on technical, professional

and personal levels. Chapter VII, “Perspectives”, includes a synopsis of my experiences presented in a reflective and self-evaluative context.

Figure 1-1. Illustrations of D. citri, its two parasitoids and symptoms of HLB. (A) D. citri adult; (B) Mummified nymphs of D. citri with emergence hole produced by T. radiata (top left) and D. aligarhensis (bottom right); (C) Fifth-instar D. citri nymph; (D) Citrus foliage showing yellow leaf veins and leaf mottling, signs of HLB; (E) T. radiata female; (F) T. radiata male; (G) D. aligarhensis female. Scale: (A) 1 mm; (B-G) 0.5 mm.

CHAPTER 2 MICROBIAL ENDOSYMBIONTS OF THE ASIAN CITRUS PSYLLID Diaphorina citri KUWAYAMA [HEMIPTERA: PSYLLIDAE] AND ITS PARASITOIDS Tamarixia radiata (WATERSTON) [HYMENOPTERA: EULOPHIDAE] AND Diaphorencyrtus aligarhensis (SHAFEE, ALAM AND AGARWAL) [HYMENOPTERA: ENCYRTIDAE]

Introduction

Symbioses ranging from mutualism to parasitism exist between arthropods and a diverse biota of microorganisms (Werren and O’Neill, 1997). The number of surveys of arthropod endosymbionts has dramatically increased following the advent of molecular tools used to identify uncultivated microbes (Darby et al., 2006). Endosymbionts influence fundamental biological processes in arthropods including metabolism (Douglas, 2003), reproduction (O’Neill et al., 1997) and other fitness attributes (Tagami et al. 2002, Grenier et al., 2002, Huigens et al.,

2004), but the role of most microorganisms in the biology of their host is unknown.

Thorough analyses of the microbial diversity, transmission mechanisms and role of endosymbionts in parasitoid-host interactions are lacking. To address this, the microbial associations of a Florida population of the Asian citrus psyllid Diaphorina citri Kuwayama

[Hemiptera: Psyllidae] and its parasitoids Tamarixia radiata (Waterston) [Hymenoptera:

Eulophidae] and Diaphorencyrtus aligarhensis (Shafee, Alam and Agarwal) [Hymenoptera:

Encyrtidae] were characterized. This system is of particular interest because Tamarixia radiata is an arrhenotokous ectoparasitoid while D. aligarhensis is a thelytokous endoparasitoid, and

these differences in strategies of parasitization and sex determination may be tied to the

endosymbionts in each parasitoid. The intimate interaction that exists between a host and parasitoid may facilitate horizontal transfer or “sharing” of microorganisms.

The Asian citrus psyllid is an economically important vector of citrus greening disease or

Huanglongbing (HLB), which is caused by the bacterium Candidatus Liberibacter asiaticus (Ca.

L. asiaticus) (Garnier et al., 2000). HLB was reported in Florida in 2005, and this disease poses

a serious threat to the citrus industry because long-term infections result in a reduction of fruit

quality and ultimately can kill citrus trees (Halbert, 2005; Bouffard, 2006). Research addressing

the eubacterial community associated with an Asian population of D. citri previously was

conducted by Subandiyah et al. (2000b). Five different eubacteria were identified based on

RFLP analysis of PCR-amplified 16S rRNA genes, including a primary endosymbiont

(mycetocyte symbiont), a secondary symbiont (syncytium symbiont) and species in the genera

Arsenophonus, Ca. L. asiaticus (HLB-causing pathogen), and Wolbachia. Using in situ

hybridization, the primary and secondary symbionts were detected in the mycetocyte, a microbe-

containing structure commonly found in hemipteran insects (Baumann, 2006), but they were not

able to localize the other eubacterial endosymbionts using this method (Subandiyah et al.,

2000b). The primary and secondary symbionts were found in 100% of the Asian population of

D. citri, but Arsenophonus, Ca. L. asiaticus, and Wolbachia were detected in 83, 45, and 76% of

the psyllids tested, respectively (Subandiyah et al., 2000b).

In Florida, colonies of T. radiata and D. aligarhensis were imported from Taiwan and

Vietnam, respectively, reared in quarantine, and released in a classical biological control

program against D. citri (Hoy and Nguyen, 1998; Hoy et al., 1999; 2001; Skelley and Hoy,

2004). Prior to the release of these parasitoids in Florida, a subset of the populations was

screened for the HLB-causing bacterium, and all samples tested negative (Hoy et al., 1999;

2001). Wolbachia was detected in D. aligarhensis, but not in T. radiata, using a high-fidelity

PCR assay (Jeyaprakash and Hoy, 2000). The population of D. aligarhensis imported into

Florida is thelytokous, which may be due to infection with Wolbacha (Chien, 1995; Jeyaprakash

and Hoy, 2000; Skelley and Hoy, 2004). Reproductive anomalies caused by Wolbachia are well-

documented in parasitoids (Stouthamer et al., 1990; Pintureau et al., 1999; Stouthamer et al.,

1999, De Barro and Hart, 2001; Giorgini, 2001; Pintureau and Bolland, 2001; Stouthamer and

Mak, 2002; Majerus, 2003), but, to our knowledge, the role of Wolbachia has not been investigated in parasitoids belonging to the genus Diaphorencyrtus.

The goals of this study were to provide a thorough molecular survey of the diversity of microbes associated with D. citri and its parasitoids and to expand on the previous work that identified some of the eubacterial endosymbionts associated with these insects. We surveyed these insects for diverse taxa of microorganisms including Archaea, Eubacteria, Fungi,

Microsporidia, Helicosporida and the bacteriophage WO of the endosymbiotic bacterium

Wolbachia using a high-fidelity PCR assay. We also were interested in determining the proportion of field-collected insects that harbored each endosymbiont species detected in the survey and to investigate which microbes were transovarially transmitted. The role of

Wolbachia was studied in D. aligarhensis by treating females in the thelytokous population with antibiotics.

Materials and Methods

Insect Colonies

Small citrus trees (20-50 cm tall) were grown in 15.2-cm diameter pots to maintain colonies of D. citri and its two parasitoids (Skelley and Hoy, 2004). Ten trees were pruned each week, fertilized with Peter’s 20-20-20 (N-P-K) water-soluble fertilizer (United Industries, St.

Louis, MO), and placed in wooden-framed mesh cages (0.76 m x 0.91 m x 1.11 m) in a greenhouse at 20-32°C with a 16L:8D photoperiod. Adult female psyllids oviposited on the new growth (flush) produced by the trees. Adult parasitoids were aspirated and released into the cages according to species when immature D. citri reached the first or second instar. Psyllid nymphs that were not attacked by the parasitoids and developed to adulthood were used to initiate the next generation.

Surface Sterilization

Adult D. citri from the laboratory colony had fungi growing on their external surfaces,

probably due to crowded rearing conditions and a high relative humidity (RH). Therefore, a

method was needed to eliminate the DNA from these fungi (and other microorganisms) that may

inhabit the external surfaces of D. citri and its parasitoids prior to conducting the molecular

survey of endosymbionts. The external fungi associated with D. citri from the laboratory colony

were cultured on nutrient agar (NA) plates, and the fungi were identified using molecular

methods (described below).

The solutions in Table 2-1 were evaluated for their ability to both kill external fungi and to

eliminate their DNA. Two replicates of three insects were gently vortexed in 5 mL of each

solution for 1 min and then were rinsed three times with 5 mL of sterile water. These insects

were individually rolled across NA plates in a “Z” pattern to determine if the surface sterilization

process killed the external fungi. Two replicates of two insects were treated similarly and then

used for DNA extraction.

Scanning Electron Microscopy

For SEM, adult D. citri from the laboratory colony that were surface-sterilized with bleach

or untreated (control) were fixed with OsO4, dehydrated in an ethanol series, critical-point dried with a Baltec CPD-030 critical point dryer, sputter coated with Gold-Palladium using a Baltec

SCD-005 sputter coater, and examined on a Hitachi S-450 scanning electron microscope operating at 10 kV.

DNA Extraction

Individual insects treated with the surface sterilization solutions under evaluation were homogenized with a blunt-ended sterile pipette tip, and used for DNA extraction using

PUREGENE reagents (Gentra Systems, Minneapolis, MN) according to the manufacturer’s

protocol. For the microbial surveys, ten newly emerged adult insects were pooled according to

species, before DNA extraction. Two DNA extractions were conducted using adult D. citri and

T. radiata prior to bleach treatment, respectively, and two replicates of DNA extractions for D.

citri, T. radiata and D. aligarhensis were conducted following bleach treatment. One-week-old

cultures of fungi grown on NA plates (external surface of adult D. citri) were harvested and used

for DNA isolation. DNA pellets were air dried, resuspended in 10-50 µL sterile water, and

stored at -70°C. Ten individual D. citri, T. radiata, and D. aligarhensis from the laboratory

colonies and ten individual D. citri and T. radiata collected from the field in Polk county, Florida

(28°03.656’ N, 81°34.937' W) were used to isolate DNA for species-specific PCR. These insects

were processed as described above, but their DNA was resuspended in 10 µL of sterile water.

No field-collected D. aligarhensis were collected because this parasitoid is rare in Florida.

Twenty eggs of D. citri and T. radiata collected from the laboratory colonies were pooled,

surface sterilized, and the DNA was isolated as described above and resuspended in 10 μL of

sterile water. No DNA was isolated from eggs of D. aligarhensis because the endoparasitoid

deposits eggs inside of D. citri nymphs, and attempts to dissect and recover these eggs were

unsuccessful.

High Fidelity Polymerase Chain Reaction

A 50 µL high-fidelity polymerase chain reaction (PCR) that contained 50 mM Tris, pH 9.2,

16 mM ammonium sulfate, 1.75 mM MgCl2, 350 mM dNTPs, 800 pmol of primers, 1 unit Pwo

DNA polymerase and 5 units of Taq DNA polymerase (Roche Molecular Biochemicals) (Barnes,

1994) was used to amplify 1 µL of template DNA with the primers and PCR reaction conditions listed in Table 2-2 (Hoy and Jeyaprakash, 2005). The fungal large ribosomal subunit (LSU) gene was amplified from DNA extracted from fungi grown on NA plates using the fungal LSU

primers and conditions shown in Table 2-2. The degenerate actin gene primers MHO105

(forward: 5’-TGGGAYGAYATGGARATHTGGCAYCA-3’) and MHO99 (reverse: 5’-

GCCATYTCYTGYTCRAARTC-3’), where Y = C or T, R = A or G, and H = A or C or T) designed by Hoy et al. (2000) were used to amplify genomic DNA from D. citri and from D. aligarhensis with an annealing temperature of 47°C following bleach treatment. Species-specific high-fidelity PCR was conducted using the primers listed in Table 2-5. Three linked profiles were used for the high-fidelity PCR that included (i) 1 cycle of denaturation at 94°C for 2 min;

(ii) 10 cycles of denaturation at 94°C for 10 s, annealing at 50°C for 30 s, and elongation at 68°C for 1 min; and (iii) 25 cycles of denaturation at 94°C for 10 s, annealing at 55°C for 30 s, and extension at 68°C for 1 min plus an additional 20 s for each consecutive cycle (Hoy et al., 2001).

Agarose gel electrophoresis (1% TAE gels) was used to separate PCR-amplified DNA, which was stained with ethidium bromide and visualized with ultraviolet light.

Cloning and Restriction Fragment Length Polymorphism Analysis

PCR products were purified with the QIAquick PCR Purification Kit (QIAGEN, Valencia,

CA), ligated into the pCR2.1 TOPO plasmid (Invitrogen, Carlsbad, CA), and cloned using competent E. coli cells (Bioline USA, Inc, Randolph, MA). Plasmid DNA was extracted from cultures of randomly-picked E. coli colonies using QIAGEN Plasmid Mini columns (Valencia,

CA). The presence and size of the inserted DNA was confirmed by gel electrophoresis of plasmids following digestion with EcoRI for 2 h at 37°C. RsaI digests were used for the restriction fragment length polymorphism (RFLP) analyses (Jeyaprakash et al., 2003). Clones with inserts yielding unique RFLP's were bidirectionally sequenced at the University of Florida

Interdisciplinary Core Facility, Gainesville, FL.

Phylogenetic Analysis

DNA sequences obtained were used in a BLAST search to identify related DNA sequences in GenBank using the default settings. Retrieved sequences were aligned with CLUSTAL X v.

1.83 (Thompson et al., 1997), and manual adjustments of the alignment were conducted using

MacClade 4.0 (Madison and Madison, 2000). The outgroup taxon was the gram + bacterium

Bacillus subtilis. Maximum likelihood (ML) and maximum parsimony (MP) analyses were conducted using heuristic searches implemented in PAUP* 4.0b4a (Swofford, 2001). For ML, the data matrix was subjected to the MODELTEST 3.7 program (Posada and Crandall, 1998) to select the best-fit nucleotide substitution model for the alignment. The substitution rate-matrix parameters and shape parameter (alpha) were estimated via ML. The bootstrap method (100 replicates) was used to support each branch in the ML tree in PAUP*.

Antibiotic Treatment and Detection of Wolbachia in D. aligarhensis

Mixtures of tetracycline hydrochloride (Sigma Chemical Co., St Louis, MO) (Stouthamer

et al., 1990) and pure clover honey were smeared on small strips of Kimwipes (Kimberly-Clark,

Roswell GA) and provided to adult females of D. aligarhensis held in 50-mL centrifuge tubes at

70-75% RH, 24-25°C with a 16L:8D photoperiod. A preliminary toxicity test was conducted to determine the effect of a series of tetracycline concentrations (0-50 mg tetracycline/mL + honey,

10 parasitoids/ treatment) on the longevity of adult females. The parasitoids were observed feeding on each of the honey + tetracycline mixtures and on the honey-only control. After 3

days, only 30% of the females that fed on 50 mg/mL honey + tetracycline were alive, while

100% of the insects were alive in the control. This indicated that the high doses of tetracycline

(20-50 mg/mL) had a negative effect on survival in D. aligarhensis. After 7 days, 80% of D.

aligarhensis that fed on 10 mg/mL tetracycline + honey were alive, which was the same

percentage of insects that survived in the control.

It is laborious to produce large numbers of D. aligarhensis in the laboratory because each

female produces only a few progeny (Skelley and Hoy, 2004). Humid and crowded rearing

conditions also result in fungal growth that causes mortality to D. citri nymphs parasitized by D.

aligarhensis. Attempts to monitor individual antibiotic-treated females on single potted plants

were not successful due to lack of air flow in mesh-covered plants that resulted in fungal growth,

so the following alternative strategy was adopted.

Tetracycline was used to attempt to eliminate the Wolbachia infection in D. aligarhensis,

as follows. A total of 50 newly-emerged female D. aligarhensis were aspirated from the

greenhouse colony and treated with tetracycline (10 mg/mL + honey) for 24 h as described

above. The treated parasitoids were then released into a cage that was kept separate from the untreated colony of D. aligarhenisis and that held citrus trees infested with second- and third-

instar D. citri nymphs. This procedure was conducted for three consecutive generations and new

trees infested with D. citri nymphs were added to the cage when the treated adult female D. aligarhensis were released. Not all of the second- or third-generation females were treated with tetracycline, but they were allowed to remain in the cage. After the adults emerged from the third generation, what appeared to be male D. aligarhensis were observed and they were collected for the following molecular and morphological studies.

DNA was isolated from three individual female and male wasps and used in the PCR protocol described above to detect the wsp gene of Wolbachia. A portion of the mitochondrial cytochrome c oxidase I gene (COI) was PCR-amplified using the primers CI-J1632 (5’-

TGATCAAATTTATAAT- 3’) and CI-N-2191 (5’-GGTAAAATTAAAATATAAACTTC- 3’)

(Kambhampati and Smith, 1995) with an annealing temperature of 45°C to control for DNA template quality. The COI amplification products were cloned and sequenced, as described above, to confirm that the male and female parasitoids were the same species.

Female and male D. aligarhensis were placed on a slide and submerged in 95% EtOH or slide-mounted in Euparal mounting medium (BioQuip, Rancho Domingez, CA) before they were

photographed using the Auto-Montage Pro system using software ver. 5.02 (Synoptics,

Frederick, MD).

Results and Discussion

Surface Sterilization

Adult psyllids from the laboratory colony had fungi growing on their external surfaces, primarily on their abdominal region (Figure 2-1 A). The external-inhabiting fungi of D. citri

from the laboratory colony were cultured on NA plates. A portion of the fungal LSU gene was

PCR amplified using template DNA extracted from the fungi grown on NA plates and cloned.

The clones were analyzed with the RFLP technique, as follows. After RsaI digest, two unique

banding patterns were detected among the 10 clones that were selected, and these clones were

sequenced. The two obtained sequences were used in a BLAST search to identify the fungi. The

first sequence was 856 bp and produced significant alignments to the LSU gene of multiple

Ascomycete species in the genus Penicillium. Fungi in this genus are associated with citrus and

can cause citrus green mold, a damaging post-harvest disease (Smilanick et al., 2006). The

second sequence was 857 bp and was 100% identical (857/857 bp) to a homologous region of the

LSU gene of the Ascomycete Cladosporium cladosporioides (GenBank accession DQ008145), the causal organism of Cercospora leaf spot in olives. Previously, a Cladosporium species was

reported as a pathogen of D. citri during periods of high RH (Aubert, 1987). Both of these

fungal species detected on D. citri from the laboratory colony likely are external contaminants

and not endosymbionts. The external fungi were used as indicators for the efficacy of the

surface-sterilization solutions tested for their ability to both kill fungi and eliminate external

fungal DNA from D. citri.

Adult D. citri from the laboratory colony were treated with the decontamination solutions

in Table 2-1 and then used to inoculate NA plates. No fungal growth was observed on the NA

plates following treatment of D. citri with bleach or bleach + Tween 20, whereas treatment with

the other solutions did not consistently kill the fungi. Following bleach treatment, a significant reduction of fungi was observed on the ovipositor of adult female D. citri when compared to untreated females (Figure 2-1 A, B). No PCR amplification products were obtained for the fungal LSU using template DNA isolated from D. citri treated with bleach and bleach + Tween

20 (Table 2-1) in the PCR, indicating that bleach treatment killed the external fungi, removed most of the cells, and eliminated or damaged the fungal DNA sufficiently so that it did not amplify in the PCR. PCR products were obtained for the fungal LSU using template DNA isolated from D. citri treated with all of the other decontamination solutions that were tested

(Table 2-1), providing evidence that these treatments were insufficient to eliminate the fungal

DNA.

The bleach and bleach + Tween 20 treatments did not interfere with downstream PCR amplification of endosymbiont or genomic DNA from adult or nymphs of D. citri. The actin gene of D. citri and the 16S rRNA gene of the mycetocyte symbiont and the wsp gene of

Wolbachia were amplifiable using template DNA isolated from the bleach-treated psyllids

(Table 2-3). Amplifcation of the actin and wsp genes from D. aligarhensis was also successful following bleach or bleach + Tween 20 treatments (Table 2-3).

Prior to evaluation of the surface sterilization methods, a survey of the eubacterial community in T. radiata was conducted using the “universal” primers for the 16S rRNA gene

(Table 2-2). The eubacterial 16S rRNA gene was amplified from DNA isolated from adult T. radiata that were not pre-treated with bleach, and the amplification products were cloned.

Twenty-five clones were randomly selected and used in RFLP analysis. Seven unique banding patterns were obtained following RsaI digest, and a clone representing each pattern was partially

sequenced. In BLAST searches, each sequence produced significant alignments to the 16S

rRNA gene of the following eubacterial species. The first sequence was 727 bp and was 99%

identical (724/727) to a Spiroplasma sp. (GenBank accession AM087471) from the ladybird

beetle Anisostica novemdecimpunctata (Coleoptera: Coccinellidae). The second sequence was

730 bp and was 100% identical (727/727 bp) to an Acinetobacter sp. (GenBank accession

DQ451095) and produced significant alignments to multiple other Acinetobacter species from a variety of environments. The third sequence was 676 bp and produced significant alignments (>

98% sequence identity) to multiple uncultured α-proteobacterial and Sphingomonas species. The

fourth sequence was 718 bp and produced significant alignments to multiple γ-proteobacterial species from soil and aquatic environments. This sequence was also 97% identical (661/679) to an uncultured γ-proteobacterial species (GenBank accession AB074648) from aposymbiotic

Acyrthosiphon pisum (pea aphids) [Hemiptera: Aphididae] lacking their primary symbiont

(Nakabachi et al., 2003). The fifth sequence was 663 bp and was 99% identical (661/663 bp) to

a Bacteroidetes symbiont from the predatory mite Metaseiulus occidentalis (Hoy and

Jeyaprakash, 2005). The sixth sequence was 707 bp and produced significant alignments to multiple α-proteobacterial species that were uncultured or cultured species in the genus

Caulobacter. The seventh sequence was 719 bp and was related to 16S rRNA sequences from multiple γ-proteobacterial species in the family Enterobacteriaceae. Although some of the 16S rRNA sequences were related to sequences from other endosymbiotic eubacterial species of

arthropods, the high number and diversity of species detected in non-surfaced sterilized T.

radiata was surprising and was believed to be due, at least in part, to external contamination.

Future research is needed to evaluate if bleach treatment removed DNA from contaminating

external bacteria on T. radiata, but, because bleach treatment eliminated external fungal DNA

from D. citri, the surface-sterilization method was adopted for the following molecular survey of

endosymbionts in D. citri and its two parasitoids.

High-Fidelity PCR Amplification of Symbionts in D. citri and its Parasitoids

Results from the high fidelity-PCR assays for the endosymbionts of surface-sterilized D.

citri, T. radiata and D. aligarhensis are summarized in Table 2-4. Amplification of the eubacterial 16S rRNA gene was detected using template DNA from each insect, but no

amplification products were detected in any of the insects using the primers for Archaea, Fungi,

Helicosporida, or Microsporidia. The orf7 gene from the bacteriophage WO of Wolbachia was

amplified using DNA from D. ctiri, but not from D. aligarhensis or T. radiata as the template.

Symbionts of D. citri

The eubacterial 16S rRNA PCR products were cloned from two replicate high-fidelity

PCR reactions, and a total of 15 clones were analyzed from each replicate using the RFLP

technique. Analysis using EcoRI digests indicated that all clones from each replicate had an

insert approximately 1.4-kb in length. Digests with RsaI resulted in two and three unique

banding patterns in the RFLP analysis according to replicate, respectively (Figure 2-2). A clone

representing each unique banding pattern in both replicates was sequenced (five total sequences).

Two pairs of these sequences were 100% identical between each replicate, respectively. These

comparisons indicated that there are at least three types of Eubacteria associated with our

laboratory colony of D. citri. The three 16S rRNA sequences obtained from D. citri were used in

a BLAST search to identify related sequences in GenBank.

The first sequence (1466 bp, GenBank accession EF433792) was 100% identical over a

1463-bp homologous region of the 16S rRNA gene of the syncytium symbiont of D. citri from

an Asian population (GenBank accession AB038368) (Subandiyah et al., 2000b), which is

related to β-proteobacteria species in the genera Oxalobacter and Herbaspirillum (Figure 2-5).

The second sequence was 1429 bp (GenBank accession EF433793) and produced significant alignments to the 16S rRNA gene of species in the α-proteobacterial family

Rickettsiaceae. This sequence was 99% identical (1177/1185 bp) to a 1185-bp homologous

region of a partial 16S rRNA gene sequence from the endosymbiont Wolbachia of D. citri from an Asian population (GenBank accession ABO38370) (Subandiyah et al., 2000b). Five of the eight nucleotide differences between the two Wolbachia sequences were attributed to errors

(bases designated “N”) in the deposited sequence, which could be due to the standard PCR reaction used by Subandiyah et al. (2000b) because this protocol does not include a proofreading enzyme.

The third sequence (1459 bp, GenBank accession EF450250) produced significant alignments to the 16S rRNA gene of a γ-proteobacterial species and was 99% identical to a homologous region of the 16S rRNA gene sequence from the mycetocyte symbiont, Candidatus

Carsonella rudii, of D. citri from an Asian population (GenBank accession AB038367)

(Subandiyah et al., 2000b).

Subandiyah et al. (2000b) reported two additional eubacterial symbionts, Ca. L. asiaticus and Arsenophonus, associated with an Asian population of D. citri. No clones containing sequences related to these symbionts were detected in this survey. The species-specific primers designed by Subandiyah et al. (2000b) to amplify the 16S rRNA gene from Ca. L. asiaticus and

Arsenophonus were tested on DNA isolated from the Florida population of D. citri. No positive

PCR reactions were detected for Ca. L. asiaticus indicating that our laboratory colony of D. citri is free of the citrus greening pathogen and confirming prior results of Hoy et al. (2001). The

PCR reactions using the Arsenophonus-specific primers produced inconsistent results, including

amplification products in the control which had no DNA template. Future research is needed to

develop improved Arsenophonus-specific primers that do not produce artifacts in the PCR to

investigate if this symbiont is associated with D. citri populations in Florida.

To determine if there are multiple Wolbachia strains in the Florida population of D. citri,

the Wolbachia wsp gene was amplified and 10 clones were sequenced. For each clone, an identical 539-bp sequence was obtained that was 100% identical to the wsp sequence previously

reported from the Florida population of D. citri (GenBank accession AF217721) (Jeyaprakash

and Hoy, 2000). These results suggest that only a single Wolbachia strain is present in our laboratory population of D. citri.

The putative capsid protein gene orf7 of the bacteriophage WO was PCR-amplified from

DNA extracted from adult D. citri. In a BLAST search, the 409-bp orf7 sequence (GenBank

accession EF444818) produced significant alignments to orf7 sequences of the bacteriophage

WO of Wolbachia from multiple sources, and it was 99% identical (405/499 bp) to two deposited

orf7 sequences associated with Wolbachia-infected Culex pipiens (GenBank accession

AY505105, AY505101). The orf7 gene has been found in most, but not all Wolbachia-infected arthropods (Masui et al., 2000; Fujii et al., 2004; Gavotte et al., 2004; Braquart-Varnier et al.,

2005; Hoy and Jeyaprakash, 2005). Masui et al. (2000) and Braquart-Varnier et al. (2005) found that 100% of the Wolbachia strains tested had bacteriophage WO. Gavotte et al. (2007) reported that 70% of the Wolbachia strains tested positive for bacteriophage WO, where the Wolbachia infecting multiple species of Trichogramma sp. (Hymenoptera: Trichogrammatidae) and the nematodes Dirofilaria immitis, Litosomoides sigmodontis, Setaria equine, and Brugia malayi

lacked bacteriophage WO. Phylogenetic comparisons of the bacteriophage WO and host

Wolbachia have suggested that the bacteriophage is horizontally transferred among different

lineages of Wolbachia by unknown mechanisms (Masui et al., 2000; Gavotte et al., 2004; 2007)

Diagnostic, species-specific PCR was conducted to determine the proportion of laboratory

and field-colected D. citri in the Florida population that were positive for each eubacterial

species and for the bacteriophage WO using the primers in Table 2-5. Amplification products of a portion of the 16S rRNA gene from the mycetocyte symbiont, syncytium symbiont, Wolbachia

and the bacteriophage WO of Wolbachia were detected in 100% of DNA samples extracted from adult D. citri from the laboratory colony (N=10: 5 females, 5 males) and from 100% of the DNA

isolated from psyllids collected from the field (N=10: 5 females, 5 males). Both the mycetocyte

and syncytium symbionts were detected in 100% of D. citri in an Asian population by

Subandiyah et al. (2000b). The percentage of Wolbachia (100%) in the Florida population was

higher than in the Asian population of D. citri (76%) (Subandiyah et al., 2000b). This could

reflect true differences in the endosymbiotic complex of D. citri, or could be related to the

increased sensitivity of the high-fidelity PCR assay used in this study compared to the standard

PCR protocol used by Subandiyah et al. (2000b). Hoy et al. (2001) reported that the high-

fidelity PCR assay was seven-fold more sensitive than standard PCR.

To determine the transmission mechanism of each symbiont, DNA isolated from D. citri

eggs was used in a high-fidelity, species-specific PCR reaction. The primary symbiont,

secondary symbiont, Wolbachia and the bacteriophage WO were detected both in samples that

were not surface sterilized with bleach and in samples that were bleach treated. This indicated

that the symbiont DNA was present inside the eggs (transovarial transmission). Maternally-

transmitted symbionts typically are obligatory to the host, such as in the case of Buchnera

species that provide nutrients to their aphid hosts (Moran and Degnan, 2006), or can manipulate

their hosts’ reproductive system to their advantage, as does Wolbachia in a variety of arthropods

(O’Neill et al., 1997).

Symbionts of T. radiata

Amplification products from the eubacterial 16S rRNA gene were cloned and sequenced from two replicate high-fidelity PCR reactions using DNA from surface-sterilized adult T. radiata, and a total of 15 clones were analyzed from each replicate using the RFLP technique.

Analysis using EcoRI digests indicated that all clones from each replicate had an insert approximately 1.4 kb in length. Digests with RsaI resulted in a total of two and three unique banding patterns in the RFLP analysis according to replicate, respectively (Figure 2-2). A clone representing each unique banding pattern in both replicates was sequenced (five total sequences).

Two pairs of these sequences were 100% identical between each replicate, respectively. These comparisons indicated that there are at least three types of Eubacteria associated with our laboratory colony of T. radiata.

The three 16S rRNA sequences obtained from T. radiata were used in a BLAST search to identify related sequences in GenBank. The first sequence (1409 bp, GenBank accession

EF433789) produced significant alignments to Caulobacter species of the α-proteobacterial family Caulobacteraceae. The sequence was 100% identical to the 16S rRNA gene sequence from Caulobacter sp. strain FWC41 (GenBank accession AJ227775) identified from activated sludge in a secondary treatment facility in Calgary, Alberta, Canada (Abraham et al., 1999). The sequence was also 100% identical to an uncultured eubacterial species (1283 bp, GenBank accession AY038618) from an “environmental sample”, as designated in GenBank. Other reports have associated Caulobacter species with the gut of arthropods, including a millipede

(Abraham et al., 1999), Acromyrmex leafcutter ants (Van Borm et al., 2002), and the mite

Tetranychus urticae (Koch) (Hoy and Jeyaprakash, 2005).

The second sequence (1410 bp, GenBank accession EF433790) produced significant alignments to Methylobacterium species of the α-proteobacterial family Methylobacteriaceae.

This sequence was 100% identical to homologous portions of the 16S rRNA gene sequence from

Methylobacterium lusitanum strain NCIMB 13779 (1435 bp, GenBank accession AB175635)

(Kato et al., 2005) and from a Methylobacterium sp. strain TNAU12 (1340 bp, GenBank

EF116590) reported from the phyllosphere of soybean. Species belonging to the genus

Methylobacterium have been reported in a wide variety of environments (Kato et al., 2005).

The third sequence (1457 bp: GenBank EF43379) produced significant alignments to the

16S rRNA gene sequence from β-proteobacterial species in the family Alcaligenaceae. This sequence was 99% identical to the homologous portion of the 16S rRNA gene sequence from an unidentified bacterium in the family Alcaligenaceae (1452/1454 bp) found on the epiphytic surfaces of rice (Hiraoka et al., 2006).

In the diagnostic PCR assay, using species-specific primers (Table 2-5), the Caulobacter,

Methylobacter and Alcaligenaceae species were detected in 70, 30 and 20% of the individual T. radiata collected from the laboratory colony (N=10), respectively, and 20, 0 and 0% of the field collected specimens (N=10), respectively. None of the species were detected in the bleach- treated eggs of T. radiata. It appears that the eubacterial species detected in T. radiata are likely acquired from the environment and are not transovarially transmitted. Despite the efforts to surface-sterilize the insects and to use newly emerged adult T. radiata prior to DNA extraction, it

is possible that these Eubacteria were acquired when adult T. radiata chewed a hole in the

dorsum of the mummified D. citri host that was contaminated. If so, these Eubacteria would be

protected from the bleach treatment in the gut of T. radiata, and likely are facultative or transient

associates.

Symbionts of D. aligarhensis

PCR amplification products for the eubacterial 16S rRNA gene were detected using template

DNA from two separate DNA extractions of D. aligarhensis. Ten clones from each replicate

were analyzed using the RFLP technique. All clones had an approximate 1.4-kb insert as

indicated by digestion with EcoRI. RsaI digests resulted in a single banding pattern for all 10

clones in both replicates (Figure 2-2), and a single clone from each replicate was sequenced.

Both sequences were 1429 bp and 100% identical, indicating that only one eubacterial species is

associated with the laboratory colony of D. aligarhensis.

A BLAST search was conducted using this sequence (GenBank accession EF433794) that

produced significant alignments to multiple Wolbachia species in the α-proteobacterial family

Rickettsiaceae. This sequence was different than the 16S rRNA sequence from Wolbachia

obtained from the Florida population of D. citri (GenBank accession EF433793), and a sequence

alignment indicated the sequences were 99% identical (1416/1429 bp). The different Wolbachia

infections in D. citri and D. aligarhensis indicated that horizontal transfer of Wolbachia did not

likely occur between these species.

To determine if D. aligarhensis had multiple strains of Wolbachia, the wsp gene was PCR-

amplified and the amplification products were cloned. Ten clones were sequenced and the

sequences were 100% identical in size (542 bp) and nucleotide composition to the wsp gene

previously reported in our laboratory population of D. aligarhensis (Jeyaprakash and Hoy,

2000). This suggested that only a single strain of Wolbachia was present in the parasitoid. The wsp gene sequences of Wolbachia from D. citri and D. aligarhensis were different, and these data supported the differences found in the 16S rRNA gene sequences of these Wolbachia strains. Although the sequences are different, the two Wolbachia strains are classified in the same “Super-Group B” of Wolbachia (Jeyaprakash and Hoy, 2000).

Amplification products for the wsp gene of Wolbachia were detected in 100% of DNA

samples extracted from adult female D. aligarhensis from our laboratory colony (N=10). No

field-collected specimens were available for analysis because the parasitoid is rare in Florida.

No eggs were sampled to confirm the transmission of Wolbachia in the eggs of D. aligarhensis,

due to difficulties obtaining eggs from the endoparasitoid, which deposits them inside D. citri nymphs. However, it is speculated that Wolbachia is transmitted inside the egg of D. aligarhensis, based on the results from this study regarding Wolbachia transmission in D. citri and on other reports demonstrating such a transmission mechanism (Kose and Karr, 1995).

No PCR amplification products were obtained for the orf7 gene of the bacteriophage WO of Wolbachia using D. aligarhensis DNA as the template. This was in contrast to the presence of the bacteriophage WO in D. citri and indicated that the Wolbachia species in D. aligarhensis

either does not have bacteriophage WO or that the sequence representing the orf7 gene is not

amplifiable with the primers used in this survey.

Antibiotic Treatment of D. aligarhensis

After three generations of treating thelytokous female D. aligarhensis with tetracycline (10 mg/mL + honey), adult male D. aligarhensis were observed in the laboratory colony and approximately 60 males were collected. There were distinct morphological differences between

female and male D. aligarhensis (Figure 2-3 A, D). The male abdomen was small and black, but

the female abdomen was larger and was yellowish and black. Structural differences were also

apparent between both the genitalia and antennae of female and male D. aligarhensis (Figure 2-3

B, C, E, F). A description of male D. aligarhensis in an arrhenotokous population from Asia was

provided by Shafee et al. (1975) but only included a drawing of the male antennae. The

illustration was similar to the antennal morphology observed in male D. aligarhensis produced

following tetracycline treatment of the thelytokous laboratory colony in Florida.

A high-fidelity PCR assay was conducted to test female and male D. aligarhensis for the

wsp gene of Wolbachia. Amplification of a 0.6-kb portion of the wsp gene was detected in all

female D. aligarhensis (N=3) but not in any males (N=3) (Figure 2-4). PCR products for the

mitochondrial COI gene were observed in all samples indicating that the template DNA in each

sample was adequate for the PCR. No amplification products were detected in the negative

control (no-DNA) for both the wsp and COI genes, as expected.

The PCR amplification products for the COI gene from female and male D. aligarhensis

were cloned and a single clone produced from each sex was sequenced. The sequences from

both female and male D. aligarhensis were 552 bp (GenBank accession EF431956), and these

sequences were 100% identical. This confirmed that the males were the same species as the

females treated with tetracycline and that another parasitoid had not unexpectedly invaded the

laboratory colony.

No eubacterial symbionts other than Wolbachia were detected in the 16S rRNA gene

survey, and the elimination of Wolbachia correlated with the production of a male phenotype in

D. aligarhensis. These molecular data support the hypothesis that Wolbachia is the causal agent

of thelytokous reproduction in our laboratory colony of D. aligarhensis. However, there is a

possibility that the level of Wolbachia infection in male D. aligarhensis was below the

sensitivity of our high-fidelity PCR assay, which detects as few as 100 copies of the target

template 100% of the time and as few as 10 copies 50% of the time (Hoy et al., 2001). If so, the

reduced titer of Wolbachia would then be correlated with the sex determination mechanism in D.

aligarhensis. In addition, it cannot be excluded that there are other eubacterial species in D.

aligarhensis that were not detected in the survey because the amount of this microbial DNA was below the sensitivity of our PCR assay.

This appears to be the first report of Wolbachia-correlated thelytoky in the genus

Diaphorencyrtus. Antibiotic and heat treatment of Wolbachia-infected parasitoids have resulted in the production of males in multiple thelytokous species of Trichogramma (Hymenoptera:

Trichogrammidae) (Stouthamer et al., 1990; Pintureau et al., 1999), Telenomus nawai Ashmead

(Hymenoptera: Scelionidae) (Arakaki et al., 2000), Galeopsomyia fausta LaSalle (Hymenoptera:

Eulophidae) (Argov et al., 2000), Eretmocerus mundus Mercet (Hymenoptera: Aphelinidae) (De

Barro and Hart, 2001), Encarsia formosa Gahan (Stouthamer and Mak, 2002), E. meritoria

Gahan, and E. protransvena Viggiani (Hymenoptera: Aphelinidae) (Giorgini, 2001).

Reproductive anomalies can result due to ancient Wolbachia infections, so mating studies are important to determine if males function normally by examining their sperm production, monitoring their ability to copulate and inseminate females, and also to confirm that the female’s eggs are fertilized and result in the production of a bisexual line (Arakaki et al., 2000; De Barro and Hart, 2001). Males in populations of G. fausta have been rendered non-functional due to

Wolbachia infection (Argov et al., 2000). Alternatively, male production has resulted in the production of stable cured sexual lines in Trichogramma species (Grenier et al., 2002). Removal of Wolbachia in Asobara tabida Nees (Hymenoptera: Braconidae) resulted in an inhibition of oocyte production and no reproduction (Dedeine et al., 2001).

When male and female D. aligarhensis were observed together in a 50-mL centrifuge tube, the insects exhibited mating behavior. First the male faced the female, then moved behind and climbed on top of the female and finally the male attempted to copulate by bending its abdomen to contact the abdominal region of the female. Males were observed attempting to mate with multiple females. Further studies are needed to determine if males produce viable sperm, transfer sperm to the female during mating, and to determine if a bisexual line can be produced.

If so, the performance of the bisexual line could be compared to that of the thelytokous line for their ability to control D. citri.

Phylogenetic Analysis

The eubacterial 16S rRNA gene sequences obtained from D. citri, T. radiata and D. aligarhensis were used for phylogenetic analyses. The GTR + G nucleotide substitution model

(Yang et al., 1994) was selected by MODELTEST for the data matrix and used for maximum likelihood (ML) analysis. The topologies of the ML and maximum parsimony (MP) trees were similar, and each method grouped the taxa according to their expected classification within the gram-negative Eubacteria and separated them from the outgroup taxon, Bacillus subtilis, a gram- positive eubacterium. Figure 2-5 depicts the tree constructed by ML analysis. Three major clades were produced that included taxa belonging to the α-, β-, and γ-proteobacteria, respectively, and the separation of each major eubacterial division was strongly supported by the bootstrap method. The mycetocyte symbiont of D. citri (Florida) was grouped in the γ- proteobacteria in a clade including the mycetocyte symbiont from D. citri (Asia) and with the primary symbiont of Cacopsylla brunneipennis (Edwards) [Hemiptera: Psyllidae]. The syncytium symbiont of D. citri (Florida) was grouped in the β-proteobacteria with the syncytium symbiont of D. citri (Asia) and related Eubacteria in the genera Oxalobacter and Herbaspillium.

These findings were consistent with the phylogenetic analysis conducted by Subandiyah et al.

(2000b). Wolbachia of D. citri (Florida) was grouped in the α-proteobacteria in a clade consisting of three Wolbachia species from D. citri (Asia), D. aligarhensis and Culex pipiens

Linnaeus [Diptera: Culicidae], respectively. The Caulobacter and Methylobacter symbionts of

T. radiata were clustered with other species in the α-proteobacteria, and the bacterium in the family Alcaligenaceae was grouped with the β-proteobacteria. Separation in the clades including

the eubacterial symbionts of D. citri, T. radiata, and D. aligarhensis was strongly supported by the bootstrap method.

Potential Pitfalls

Conducting molecular surveys of microbes associated with insects requires careful investigation and has certain limitations that need to be addressed. The microbes identified in this study were only detected with the PCR and were not isolated in pure culture. Obligate endosymbionts associated with insects often are not amenable to traditional culturing methods because of their unique environmental requirements (Darby and Welburn, 2006). The eubacterial species were not located inside the insects using in situ hybridization (or other equivalent techniques). However, the bleach treatment prior to DNA extraction should have eliminated DNA from any external contaminants, indicating that the eubacterial species detected in D. citri and its parasitoids were inside these insects.

The “universal” primers used in the PCR to amplify microbial DNA may not amplify all microbial sequences in a particular taxonomic group and the unavailability of PCR primers for other taxa could result in an underestimation of the total microbial diversity. There also may be other microbes associated with wild populations of D. citri and its parasitoids in Florida that were not identified in this survey. The titer of the microbial DNA may influence the PCR. For example, microbial DNA sequences that are very low in titer may not compete with abundant microbial DNA sequences or could be below the sensitivity of the high-fidelity PCR assay (Hoy et al., 2001). The random selection of clones and analysis of clones containing different sequences that yield identical RFLP profiles could also contribute to an underestimation of the total diversity present. Screening of additional clones and using multiple restriction enzymes in the RFLP analysis could be used to address these issues; however, the methods used here were

adequate because the microbial communities in D. citri and its two parasitoids are relatively

simple.

Attributing a phenotype in the host to the presence of an endosymbiont requires careful

consideration and a satisfaction of Koch’s postulates (Koch, 1891). Male production in D.

aligarhensis following antibiotic treatment correlates with the elimination of Wolbachia.

However, it is possible that other microbes, that have gone undetected using the current PCR

technology, may be influencing reproduction in D. aligarhensis. Previously, Johanowicz and

Hoy (1998) suggested that Wolbachia, which was detected using a standard PCR assay,

influenced the non-reciprocal reproductive incompatibility in the predatory mite Metaseiulus

occidentalis (Nesbitt), but later Hoy and Jeyaprakash (2005) used a high-fidelity PCR assay and

found additional eubacterial species related to Cardinium, Bacteroidetes and Enterobacter that

also may influence reproduction in the mite. In this case, it is reasonable to attribute the

thelytokous phenotype to infection with Wolbachia considering that no other microbes were

detected in the parasitoid using the high-fidelity PCR assay.

Conclusions

Bleach treatment both killed the surface-inhabiting fungi and eliminated the DNA from

these fungi associated with D. citri, whereas the other solutions that were evaluated failed to do

so consistently. Surface sterilization is important because an overestimation of the total

microbial biota could occur if DNA from surface-inhabiting microbes was included in the

molecular survey of endosymbionts. Bleach treatment did not inhibit downstream PCR analysis

of endosymbionts in D. citri, T. radiata or D. aligarhensis. The endosymbiotic communities in the Florida population of D. citri and its parasitoids are relatively simple; a total of three eubacterial species each were detected in D. citri and T. radiata and only one species was

detected in D. aligarhensis. None of the eubacterial 16S rRNA sequences obtained from these

insects were identical when compared between species, indicating that horizontal transfer of these microorganisms likely has not occurred in this host-parasitoid system. Furthermore, the bacteriophage WO of Wolbachia was found in D. citri but not in D. aligarhensis, providing further evidence against the occurrence of horizontal transfer. Importantly, the HLB-causing pathogen was not detected in the laboratory or field-collected D. citri in this study, whereas Ca.

L. asiaticus was reported by Subandiyah et al. (2000b) in an Asian population of D. citri.

Wolbachia infection is correlated with thelytokous reproduction in D. aligarhensis, as demonstrated by male production following tetracycline treatment of parental females.

Table 2-1. Two methods to evaluate if surface decontamination solutions both kill external fungi and eliminate their DNA from a laboratory colony of adult D. citri. Following treatment with each decontamination solution, adult D. citri were used to inoculate nutrient agar (NA) plates that were monitored for fungal growth. To determine if treatment with the decontamination solutions was effective in eliminating the external fungal DNA, the PCR was used to amplify the fungal 28S rRNA gene (large ribosomal subunit: LSU) using template DNA extracted from treated adult D. citri. Decontamination Solution Fungi1

Growth on NA PCR: LSU

Acetone (>99% %) + +

Acetone + Tween 20 (0.1 %) + +

Bleach: 5 % solution (stock: 6% sodium hypochlorite) - -

Bleach + Tween 20 - -

DNA Away (Molecular BioProducts, San Diego, CA) + +

DNA Away + Tween 20 + +

DNA lysis buffer (Gentra Systems, Minneapolis, MN) + +

DNA lysis buffer + Tween 20 + +

Ethanol (100%) + +

Ethanol + Tween 20 + +

Tween 20 + +

Water (control) + +

1Fungi: Two species of fungi were identified using molecular methods (Penicillium sp. and Cladosporium sp.).

Table 2-2. Primer sequences used in initial survey of microorganisms associated with D. citri, T. radiata, and D. aligarhensis. Microorgansim (primer name) Forward Primer Annealing Expected PCR (Reference) Reverse Primer Temperature product size (bp) °C Archaea (Arch 21F, Arch 958R) 5’-TTCCGGTTGATCCYGCCGGA-3’ 51 1000 (DeLong, 1992) 5’-YCCGGCGTTGAMTCCAATT-3’

Eubacteria: 16S rRNA (27f and 1495r) 5’-GAGAGTTTGATCCTGGCTCAG-3’ 55 1400 (Weisburg et al., 1991) 5’-CTACGGCTACCTTGTTACGA-3’

Fungal LSU primers (LS1, LR5) 5’-AGTACCCGCTGAACTTAAG-3’ 55 1000 (Hausner et al., 1993; Rehner and Samuels, 5’-CCTGAGGGAAACTTCG-3’ 1995; Zhang et al., 2003) Helicosporidia (ms-5, ms-3) 5’-GCGGCATGCTTAACACATGCAAGTCG-3’ 65 1300 (Nedelcu, 2001) 5’-GCTGACTGGCGATTACTATCGATTCC-3’

55 Microsporidia (Mic-F, Mic-R) 5’-CACCAGGTTGATTCTGCCTGACGTAGACGC-3’ 65 1240 (Becnel et al., 2002) 5’-GATCCTGCTAATGGTTCTCCAACAGCAACC-3’

WO phage (phgWOF, phgWOR) 5’-CCCACATGAGCCAATGACGTCTG-3’ 65 400 (Masui et al., 2000) 5’-CGTTCGCTCTGCAAGTAACTCCATTAAAAC-3’

Yeast-like organism (NS1, FS2) 5’-GTAGTCATATGCTTGTCTC-3’ 55 1500 (Nikoh and Fukatsu, 2000) 5’-TAGGNATTCCTCGTTGAAGA-3’

Table 2-3. Results from high-fidelity PCR amplification of genomic DNA and endosymbiont DNA from D. citri (adults and nymphs) and from the parasitoid D. aligarhensis, following bleach treatment. Species (N=3) Actin Wolbachia (wsp) Mycetocyte endosymbiont 16S rRNA

D. citri (adult) + + +

D. citri (nymph) + + +

D. aligarhensis + + NA

Table 2-4. Summary of the high-fidelity PCR results for the survey of microbial endosymbionts in D. citri and its two parasitoids. Endosymbiont Species

D. citri D. aligarhensis T. radiata

Archaea - - -

Eubacteria + + +

Fungi - - -

Helicosporidia - - -

Microsporidia - - -

Yeast - - -

Wolbachia (wsp) + + -

Bacteriophage WO + - -

Table 2-5. Species-specific forward and reverse primers used to detect eubacterial sequences in DNA isolated from D. citri, T. radiata, and D. aligarhensis. Insect species Forward primer sequence Target gene Expected PCR product size Bacterium Reverse primer sequence (bp) (Reference) D. citri 5’-GTGCCAGCAGCCGCGGTAATAC-3’ 16S rRNA 547 Syncytium symbiont 5’-CACCTGTGTTTAGATTCTTT-3’ (Subandiyah et al., 2000b)

D. citri 5’-TGGTCCAATAAGTGATGAAGAAAC-3 wspA 600 Wolbachia 5’-AAAAATTAAACGCTACTCCA-3 (Braig et al., 1998)

D. citri 5’-GTGCCAGCAGCCGCGGTAATAC-3’ 16S rRNA 560 Mycetocyte symbiont 5’-CACCTGTCTCAAAGCTAAAG-3’ (Subandiyah et al., 2000b)

D. citri 5’-GTGCCAGCAGCCGCGGTAATAC-3’ 16S rRNA 534 Ca. L. asiaticus 5’-CACCTGTGTAAAGGTCTCCG-3’ 58 (Subandiyah et al., 2000b)

D. citri 5’-GTGCCAGCAGCCGCGGTAATAC-3’ 16S rRNA 533 Arsenophonus 5’-CACCTGTCTCAGCGCTCCCG-3' (Subandiyah et al., 2000b)

Table 2-5. (continued). T. radiata 5’-CTGGACCGCCACAGAGAT-3’ 16S rRNA 437 Caulobacter 5’-CCTTCGGGTAAAGCCAACTC-3’ (Meyer and Hoy, unpublished)

T. radiata 5’-GAGATCCAGGGTCCTCTTCG-3’ 16S rRNA 423 Methylobacter 5’-CCGTCGGGTAAGACCAACT-3’ (Meyer and Hoy, unpublished)

T. radiata 5’-ATGTCTGGAATGCCGAAGAG-3’ 16S rRNA 489 Unknown β-proteobacterium 5’-CCCAGTCATGAATCCTACCG-3’ (Meyer and Hoy, unpublished)

D. aligarhensis 5’-TGGTCCAATAAGTGATGAAGAAAC-3’ wspA 600 Wolbachia 5’-AAAAATTAAACGCTACTCCA-3’ (Braig et al., 1998)

Figure 2-1. SEM of the ovipositor of an adult female D. citri from a laboratory colony. (A) untreated female, showing abundant fungal growth; (B) bleach-treated female, showing removal of most of the fungal growth. Scale: (A) 0.1 μm; (B) 0.2 μm.

Figure 2-2. Representative results of RFLP analysis using RsaI digestion of plasmid DNA containing inserts (approximately 1.4 kb) of the eubacterial 16S rRNA gene amplified from DNA isolated from D. citri and its two parasitoids. Lane 1: M = DNA marker; Lane: (2-4) Dc = Diaphorina citri; (5-7) Tr = Tamarixia radiata; (8) Da = Diaphorencyrtus aligarhensis. Lane (2-8) Syncytium symbiont, Wolbachia, Mycetocyte symbiont, Caulobacter sp., Methylobacter sp., Alcaligenaceae sp., Wolbachia, respectively.

Figure 2-3. Adult female compared to a male D. aligarhensis produced by tetracycline treatment. (A) Adult female; (B) Antenna: adult female; (C) Terminal abdominal segment: adult female (ventral view); (D) Adult male; (E) Antenna: adult male; (F) Terminal abdominal segment: adult male (dorsal view). Scale: (A, D) 0.25 mm; (B, C, E, F) 0.1 mm.

Figure 2-4. PCR amplification of the wsp gene of Wolbachia and the mitochondrial cytochrome c oxidase I (COI) gene from DNA isolated from female and male D. aligarhensis. Wolbachia appears to be missing in males of D. aligarhensis produced by tetracycline treatment of their mothers, indicating that Wolbachia causes thelytoky in this population. (Top) wsp gene of Wolbachia; (Bottom) mitochondrial COI gene. Lane: (M) DNA size Marker (Hyperladder II); (2-4) individual females of D. aligarhensis; (5-7) individual males of D. aligarhensis; (8) no-DNA control.

Figure 2-5. Phylogenetic tree generated by maximum likelihood analysis using 16S rRNA sequences from Eubacteria identified from D. citri, T. radiata, and D. aligarhensis compared to related sequences deposited in GenBank. The outgroup taxon is Bacillus subtilis (gram +) and the numbers at branch points of the tree designate bootstrap values. The ingroup taxa are clustered in the α, β, and γ divisions of the proteobacteria.

CHAPTER 3 LOW INCIDENCE OF Candidatus Liberibacter asiaticus IN Diaphorina citri POPULATIONS BETWEEN NOVEMBER 2005 AND JANUARY 2006: RELEVANCE TO MANAGEMENT OF CITRUS GREENING DISEASE IN FLORIDA

Scientific Note

Citrus greening disease or Huanglongbing (HLB) is caused by the gram-negative bacterium Candidatus Liberibacter asiaticus (Ca. L. asiaticus) (Garnier et al., 2000) and was confirmed in southern Florida in 2005 (Halbert, 2005; Bouffard, 2006). This disease is vectored by Diaphorina citri Kuwayama (Hemiptera: Psyllidae), which colonized the citrus-growing regions of Florida after it was discovered in 1998 (Halbert, 1998a, b; Knapp et al., 1998; Halbert et al., 2000). Diaphorina citri acquires the greening bacterium while feeding on infected phloem

(Hung et al., 2004). HLB ultimately is fatal to susceptible citrus trees, so early detection and removal of infected trees is important for disease management. Unfortunately, citrus trees often are asymptomatic for years before the common signs of HLB, including yellowing and mottling of leaf veins and misshapen green-colored fruit, are noticeable (da Graça, 1991). Current chemical and biological controls reduce D. citri populations (Rae et al., 1997; Hoy et al., 1999;

Hoy and Nguyen, 2000; Michaud, 2004; Browning et al., 2006), but may not be sufficient to eliminate all HLB transmission.

It will be important to understand the epidemiology of HLB to control the spread of this disease. The regions of Florida with citrus showing symptoms of HLB currently are being mapped (http://www.doacs.state.fl.us/pi/chrp/greening/maps/cgsit_map.pdf). However, little is known about infection rates and transmission frequency of HLB by the psyllid vector. We surveyed the vector, D. citri, for the greening bacterium in eleven citrus-growing counties in

Florida (Table 3-1). In most of the counties sampled, citrus trees did not show signs of HLB infection, so we anticipated a low incidence of the greening bacterium (perhaps < 1-2%) in these

psyllid populations. However, we hypothesized that if citrus trees had acquired HLB recently

and did not show disease symptoms, HLB could still be spread in these regions and detected in vector populations by molecular analyses.

Adult psyllids collected in this survey were killed in 95% ethanol in the field and placed on ice during transit to the Department of Entomology and Nematology at the University of Florida,

Gainesville FL. Adult and immature D. citri were separated, counted and stored in fresh 95% ethanol or acetone at –80°C (Fukatsu, 2005). Tools used to separate insect specimens were washed with bleach, which degrades DNA, to avoid cross-contamination between samples. A maximum of ten D. citri were pooled for DNA isolation using PUREGENE reagents according

to the manufacturer’s instructions (Gentra Systems, Minneapolis, MN). DNA pellets were re-

suspended in 50 µL of sterile water or TE buffer and stored at -80°C. High-fidelity PCR was

used to analyze each sample for the 16S rRNA (Subandiyah et al., 2000b) and nusG-rplK

(Villechanoux et al., 1993; Hoy et al., 2001) gene sequences of Ca. L. asiaticus, which would

yield DNA bands 0.5 kb and 0.6 kb in length, respectively. The samples also were screened for a

0.6-kb portion of the wsp gene of Wolbachia (Braig et al., 1998), an endosymbiotic bacterium

found in D. citri (Subandiyah et al., 2000b), to control for DNA quality.

A positive control was obtained from Vernon Damsteegt at the USDA-ARS quarantine

facility in Beltsville, MD, where adult D. citri fed on citrus trees positive for HLB. A total of

three DNA extractions from these adult D. citri, including two extractions from single adults and

one extraction from 10 pooled adults, was conducted by Micki Kuhlmann using the methods

described above. The DNA was shipped from Beltsville, MD to the University of Florida and

used in a high-fidelity PCR assay. Amplification products were detected in each of the three

samples using primers for the nusG-rplK gene of Ca. L. asiaticus and for the wsp gene of

Wolbachia.

To quantify the sensitivity of our high-fidelity PCR assay, a dilution series of plasmid

DNA containing the nusG-rplK gene of Ca. L. asiaticus, mixed with DNA from adult D. citri from a laboratory colony that previously had tested negative Ca. L. asiaticus, was amplified with

high-fidelity PCR (Figure 3-1). As little as 1 fg of the target template could be detected 100% of

the time, which is approximately equivalent to 100 copies of the nusG-rplK gene sequence

(Figure 3-1), while as few as 10 copies could be detected 50% of the time (Hoy et al., 2001).

Control reactions containing no DNA were negative for the 16S rRNA and nusG-rplK genes of

Ca. L. asiaticus and for the wsp gene for Wolbachia, as expected.

A total of 1,793 adult and 179 immature D. citri was collected from 23 sites in 11 counties

between Sept. 2005 and Jan. 2006 (Table 3-1). All field-collected D. citri tested negative for Ca.

L. asiaticus (< 1 in 1,972 psyllids surveyed = <0.05% infection frequency). All samples were

positive for Wolbachia in the PCR assays, which indicates that the DNA extractions and PCR

protocols were working for these samples of microbial DNA mixed with D. citri genomic DNA

(Table 3-1). The amount of Ca. L. asiaticus DNA in our field-collected D. citri was either below

the sensitivity of the high-fidelity PCR assay (which reliably detects 100 DNA copies and can

detect as few as 10 copies), or the psyllids were truly negative for the HLB-causing bacterium.

The failure to obtain any positives for Ca. L. asiaticus was surprising, particularly for the site in

Hendry County (26°20.307’°N: 80°54.597’°W) where 486 adult D. citri were collected from

flushing citrus trees with symptoms of HLB. However, the psyllids were aggregating on these

trees to mate and oviposit on the tender flush, so they may not have acquired Ca. L. asiaticus

before they were collected or the greening bacterium had not multiplied sufficiently in the host to facilitate detection.

The results from this study can be used as a benchmark for the infection status of D. citri in these sites in Florida during 2005-2006. The absence of Ca. L. asiaticus in the psyllid populations surveyed could be due to the recent detection of HLB in Florida and because most psyllids were collected from trees that did not appear to have HLB. However, the lack of any

PCR positives in the 486 psyllids collected in Hendry county (Table 3-1) from trees with HLB symptoms was perplexing; with even a 1% infection frequency we would have expected positives in at least 4 psyllids. In Indonesia, where HLB is more prevalent, up to 45.2% of individual adult D. citri tested positive for Ca. L. asiaticus in a standard PCR assay (Subandiyah et al., 2000b), which is approximately 7-fold less sensitive than the high-fidelity PCR method used here (Hoy et al., 2001). However, in 1992 in India fewer than 1% of the D. citri tested were positive for Ca. L. asiaticus (Bové et al., 1993). The proportion of D. citri carrying Ca. L. asiaticus in Florida will likely increase if the titer and distribution of the pathogen increases in infected trees and the number of citrus trees with HLB multiplies.

The findings of this study raised a number of important questions concerning the epidemiology and management of HLB in Florida. For instance, how appropriate is it to attempt to kill every psyllid in citrus groves using chemical control if the infection frequency is less than

1%? The cost of widespread chemical control of psyllids and the potential disruption of biological control of other citrus pests needs to be considered. Other questions remain unanswered including: How long does it take psyllids to acquire and transmit Ca. L. asiaticus when feeding on infected citrus under Florida conditions? How many citrus trees can be infected by a single psyllid hosting Ca. L. asiaticus? How does the duration and level of infection in

HLB-positive trees affect disease acquisition and transmission by psyllids? Are there seasonal

factors that influence HLB transmission? What roles do other host plants, such as Murraya

paniculata (L.) Jack., play in HLB transmission? Are there other mechanisms that contribute to

the spread of HLB, such as mechanical transmission or native vectors? A more extensive effort

to survey psyllid populations for Ca. L. asiaticus is needed to better understand the epidemiology

of HLB. It is thought that destruction of HLB-positive citrus trees, along with suppression of D.

citri populations in infected citrus groves, will slow the spread of HLB (Stansly and Rogers,

2006). However, research is needed to determine which management tactics should have

priority in order to minimize the spread of HLB while maintaining existing biological control of

other economically-important citrus pests. Possibly, detecting and removing infected trees

should be considered a higher priority than attempting to kill all D. citri in citrus groves, due to the apparently low proportion of the vector population carrying Ca. L asiaticus.

Summary

Populations of D. citri in Florida citrus were surveyed between Sept. 2005 and Jan. 2006 for Ca. L. asiaticus, the causal agent of HLB. No field-collected adults or immatures of the

1,972 D. citri tested were positive for the HLB pathogen in these samples, indicating that the

proportion of D. citri populations hosting Ca. L. asiaticus in the regions sampled was very low

(< 0.05%) during this survey. More extensive surveys for Ca. L. asiaticus in D. citri are

recommended to learn more about the epidemiology of disease transmission in Florida.

Table 3-1. Collection data for D. citri and results of the high-fidelity PCR assay for Ca. L. asiaticus and the endosymbiont Wolbachia between September 2005 and January 2006. County °N °W No. adults tested1 No. nymphs tested1 Host2 Grove3 PCR: Ca. L. asiaticus PCR: Wolbachia

De Soto 27°13.877’ 81°53.990’ 56 0 G C - +

Glades 27°06.559’ 80°56.427’ 30 25 O A - +

Glades 27°00.372’ 81°03.003’ 10 12 G D - +

Hendry 26°44.256’ 81°10.490’ 5 0 O C - +

Hendry 26°46.322’ 81°12.654’ 61 0 G C - +

Hendry 26°33.898’ 81°26.202’ 0 38 G D - +

Hendry 26°44.423’ 81°28.029’ 90 0 G C - +

Hendry 26°20.307’ 80°54.597’ 486 0 O C - + 71 Highlands 27°24.781’ 81°24.714’ 48 39 O C - +

Highlands 27°09.201’ 81°19.877’ 22 27 G C - +

Indian River 27°40.953’ 80°27.621’ 48 0 G A - +

Lake 28°51.627’ 81°38.306’ 69 0 O C - +

Lake 28°23.967’ 81°41.768’ 52 0 O A - +

Lee 26°42.707’ 81°36.559’ 36 38 O D - +

Marion 28°59.204’ 81°55.267’ 41 0 G C - +

Pasco 28°19.505’ 82°11.240’ 116 0 O C - +

Polk 28°03.656’ 81°34.937’ 140 0 O C - +

Table 3-1. (continued) Polk 28°02.880’ 81°37.035’ 91 0 O C - +

Polk 27°52.542’ 81°34.654’ 70 0 O C - +

Polk 27°47.537’ 81°32.044’ 79 0 O C - +

Polk 28°06.295’ 81°42.895’ 197 0 G R - +

St. Lucie 27°32.976’ 80°25.852’ 40 0 G N - +

St. Lucie 27°23.360’ 80°28.376’ 6 0 O C - +

Total 1793 179

1A maximum of 10 specimens were pooled for each DNA extraction.

2 72 Host: O=Oranges, G=Grapefruit

3Grove: C=Commercial, A=Abandoned, D=Dooryard, R=Research Plot, N=Non-Commercial

Figure 3-1. Sensitivity analysis for high-fidelity PCR-amplification of plasmid DNA containing the nusG-rplK gene of Ca. L. asiaticus mixed with D. citri DNA. PCR-products were obtained with as little as 1 fg (approximately 100 copies) of the 0.6-kb amplification target.

CHAPTER 4 MORPHOLOGICAL AND MOLECULAR CHARACTERIZATION OF A Hirsutella SPECIES INFECTING THE ASIAN CITRUS PSYLLID IN FLORIDA

Introduction

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), vectors the

gram-negative bacterium Candidatus Liberibacter asiaticus, the causal agent of citrus greening

disease or Huanglongbing (HLB) (Garnier et al., 2000). Citrus trees infected with L. asiaticus

are often asymptomatic for years, but they ultimately show signs of disease, including yellowing

of leaf veins, leaf mottling, and misshapen and poor-tasting fruit before dying as a result of the

infection (da Graça, 1991). Diaphorina citri rapidly colonized all citrus-growing regions in

Florida after it was discovered in 1998 (Halbert, 1998a, b; Knapp et al., 1998; Halbert et al.,

2000). In 2005, citrus trees infected with HLB were found near Homestead, FL, and more

infected trees have since been detected in multiple counties (Halbert, 2005; Bouffard, 2006;

http://www.doacs.state.fl.us/pi/chrp/greening/maps/cgsit_map.pdf). Integrated pest management

tactics are needed to slow the spread of HLB to uninfected citrus groves and nurseries.

Currently, suppression of D. citri populations is achieved by chemical applications and

biological control (Rae et al., 1997; Browning et al., 2006). Foliar insecticides are most effective

when the density of D. citri is high, particularly during the early phase of each flush (tender new

growth) cycle (Browning et al., 2006; Stansly and Rogers, 2006). Natural enemies of D. citri in

Florida include native lady beetles, lacewings, spiders (Michaud, 2004) and the specialist parasitoid, Tamarixia radiata (Waterston) (Hymenoptera: Eulophidae), which was released in a classical biological control program (Hoy et al., 1999; Hoy and Nguyen, 2000; Skelley and Hoy,

2004).

Several species of entomopathogenic fungi, including Paecilomyces fumosoroseus (Wize)

A. H. S. Brown and G. Smith (Samson, 1974; Subandiyah et al., 2000a), Hirsutella citriformis

Speare (Rivero-Aragon and Grillo-Ravelo, 2000; Subandiyah et al., 2000a; Étienne et al., 2001),

Cephalosphorium lecanii Zimm (Verticillium lecanii) (Xie et al., 1988; Rivero-Aragon and

Grillo-Ravelo, 2000), Beauveria bassiana (Bals.) Vuill. (Rivero-Aragon and Grillo-Ravelo,

2000), Cladosporium sp. nr. oxysporum Berk. and M. A. Curtis (Aubert, 1987) and Capnodium

citri Berk. and Desm. (Aubert, 1987) have been found to infect D. citri worldwide. In most

cases, mycosed D. citri have been observed during periods of high relative humidity. In Florida,

Halbert and Manjunath (2004) noted the occurrence of an unidentified fungal pathogen that

attacked D. citri, but no information on the pathogen was provided. This research was initiated

following the field collection of mycosed D. citri between September 2005 and February 2006 in citrus groves in Florida. We report the morphology and biology of this fungal pathogen associated with D. citri populations in Florida.

Materials and Methods

Insect Colony

Diaphorina citri were reared according to a method modified from Skelley and Hoy

(2004). Small citrus trees, approximately 30-50 cm tall and grown in 15.2-cm diameter pots, were used to maintain D. citri in a greenhouse at 20-32°C with a 16L:8D photoperiod. Twenty trees were pruned each week, fertilized with Peter’s 20-20-20 (N-P-K) water-soluble fertilizer

(United Industries, St. Louis, MO), and watered as necessary. Approximately two weeks after pruning, the trees produced flush and were placed inside wooden-framed mesh cages (0.76 m x

0.91 m x 1.11 m) where adult D. citri females were allowed to oviposit. Upon emergence, adult

D. citri were aspirated and transferred to another cage to initiate the next generation.

Collection, Maintenance, and Cultivation of the D. citri Pathogen

Between September 2005 and February 2006, mycosed D. citri were collected at four sites

in three counties of Florida on orange and grapefruit trees (Hendry county: 26°20.307' N,

80°54.597' W; Marion county: 28°58.943' N, 81°51.098' W; Polk county: 28°03.656’ N,

81°34.937' W and 28°06.295’ N, 81°42.895' W). Mycosed psyllids were found during each trip

to the field, and they were collected once from Hendry county, twice from Marion county, and

four times from Polk county. The cadavers were transported to the laboratory, and the pathogen

collected in Polk county and Marion county was maintained by in vivo passage conducted at

weekly intervals, as follows. Ten to twenty healthy adult D. citri were collected from the

laboratory colony in a sterile 50-mL centrifuge tube and placed on ice for 10-15 min. The immobilized psyllids, held with fine-tipped forceps, were touched to conidial-bearing synnemata present on fresh cadavers of mycosed D. citri. Treated psyllids were placed individually in 50- mL centrifuge tubes containing a single mature citrus leaf with a water-soaked cotton ball placed under the cap to maintain a relative humidity (RH) of approximately 100% and held at 24-25°C with a 16L:8D photoperiod.

Cadavers of adult D. citri collected in Polk county and Marion county were used to initiate in vitro cultures. Single conidia were inoculated on 6-cm diameter plates containing quarter- strength Sabouraud dextrose agar + 1% yeast extract (SDAY). Sub-cultures of the pathogen were maintained by transferring a 1-cm square section from a 2- to 3-week-old culture to a fresh

SDAY plate. In order to produce sporulating cultures of the fungus, additional in vitro cultures were initiated by inoculating approximately 4 g of autoclaved boiled rice with mycelia produced on the SDAY plates (Sosa Gomez, 1991). Hemolymph samples from surface-sterilized infected

D. citri were harvested and used to inoculate TNM-FH insect tissue culture media (Sigma, St.

Louis, MO) + gentamycin (50 μg/mL) + 5% fetal calf serum to cultivate the hyphal body

phenotype. All in vitro cultures were maintained in a growth chamber at 26°C without light. A subculture of the fungus, initiated from an adult D. citri cadaver collected in Polk county, was deposited in the USDA-ARS Collection of Entomopathogenic Fungal Cultures (ARSEF 8315).

Microscopy

The fungus on the insect host was examined with a dissecting microscope and photographed using the Auto-Montage Pro system using software ver. 5.02 (Synoptics,

Frederick, MD). Hemolymph samples from infected adult D. citri were examined with differential interference contrast (DIC) microscopy at 360-1000x. For SEM, cadavers of

mycosed D. citri collected in Polk county were fixed in OsO4 vapors for 48 hr, dehydrated in an ethanol series, critical-point dried using a Bal-Tec 030 critical point dryer, sputter coated with

Au/Pt alloy and examined on a Hitachi 4000 FE-SEM operating at 4-6 kV (Quattlebaum and

Carner, 1980). Measurements of all digitally-captured subjects were made using SPOT software

3.4.3 (Diagnostic Instruments, Sterling Heights, MI).

Bioassays

Qualitative bioassays were conducted to test the infectivity of the D. citri pathogen against a laboratory colony of D. citri. Three replicates over time were conducted using adults, each

including 20 healthy D. citri that were exposed to mycosed psyllids as described above or not

treated (control). Third-instar nymphs were also assayed with the fungal pathogen. Tender flush

from sour orange trees was used to support nymphal development. Two replicates of ten D. citri nymphs were exposed to the mycosed adult psyllids or not treated (control). Mortality due to fungal pathogenesis was monitored daily in the bioassays, which were conducted at 25°C with a

16L:8D photoperiod. To test the effect of treatment on mean percentage mortality the data were subjected to a one-way analysis of variance with PROC GLM, and the least squares means were separated using a probability of a significant divergence of P < 0.05 (SAS Institute, 1996).

To determine if the pathogen requires a specific site to initiate infection, the head, thorax or abdomen of five adult D. citri was exposed to the synnemata on mycosed adult psyllids and held as described above. Five psyllids were not treated and maintained as the control. Ten adult

D. citri were exposed to the in vitro cultures propagated on rice or not treated (control) and held as described above.

Molecular Analyses

DNA was isolated from synnemata arising from D. citri cadavers and also from in vitro cultures initiated from the pathogen collected in Polk county and Marion county. Fungal tissue was homogenized and processed using PUREGENE reagents according to the manufacturer's instructions (Gentra Systems, Minneapolis, MN). DNA pellets were air dried for 30 min to remove any remaining EtOH, re-suspended in 25-50 μL sterile water and stored at -70°C. A high-fidelity polymerase chain reaction (PCR) was used to amplify the 18S small ribosomal subunit (SSU) with primers NS1 (5'-GTAGTCATATGCTTGTCTC-3') and FS2 (5'-

TAGGNATTCCTCGTTGAAGA-3') (Nikoh and Fukatsu, 2000), the 5' variable region of the

28S large ribosomal subunit (LSU) with primers LS1 (5'-AGTACCCGCTGAACTTAAG-3') and

LR5 (5'-CCTGAGGGAAACTTCG-3') (Hausner et al., 1993; Rehner and Samuels, 1995), and the ß-tubulin gene with degenerate primers betatubF (5'-TGGGCYAARGGYCACTACACYGA-

3') and betatubR (5'-TCAGTGAACTCCATCTCRTCCAT-3') (Tartar et al., 2002). The high fidelity PCR reaction (50 μL) included 50 mM Tris, pH 9.2, 16 mM ammonium sulfate, 1.75 mM MgCl2, 350 mM dNTPs, 800 pmol of primers, 1 unit Pwo DNA polymerase and 5 units of

Taq DNA Polymerase (Roche Molecular Biochemicals, Indianapolis, IN) (Barnes, 1994; Hoy et

al., 2001). The PCR cycling parameters included three linked temperature profiles: (i) 1 cycle

consisting of denaturation at 94°C for 2 min; (ii) 10 cycles each consisting of denaturation at

94°C for 10 s, annealing at 50°C for 30 s, and elongation at 68°C for 1 min; and (iii) 25 cycles,

each consisting of denaturation at 94°C for 10 s, annealing at 50°C for 30 s, and extension at

68°C for 1 min plus an additional 20 s for each consecutive cycle (Hoy and Jeyaprakash, 2005).

PCR products were separated on 1% agarose TAE gels, stained with ethidium bromide, and visualized with ultraviolet light. PCR products were purified using QIAquick PCR Purification

Kit (QIAGEN, Valencia, CA) and cloned into the pCR2.1 TOPO plasmid (Invitrogen, Carlsbad,

CA). Plasmid DNA was isolated from overnight cultures of randomly-picked E. coli colonies using QIAGEN Plasmid Mini columns (Valencia, CA), and the size of the inserts was confirmed with EcoRI digestion followed by gel electrophoresis. Three clones of each gene were bidirectionally sequenced using an ABI Prism DNA Sequencer at the Interdisciplinary Center for

Biotechnology Research Core Facility at the University of Florida, Gainesville, FL. DNA sequences were compared to those deposited in GenBank with BLAST (blastn) using the default settings. The deduced amino acid sequences of DNA sequences were obtained using the translate tool of the Expert Protein Analysis System (ExPASy) provided on the Proteomics

Server (Swiss Institute of Bioinformatics).

Phylogenetic Analysis

The LSU and ß-tubulin sequences from the D. citri pathogen were used for phylogenetic analysis. Sequences from seven Hirsutella species that had both the LSU and ß-tubulin genes available in GenBank were included in the analysis (Table 4-1). Beauveria bassiana, which belongs to the phylum Ascomycota, class Sordariomycetes, order Hypocreales and family

Clavicipitaceae, was used as the outgroup taxon in the analysis. The DNA sequences were aligned with CLUSTAL X v. 1.83 (Thompson et al., 1997), and the LSU and ß-tubulin sequences were combined according to species using MacClade 4.0 (Madison and Madison,

2000). The putative intron region of the ß-tubulin gene was removed from the data matrix for each taxon because the high degree of variability in that region prevented an acceptable DNA

sequence alignment. The final data matrix was composed of 1128 total characters (505 bp of

LSU, 623 bp of ß-tubulin). The incongruence length difference (ILD) test was used to measure incongruence between the LSU and ß-tubulin datasets (Farris et al., 1995). Maximum likelihood

(ML) and maximum parsimony (MP) analyses were conducted using heuristic searches implemented in PAUP* 4.0b4a. For ML, the MODELTEST 3.7 program (Posada and Crandall,

1998) was executed on the data matrix to select the best-fit nucleotide substitution model for the alignment. The substitution rate-matrix parameters and shape parameter (alpha) were estimated via ML. Support for each branch in the ML tree was generated by the bootstrap method (100 replicates) in PAUP*. For MP, the number of parsimony-informative characters, tree length, consistency index and retention index were obtained in PAUP*.

Isolate-Specific PCR

Isolate-specific PCR primers were designed based on the unique putative intron region of the ß-tubulin sequence of the Florida Hirsutella isolate from D. citri. The forward primer

(betatub_intF: 5'-GGCTTCCAGATCACCCACTC-3') was designed at the 5' portion of the ß- tubulin sequence (5'=position 71), and the reverse primer (betatub_intR: 5'-

TATCCACCTTCGTCAGCACA-3') was nested within the unique putative intron region

(5'=position 707) (Table 4-2). The specificity of the primers was tested on DNA isolated from in vivo and in vitro cultures of the Florida Hirsutella isolate from D. citri and on DNA samples from in vitro cultures of five related Hirsutella species (H. citriformis ARSEF 2346, H. guyana

ARSEF 878, H. homalodiscae, H. nodulosa ARSEF 5473, and H. thompsonii). A 1.0-kb portion of the ß-tubulin gene was amplified from each DNA sample using degenerate primers (see above) to control for template quality. PCR reactions (25 μL) included 5 units of Taq DNA polymerase, 1X PCR buffer (Bioline USA, Inc., Randolph, MA), 350 mM dNTPs, and 800 pmol of primers. Standard PCR cycling parameters included an initial denaturation at 94°C for 2 min,

followed by 35 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 30 s, and

extension at 68°C for 1 min. A final extension of 5 min at 68°C concluded the assay. PCR

products were analyzed by gel electrophoresis as described above.

Results

Collection, Maintenance and Cultivation of the D. citri Pathogen

Between September 2005 and February 2006, a total of 365 mycosed adult D. citri were collected from orange and grapefruit trees at four sites in central Florida. No mycosed D. citri

nymphs were detected during the field collection. Mycosed adult D. citri (Figure 4-1 A) were

attached to the undersurface of leaves, the stems of leaves, or on the undersurface of branches by

a brown-colored mycelial mat underlying the ventral portion of the head and thorax.

The pathogen was propagated in vivo by exposing healthy adult and immature psyllids to

the synnemata borne on the field-collected cadavers. One week post-inoculation at 24-25°C,

topically treated adult psyllids displayed changes in behavior. Disease symptoms included

trembling legs and antennae, wing flicking, reduced flight and a darkening of the cuticle on the

head and thoracic regions. After succumbing to the pathogen, adult D. citri had pale-white

hyphae emanating from the intersegmental regions of the legs, thorax, head, and from the tip of

the abdomen. This "early" phenotype was not observed in the field-collected cadavers.

Mycosed adult psyllids were situated in a feeding position with their head down and secured to

the leaf or side of the centrifuge tube by a mycelial mat. Synnemata were first observed

protruding from the head and abdomen of D. citri cadavers 14 and 16 days after inoculation,

respectively, when held at 24-25°C. The distal regions of the synnemata were covered with

small drops of mucus. Cadavers of D. citri remained infectious for at least 10 weeks in the

laboratory when held at 24-25°C in the centrifuge tube, but infectivity after 10 weeks was not

assessed. Mycosed immature D. citri (Figure 4-1 B) had white hyphae that emerged initially

from the intersegmental regions of the legs and then developed to cover the entire dorsal surface of the insect.

In vitro cultures propagated on SDAY media were slow growing at 26°C, with a diameter measuring 1.3 ± 0.1 (standard deviation) cm after 7 days, 2.3 ± 0.1 cm after 14 days, and 3.5 ±

0.1 cm after 21 days (N=3). These cultures appeared white to light-gray two weeks post- inoculation and did not sporulate during the five weeks that they were maintained. An in vitro culture grown on rice produced multiple synnemata on a single rice grain 6 weeks post- inoculation (Figure 4-2). The morphology and number of these synnemata was similar to the synnemata produced on a single adult D. citri.

Microscopy

A total of 9 ± 3 (mean ± standard deviation) synnemata were observed extending from the body of field-collected mycosed D. citri (N = 10). The synnemata, measuring 0.8 ± 0.6 mm in length (N = 90) and 50.0 ± 10.0 μm in diameter (N = 90), were simple or possessed short lateral branches (Figure 4-1 A). Monophiladic conidiogenous cells arose laterally and terminally from the distal portions of the synnemata (Fig 4-1 C-D). Conidiogenous cells measured 17.5 ± 1.9 µm in length (N = 16) and had an ellipsoid base with a diameter of 2.6 ± 0.5 µm that tapered to 0.6 ±

0.1 µm at the conidial apex (N = 15). Each phialide produced a single, smooth-walled, aseptate, fusiform or ellipsoidal conidium averaging 5.9 ± 0.8 µm (N = 17) in length and 2.6 ± 0.3 µm in diameter (N = 16) (Figure 4-1 C-D).

One week post-inoculation, microscopic examination of the hemolymph isolated from diseased adult D. citri revealed an abundance of septate hyphal bodies measuring 26.7 ± 6.2 µm long and 4.8 ± 0.4 µm in diameter (N = 20) (Figure 4-1 E). Observations using DIC microscopy

confirmed that the in vitro cell phenotype derived from hemolymph samples closely resembled the structure of the hyphal bodies isolated from the hemolymph of infected D. citri.

Bioassays

No sign of disease was observed in the control psyllids throughout the bioassays, and no mortality was observed in immature and adult psyllids exposed to the pathogen until days 5 and

6, respectively. The mean time after inoculation until death was 7.4 ± 0.7 (standard deviation) days in adults (N = 60) and 5.3 ± 0.6 days in immatures (N = 20) at 25°C and approximately

100% RH. After 6 days, there was 8.3% mortality in adult psyllids exposed to the pathogen, which was significantly greater than the 1.7% mortality in the controls (F = 8.0; df = 1, 4; P <

0.05). After 9 days, 100% mortality was observed in adult psyllids exposed to the pathogen, which was significantly greater than the 1.7% mortality in the controls (F = 3481; df = 1, 4; P <

0.0001).

Inoculations targeting specific tagma (head, thorax or abdomen) of adult D. citri all resulted in infections that caused mortality, while no mortality was observed in the controls. The adult D. citri exposed to synnemata produced in vitro on rice all succumbed to the pathogen between 9 and 10 days after they were inoculated at 25°C and approximately 100% RH. These psyllids exhibited the same behavioral symptoms of disease as previously described, and no mortality was observed in the controls.

There was 75% mortality in immature psyllids exposed to the pathogen after 5 days, which was significantly greater than the 5% mortality in the controls (F = 98; df = 1, 2; P = 0.01).

After 7 days, 100% mortality was observed in immature psyllids, which was significantly greater than the 5% mortality in the controls (F = 361; df = 1, 2; P = 0.003). The synnemata structure found commonly on adults formed on only one of the 20 immature D. citri exposed to the pathogen in the bioassays.

Molecular Analyses

DNA prepared from the synnemata of a D. citri cadaver collected in Polk county and from three asporogenous in vitro cultures was subjected to PCR amplification with gene-specific primers. The three in vitro cultures used in the analysis included two cultures initiated from mycosed adult D. citri from Polk county (propagated on SDAY media) and one culture initiated from hyphal bodies found in the hemolymph of infected adult D. citri inoculated by exposure to a cadaver from Polk county (grown in TNM-FH insect tissue culture media). Sequence data from the four DNA preparations were obtained for the SSU (1521 bp, GenBank accession

EF363708), LSU (896 bp, GenBank accession EF363707) and ß-tubulin (964 bp, GenBank accession EF363706) genes, and these sequences were 100% identical for each gene analyzed in each DNA preparation. This indicated that the in vitro isolates were identical to the isolate that infected D. citri. An additional ß-tubulin gene sequence was amplified from DNA extracted from an in vitro culture (grown on SDAY) initiated from a D. citri cadaver collected in Marion county. This sequence was 100% identical to the ß-tubulin sequence of the pathogen collected in

Polk county, which suggested that the same isolate was infecting D. citri at each location.

A BLAST search of the SSU, ß-tubulin, and LSU gene sequences produced significant alignments to these sequences from species in the phylum Ascomycota and class

Sordariomycetes. The most significant alignment for both the SSU and ß-tubulin genes was to sequences from Hirsutella citriformis Speare, in the order Hypocreales and family

Clavicipitaceae. The next most significant alignments for the SSU gene were to SSU sequences of various Paecilomyces and Cordyceps species, all classified in the Clavicipitaceae. The next most significant alignments for the ß-tubulin gene were to ß-tubulin sequences in the family

Chaetosphaeriales. The most significant alignments of the LSU gene were to LSU sequences from various Cordyceps species in the Clavicipitaceae.

The SSU sequence was 99% identical (1516/1521 bp) to the SSU sequence of Hirsutella citriformis isolated from D. citri in Indonesia (GenBank accession AB032476) (Subandiyah et al., 2000a). The LSU sequences were 97% identical to the available LSU sequences of the H. citriformis isolates ARSEF 532 (750/766 bp: GenBank accession AY518376) and ARSEF 2346

(585/600 bp: GenBank accession DQ075678), which were 100% identical to each other in the

600 bp available for comparison. There were no sequences available in GenBank for the SSU of

H. citriformis isolates ARSEF 532 or ARSEF 2346.

The most similar ß-tubulin gene sequence deposited in GenBank was a 915-bp sequence from H. citriformis isolate ARSEF 2346 (GenBank accession DQ079601). However, when these two sequences were aligned, the ß-tubulin sequence for the Florida Hirsutella isolate from D. citri was 57 nucleotides longer at the 5' end, and the H. citriformis sequence had an additional 6 nucleotides at the 3' end. The ß-tubulin sequences were 95% identical (508/534 bp) between bases 94-627 (bases 37-570 of the H. citriformis isolate ARSEF 2346) and 95% identical

(242/256 bp) between bases 709-964 (bases 654-909 of ARSEF 2346). These sequences were different between bases 58-93 (bases 1-36 of the H. citriformis isolate ARSEF 2346) and 628-

708 (bases 571-653 of the H. citriformis isolate ARSEF 2346). There were no sequences available in GenBank for the ß-tubulin gene of H. citriformis isolate ARSEF 532 or the H. citriformis isolate collected on D. citri in Indonesia (Subandiyah et al., 2000a).

The ß-tubulin gene sequence of the Florida Hirsutella isolate from D. citri is unique because it does not contain a stop codon within a putative intron, whereas all other available ß- tubulin sequences from Hirsutella isolates contain a stop codon in this region (Boucias et al.,

2007). The 5'-GTA and AG-3' eukaryotic consensus boundaries were detected at position 628 and 708 of the ß-tubulin sequences from the Florida Hirsutella isolate from D. citri and at 571-

653 of H. citriformis isolate ARSEF 2346, respectively, that flanked putative introns (Table 4-2).

The putative intron sequences of the Florida Hirsutella isolate from D. citri (81 bp) and H. citriformis (83 bp) are larger than the putative intron sequences of other Hirsutella species, which range from 53-59 bp (Boucias et al., 2007). When the putative introns and the unique sequences at the 5' region were removed from the ß-tubulin sequences of the Florida Hirsutella isolate from D. citri and from H. citriformis isolate ARSEF 2346, the deduced amino acid sequences were 99% identical (261/263 amino acids). However, it has not been demonstrated that the putative introns of the ß-tubulin mRNA are actually spliced out, so the intron-free deduced amino acid sequences may not reflect the actual amino acids of the ß-tubulin proteins in vivo.

Phylogenetic Analyses

The ß-tubulin and LSU DNA sequences from the D. citri pathogen, seven related

Hirsutella species, and the outgroup Beauveria bassiana were used to compile a data matrix for

ML and MP analysis (Table 4-1). The GTR + G nucleotide substitution model (Yang et al.,

1994) was selected by MODELTEST for the data matrix and used for ML analysis. The topologies of the ML and MP (154 parsimony-informative characters, tree length = 487, consistency index = 0.6920, retention index = 0.4643) trees were identical. The consensus tree shown in Figure 4-3 was rooted with the outgroup B. bassiana. However, the bootstrap method did not support separation of H. thompsonii from the outgroup. The remaining Hirsutella species were clustered in a monophyletic clade supported by the bootstrap method (66%) that consisted of two groups. Group I had five taxa including a clade that paired H. guyana and H. homalodiscae (bootstrap 100%), a second clade linking H. repens with H. kirchneri (bootstrap

99%), and a third clade including H. nodulosa. Group II consisted of a single clade linking H. citriformis isolate ARSEF 2346 with the Florida Hirsutella isolate from D. citri, and the pairing

was strongly supported by the bootstrap method (99%). The ILD test indicated that the data partitions for the intron-free ß-tubulin and LSU sequences were heterogeneous (P = 0.01), so the datasets were analyzed separately by MP. In these analyses, the clades that paired H. guyana with H. homalodiscae and the D. citri pathogen with H. citriformis remained as sister taxa, respectively, but rearrangements in the topology were observed for some of the other Hirsutella species, as was previously reported by Boucias et al. (2007).

Isolate-Specific PCR

PCR assays conducted using the isolate-specific PCR primers designed based on the ß- tubulin gene produced a 0.6-kb product with template DNA extracted from both in vivo and in vitro cultures of the Florida Hirsutella isolate from D. citri (Figure 4-4). No amplification products were detected in PCR assays that included DNA extracted from a healthy adult psyllid or DNA prepared from in vitro cultures of five other related Hirsutella isolates. However, amplification of a 1.0-kb portion of the ß-tubulin gene using degenerate primers was observed in all samples, demonstrating that each DNA template was adequate for the PCR and contained the

ß-tubulin gene sequence.

Discussion

This research resulted in the morphological and molecular characterization of a

Hirsutella isolate related to H. citriformis found infecting D. citri in Florida citrus groves during

2005 and 2006. The structure of the synnemata, philades, and conidia formed on mycosed D.

citri were similar to the characteristics of Hirsutella citriformis described on the brown

planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) (Brady, 1979). The

measurements of the conidia were also consistent with this description, but there were distinct

differences in length of the philades (30 - 40 μm) and diameter of the synnemata (200-300 μm)

produced on N. lugens (Brady, 1979) in comparison to those structures found on mycosed D.

citri (philade length = 17.5 ± 1.9 µm, synnemata diameter = 50.0 ± 10.0 μm). The ß-tubulin gene sequence of the Florida Hirsutella isolate from D. citri was novel and different from the ß- tubulin gene sequence from H. citriformis isolate ARSEF 2346. Boucias et al. (2007) also

reported that size and nucleotide differences were found in the putative intron region of the ß-

tubulin gene among other Hirsutella species. The isolate-specific PCR primers that were based

on the unique putative intron region of the ß-tubulin sequence distinguished the Florida

Hirsutella isolate from D. citri from five other related Hirsutella species, and will be useful to

identify the pathogen on D. citri cadavers in future studies addressing its frequency and

distribution. The molecular and morphological differences between the Florida Hirsutella isolate

from D. citri and H. citriformis seem sufficient to call it a novel species, and perhaps additional

genetic analyses will confirm this notion.

The origin of the Florida Hirsutella isolate from D. citri is unknown, but it may have

accompanied D. citri to Florida. This Hirsutella isolate is not the same as the Indonesian isolate

of H. citriformis from D. citri due to differences in the SSU sequence (Subandiyah et al., 2000a).

However, this pathogen could represent an as-of-yet unidentified Asian strain of H. citriformis.

Alternatively, an indigenous isolate of Hirsutella may have adapted to D. citri after it became established in Florida. Hirsutella citriformis was previously identified in Florida (Mains, 1951), and it is known to attack D. citri in Cuba and Guadeloupe (Rivero-Aragon and Grillo-Ravelo,

2000; Étienne et al., 2001) and a variety of other hemipteran insects including the leucaena

psyllid (Mains, 1951; Rombach and Roberts, 1987; Villacarlos and Robin, 1989; Sajap, 1993;

Hywel-Jones, 1997).

The studies of the pathogen-host interaction were made possible using cultures of the

pathogen maintained in the laboratory. Conidia produced in vivo and in vitro were pathogenic to

psyllids and produced a phenotype similar to that observed in field-collected cadavers, thus fulfilling Koch's postulates. We do not yet know if the pathogen overwhelmed D. citri during its vegetative stage, killed the psyllids with toxins, such as hirsutellins, hirsutides or hirsutatins (Liu et al., 1995; Mazet and Vey, 1995; Isaka et al., 2005; Lang et al., 2005), or used a combination of these effects. The susceptibility of immature psyllids to the pathogen was consistent with that reported by Étienne et al. (2001), in which immature D. citri were killed by H. citriformis in

Guadeloupe.

In the field, survival and transmission of this pathogen were likely enhanced by the production of synnemata, which emanated laterally from the cadavers near the ventral portion of the head and thorax and from the tip of the abdomen. The synnemata could provide a slow release of infectious conidia, because only a limited number of philades produced conidia simultaneously, while the vast majority of philades remained undifferentiated. The pathogen could have been protected from exposure to sunlight because the cadavers were usually found secured to the underside of citrus foliage. Similarly, cadavers of the sugarcane leafhopper killed by H. citriformis were found on the undersurface of sugarcane leaves (Singaravelu et al., 2003).

Further investigation addressing the transmission mechanisms of the pathogen is needed to characterize the spatial and temporal patterns of the pathogen-host interaction.

Additional research also is needed to evaluate the potential for using the Florida Hirsutella isolate from D. citri as part of an integrated pest management program to suppress D. citri populations. The fastidious nature of the fungal pathogen, coupled with the slow development of cultures in vitro, may limit the likelihood of developing it as a microbial insecticide. However, studies are needed to investigate additional culturing methods aimed at increasing sporulation of the pathogen in vitro and to develop and test a formulation of fragmented mycelia, as was

conducted with Hirsutella thompsonii to control citrus rust mite (McCoy et al., 1971). An augmentative biological control approach, in which live infected D. citri are released or mycosed psyllids are manually dispersed, might also be used to increase the prevalence of the pathogen in

D. citri populations in Florida, or elsewhere.

Table 4-1. Collection data and GenBank accessions for taxa used in phylogenetic analysis.

Taxon Collection data GenBank accession

Host Origin LSU ß-tubulin

B. bassiana Orthoptera: Gryllotalpidae Brazil DQ075680 DQ079603

H. citriformis Hemiptera: Delphacidae Indonesia DQ075678 DQ079601

H. guyana Hemiptera: Cicadellidae Philippines DQ075676 DQ079598

H. homalodiscae Hemiptera: Cicadellidae FL, USA DQ075674 DQ079600

H. kirchneri Acari: Eriophyidae UK AY518382.1 DQ079597

H. nodulosa Lepidoptera: Pyralidae MI, USA DQ075675 DQ079596

H. repens Hemiptera: Delphacidae Korea DQ075679 DQ079602

H. thompsonii Acari: Eriophyidae FL, USA DQ075673 DQ079595

Florida Hirsutella isolate from D. citri Hemiptera: Psyllidae FL, USA EF363707 EF363706

Table 4-2. Putative intron sequences for the Florida Hirsutella isolate from D. citri ARSEF 8315 (GenBank accession EF363706) and H. citriformis ARSEF 2346 (GenBank accession DQ079601). The 5'-GTA and AG-3' eukaryotic consensus boundaries are underlined at each end, and the putative stop codon in the H. citriformis ARSEF 2346 sequence is in boldface (sequence position number 584-586). The isolate-specific reverse PCR primer (reverse complement shown in boldface: sequence position number 688-707) was nested in the unique putative intron sequence of the Florida Hirsutella isolate from D. citri and used to discriminate it from five other Hirsutella species. Sequence position number Species Size (bp) ß-tubulin intron sequence

Florida Hirsutella 628 708

isolate from D.citri 81 GTACGTGCCGCGGGCCCCTCGAACCGGCCTCTCCATAGCCCCTCCGCTCCCCCTCGAGCCTGTGCTGACGAAGGTGGATAG

ARSEF 8315

571 653 H. citriformis ARSEF 83 GTACGTGACGCCATGATGGCTCGAGGCCGTCGCCTCCCATTGCCCCCTTGCTCGAGCTCCTACTGACGATGGCCCACCCACAG

92 2346

Figure 4-1. Light and electron micrographs of the Florida isolate of Hirsutella from D. citri. A) synnemata borne on mycosed adult D. citri; (B) deceased immature D. citri bearing fungal hyphae; (C) apex of synnemata showing mononematious philades; (D) high magnification of the philade and conidia; (E) septate hyphal body isolated from hemolymph of infected adult D. citri. Scale: (A) 0.5 mm; (B) 0.4 mm; (C) 15.0 µm; (D) 3.0 µm; (E) 5.0 µm.

Figure 4-2. In vitro culture of the Florida Hirsutella isolate from D. citri on rice. Six weeks post-inoculation, synnemata (arrows) were produced on a single grain of rice that were infective to healthy adult D. citri from a laboratory colony. Scale: 2.0 mm

Figure 4-3. Consensus phylogenetic tree using ML and MP for the Florida Hirsutella isolate from D. citri and related fungal species.

Figure 4-4. Isolate-specific PCR using primers based on the unique, putative ß-tubulin intron sequence of the Florida Hirsutella isolate from D. citri. (Top) A 0.6-kb PCR product was obtained using template DNA extracted from both in vivo and in vitro cultures of the Florida Hirsutella isolate from D. citri, but no amplification products were detected using template DNA from other Hirsutella species. (Bottom) A 1.0-kb portion of the ß-tubulin gene was amplified from each DNA sample to control for template quality. Lanes: (1) DNA marker; (2-3) Florida Hirsutella isolate from D. citri (in vitro culture and in vivo culture, respectively); (4) adult D. citri (control); (5) H. citriformis ARSEF 2346; (6) H. guyana ARSEF 878; (7) H. nodulosa ARSEF 5473; (8) H. thompsonii; (9); H. homalodiscae; (10) no DNA template (control).

CHAPTER 5 ISOLATION AND CHARACTERIZATION OF A NOVEL STRAIN OF Paecilomyces fumosoroseus INFECTING THE ASIAN CITRUS PSYLLID

Introduction

The Asian citrus psyllid, Diaphorina citri Kuwayama, was discovered in Florida in 1998 and apparently arrived without its natural enemies (Halbert, 1998a, b; Knapp et al., 1998; Halbert

et al., 2000). Control of D. citri is important because this phloem-feeding pest vectors

Candidatus Liberibacter asiacticus (Ca. L. asiaticus), the bacterium that causes citrus greening disease or Huanglongbing (HLB) (Garnier et al., 2000). HLB was discovered in Florida in 2005 and poses a serious threat to the citrus industry because Ca. L. asiaticus infections cause fruit damage and ultimately kill citrus trees (Halbert, 2005; Bouffard, 2006).

Management of D. citri to limit the spread of HLB will require a multi-tactic program.

Petroleum oil and foliar and systemic insecticides are currently recommended to reduce D. citri populations (Rae et al., 1997; Browning et al., 2006; Rogers and Timmer, 2007), but will not likely eliminate disease transmission. Other control agents include native predators (Michaud,

2004) and the exotic parasitoid Tamarixia radiata Waterston (Hymenoptera: Eulophidae)

(Waterston, 1922; Hoy et al., 1999; Hoy and Nguyen, 2000). The maintenance of clean nursery stocks and removal of HLB-infected citrus trees are cultural measures used to retard the spread of HLB. Widespread use of chemical insecticides may result in the development of resistant psyllid populations and could negatively affect existing biological control agents in citrus that suppress populations of mites, scales, whiteflies, mealybugs, aphids, and the citrus leafminer.

Therefore, new approaches to control D. citri that are compatible with natural enemies in

Florida’s citrus groves, such as the use of microbial pathogens, are desirable.

Fungal pathogens of D. citri have been reported previously in Florida, including a novel isolate closely related to Hirsutella citriformis Speare (Meyer et al., in press) and “unidentified

fungi” (Halbert and Manjunath, 2004). Diverse species of pathogenic fungi are reported to

attack D. citri worldwide, including Paecilomyces fumosoroseus (Wize) A. H. S. Brown and G.

Smith (Samson, 1974; Subandiyah et al., 2000a), Hirsutella citriformis Speare (Rivero-Aragon

and Grillo-Ravelo, 2000; Subandiyah et al., 2000a; Étienne et al., 2001), Cephalosphorium

lecanii Zimm (Verticillium lecanii) (Xie et al., 1988; Rivero-Aragon and Grillo-Ravelo, 2000),

Beauveria bassiana (Bals.) Vuill. (Rivero-Aragon and Grillo-Ravelo, 2000), Cladosporium sp.

nr. oxysporum Berk. and M. A. Curtis (Aubert, 1987) and Capnodium citri Berk. and Desm.

(Aubert, 1987).

The objectives of this study were to identify and characterize a fungal pathogen that killed

adult D. ctiri in Florida citrus groves during September and October 2005. Morphological and

molecular data were used to identify the pathogen designated as Paecilomyces fumosoroseus from the Asian citrus psyllid (Pfr AsCP), and the interaction between the pathogen and D. citri was investigated using infective conidia produced on dead psyllids and in vitro. Pfr AsCP was distinguished from a related pathogen collected in Florida by comparing their growth characteristics in vitro and with amplified fragment length polymorphism (AFLP) analysis. The potential use of this pathogen as a microbial insecticide to suppress D. citri populations in

Florida is discussed.

Materials and Methods

Insect Cultures

A laboratory colony of D. citri was maintained according to Skelley and Hoy (2004) in a greenhouse at 20-32°C with a 16L:8D photoperiod. Adult D. citri were allowed to oviposit on the tender new growth (flush) produced by small potted orange trees held in mesh cages (0.8 m x

0.9 m x 1.1 m). Upon emergence, adult D. citri were collected to initiate another generation.

Collection and Cultivation of Pfr AsCP

Mycosed D. citri were collected from the underside of foliage on orange trees in Polk

County, FL (28°06’295’’ N, 81°42’895’’ W) on two field trips during September and October

2005. The cadavers were placed into sterile 50-mL centrifuge tubes (USA Scientific, Ocala, Fl) and held at 4°C during transit to the Entomology and Nematology Department at the University of Florida, Gainesville, FL.

Initially, 20 healthy adult D. citri from the laboratory colony were either exposed to the field-collected cadavers or not exposed (control) to test if the infection could be initiated in the laboratory according to the following procedure. Adult D. citri were collected from the laboratory colony in a sterile 50-mL centrifuge tube and placed on ice for 10-15 min. The immobilized psyllids, held with fine-tipped forceps, were touched to the conidia present on cadavers of mycosed D. citri. Inoculated insects were held in a sterile 50-mL centrifuge tube containing a single mature orange leaf and a water-soaked cotton ball to maintain approximately

100% relative humidity (RH). The inoculated psyllids were held in a growth chamber at 24-

25°C with a 16L:8D photoperiod. Once the culture was established, fresh cadavers produced in the laboratory were used to inoculate 10-20 psyllids each week to maintain the culture. To determine if Pfr AsCP requires a specific site to initiate infection, the head, thorax or abdomen of five adult D. citri was exposed to mycosed adult D. citri and held as described above. As a control, five psyllids were not treated and held under the identical conditions as the treated psyllids. A qualitative assay was conducted to determine if Pfr AsCP is specific to D. citri or has a broad host range. Laboratory-produced cadavers of adult D. citri bearing conidia were grasped with a fine-tipped forceps and the arthropods listed in Table 5-1 were touched or not touched

(controls) with the mycosed psyllid. Mortality due to fungal pathogenesis was recorded for each

arthropod species one week after incubation at 24-25°C and 70-100% RH with a 16L:8D photoperiod.

Conidia isolated from field-collected D. citri cadavers were inoculated onto 6-cm plates

containing quarter-strength Sabouraud dextrose agar + 1% yeast extract (SDY) to culture the

pathogen in vitro. A Florida isolate of P. fumosoroseus, Pfr 97, was supplied by Dr. L. Osborne

and maintained on psyllids and in vitro by the methods described above. Pfr 97 was originally

collected from Phenacoccus sp. (Hemiptera: Pseudococcidae) in Apopka, FL and subsequently commercialized as the microbial insecticide Pre-FeRal PFR-97 (W. R. Grace and Co., Columbia

MD; Thermo Trilogy/Biobest N.V., Belgium) (Vidal et al., 1998; Faria and Wraight, 2001). In

vitro cultures were maintained in a growth chamber at 26°C without light, and the conidia were

harvested two weeks after inoculation as follows: fungal hyphae and conidia were scraped from

the plates with a sterilized spatula and suspended in 10 mL of sterile water. The suspension was

filtered through Miracloth (Calbiochem, EMD Biosciences Inc., La Jolla, CA) and conidial

concentrations were determined using a hemocytometer.

Qualitative assays were conducted to determine if the in vitro cultures were infective to D.

citri. Twenty adults were grasped with a fine-tipped forceps and touched or not touched

(control) directly to the surface of sporulating cultures of Pfr AsCP and Pfr 97 grown on quarter-

strength SDY media and held according to the method used to maintain cultures of the pathogen

on the psyllid host. Mortality in the direct contact assays was recorded three days after

treatment. Sterile water (control) or suspensions of conidia (1 X 107 conidia/mL) from Pfr AsCP

and Pfr 97 grown on quarter-strength SDY media were applied to 20 adults, nymphs, and eggs of

D. citri with a glass reagent sprayer (Analtech, Newark, DE) at a rate of approximately 100uL/

psyllid. Mortality in the spray-treatment assays was recorded one week after treatment.

100

The in vitro growth rate and conidia yield of Pfr AsCP and of Pfr 97 were compared one week after inoculation on quarter-strength SDY and malt extract agar (MEA) media. Two replicates each consisting of 6 quarter-strength SDY and MEA plates (6 cm) were spot- inoculated with a 5 μL water-suspension of 4.5 x 105 conidia of Pfr AsCP or Pfr 97 and held at

26°C without light to compare fungal growth rates. Conidial yield from each fungus was assessed by inoculating two replicates each consisting of 6 quarter-strength SDY and MEA plates (6 cm) with 100 μL of a 4.5 x 107 conidia/mL suspension, and the conidia were harvested and counted after one week, as described above. To test the effect of media on mean growth

(diameter) and mean conidia yield for Pfr AsCP and Pfr 97, the data were subjected to a one-way analysis of variance with PROC GLM, and the least squares means were separated using a probability of a significant divergence of P < 0.05 (SAS Institute, 1996).

Microscopy

Mycosed D. citri were photographed using a dissecting microscope and the Auto-Montage

Pro system using software ver. 5.02 (Synoptics, Frederick, MD). Two-week old D. citri cadavers were fixed in OsO4 vapors for 48 hr and prepared for scanning electron microscopy

(SEM) (Quattlebaum and Carner, 1980). Digital images of mycosed adult D. citri were captured using a Hitachi 4000 FE-SEM operating at 4-6 kV. Differential interference contrast (DIC) microscopy (360-1000X) was used to analyze the hemolymph of infected adult D. citri and mature conidia isolated from in vitro cultures of Pfr AsCP. SPOT software 3.4.3 (Diagnostic

Instruments, Sterling Heights, MI) was used to measure structures of psyllid pathogen captured digitally by SEM and DIC microscopy. Transparent tape-mounts of sporulating cultures of Pfr

AsCP and Pfr 97 grown on quarter-strength SDY media were stained with acid fuchsin and examined under a light microscope at 400X to examine the structural characteristics of the fungi

(Koneman and Roberts, 1985). SPOT software 3.4.3 (Diagnostic Instruments, Sterling Heights,

101

MI) was used to measure structures of Pfr AsCP captured digitally by SEM and DIC microscopy.

Molecular Analyses

DNA was isolated from individual mycosed adult D. citri and from one-week-old cultures of Pfr AsCP and Pfr 97, grown on 6-cm plates containing quarter-strength SDY media, using

PUREGENE reagents (Gentra Systems, Minneapolis, MN) according to the instructions provided by the manufacturer. A portion of the 18S small ribosomal subunit (SSU), the 5’ variable region of the 28S large ribosomal subunit (LSU), and the ß-tubulin gene were amplified using a high-fidelity polymerase chain reaction (PCR) (Barnes, 1994). The SSU was amplified with primers NS1 (5'-GTAGTCATATGCTTGTCTC-3') and FS2 (5'-

TAGGNATTCCTCGTTGAAGA-3') (Nikoh and Fukatsu, 2000), and the LSU was amplified with primers LS1 (5'-AGTACCCGCTGAACTTAAG-3') and LR5 (5'-

CCTGAGGGAAACTTCG-3') (Hausner et al., 1993; Rehner and Samuels, 1995). Degenerate primers, betatubF (5'-TGGGCYAARGGYCACTACACYGA-3') and betatubR (5'-

TCAGTGAACTCCATCTCRTCCAT-3'), were used to amplify the ß-tubulin gene (Tartar et al.,

2002). The high-fidelity PCR reactions (50 μl) contained 50 mM Tris, pH 9.2, 16 mM ammonium sulfate, 1.75 mM MgCl2, 350 mM dNTPs, 800 pmol of primers, 1 unit Pwo DNA polymerase and 5 units of Taq DNA polymerase (Roche Molecular Biochemicals) (Hoy and

Jeyaprakash, 2005). The PCR cycling parameters included three linked temperature profiles: (i)

1 cycle consisting of denaturation at 94°C for 2 min; (ii) 10 cycles each consisting of denaturation at 94°C for 10 s, annealing at 50°C for 30 s, and elongation at 68°C for 1 min; and

(iii) 25 cycles, each consisting of denaturation at 94°C for 10 s, annealing at 50°C for 30 s, and extension at 68°C for 1 min plus an additional 20 s for each consecutive cycle (Hoy and

Jeyaprakash, 2005). PCR products were electrophoresed on 1% agarose TAE gels containing

102

ethidium bromide and then observed under ultraviolet light. The QIAquick PCR Purification Kit

(QIAGEN, Valencia, CA) was used to purify PCR products before cloning into the pCR2.1

TOPO vector (Invitrogen, Carlsbad, CA). Plasmid DNA was isolated from randomly-selected E.

coli colonies with QIAGEN Plasmid Mini columns (Valencia, CA). Clones were sequenced

with an ABI Prism DNA Sequencer and compared to those deposited in GenBank using BLAST

(blastn) with the default settings.

DNA fingerprints of Pfr AsCP and Pfr 97 were produced using amplified fragment length

polymorphism (AFLP) analysis, using the methods of Boucias et al. (2000) with the primers

shown in Table 5-2. A negative control was included for each primer that contained all of the

reagents for the AFLP procedure but did not have any DNA to ensure that no PCR artifacts

confounded the analysis. Amplified DNA was electrophoresed as described above, and DNA

size markers (HyperLadder III and IV, Bioline USA Inc., Randolph, MA) were used to estimate

the relative sizes of the amplification products. Amplification products > 0.2 kb and < 2.5 kb

were scored for each fungus in the AFLP analysis.

Three polymorphic bands, amplified only from DNA isolated from Pfr AsCP, were

excised from the gel and homogenized with a sterile blunt-ended pipette tip in 50 μl of sterile

water. A 10-μl aliquot of the homogenate was used in a re-amplification reaction using the same

AFLP primer and reaction conditions that produced each polymorphism. Re-amplified PCR

products were cloned and sequenced as described above. Isolate-specific PCR primers were

designed based on each polymorphism sequence with the Primer3 program

(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) (Table 5-3). The forward primers

included the EcoRI specificity site at the ends of each polymorphism sequence, and the reverse

primers were nested in the middle portion of each sequence. Primers designated with an “A” or

103

“B” were designed to include the EcoRI specificity site at the 5’ or 3’ end of the sequence, respectively. The annealing temperature was optimized for each psyllid pathogen-specific PCR primer pair using the temperature gradient feature of the MyCycler thermal cycler (BIO-RAD,

Hercules, CA). The PCR reactions (25 μl) included 2.5 units of Taq DNA polymerase and 1X stock PCR buffer (Bioline USA, Inc, Randolph, MA), 350 mM dNTPs, and 800 pmol of primers.

The PCR cycling parameters included an initial denaturation at 94°C for 2 min followed by 35 cycles of denaturation at 94°C for 30 s, primer annealing at the optimized temperature for each primer pair for 30 s, and extension at 68°C for 1 min. A final extension at 68°C for 5 min concluded the reaction.

The specificity of each psyllid pathogen-specific PCR primer pair was tested in a standard

PCR assay using DNA isolated from in vitro cultures of Pfr AsCP and Pfr 97 and from psyllids killed by Pfr AsCP and Pfr 97. The samples from psyllids killed by each pathogen included two replicates each consisting of dead individual adults and nymphs. As a control for DNA template quality, a 0.9-1.0 kb portion of the ß-tubulin gene was amplified from each DNA sample, and a negative control (no DNA) was included for each isolate-specific primer pair tested. PCR products were analyzed by gel electrophoresis as described above.

Results

Collection and Cultivation of Pfr AsCP

During September and October 2005, a total of six mycosed adult D. citri were collected from the undersurface of foliage on citrus trees in Polk county, FL. These dead psyllids were in a feeding position with their head down and were lightly attached to the foliage by fungal mycelia. The dorsal surface of the field-collected cadavers was extensively covered with fungal growth. This fungal pathogen was not observed on any nymphs or eggs of D. citri in the field, although a quantitative survey was not conducted.

104

In the laboratory, healthy adult psyllids were exposed to the field-collected cadavers to attempt to transmit the infection. These psyllids displayed disease symptoms, including twitching of legs and antennae, two-three days after they were exposed to the field-collected cadavers. After 72 hr at 24-25°C and approximately 100% RH, 100% of the adult D. citri from the laboratory colony exposed to the field-collected cadavers died, but no mortality was observed in the control psyllids. The dead adult psyllids were lightly fastened to the leaf or side of the centrifuge tube by white fungal mycelia. Immediately prior to death, infected psyllids had fungal hyphae emerging from the tarsi and intersegmental regions of the legs. No fungal cells were observed in the hemolymph of adult D. citri that exhibited disease symptoms before death

(N=10), which was approximately 64-72 h after the psyllids were exposed to the pathogen at 24-

25°C and approximately 100% RH. Infections initiated by exposing adult psyllids to the pathogen at their heads, abdomens or legs all resulted in 100% mortality, and no mortality due to fungal pathogenesis was observed in the control psyllids. One week post-mortem at 24-25°C and approximately 100% RH, nearly the entire external surface of adult D. citri was covered by

the fungus (Figure 5-1 A). The fungal pathogen appeared light gray, dry and powdery after it

sporulated on the dead insect, which was similar to the phenotype of diseased psyllids collected

in the field.

In qualitative assays, 84-100% mortality was recorded for 8 other arthropods that were

exposed to Pfr AsCP on cadavers of adult D. citri. Additional citrus pests, including the brown

citrus aphid, citrus leafminer and the citrus red mite, were susceptible to Pfr AsCP under

laboratory conditions (Table 5-1). The two parasitoids of D. citri, T. radiata and

Diaphorencyrtus aligarhensis (Shafee, Alam and Agarwal), and the parasitoid of the brown citrus aphid, Lipolexis oregmae Gahan, were also killed by this pathogen in the laboratory (Table

105

5-1). These experiments demonstrated that Pfr AsCP has a broad host range that includes multiple orders of insects and mites including beneficial and pest species.

SEM of the psyllid cadavers revealed that Pfr AsCP had conidiophores bearing whorls of divergent, mononematous philades that terminated in smooth-walled conidia (Figure 5-1 B). The flask-shaped philades averaged 5.2 ± 1.1 μm (standard deviation) in length and 1.8 ± 0.3 μm in diameter at the swollen basal region (N=6). Each philade tapered to a distinct neck averaging 0.4

± 0.1 μm in diameter (N=8) that interfaced with the cylindrical or fusiform conidia. Mature conidia harvested from a dead adult psyllid averaged 4.1 ± 0.5 μm in length and 2.0 ± 0.2 μm in diameter (N=21). The vegetative hyphae were hyaline, smooth-walled, and had an average diameter of 1.5 ± 0.3 μm (N=21). The morphological features of Pfr AsCP were consistent with species in the genus Paecilomyces (Samson, 1974; Onions, 1979; Humber, 1998).

The colony morphology of Pfr AsCP was characterized using in vitro cultures maintained on quarter-strength SDY and MEA media. On quarter-strength SDY media, one-week-old cultures were floccose, powdery and appeared white to light gray (Figure 5-2 A), while older cultures that were sporulating abundantly turned gray-pale pink. The underside of these cultures appeared smooth and pale yellow. On MEA media, cultures of Pfr AsCP were similar to cultures grown on quarter-strength SDY media (Figure 5-2 B), except the underside of the cultures were white.

After one week at 26°C, there were differences observed in the growth rate and conidia yield between Pfr AsCP and another Florida isolate, Pfr 97, cultured on quarter-strength SDY and MEA media (Figure 5-2 A-D). On quarter-strength SDY media, cultures of Pfr AsCP grew to an average diameter of 3.0 ± 0.1 cm (standard deviation) which was significantly larger than the diameter of Pfr 97 cultures, which averaged 2.6 ± 0.1 cm (F = 355.8; df = 2; P < 0.001).

106

The average diameter of cultures of Pfr AsCP grown on MEA media was 2.1 ± 0.1 cm, which

was also significantly larger than the 1.9 ± 0.1 cm average diameter of Pfr 97 cultures (F = 54.9;

df = 2; P < 0.001). On quarter-strength SDY and MEA media, the average number of conidia

harvested from Pfr 97 cultures (4.5 X 108 ± 3.7 X 107; 2.0 X 108 ± 2.3 X 107, respectively) was

significantly greater than the conidia harvested from cultures of Pfr AsCP (1.1 X 108 ± 1.6 X

107; 9.9 X 107 ± 1.4 X 107, respectively) (F = 866.3; df = 2; P < 0.0001; F = 184.8; df = 2, P <

0.0001, respectively). Overall, the characteristics of Pfr 97 cultures were similar to those

observed in cultures of Pfr AsCP. However, the edges of the Pfr 97 cultures grown on both

quarter-strength SDY and MEA media were not smooth, unlike the growth pattern observed in

cultures of Pfr AsCP (Figure 5-2 C-D). Also, the underside of Pfr 97 cultures grown on quarter-

strength SDY media were pale yellow with dark-yellow circular and linear regions indicating signs of radiating growth, and the underside of Pfr 97 grown on MEA media was pale yellow.

Tape-mounts of Pfr AsCP and Pfr 97 prepared from one-week-old cultures grown on quarter- strength SDY media showed that the conidia of both Pfr AsCP and Pfr 97 were cylindrical to

fusiform, smooth-walled and formed in chains on mononematous conidiophores, as described by

Samson (1974) for P. fumosoroseus (Figure 5-3).

Qualitative assays were conducted to test if in vitro cultures of Pfr AsCP and Pfr 97 were

infective to D. citri. The 20 adult psyllids exposed to Pfr AsCP and Pfr 97 cultures on quarter-

strength SDY media were killed within 3 days, but no sign of fungal pathogenesis was observed

in the control psyllids. These cadavers had the same phenotype as the dead psyllids collected in

the field. Topical spray applications of conidia (1 X 107 conidia/ mL) from in vitro cultures of

Pfr AsCP or Pfr 97 grown on quarter-strength SDY media also killed 100% of adult and

immature D. citri. Eggs sprayed with conidia (1 X 107 conidia/ mL) from Pfr AsCP or Pfr 97

107

either did not hatch or died as young nymphs. No sign of fungal pathogenesis was observed in adults, nymphs or eggs of D. citri sprayed with sterile water (control).

Molecular Analyses

Partial sequences of the SSU (1520 bp) (GenBank accession EF429302), LSU (890 bp)

(GenBank accession EF429301), and ß-tubulin (933 bp) (GenBank accession EF429303) genes,

amplified from DNA isolated from both mycosed psyllids and an in vitro culture (grown on

quarter-strength SDY media) of Pfr AsCP, were 100% identical for each gene analyzed. For Pfr

97, the SSU (1520 bp) (GenBank accession EF429305), LSU (890 bp) (GenBank accession

EF429304), and ß-tubulin (933 bp) (GenBank accession EF429306) sequences were 99%

(1519/1520 bp), 100% (890/890), and 99% (932/933) identical to these gene sequences of Pfr

AsCP, respectively. The nucleotide substitution in the ß-tubulin gene was at position 103 (T in

Pfr AsCP and C in Pfr 97), but this substitution did not create differences in the deduced amino

acid sequences.

BLAST searches of the SSU, LSU, and ß-tubulin gene sequences from Pfr AsCP and Pfr

97 produced significant alignments to these sequences from various Ascomycete fungi in the

class Sodariomycetes. The most significant alignments for the SSU sequences were to

Paecilomyces species classified in the order Hypocreales, family Clavicipitaceae. The SSU

sequence from Pfr AsCP was 100% identical (1520/1520 bp) to the SSU sequence of P.

fumosoroseus isolated from D. citri in Indonesia (GenBank accession AB032475) (Subandiyah

et al., 2000a). Unfortunately, there were no available sequences for the LSU or ß-tubulin genes

of the Pfr isolate from Indonesia for further comparison. The most significant alignments of the

LSU sequence from Pfr AsCP were to LSU sequences from Beauveria and Cordyceps species in

the order Hypocreales, family Clavicipitaceae. There were no deposited Pfr sequences

containing a significant homologous portion of the LSU sequence for comparison.

108

The most significant alignment of the ß-tubulin sequence from Pfr AsCP (GenBank accession EF429303) was to the ß-tubulin sequence of P. fumosoroseus ARSEF 3590 (GenBank accession DQ069285). When the sequences were aligned, the ß-tubulin sequence from Pfr

AsCP was 24 and 26 bases longer at the 5’ and 3’ ends, respectively. The sequence from Pfr

AsCP was 97% identical (587/604 bp) to the ß-tubulin sequence from Pfr ARSEF 3590 from bases 25-627 (bases and 1-604 of Pfr ARSEF 3590) and 96% identical (221/230 bp) from bases

678-906 (665-894 of Pfr 3590). A 5'-GTA and AG-3' eukaryotic intron consensus boundary was detected between bases 628-677 of Pfr AsCP and the bases 605-664 of Pfr ARSEF 3590 that flanked unique 50-bp and 60-bp putative intron sequences, respectively (Table 5-4). When the putative intron sequences were removed from each sequence and the additional nucleotides on the 5' and 3' ends of Pfr AsCP sequence were excluded, the deduced amino acid sequences were

98% identical (271/277 amino acids) and had an open reading frame without a stop codon (data not shown). Collectively, the differences in nucleotide composition and relative sizes of the putative intron regions between the two Pfr sequences provide genetic evidence that Pfr AsCP is a novel strain of Pfr.

An AFLP assay was conducted to differentiate Pfr AsCP and Pfr 97 because the SSU,

LSU, and ß-tubulin gene sequences of these isolates were nearly 100% identical, yet there were differences in their in vitro growth characteristics. A total of 21% (24/116) and 26% (32/125) of the bands produced in the assay using 12 different primers were unique to Pfr AsCP or Pfr 97, respectively (Table 5-2). Only primer 4 did not produce any polymorphisms between the two fungi. Three bands that were unique to Pfr AsCP when compared to Pfr 97 following amplification with primer 6, 7, and 11 are shown by the arrows in Figure 5-4, and these polymophisms were designated as AFLP-1-3. These bands were excised from the gel, re-

109

amplified, cloned and sequenced. The sequences obtained for AFLP-1 (GenBank accession

EF429307), AFLP-2 (GenBank accession EF429308), and AFLP-3 (GenBank accession

EF429309) were 429, 1161, and 924 bp, respectively (Table 5-3), and each sequence was flanked

by the adapter sequences + the EcoRI specificity site, as expected following amplification with

each AFLP primer (Table 5-2). No significant alignments to other fungal sequences were

retrieved from GenBank following a BLAST search (blastn) of the AFLP 1-3 sequences.

PCR primers were developed based on the AFLP 1-3 polymorphisms to develop molecular

markers specific to Pfr AsCP. Using the isolate-specific primer pairs PfrAsCP-1A-F/R and

PfrAsCP-2A-F/R, PCR products were detected in a sample containing DNA isolated from an in vitro culture of Pfr AsCP and in samples of DNA isolated from psyllids killed by Pfr AsCP (two

samples each from individual adult and immature D. citri) but not from DNA isolated from an in

vitro culture or four dead psyllids killed by Pfr 97 (two cultures each from individual adult and

immature D. citri) (Figure 5-5 A,C). Amplification products were observed in these cultures of

both Pfr AsCP and Pfr 97 with the primers PfrAsCP-1B-F/R (Figure 5-5 B), PfrAsCP-3A-F/R

(Figure 5-5 D) and PfrAsCP-3B-F/R (Figure 5-5 E). Thus, amplification was specific to Pfr

AsCP with primers designed from the 5’ end of AFLP-1 but not at the 3’ end, which indicated

that a polymorphism was likely present only at the 5’ end of this region. Amplification of Pfr

AsCP and Pfr 97 with primers designed based on both the 5’ and 3’ ends of AFLP-3 was

surprising, and indicated that AFLP-3 likely was an artifact. No amplification products were

detected in the negative control for each Pfr AsCP-specific primer pair, as expected.

Discussion

Two fungal pathogens were found infecting D. citri in the same citrus grove in central

Florida during the fall of 2005. One pathogen was identified as a close relative of Hirsutella

citriformis (Meyer et al., in press). In this study, the other psyllid pathogen was identified as Pfr

110

AsCP and characterized. During the field collection, it appeared that the H. citriformis-like pathogen was more prevalent during the sampling interval. However, psyllids killed by H. citriformis were tightly fastened to the plant surface by a mycelial mat underlying the head and thorax and by synnemata (Meyer et al., in press), whereas psyllids killed by Pfr AsCP were only loosely attached to the substrate by mycelia. Therefore, collection of psyllids killed by Pfr AsCP might be negatively influenced by both abiotic and biotic factors that could displace cadavers from the plant surface. Quantitative surveys are needed to investigate the spatial and temporal dynamics of each fungal pathogen in Florida’s citrus groves.

Identification of Pfr AsCP as a novel isolate was supported by morphological and molecular genetic data. The morphology of Pfr AsCP was consistent with the description of other Pfr species (Samson, 1974; Onions, 1979, Humber, 1998). Molecular genetic analysis of the ß-tubulin gene yielded the discovery of a unique putative intron region that indicated Pfr

AsCP was a novel Pfr isolate. A putative intron region in the ß-tubulin gene has been useful for differentiating entomopathogenic fungi in the genus Hirsutella (Boucias et al., 2007; Meyer et al., in press). A phylogenetic analysis using the SSU sequence of Pfr from D. citri in Indonesia, which was 100% identical to the SSU sequence of Pfr AsCP, previously was conducted by

Subandiyah et al. (2000a) for identification, so this was not repeated here. We cannot exclude the possibility that Pfr AsCP is the same as the Indonesian Pfr isolate from D. citri because the

SSU sequences are 100% identical but, unfortunately, there were no sequences available for the

LSU and ß-tubulin genes from the Indonesian isolate to compare with our sequences from Pfr

AsCP.

Comparison of the LSU, SSU and ß-tubulin genes from Pfr AsCP and another Florida isolate, Pfr 97, yielded only two nucleotide differences out of the 3343 bp analyzed, indicating

111

that these isolates are closely related. Both isolates were infectious to D. citri, but they are clearly distinguished by their in vitro growth characteristics (Figure 5-2) and by AFLP analysis

(Figure 5-4, 5-5). The Pfr AsCP-specific PCR primers developed from the AFLP analysis will be useful to confirm the identity of cultures maintained in vitro and to identify Pfr AsCP in future surveys or field trials using Pfr AsCP as a microbial insecticide. In support of this, the primers Pfr AsCP-1A-F/R and Pfr AsCP-2A-F/R were used to confirm that D. citri nymphs were killed by Pfr AsCP in a pilot field trial using Pfr AsCP as a microbial insecticide in Florida (Hoy et al., unpublished).

The interaction between Pfr AsCP and D. citri was investigated in the laboratory using conidia produced on the psyllid host and in vitro. The phenotype of diseased adult psyllids produced in the laboratory by exposing them to in vitro cultures of Pfr AsCP was the same as was observed in the field-collected specimens, thus fulfilling Koch’s postulates. The infection process of Pfr AsCP appeared to be different from the Hirsutella citriformis-like species that was found attacking adult D. citri (Meyer et al., in press). Pfr AsCP killed D. citri in 3 days, which was faster than the 7-9 days required by the H. citriformis-like species tested under the same laboratory conditions (Meyer et al., in press). However, the behavioral symptoms of disease were similar in D. citri adults infected by both pathogens. Surprisingly, no evidence of fungal cells of Pfr AsCP was found in the hemolymph of infected D. citri adults during the two days preceding mortality. By contrast, psyllids infected with H. citriformis had abundant hyphal bodies in the hemolymph (Meyer et al., in press). This was also in contrast to other studies, where blastospores of other Pfr isolates were found in the hemocoel of the glasshouse whitefly

Trialeurodes vaporariorum Westwood (Gökçe and Er, 2005), diamondback moth Plutella xylostella (Linnaeus), and the fall armyworm Spodoptera frugiperda (J. E. Smith) (Altre and

112

Vandenberg, 2001). It appears that Pfr AsCP is necrotrophic, killing D. citri with toxins and then utilizing the nutrients in the dead insect to develop. The toxin dipicolinic acid was found in a Pfr isolate that killed immature whiteflies (Asaff et al., 2005), and another toxin was found in

Paecilomyces tenuipes (Nam et al., 2001); however, toxin production has not yet been

demonstrated in Pfr AsCP.

Currently, there are no fungal pesticides registered for D. citri management in Florida.

There is potential for developing Pfr AsCP as a microbial insecticide because conidia, which are

infective to all life stages of D. citri, can be produced in vitro. In this study, we have completed

the first steps toward the use of a microbial control agent, as reviewed by Montesinos (2003),

including sampling, culturing, identification, and characterization by molecular, morphological

and biological assays. Immature D. citri were killed by Pfr AsCP during a pilot field trial (Hoy

et al., unpublished), so additional field experiments are warranted to evaluate both Pfr AsCP and

the commercially available formulation of Pfr 97 (Vidal et al., 1998; Faria and Wraight, 2001)

for psyllid management. Other isolates of Pfr have been successfully used against insecticide-

resistant whitefly populations, particularly in glasshouses (reviewed by Smith, 1993), and in

orchard field trials to control pear psylla (Puterka, 1999).

The potential utility of Pfr AsCP for citrus IPM depends on factors related to the

development of a microbial insecticide, including application costs and numerous other issues.

For example, Pfr species, including Pfr AsCP, have a broad host range (Smith, 1993), so the

effect of the pathogen on psyllid parasitoids and other natural enemies in citrus should be

investigated under field conditions (Pell and Vandenberg, 2002). The response of Pfr AsCP to

copper, which is widely used to control plant pathogens in Florida citrus (Timmer et al., 2006),

will be crucial to implementation. A quantitative survey to characterize the distribution,

113

abundance, and seasonality of the naturally occurring interaction between D. citri and Pfr AsCP in Florida could provide information about the role of this entomopathogen in the population dynamics of D. citri.

114

Table 5-1. Qualitative assessment of the infectivity of Pfr AsCP by a “touch test” against selected arthropods scored after one week at 24-25°C with 70-100% relative humidity and a 16L:8D photoperiod. Species Common name Order: Family % Mortality (number, stage)

Bemisia tabaci (Gennadius)1 Sweet potato whitefly Hemiptera: Aleyrodidae 100 (30, adult)

Diaphorencyrtus aligarhensis (Shafee, Alam and Agarwal) Parasitoid of D. citri Hymenoptera: Encyrtidae 100 (10, adult)

Diaphorina citri Kuwayama Asian citrus psyllid Hemiptera: Psyllidae 100 (20, adult; 20, nymph; 20, egg)

Lipolexis oregmae Gahan2 Parasitoid of brown citrus aphid Hymenoptera: Aphidiidae 100 (10, adult)

Panonychus citri McGregor Citrus red mite Acari: Tetranychidae 92 (25, adult)

Phyllocnistis citrella Stainton Citrus leafminer Lepidoptera: Gracillariidae 100 (10, adult)

Tamarixia radiata (Waterston) Parasitoid of D. citri Hymenoptera: Eulophidae 90 (20, adult)

115 Tetranychus urticae Koch Two-spotted spider mite Acari: Tetranychidae 84 (25, adult)

Toxoptera citricida Kirkaldy Brown citrus aphid Hemiptera: Aphididae 100 (30, adult)

1 (=B. argentifolii Bellows and Perring) 2 (=scutellaris Mackauer)

Table 5-2. Total number of bands and unique bands (polymorphisms) produced by each primer in the AFLP analysis of DNA isolated from in vitro cultures of Pfr AsCP and Pfr 97. Amplification products between 0.2-2.5 kb were included for the analysis. Pfr AsCP Pfr 97

Primer + 3 basesa Total Bands Polymorphisms Total Bands Polymorphisms

1 GGC 12 2 12 2

2 CAG 8 3 10 5

3 GCC 10 5 9 3

4 AGG 11 0 11 0

5 AGT 7 0 11 4

6 ATA 6 2 8 4

7 ACC 14 3 12 2

8 AGC 11 1 12 3

9 ATT 6 0 11 5

10 AAC 11 3 10 2

11 ACT 10 1 9 0

12 TCG 10 4 10 2

Totals 116 24 125 32

116

Table 5-3. Primers designed from AFLP polymorphisms of Pfr AsCP and details relevant for use in the PCR. AFLP polymorphisms 1-3 were produced by primers 6, 7, and 11, respectively. Polymorphism # Primer sequence1 Primer GenBank Size (bp) Product size (bp) Annealing Primers position2 accession temperature °C

1: EF429307 429 245 63 PfrAsCP-1A-F 5’- TCATATTGGCCGGATATATACAA-3’ 5 PfrAsCP-1A-R 5’- GAGGCTGCAAGTAAGGGCTATC-3’ 249

1 (complement) EF429307 429 178 63 Pfr AsCP-1B-F 429 Pfr AsCP-1B-R 5’-CAATTCATAGCAAAAGACAAAAGA-3’ 252

5’ TCTCTCTCCTGTCCCACCAT-3’

23: EF429308 1161 235 60 Pfr AsCP-2A-F 1 Pfr AsCP-2A-R 5’- CAATTCACCCCTCCTTCTAG-3’ 235 117 5’-TACCCTATAGCAGCGGCATT-3’

3: EF429309 924 151 63 Pfr AsCP-3A-F 5’-TCACTGTAGATGGTGCCATTG-3’ 5 Pfr AsCP-3A-R 5’-TGTGCAAGAAGCAGCTGAAG-3’ 155

3 (complement): EF429300 924 203 63 Pfr AsCP-3B-F 5’- CAATTCACTGGTGAAGAGCTTG-3’ 924 Pfr AsCP-3B-R 5’-AATGCCAGCATTTTCTCTGG-3’ 722

1 The EcoRI specificity sites included in the forward PCR primers are underlined, and the reverse primers are nested in the DNA sequence at the designated position. 2 Sequence positions of the forward and reverse primers are relevant to the 5’ and 3’ ends of the DNA sequence, respectively. 3 Only the AFLP recognition site at the 5’ end of AFLP polymorphism number 2 was used for primer design.

Table 5-4. Putative ß-tubulin intron sequences of Pfr AsCP, Pfr 97, and Pfr ARSEF 3590 (GenBank accession DQ079604). The 5'-GTA and AG-3' eukaryotic consensus intron boundaries are underlined at each end, and the putative stop codon (TAA) in each sequence is italicized. Sequence position number Pfr isolate Size (bp) ß-tubulin intron sequence

628 677

Pfr AsCP 50 GTAAGTGCACCTTGTTGGCACCAATTGACACACAACTAACAACCCATTAG

628 677

Pfr 97 50 GTAAGTGCACCTTGTTGGCACCAATTGACACACAACTAACAACCCATTAG

Pfr ARSEF 605 664 60 GTAAGATTGATCGTTAGTCATGACAACACTATACTGACCATGTACTGAAACGTATTACAG 3590

118

Figure 5-1. Light and electron micrographs of Pfr AsCP. (A) Dead adult psyllid killed by Pfr AsCP in the laboratory at 24-25°C, with approximately 100% RH and a 16L:8D photoperiod; (B) high magnification of Pfr AsCP showing of a whorl of mononematous philades terminating in conidia. Scale bars: (A) 1 mm; (B) 3 µm.

119

Figure 5-2. In vitro cultures of Pfr AsCP and Pfr 97 on quarter-strength SDY and MEA media photographed one week post-inoculation. Cultures were maintained without light at 26°C. (A) Pfr AsCP on quarter-strength SDY; (B) Pfr AsCP on MEA; (C) Pfr 97 on quarter-strength SDY; (D) Pfr 97 on MEA. Scale (A-D): 0.5 mm.

120

Figure 5-3. Light micrographs of tape-mounts prepared using in vitro cultures grown on quarter- strength SDY media showing chains of conidia. (A) Pfr AsCP; (B) Pfr 97. Scale (A- B): 0.5 μm.

121

Figure 5-4. Representative results of AFLP analysis using DNA isolated from Pfr AsCP and Pfr 97. Lane (1) DNA size marker; Lanes (2, 4, 6) AFLP of Pfr AsCP with primer 6, 7, 11, respectively; Lanes (3, 5, 7) AFLP of Pfr 97 with primer 6, 7, 11, respectively. DNA bands marked with arrows were excised from the gel, sequenced, and used to design isolate-specific PCR primers for Pfr AsCP.

Figure 5-5. PCR amplification of DNA isolated from psyllids killed by Pfr AsCP and Pfr 97 and from in vitro cultures of Pfr AsCP and Pfr 97 using AFLP primers. (A) Primers PfrAsCP-1A-F/R; (B) Primers PfrAsCP-1B-F/R; (C) Primers PfrAsCP-2A-F/R; (D) Primers PfrAsCP-3A-F/R; (E) Primers PfrAsCP-3B-F/R. Lane (1) DNA size marker; (2) in vitro culture of Pfr AsCP (grown on quarter-strength SDY media); (3-4) D. citri adults killed by Pfr AsCP; (5-6) D. citri nymphs killed by Pfr AsCP; (7) in vitro culture of Pfr 97 (grown on quarter-strength SDY media); (8-9) D. citri adults killed by Pfr 97; (10-11) D. citri nymphs killed by Pfr 97; (12) negative control (no DNA).

122

CHAPTER 6 PERSPECTIVES

This chapter highlights events which influenced my Ph.D. experience on scientific, professional, and personal levels. The commentary is written in a reflective and self-evaluative context.

Initially, it was clear that I had much to learn about the citrus ecosystem which was unfamiliar to me, coming from the Midwest. This made it challenging to design a research project. Dr. Hoy and I talked at length about investigating the influence of microbes on the biology of the Asian citrus psyllid and its two parasitoids. The interaction between microbes and insects also was a new realm of entomology to which I was introduced. Thankfully, Dr. Hoy shared her experience and knowledge of biological control in citrus and of symbiosis, and she suggested numerous directions for my research program. It was time-consuming to learn the basic biology of the parasitoid-host system and to review the literature concerning microbial- insect interactions. During this introductory period, I was able to work on the coursework required by the department and recommended by my committee.

As part of my Ph.D., I completed the following courses: Biological Control, Insect

Pathology, Insect Molecular Genetics, Insect Physiology, Insect Ecology, Medical and

Veterinary Entomology, Insect Identification, Mites and Agriculture, Insect Symbiosis Seminar,

Designer Insects Seminar and a directed study in Transmission Electron Microscopy with Dr.

Becnel. These courses significantly increased the breadth of my entomological knowledge, which previously was limited to plant-insect interactions. My favorite class was Insect

Pathology, instructed by Dr. Boucias, because the topics were related to my research and the material was presented in a manner that encompassed microbe-insect interactions from the ecological level down to the molecular level. I developed a good working relationship with Dr.

123

Boucias that resulted in collaborative efforts with two projects involving fungal pathogens of the

Asian citrus psyllid.

During the molecular survey for endosymbionts in the citrus psyllid and its two parasitoids, I encountered problems with polymerase chain reaction (PCR) amplification of DNA from external contaminating microbes. In order to reduce the possibility that non-endosymbiotic microbes were included in my analysis, I developed a method to “surface-sterilize” insects, using the citrus psyllid as a model. This procedure both killed the external microbes and eliminated their DNA but preserved the integrity of the insect genomic DNA and endosymbiont DNA. The results from this unexpected side-project were included in my dissertation, and this technique will be a valuable tool for other researchers studying insect endosymbionts.

My previous molecular skills were an asset for designing and completing my research, but

I wanted to obtain some new skills both at the bench and in the field. My research took on a new direction during 2005, when citrus greening disease was detected in south Florida, and I began to survey the vector population for the citrus greening disease-causing pathogen. This research was under the framework of my dissertation topic and allowed me to get out of the laboratory and obtain some hands-on field experience. It was beneficial to have such flexibility in my research pursuits, and I must thank my committee for supporting the amendments to my research proposal. During my collecting trips, I visited citrus groves and witness the various pest problems associated with citrus production. I also observed damage to citrus caused by the hurricanes, the burning of entire groves to manage citrus canker, trees showing symptoms of citrus greening disease and saw that many citrus groves were for sale to accommodate demands for housing and business developments. In addition, I fortuitously found dead adult citrus psyllids that were apparently killed by fungi, and this discovery spawned two research projects

124

that involved the identification and characterization of these unknown microbes associated with

D. citri.

At the bench, I learned the AFLP technique from Dr. Boucias which was incorporated into

a project to discriminate the psyllid-associated Paecilomyces fumosoroseus (Pfr) isolate from another Florida isolate, Pfr 97. This was done in part to satisfy the UF patent office that wanted this information to determine if we should protect the rights of the pathogen, in case it could be

developed for microbial control of psyllids or other citrus pests. This turned out to be a dead end

because Pfr 97 had already been marketed and there was not enough interest in the new isolate to

warrant further development at UF. However, I did learn, in part, the enormous amount of

effort, legal issues and finances required to obtain a patent. I was able to gain valuable teaching

experience by working with Katerina Simackova, a student from Europe who visited our lab to

learn the AFLP technique. Dr. Hoy repeatedly has mentioned that the best way to learn a

molecular technique is first to be taught it, then do it yourself and finally teach it to someone

else. That way you are forced to learn what is actually going on in the reaction rather than just

blindly following a protocol. I agree with this thought process and had a positive experience

while instructing Katerina.

I learned how to rear a number of insects and mites during my dissertation research and in

my coursework. I now appreciate the effort required for insect rearing which is necessary to

conduct in-depth entomological studies. Rearing Diaphorencyrtus aligarhensis is problematic

because it has such a low reproductive rate. The time involved and difficulty producing large

numbers of D. aligarhensis limited the research that I could do concerning the Wolbachia story

and its relation to thelytokous reproduction in the parasitoid. Clearly, there are a number of

questions that still remain on this project, but these may not soon be answered because of the

125

rearing difficulties. I also was able to rear other citrus-inhabiting arthropods such as the citrus red mite, two-spotted spider mite, brown citrus aphid, the aphid parasitoid Lipolexis oregmae, the citrus leafminer, and in the Biological Control course I reared some coccinellids and green lacewings. I quickly realized that each insect requires a specific set of environmental conditions so that healthy, vigorous colonies can be produced in the laboratory. In my leisure, I enjoyed rearing swallowtails collected from citrus trees in our greenhouse.

My professional skills as a scientist have improved through my Ph. D. research. Most importantly, my time-management skills and multi-tasking abilities were enhanced. Previously,

I worked on a single project at a time, but during my dissertation research Dr. Hoy emphasized that it was necessary for me to make progress on multiple projects simultaneously. This was painful at first, but as I began to write and analyze data soon after it was obtained, my research progressed much faster than in the past. In fact, working on different projects added variety to each day that made this process enjoyable.

I have always appreciated funding support from Dr. Hoy and have not had to write grants to support my research. In our laboratory, I have tried to find ways to conserve resources, such as scaling back the amount of reagents per reaction used for cloning and have pursued a personal connection to a sales representative who sells PCR reagents at a much-reduced rate. When possible, I have tried to communicate money-saving measures in our weekly laboratory meetings and to other scientists in the department. Besides writing some mini grants to the Florida

Entomological society and a short grant proposal for my qualifying exam, my experience in grant writing is limited. This is certainly an area of my professional skills that will need to be developed, given the current competition for funding that exists in the biological sciences.

126

I’ve had positive experiences working together with numerous other researchers at UF. I feel fortunate to have the assistance of Dr. Jeyaprakash in our laboratory because he has provided

instruction on various laboratory procedures, introduced me to many people in the department

and encouraged that I continue to work with others. My appreciation for phylogenetics and skills

using phylogenetic software were increased by interacting with Jennifer Zaspel, who is working

on various molecular projects in Dr. Hoy’s laboratory. In turn, I have assisted her with trouble-

shooting her molecular techniques and, we have developed a solid professional relationship. Dr.

Becnel, Dr. Boucias and Dr. Blaske kindly helped me learn the basics of scanning and

transmission electron microscopy. These techniques are difficult for a novice and require a great

deal of experience and technical know-how. I must again acknowledge my wife for her support

and assistance with my projects and dedication to our careers as entomologists. My only

reservation through my interactions with others is that I could have helped out more people

during my time in the department.

It was challenging to navigate the procedures necessary to publish a manuscript as the first

author. I was surprised that it took so long to have everything formatted appropriately, wait for

the reviews and to address the reviewer’s corrections. I am pleased that two of the chapters in

my dissertation have already been accepted for publication. In addition, additional time was

spent depositing DNA sequence information in GenBank and submitting fungal cultures to the

USDA collection of entomopathogenic fungi.

It was a privilege to present my research findings at the national Entomological Society of

America (ESA) meetings and at a Keystone conference focused on metagenomics. Clearly,

these functions are a great way to meet other scientists in a professional but relaxed environment,

create a network and to learn about ongoing research elsewhere. Based on my positive

127

experiences at the national meetings, I regret not presenting at some of the smaller ESA branch meetings because I’ve heard good things from the other graduate students in the department who have done so.

Our department offered a position for an insect physiologist, and I served as one of the graduate student representatives for the search committee. It was an honor to be included in professional discussions weighing the merits of each candidate and suggesting them to the department for consideration for the position. It was quite informative to read through all of the applicant’s CV’s because this conveyed how competitive the market is for academic positions.

I was able to participate in some outreach activities that were quite enjoyable and informative. I attended the Florida state fair and represented our department at the “Insect

Encounter” booth. It was amazing to see the diverse opinions and reactions of the general public to insects, which ranged from fear and disgust to interest and appreciation. I also presented insect demonstrations to children in a middle school in Gainesville and at the Museum of Natural

History at UF. In the future, I plan on doing more of these activities because I realize how important it is to convey my enthusiasm and knowledge of insects with others, and it was a good teaching experience.

It was important for me to balance my research with stimulating outside activities. I am an avid badminton player, participating in local, regional and national tournaments. I took a course in badminton here at UF where I assisted the instructor teach other students the fundamentals of the game. I was also the vice president and currently am the president of the badminton club at

UF. We have about 90 members, and I have responsibilities to manage the budget and arrange club activities such as our annual tournament. I hope to continue playing and teaching badminton in the future because it has helped me relieve tension, teach others and just have fun.

128

At the end of the day, I always enjoyed my work. Overall, I had a great time as a Florida

Gator, and I would highly recommend this department and Dr. Hoy’s laboratory to other prospective students.

129

LIST OF REFERENCES

Abraham, W-R., Strömpl, C., Meyer, H., Lindholst, S., Moore, E.R.B., Christ, R., Vancanneyt, M., Tindall, B.J., Bennasar, A., Smit, J., Tesar, M., 1999. Phylogeny and polyphasic taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis maris (Poindexter) comb. nov. as the type species, and emended description of the genera Brevundimonas and Caulobacter. Intl. J. Syst. Bacteriol. 49, 1053-1073.

Altre, J.A., Vandenberg, J.D., 2001. Penetration of cuticle and proliferation in hemolymph by Paecilomyces fumosoroseus isolates that differ in virulence against lepidopteran larvae. J. Invertebr. Pathol. 78, 81-86.

Arakaki, N., Noda, H., Yamagishi, K., 2000. Wolbachia-induced parthenogenesis in the egg parasitoid Telenomus nawai. Entomol. Exp. Appl. 96, 177-184.

Argov, Y., Gottlieb, Y., Spector-Amin, S., Zchori-Fein, E., 2000. Possible symbiont-induced thelytoky in Galeopsomyia fausta, a parasitoid of the citrus leafminer Phyllocnistis citrella. Phytoparasitica 28, 212-218.

Asaff, A., Cerda-Garcia-Rojas, C., de la Torre, M., 2005. Isolation of dipicolinic acid as an insecticidal toxin from Paecilomyces fumosoroseus. Appl. Microbiol. Biotechnol. 68, 542- 547.

Aubert, B., 1987. Trioza erytreae Del Guercio and Diaphorina citri Kuwayama (Homoptera: Psylloidea), the two vectors of citrus greening disease: Biological aspects and possible control strategies. Fruits 42, 149-162.

Aubert B., Quilici, S., 1984. Biological control of the African and Asian citrus psyllids (Homoptera: Psylloidea), through eulophid and encyrtid parasites (Hymenoptera: Chalcidoidea ) in Reunion Island. In Proc. 9th Conf. Int. Org. of Citrus Virologists, (J. V. da Graca, P. Moreno, and R. K. Yokomi, Eds.), pp. 392-394. Internat. Org. Citrus Virologists, Riverside, CA.

Barnes, W.M., 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from λ bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220.

Baumann, P., 2006. Diversity of prokaryote-insect associations within the Sternorrhyncha (psyllids, whiteflies, aphids, mealybugs). In Insect Symbiosis (Volume 2). Eds. Bourtzis, K., Miller, T.A. Taylor and Francis Group, LLC. Boca Raton, FL. pp. 1-24.

Becnel, J.J., Jeyaprakash, A., Hoy, M.A., Shapiro, A., 2002. Morphological and molecular characterization of a new microsporidian species froom the predatory mite Metaseiulus occidentalis (Nesbitt) (Acari, Phytoseiidae). J. Invertebr. Pathol. 79, 163-172.

Bernal, R., 1991. Diaphorina citri (Homoptera: Psyllidae). Nuevo insecto detectado en montes citricos en el area de Salto, Uruguay. INIA, Uruguay, Hocha de divulgacio, 25, 1-2.

130

Bläske, V-U., Boucias, D.G., 2004. Influence of Helicosporidium spp. (Chlorophyta: Trebouxiophyceae) infection on the development and survival of three noctuid species. Environ. Entomol. 33, 54-61.

Boucias, D.G., Scharf, D.W., Breaux, S.E., Purcell, D.H., Mizell, R.E., 2007. Studies on the fungi associated with the glassy-winged sharpshooter Homalodisca coagulata with emphasis on a new species Hirsutella homalodiscae nom. prov. Biol. Control. 52, 231-258.

Boucias, D., Stokes, C., Suazo, A., Funderburk, J., 2000. AFLP analysis of the entomopathogen Nomuraea rileyi. Mycologia 92, 638-648.

Bouffard, K., 2006. Greening found in 10 counties. Citrus Ind. 87 (1), 5-26.

Bové, J.M., Garnier, M., Ahlawat, Y.S., Chakraborty, N.K., Varma, A., 1993. Detection of the Asian strains of the greening BLO by DNA-DNA hybridization in Indian orchard trees and Malaysian Diaphorina citri psyllids, pp. 258-263 In P. Moreno, J. V. da Graça, and L. W. Timmer [eds.], Proc. 12th Conference of the International Organization of Citrus Virologists. University of California, Riverside.

Brady, B.L.K., 1979. Hirsutella citriformis [Descriptions of fungi and bacteria]. IMI Descriptions of Fungi and Bacteria 61, Sheet 607.

Braig, H.R., Zhou, W., Dobson, S.L., O’Neill, S.L., 1998. Cloning and characterization of a gene encoding the major surface protein of the bacterial endosymbiont Wolbachia pipientis. J. Bacteriol. 180, 2373-2378.

Braquart-Varnier, C., Grève, P., Fèlix, C., Martin, G., 2005. Bacteriophage WO in Wolbachia infecting terrestrial isopods. Biochem. Biophys. Res. Comm. 337, 580-585.

Browning, H.W., Childers, C.C., Stansly, P.A., Peña, J., Rogers, M.E., 2006. Florida citrus pest management guide: Soft-bodied insects attacking foliage and fruit: University of Florida IFAS Extension. http://edis.ifas.ufl.edu/BODY_CG004.

Burckhardt, D., 1994. Psylloid pests of temperate and subtropical crop and ornamental plants (Hemiptera, Psylloidea): A review. Trends Agr. Sci. Entomol. 2, 173-186.

Burckhardt, R., Martinez, M., 1989. Note sur la présence au Honduras d΄un redoubtable ennemi des citrus: Diaphorina citri Kuwayama (Hom. Psylloidea Psyllidae). Bull. Société Entomol. France 94 (1-2), 65-66.

Capoor, S.P., Rao, D.G., Viswanath, S.M. 1974. Greening disease of citrus in the Deccan Trap Country and its relationship with the vector, Diaphorina citri Kuwayama. In Proc. 6th Int. Org. of Citrus Virologists (L. G. Weathers and M. Cohen, Eds.), pp. 43-49, Univ. California, Div. Agr. Sci., Riverside, CA.

Chien, C.C., 1995. The role of parasitoids in the pest management of citrus psyllid. In Proc. Symp., Research and Development of Citrus in Taiwan. pp. 245-261.

131

Chien, C.C., Chiu, S.C., Ku, S.C. 1988. Biological control of citrus psylla, Diaphorina citri: the introduction, augmentation, and release of Tamarixia radiata. J. Agr. Res. China 37, 430- 439.

Chien, C.C., Chiu, S.C., Ku, S.C., 1989. Biological control of Diaphorina citri in Taiwan. Fruits 44, 401-407.

Chien, C.C., Chiu, S.C., Ku, S.C., 1993. Influence of temperature on the population increase, host-killing capability and storage of Tamarixia radiata. Chinese J. Entomol. 12, 111-123.

Chien, C.C., Chu, Y.I., 1996. Biological control of citrus psyllid, Diaphorina citri in Taiwan. In Biological Pest Control in Systems of Integrated Pest Management-1996, reprinted from Food and Fertilizer Technology Center Book Series No. 47, pp. 93-104, Taipei, Taiwan.

Chien, C.C., Chu, Y.I., Ku, H.C., 1991. Parasitic strategy, morphology and life history of Tamarixia radiata (Hymenoptera: Eulophidae). Chinese J. Entomol.11, 265-281.

Chu, Y.I., Chien, C.C., 1991. Utilization of natural enemies to control psyllid vectors transmitting citrus greening. In Integrated Control of Plant Virus Diseases (K. Kiritani, H. J. Su and Y. I . Chu, Eds.), pp. 135-145, Food and Fertilizer Technology Center of the Asian and Pacific Region, Taipei, Taiwan.

Costa Lima, A.M. da., 1942. Homópteros. Insetos do Brazil 3, 327 pp., 267 illus. Esc. Na. Agron. Min. Agr.

Daane, K.M., Sime, K.R., Dahlsten, D.L., Andrews Jr., J.W., Zuparko, R.L., 2005. The biology of Psyllaephagus bliteus Riek (Hymenoptera: Encyrtidae), a parasitoid of the red gum lerp psyllid (Hemiptera: Psylloidea). Biol. Control 32, 228-235. da Graça, J.V., 1991. Citrus greening disease. Annu. Rev. Phytopathol. 19, 109-136.

Daly, H.V., Doyen, J.T., Purcell III, A.H., 1998. Introduction to Insect Biology and Diversity (Second edition). Oxford University Press, Inc. New York, NY.

Darby, A.C., Welburn, S.C., 2006. Symbiont culture. In Insect Symbiosis (Volume 2). Eds. Bourtzis, K., Miller, T.A. Taylor and Francis Group, LLC. Boca Raton, FL. pp 141-155.

De Barro, P.J., Hart, P.J., 2001. Antibiotic curing of parthenogenesis in Ertmocerus mundus (Australian parthenogenic form). Entomol. Exp. Appl. 99, 225-230. de Bary, A., 1879. Die erscheinung der symbiose. Verlag von Karl J. Trübner, Strasssburg.

Dedeine, F., Varve, F., Fleury, F., Loppin, B., Hochberg, M.E., Boulétreau, M., 2001. Removing symbiotic Wolbachia bacteria specifically inhibits oogenesis in a parasitic wasp. Proc. Natl. Acad. Sci. USA 98, 6247-6252.

DeLong, E.F., 1992. Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 89, 5684-5689.

132

Douglas A.A., 2003. Buchnera bacteria and other symbionts of aphids. In Insect Symbiosis. Eds. Bourtzis, KI., Miller, T.A. CRC Press LLC, Boca Raton, FL. pp. 23-38.

Étienne, J., Aubert, B., 1980. Biological control of psyllid vectors of greening disease on Reunion Island. In Proc. 8th. Int. Org. of Citrus Virologists, (E. C. Cavalan, S.M. Garnsey, and Timmer, L.W, Eds.), pp. 118-121. Internat. Org. Citrus Virologists, Riverside, CA.

Étienne, J., Quilici, S., Marival, D., Franck, A., 2001. Biological control of Diaphorina citri (Hemiptera: Psyllidae) in Guadeloupe by imported Tamarixia radiata (Hymenoptera: Eulophidae). Fruits 56, 307-315.

Faria, M., Wraight, S.P., 2001. Biological control of Bemisia tabaci with fungi. Crop Prot. 20, 767-778.

Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1995. Testing significance of incongruence. Cladistics 10, 315-319.

Finlay-Doney, M., Walter, G.H., 2005. Discrimination among host plants (Leucaena species and accessions) by the psyllid pest Heteropsylla cubana and implications for understanding resistance. Agr. Forest Entomol. 7, 153-160.

Frisinghelli, C., Delaiti, L., Grando, M. S., Forti, D., Vindimian, M.E., 2000. Cacopsylla costalis (Flor 1861), as a vector of apple proliferation in Trentino. J. Phytopathol. 148, 425-431.

Fuji, Y., Kubo, T., Ishikawa, H., Sasaki, T., 2004. Isolation and characterization of the bacteriophage WO from Wolbachia, an arthropod endosymbiont. Biochem. Biophys. Res. Comm. 317, 1183-1188.

Fukatsu, T., 1999. Acetone preservation: a practical technique for molecular analysis. Mol. Ecol. 8, 1935-1945.

Garnier, M., Bové, J.M., 1983. Transmission of the organisms associated with citrus greening disease from sweet orange to periwinkle by dodder. Phytopathology 73, 1358-1363.

Garnier, M., Jagoueix, E.S., Cronje, P.R., Le Roux, H.F., Bove, J.M., 2000. Genomic characterization of a Liberibacter present in an ornamental rutaceous tree, Calodendrum capense, in the Western Cape province of South Africa. Proposal of 'Candidatus Liberibacter africanus subsp. capensis'. Int. J. System. Evol. Microbiol. 50, 2119-2125.

Gavotte, L., Henri, H., Stouthamer, R., Charif, D., Charlat, S., Boulétreau, M., Vavre, F., 2007. A survey of the bacteriophage WO in the endosymbiotic bacteria Wolbachia. Mol. Biol. Evol. 24, 427-435.

Gavotte, L., Vavre, F., Henri, H., Ravallec, M., Stouthamer, R., Boulétreau, M., 2004. Diversity, distribution and specificity of WO phage infection in Wolbachia of four insect species. Insect Mol. Biol. 13, 147-153.

133

Geiger, C.A., Guiterrez, A.P., 2000. Ecology of Heteropsylla cubana (Homoptera: Psyllidae): psyllid damage, tree phenology, thermal relations, and parasitism in the field. Environ. Entomol. 29, 76-86.

Gillott, C., 2005. Entomology. Springer, Dordrecht, The Netherlands.

Giorgini, M., 2001. Induction of males in thelytokous populations of Encarsia meritoria and Encarsia protransvena: a systematic tool. BioControl 46, 427-438.

Gökçe, A., Er, M.K., 2005. Pathogenicity of Paecilomyces spp. to the glasshouse whitefly, Trialeurodes vaporariorum, with some observations on the fungal infection process. Turk. J. Agric. For. 29, 331-339.

Grafton-Cardwell, E.E., Godfrey, K.E., Rogers, M.E., Childers, C.C., Stansly, P.A., 2006. Asian citrus psyllid. Univ. Calif. Div. Agr. Natl. Res. Publ. 8205.

Grenier, S., Gomes, S.M., Pintureau, B., Lassabliére, F., Bolland, P., 2002. Use of tetracycline in larval diet to study the effect of Wolbachia on host fecundity and clarify taxonomic status of Trichogramma species in cured bisexual lines. J. Invertebr. Pathol. 80, 13-21.

Halbert, S.E., 1998a. Asian citrus psyllid-A serious potential exotic pest of Florida citrus. http://www.ifas.ufl.edu/~entweb/DCITRI.htm.

Halbert, S. 1998b. Asian citrus psyllids and greening disease of citrus pest alert: a literature review. Florida Dept. Agric. Consumer Serv., Div. Plant Industry. Entomology LR- ACP/CG-1, June 25, 1998. Gainesville, FL.

Halbert, S.E., 2005. Pest alert: Citrus greening / Huanglongbing. http://www.doacs.state.fl.us/pi/chrp/greening/citrusgreeningalert.html.

Halbert, S.E., Manjunath, K.L., 2004. Asian citrus psyllids (Sternorrhyncha: Psyllidae) and greening disease of citrus: A literature review and assessment of risk in Florida. Fla. Entomol. 87, 330-353.

Halbert, S.E., Nunez, C.A., 2004. Distribution of the Asian citrus psyllid, Diaphorina citri Kuwayama (Rhynchota: Psyllidae) in the Caribbean basin. Fla. Entomol. 87, 401-402.

Halbert, S.E., Sun, X., Dixon, W.N., 2000. Asian citrus psyllid and citrus greening disease. Citrus Ind. 91(5), 22-24.

Hausner, G., Reid, J., Klassen, G.R., 1993. On the subdivision of Ceratocystis s.l., based on partial ribosomal DNA sequences. Can. J. Botany 71, 52-63.

Hiraoka, H., Yamamoto,Y., Urakawa,S., Yamada,H., Karita,S., Goto,M., 2006. Effective fractions and microbiota of fermented juice of epiphytic lactic acid bacteria (FJLB) of rice plant (Oryza sativa L.,). Jpn. J. Grassl. Sci. 51, 379-384.

134

Hodkinson, I.D., Bird, J.M., Hill, J.K., Baxter, R., 2001. Host plant growth characteristics as determinants of abundance and phenology in jumping plant-lice on downy willow. Ecol. Entomol. 26, 376-387.

Houseman, R.M., Barrett, B.A., 1998. Hackberry psyllids. MU Extension, University of Missouri-Columbia.

Hoy, M.A., 2003. Insect Molecular Genetics. Elsevier Science: Academic Press, San Diego, CA. pp 492-520.

Hoy, M.A., Jeyaprakash, A., 2005. Microbial diversity in the predatory mite Metaseiulus occidentalis (Acari: Phytoseiidae) and its prey, Tetranychus urticae (Acari: Tetranychidae). Biol. Control. 32, 427-441.

Hoy, M.A., Jeyaprakash, A., Morakote, R., Lo, P.K.C., Nguyen, R., 2000. Genomic analyses of two populations of Ageniaspis citricola (Hymenoptera: Encyrtidae) suggest that a cryptic species may exist. Biol. Control 17, 1-10.

Hoy, M.A., Jeyaprakash, A., Nguyen, R., 2001. Long PCR is a sensitive method for detecting Liberobacter asiaticum in parasitoids undergoing risk assessment in quarantine. Biol. Control 22, 278-287.

Hoy, M.A., Nguyen, R., 1998. Citrus psylla: Here in Florida-An action plan-updated. http://extlab1.entnem.ufl.edu/PestAlert/hoy-0615.htm (15 May 2001).

Hoy, M.A., Nguyen, R., 2000. Classical biological control of Asian citrus psylla. Citrus Ind.

Hoy, M.A., Nguyen, R., Jeyaprakash, A., 1999. Classical biological control of Asian citrus psylla. Citrus Ind. 80(9), 20-22.

Huang, C.H., Tsai, M.Y., Wang, C.L., 1984. Transmission of citrus likubin by a psyllid, Diaphorina citri. J. Agr. Res. China 33, 65-72.

Huigens, M.E., Hohmann, C.L., Luck, R.F., Gort, G., Stouthamer, R., 2004. Reduced competitive ability due to Wolbachia infection in the parasitoid wasp Trichogramma kaykai. Entomol. Exp. Appl. 110, 115-123.

Humber, R.A., 1998. Entomopathogenic fungal identification. APS/ESA Workshop: Joint Annual Meeting. Las Vegas, NV. http://arsef.fpsnl.cornell.edu/mycology/corner/APSwkshp.pdf

Hung, T.H., Hung, S.C., Chen, C.N., Hsu, M.H., Su, H.J., 2004. Detection by PCR of Candidatus Liberibacter asiaticus, the bacterium causing citrus Huanglongbing in vector psyllids: application to the study of vector-pathogen relationships. Plant Pathol. 53: 96- 102.

135

Husain, M. A., Nath, C.B., 1924. The life-history of Tetrastichus radiatus parasitic on Euphalerus citri Kuw., and its hyperparasite. Pusa, 5th Ent. Meeting Rept. Proc. 122-128. Govt. Printing, Calcutta, India.

Hywel-Jones, N., 1997. Hirsutella species associated with hoppers (Homoptera) in Thailand. Mycol. Res. 101, 1202-1206.

Isaka, M., Palasarn, S., Sriklung, K., Kocharin, K., 2005. Cyclohexadepsipeptides from the insect pathogenic fungus Hirsutella nivea BCC 2594. J. Nat. Prod. 68, 1680-1682.

Jarausch, W., Danet, J.L., Labonne, G., Dosba, F., Broquaire, J.M., Saillard, C., Garnier, M., 2001. Mapping the spread of apricot chlorotic leaf roll (ACLR) in southern France and implication of Cacopsylla pruni as a vector of European stone fruit yellows (ESFY) phytoplasmas. Plant Pathol. 50, 782-790.

Jeyaprakash, A., Hoy, M.A., 2000. Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol. Biol. 9, 393-405.

Jeyaprakash, A., Hoy, M.A., Allsopp, M.H., 2003. Bacterial diversity in worker adults of Apis mellifera capensis and Apis mellifera scutellata (Insect: Hymenoptera) assessed using 16S rRNA sequences. J. Invertebr. Pathol. 84, 96-103.

Jinhan, X., Yuqing, T., 1993. The immature development and morphology of Tamarixia radiata. J. Fujian Agric. Univ. (Natural Sciences Edition) 22, 311-316.

Johanowicz, D.L., Hoy, M.A., 1998. Experimental induction and termination of non-reciprocal reproductive incompatibilities in a parahaploid mite. Entomol. Exp. Appl. 87, 51-58.

Kainulainen, P., Nissinen, A., Piirainen, A., Tilikkala, K., Holopainen, J.K., 2002. Essential oil composition in leaves of carrot varieties and preference of specialist and generalist sucking insect herbivores. Agr. Forest Entomol. 4, 211-216.

Kambhampati, S., Smith, P.T., 1995. PCR primers for the amplification of four insect mitochondrial gene fragments. Insect Mol. Biol. 4, 233-236.

Kato, Y., Asahara, M., Arai, D., Goto, K., Yokota, A., 2005. Reclassification of Methylobacterium chloromethanicum and Methylobacterium dichloromethanicum as later subjective synonyms of Methylobacterium extorquens and of Methylobacterium lusitanum as a later subjective synonym of Methylobacterium rhodesianum. J. Gen. Appl. Microbiol. 51, 287-299.

Knapp, J.L., Halbert, S., Lee, R., Hoy, M., Clark, R., Kesinger, M., 1998. The Asian citrus psyllid and citrus greening disease. Citrus Ind. 79(10), 28-29.

Koch, R., 1891. Uber bakteriologische Forschung Verhandlung des X Internationalen Medichinischen Congresses, Berlin, 1890, 1, 35. August Hiirschwald, Berlin. (In German). Xth International Congress of Medicine, Berlin.

136

Koneman, E.W., Roberts, G.D., 1985. Preliminary identification of fungal cultures, in Koneman and Roberts (eds): Practical Laboratory Mycology, ed 3. Baltimore, Williams and Wilkins pp 47-51.

Korsten, L., Jagoueix, S., Bové, J. M., and Garnier, M.. 1996. Huanglongbing (greening) detection in South Africa. In Proc. 13th Conf. Int. Org. Citrus Virologists, (J. V. da Graca, P. Moreno, and R. K. Yokomi, Eds.), pp. 395-398. Internat. Org. Citrus Virologists, Riverside, CA.

Kose, H., Karr, T.L., 1995. Organization of Wolbachia pipientis in the Drosophila fertilized egg and embryo revealed by an anti-Wolbachia monoclonal antibody. Mech. Dev. 51, 275-288.

Kuwayama, S., 1908. Die psylliden Japans. Transactions of the Sapporo Natural History Society 2 (parts I and II), 149-189 (D. citri: p. 160-161, Plate III, Fig. 16).

Lang, G., Blunt, J.W., Cummings, N.J., Cole, A.L., Munro, M.H., 2005. Hirsutide, a cyclic tetrapeptide from a spider-derived entomopathogenic fungus, Hirsutella sp. J. Nat. Prod. 68, 1303-1305.

Liu, D., Trumble, J.T., 2004. Tomato psyllid behavioral responses to tomato plant lines and interactions of plant lines with insecticides. J. Econ. Entomol. 97, 1078-1085.

Liu, W.Z., D.G. Boucias, McCoy, C.W., 1995. Extraction and characterization of the insecticidal toxin Hirsutellin A produced by Hirsutella thompsonii var. thompsonii. Exp. Mycol. 19, 254-262.

Liu, Y.H., Tsai, J.H., 2000. Effects of temperature on biology and life table parameters of the Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Ann. Appl. Biol. 137, 201-206.

Maddison, W.P., Maddison, D.K., 2000. MacClade: Analysis of phylogeny and character evolution. Version 4.0. Sinauer Associates. MD, USA.

Mains, E. B., 1951. Entomogenous species of Hirsutella, Tilachlidium and Synnematium. Mycologia 43, 691-718.

Majerus, M.E.N., 2003. Sex Wars, Genes, Bacteria, and Biased Sex Ratios. Princeton University Press, Princeton NJ.

Masui, S., Kamoda, S., Sasaki, T., Ishikawa, H., 2000. Distribution and evolution of bacteriophage WO in Wolbachia, the endosymbiont causing sexual alterations in arthropods. J. Mol. Evol. 51, 491-497.

Mazet, I., Vey, A., 1995. Hirsutellin A, a toxic protein produced in vitro by Hirsutella thompsonii. Microbiology. 141, 1343-1348.

137

McCoy, C.W., Selhime, A.G., Kanavel, R.F., Hill, A.J., 1971. Suppression of citrus rust mite populations with application of fragmented mycelia of Hirsutella thompsonii. J. Invertebr. Pathol. 17, 270-276.

McFarland, C.D., Hoy, M.A., 2001. Survival of Diaphorina citri (Homoptera: Psyllidae), and its two parasitoids, Tamarixia radiata (Hymenoptera: Eulophidae) and Diaphorencyrtus aligarhensis (Hymenoptera: Encyrtidae) under different relative humidities and temperature regimes. Fla. Entomol. 84, 227-233.

Mead, F.W., 1977. The Asiatic citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Entomology Circular 180. Florida Dept. Agric. Consumer Ser., Div. Plant Ind., 4 pp.

Memmott, J., Craze, P.G., Harman, H.M., Syrett, P, Fowler, S.V., 2005. The effect of propagule size on the invasion of an alien insect. J. Anim. Ecol. 74, 50-62.

Meyer, J.M., Hoy, M.A., Boucias, D.G., In press. Morphological and molecular characteriztion of a Hirsutella species infecting the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae) in Florida. J. Invertebr. Pathol.

Michaud, J.P., 2002. Classical biological control: a critical review of recent programs against citrus pests in Florida. Ann. Entomol. Soc. Am. 94, 531-540.

Michaud, J.P., 2004. Natural mortality of Asian citrus psyllid (Homoptera: Psyllida) in central Florida. Biol. Control 29, 260-269.

Montesinos, E., 2003. Development, registration and commercialization of microbial pesticides for plant protection. Int. Microbiol. 6, 245-252.

Moran, N.A., Degnan, P.H., 2006. Functional genomics of Buchnera and the ecology of aphid hosts. Mol. Ecol. 15, 1251-1261.

Nakabachi, A., Ishikawa, H., Kudo, T., 2003. Extraordinary proliferation of microorganisms in aposymbiotic pea aphids, Acyrthosiphon pisum. J. Invertebr. Pathol. 82, 152-161

Nam, K.S., Jo, Y.S., Kim, Y.H., Hyun, J.W., Kim, H.W., 2001. Cytotoxic activities of acetoxyscirpenediol and ergosterol peroxide from Paecilomyces tenuipes. Life Sci. 69, 229-237.

Nedelcu, A.M., 2001. Complex patterns of plastic 16S rRNA gene evolution in nonphotosynthetic green algae. J. Mol. Evol. 53, 670-679.

Nikoh, N., Fukatsu, T., 2000. Interkingdom host jumping underground: phylogenetic analysis of entomoparasitic fungi of the genus Cordyceps. Mol. Biol. Evol. 17, 629-638.

O’Neill, S.L., Hoffmann, A.A., Werren, J.H., 1997. Influential Passengers: Inherited Microorganisms and Arthropod Reproduction. Oxford University Press, Inc. New York, NY.

138

Onions, A.H.S., 1979. Paecilomyces fumorosoreus [Descriptions of fungi and bacteria]. IMI Descr. Fungi Bacteria. 61, Sheet 614.

Pedigo, L.P., Rice, M.E., 2006. Entomology and Pest Management. Pearson Prentice Hall. Upper Saddle River, NJ, USA. pp 110.

Pell, J.K., Vandenberg, J.D., 2002. Interactions among the aphid Diuraphis noxia, the entomopathogenic fungus Paecilomyces fumosoroseus and the coccinellid Hippodamia convergens. Biocontrol Sci. Techn. 12, 217-224.

Pintureau, B., Bolland, P., 2001. A Trichogramma species showing a better adaptation to high temperature than its symbionts. Biocontrol Sci. Technol. 11, 12-20.

Pintureau, B., Chapelle, L., Delobel, B., 1999. Effects of repeated thermic and antibiotic treatments on a Trichogramma (Hym., Trichogrammatidae) symbiont. J. Appl. Entomol. 123, 473-483.

Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817-818.

Purvis, G., Chauzat, M.P. Segonds-Pichon, A., Dunne, R., 2002. Life history and phenology of the eucalyptus psyllid, Ctenarytaina eucalypti in Ireland. Ann. Appl. Biol. 141, 283-292.

Puterka, G.J., 1999. Fungal pathogens for arthropod pest control in orchard systems: mycoinsecticidal approach for pear psylla control. BioControl 44, 183-210.

Quattlebaum, E.C., Carner, G.R., 1980. A technique for preparing Beauveria spp. for scanning electron microscopy. Can. J. Botany 58, 1700-1703.

Rae, D.J., Liang, W.G., Watson, D.M., Beattie, G.A.C., Huang, M.D., 1997. Evaluation of petroleum spray oils for control for the Asian citrus psylla, Diaphorina citri (Kuwayama) (Hemiptera: Psyllidae), in China. Int. J. Pest Manage. 43, 71-75.

Rehner, S.A., Samuels, G.J., 1995. Molecular systematics of the Hypocreales: a telomorph gene phylogeny and the status of their anamorphs. Can. J. Botany 73, S816-S823.

Rivero-Aragon, A., Grillo-Ravelo, H., 2000. Natural enemies of Diaphorina citri Kuwayama (Homoptera: Psyllidae) in the central region of Cuba. Centro-Agricola 27, 87-88 (Abstract only).

Rogers, M.E., Timmer, L.W., 2007. Florida citrus pest management guide update. Citrus Ind. 88(1), 11-12.

Roistacher, C.N., 1996. The economics of living with citrus diseases: Huanglongbing (Greening) in Thailand. In Proc. 13th Conf. Int. Org. Citrus Virologists, (J. V. da Graca, P. Moreno, and R. K. Yokomi, Eds.), pp. 395-398. Internat. Org. Citrus Virologists, Riverside, CA.

139

Rombach, M.C., Roberts, D.W., 1987. Calcarisporium ovalisporum, symbiotic with the insect pathogen Hirsutella citriformis. Mycologia 79, 153-155.

Sajap, A.S., 1993. Prevalence of an entomopathogenic fungus, Hirsutella citriformis on leucaena psyllid, Heteropsylla cubana, in Malaysia. Pertanika J. Trop. Agric. Sci. 16, 95-99.

Samson, R.A., 1974. Paecilomyces and some allied Hyphomycetes. Stud. Mycol. 6, 1-119.

SAS Institute, 1996. SAS/STAT software; changes and enhancements through release 6.11.1996. SAS Institute, Cary, NC, USA.

Shafee, S.M., Alam, S.M., Agarwal, M.M., 1975. Taxonomic survey of encyrtid parasites (Hymenoptera Encyrtidae) in India. In Aligarh Muslim University Publication (Zoological Series) on Indian Insect Types (S. M. Alam, Ed.), pp. 91-93. Aligarh, India.

Shivankar, V.J., Rao, C.N., Singh, S., 2000. Studies on citrus psylla, Diaphorina citri Kuwayama: a review. Agricultural Reviews (Karnal, India). 21, 199-204.

Singaravelu, B., Easwaramoorthy, S., Premachandran, M.N., 2003. Epizootics of a fungal pathogen, Hirsutella citriformis Speare, on sugarcane leaf hopper, Pyrilla perpusilla (Walker). Insect Environ. 9, 62-63.

Skelley, L.H., Hoy, M.A., 2004. A synchronous rearing method for the Asian citrus psyllid and its parasitoids in quarantine. Biol. Control 29, 14-23.

Smilanick, J.L., Mansour, M.F., Gabler, F.M., Goodwine, W.R., 2006. The effectiveness of pyrimethanil to inhibit germination of Penicillium digitatum and to control citrus green mold after harvest. Posthar. Biol. Technol. 42, 75-85.

Smith, P., 1993. Control of Bemisia tabaci and the potential of Paecilomyces fumosoroseus as a biopesticide. Biocontr. News Infor. 14, 71-78.

Sosa Gomez, D.R., 1991. Production of three Hirsutella thompsonii varieties on semi-solid media and differential effects of two fungicides. Ann. Soc. Entomol. Brasil. 20, 155-163.

Stansly, P.A., Rogers, M.E., 2006. Managing Asian citrus psyllid populations. Citrus Ind. 87(3), 17-19.

Stouthamer, R., Breeuwer, J.A., Hurst, G.D.G., 1999. Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annu. Rev. Microbiol. 53, 71-102.

Stouthamer, R., Luck, R.F., Hamilton, W.D., 1990. Antibiotics cause parthenogenetic Trichogramma to revert to sex. Proc. Nat. Acad. Sci. USA. 87, 2424-2427.

Stouthamer, R., Mak, F., 2002. Influence of antibiotics on the offspring production of the Wolbachia-infected parthenogenetic parasitoid Encarsia formosa. J. Invertebr. Pathol. 80, 41-45.

140

Subandiyah, S., Nikoh, N., Sato, H., Wagiman, F., Tsuyumyu, S., Fukatsu, T., 2000a. Isolation and characterization of two entomopathogenic fungi attacking Diaphorina citri (Homoptera, Psylloidea) in Indonesia. Mycoscience 41, 509-513.

Subandiyah, S.N., Nikoh, N., Tsuyumu, S., Somowiyarjo, S., Fukatsu, T., 2000b. Complex endosymbiotic microbiota of the citrus psyllid Diaphorina citri (Homoptera: Psylloidea). Zool. Sci. 17: 983-989.

Swofford, D.L., 2001. Phylogenetic analysis using parsimony (*and other methods) Version 4. Sinauer Associates, Sunderland, MA.

Tagami, Y., Miura, K., Stouthamer, R., 2002. Positive effect of fertilization on the survival rate of immature stages in a Wolbachia-associated thelytokous line of Trichogramma deion and T. kaykai. Entomol. Exp. Appl. 105, 165-167.

Tartar, A., Boucias, D., Adams, B, Becnel, J., 2002. Phylogenetic analysis identifies the invertebrate pathogen Helicosporidium sp. as a green algae (Chlorophyta). Int. J. Syst. Evol. Micr. 52, 273-279.

Tedeschi, R., Alma, A., 2004. Transmission of apple proliferation phytoplasma by Cacopsylla melanoneura (Homoptera: Psyllidae). J. Econ. Entomol. 97, 8-13.

Tedeschi, R., Bosco, D., Alma, A., 2002. Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae), a vector of apple proliferation phytoplasma in Northwestern Italy. J. Econ. Entomol. 95, 544-551.

Teixeira, D.D.C., Saillard, C., Eveillard, S., Danet, J.L., Costa, P.I.D.C., Ayres, A.J., Bové, J., 2005. ‘Candidatus Liberibacter americanus’, associated with citrus huanglongbing (greening disease) in São Paulo State, Brazil. Int. J. Syst. Evol. Microbiol. 55, 1857-1862.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided. Nucleic Acids Res. 24, 4876-482.

Timmer, L.W., Graham, J.H., Chamberlain, H.L., 2006. Fundamentals of citrus canker management. Citrus Ind. 87(6), 12-15.

Triplehorn, C.A., Johnson, N.F., 2005. Borror and DeLong’s Introduction to the Study of Insects. Thomson Brooks/Cole. Belmont, CA, USA. pp. 317-318.

Tsai, J.H., Wang, J.H. Liu, Y.H., 2000. Sampling of Diaphorina citri (Homoptera: Psyllidae) on orange jessamine in Southern Florida. Fla. Entomol. 83, 446-459.

Tsai, J. H., Wang, J. J. Liu, Y. H., 2002. Seasonal abundance of the Asian citrus psyllid, Diaphorina citri (Homoptera: Psyllidae) in Southern Florida. Fla. Entomol. 85, 446-451.

Van Borm, S., Billen, J., Boomsma, J.J., 2002. The diversity of microorganisms associated with Acromyrmex leafcutter ants. BMC Evol. Biol. 2, 9.

141

Vidal, C., Osborne, L.S., Lacey, L.A, Fargues, J., 1998. Effect of host plant on the potential of Paecilomyces fumosoroseus (Deuteromycotina: Hyphomycetes) for controlling the silverleaf whitefly, Bemisia argentifolii (Homopatera: Aleyrodidae) in greenhouses. Biol. Control. 12, 191-199.

Villacarlos, L.T., Robin, R.P., 1999. Entomogenous fungi infecting Heteropsylla cubana Crawford (Homoptera: Psyllidae) in Leyte, Philippines. Trop. Pest Man. 35, 120-122.

Villechanoux, S.M., Garnier, M., Laigret, J., Renaudin, Bové, J.M., 1993. The genome of the non-cultured, bacterial-like organism associated with citrus greening disease contains the nusG-rplKAJL-rpoBC gene cluster and the gene for a bacteriophage type DNA polymerase. Curr. Microbiol. 26, 161-166.

Vossbrinck, C.R., Andreadis, T.G., Vavra, J., Becnel, J.J., 2004. Molecular phylogeny and evolution of mosquito parasitic microsporidia (Microsporidia: Amblyosporidae). J. Eukaryot. Microbiol. 51, 88-95.

Waterston, J., 1922. On the chalicid parasites of Psyllidae. Bull. Entomol. Res. 13, 41-58.

Weisburg, W. G., Barns, S. M., Pelletier, D. A., Lane, D. J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697-703.

Werren, J.H., O’Neill, S.L., 1997. The evolution of heritable symbionts. In Influential Passengers: Inherited Microorganisms and Arthropod Reproduction. Eds. O’Neill, S.L., Hoffmann, A.A., Werren, J.H. Oxford University Press, New York, NY. pp. 1-41.

Wineriter, S.A., Buckingham, G.R., Frank, J.H., 2003. Host range of Boreioglycaspis melaleucae Moore (Hemiptera: Psyllidae), a potential biocontrol agent of Melaleuca quinquenervia (Cav.) S. T. Blake (Myrtaceae), under quarantine. Biol. Control 27, 273-292.

Woods, C., 2002. Florida’s $9 billion citrus powerhouse. In Impact: the University of Florida Institute of Food and Agricultural Sciences, 19 (1), pp. 4-9. Inst. Food and Agric. Sci., Univ. Florida.

Wooler, A., Padgham, D., Arafat, A., 1974. Outbreaks and new records. Saudi Arabia. Diaphorina citri on citrus. FAO Plant Prot. Bull. 22, 93-94.

Xie, P.H., Su, C., Lin, Z.G., 1988. A preliminary study on an entomogenous fungus [Verticillium lecanii] of Diaphorina citri Kuwayama (Hom.: Psyllidae). Chinese J. Biol. Control 4, 92.

Yang, Y., 1989. Influence of light, temperature, and humidity on the development, reproduction and survival of citrus psylla. Acta Ecol. Sinica. 9, 348-354.

Yang, Z., Goldman, N., Friday, A., 1994. Comparison of models for nucleotide substitution used in maximum-likelihood phylogenetic estimation. Mol. Biol. Evol. 11, 316-324.

142

Yang, Y., Huang, M., Beattie, G.A.C., Xia, Y., Ouyang, G., Xiong, J., 2006. Distribution, biology, ecology and control of the psyllid Diaphorina citri Kuwayama, a major pest of citrus: A status report for China. Int. J. Pest Manage. 52, 343-352.

Zhang, N., Suh, S.O., Blackwell, M., 2003. Microorganisms in the gut of beetles: evidence from molecular cloning. J. Invertebr. Pathol. 84, 226-23.

143

BIOGRAPHICAL SKETCH

Jason Michael Meyer was born 28 March 1976 in Paynesville, Minnesota. Upon graduation from Paynesville Area High School in 1994, he began his undergraduate studies at

Concordia College in Moorhead, Minnesota. After transferring to the University of Minnesota

(Duluth) in 1996, he received his bachelor’s degree in biology in 1998. He then moved to

Lafayette, Indiana and obtained a Master of Science degree in entomology from Purdue

University in 2002. He was employed at the University of Florida, Department of Pediatrics, for the remainder of 2002 and then enrolled in a Ph.D. program under the supervision of Dr.

Marjorie A. Hoy in the Department of Entomology and Nematology at the University of Florida in 2003. In June 2003, Jason married Jennifer L. Steill. He currently is a member of the Florida

Entomological Society, the Entomological Society of America,and the Society for Invertebrate

Pathology.

144