DOCSLIB.ORG

Parasites and Vector-Borne Pathogens of Southern Plains Woodrats (Neotoma Micropus) from Southern Texas

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Parasites and Vector-Borne Pathogens of Southern Plains Woodrats (Neotoma Micropus) from Southern Texas Parasitol Res (2012) 110:1855–1862 DOI 10.1007/s00436-011-2710-z ORIGINAL PAPER Parasites and vector-borne pathogens of southern plains woodrats (Neotoma micropus) from southern Texas Roxanne A. Charles & Sonia Kjos & Angela E. Ellis & J. P. Dubey & Barbara C. Shock & Michael J. Yabsley Received: 14 August 2011 /Accepted: 6 November 2011 /Published online: 23 November 2011 # Springer-Verlag 2011 Abstract From 2008 to 2010, southern plains woodrats reaction (PCR) testing of blood samples from 104 woodrats (Neotoma micropus) from southern Texas, were examined detected a novel Babesia sp. in one (1%) and Hepatozoon for parasites and selected pathogens. Eight helminth species sp. in 17 (16%) woodrats. Partial 18S rRNA gene sequence were recovered from 97 woodrats including, Trichuris of the Babesia was 94% similar to B. conradae. Histologic neotomae from 78 (prevalence = 80%), Ascarops sp. from examination of tissues detected intestinal coccidia in seven 42 (43%), Nematodirus neotoma from 31 (32%), Raillietina of 104 (7%), Sarcocystis neotomafelis in 26 (25%), sp. from nine (9%), Taenia taeniaeformis larvae from eight Hepatozoon sp. in 21 (20%), and Dunnifilaria meningica (8%), and an unidentified spiurid, a Scaphiostomum sp. and in four (4%) woodrats. Three woodrats (5%) were a Zonorchis sp. each from a single woodrat. Besnotia seropositive for Toxoplasma gondii. Ectoparasites recov- neotomofelis was detected in three (3%) woodrats and ered included fleas (Orchopeas sexdentatus and O. neo- microfilaria were detected in seven (7%). Polymerase chain tomae), ticks (Ixodes woodi and Ornithodoros turicata), mites (Trombicula sp. and Ornithonyssus (Bdellonyssus) bacoti) and bot flies (Cuterebra sp.). The only difference in R. A. Charles : B. C. Shock : M. J. Yabsley Southeastern Cooperative Wildlife Disease Study, prevalence related to gender was for N. neotoma (males> Department of Population Health, College of Veterinary Medicine, females, p=0.029). Prevalence of T. neotomae and all University of Georgia, intestinal parasites combined was significantly higher in 589 DW Brooks Drive, Wildlife Health Building, adults compared with juveniles (p=0.0068 and p=0.0004), Athens, GA 30602, USA respectively. Lesions or clinical signs were associated with S. Kjos Cuterebra and B. neotomofelis. Collectively, these data Marshfield Clinic Research Foundation, indicate that woodrats from southern Texas harbor several Marshfield, WI 54449, USA parasites of veterinary and/or medical importance. A. E. Ellis Athens Diagnostic Laboratory, College of Veterinary Medicine, University of Georgia, Introduction Athens, GA 30602, USA J. P. Dubey The southern plains woodrat (Neotoma micropus), com- United States Department of Agriculture, Agricultural Research monly called a packrat, is a medium-sized, nocturnal rodent Service, Animal and Natural Resources Institute, that inhabits semiarid brush lands, low valleys and plains of Animal Parasitic Diseases Laboratory, the south-central and southwestern United States and Building 1001, Beltsville, MD 20705, USA northeastern Mexico. In Texas, N. micropus inhabits areas : dominated by thorny desert shrubs or cacti (Braun and B. C. Shock M. J. Yabsley (*) Mares 1989), and their diet consists mainly of vegetation Daniel B. Warnell School of Forestry and Natural Resources, such as succulent leaves and fruit of cacti, seeds and acorns University of Georgia, Athens, GA 30602, USA (Raun 1966). Woodrats (Neotoma spp.) are common hosts e-mail: [email protected] for ticks and fleas which are potential vectors of tularemia 1856 Parasitol Res (2012) 110:1855–1862 (Francisella tularensis), plague (Yersinia pestis), Q fever were selected based on fresh tracks and rodent droppings at (Coxiella burnetti), relapsing fever (Borrelia spp.) and the base of presumed woodrat nests built among cactus Rocky Mountain spotted fever (Rickettsia rickettsi). Other (Opuntia spp.) plants. Traps were set in the afternoon and pathogenic organisms reported from woodrats include checked the following morning. Trypanosoma cruzi (causative agent of Chagas disease in humans and domestic animals), Besnoitia neotomofelis, and Anesthesia and blood collection Leishmania mexicana (McHugh et al. 1990; Dubey and Yabsley 2010; Pinto et al. 2010). Captured animals were anesthetized and weighed. Briefly, Although numerous studies have looked at the ectoparasitic woodrats were anesthetized with 100 mg/kg ketamine (Fort fauna of woodrats in Texas, to date, only a few studies have Dodge Laboratories, Fort Dodge, IA) followed by blood looked at endoparasites of southern plains woodrats. Collec- collection via cardiocentesis into potassium ethylenediami- tively, in the United States and Mexico, only nine species have netetraacetic acid (K2EDTA) BD Vacutainer® tubes (Beckton been reported including: Taenia taeniaeformis, Litomosoides Dickinson, Franklin Lakes, NJ) using aseptic techniques. In carinii, Dunnifilaria meningica, Trichuris muris, L. mexicana, 2010, blood smears were made with fresh blood, air-dried, Try. cruzi, Try. neotomae, Sarcocystis neotomafelis,andB. fixed in absolute alcohol for 5 min, and stained with Geimsa neotomofelis (Packchanian 1942; Johnson 1966; Burkholder stain. All animals were euthanized by cervical dislocation et al. 1980; Gutierrez-Pena 1989; Galaviz-Silva et al. 1991; and adult and juvenile (not pups) were then necropsied and Pinto et al. 2010; Charles et al. 2011). Because higher examined for parasites. All techniques were reviewed and diversities of parasites have been reported in other species of approved by the IACUC committee at the University of woodrats in the southwestern United States, we conducted this Georgia. study to better understand the endo- and ectoparasitic fauna of southern plains woodrats from Uvalde County, Texas. Parasite collection and identification Each woodrat was examined for ectoparasites by combing Materials and methods back the fur and collecting specimens with fine forceps. Collected ectoparasites were preserved in 100% ethanol. Trapping Bot-fly larvae were removed by gentle traction with forceps and characterized using polymerase chain reaction (PCR) A total of 104 southern plains woodrats (56 females and 48 and sequencing of two regions of the cytochrome oxidase males) were trapped during July 2008 and March and May subunit I (COI) gene as described in Table 1. Fleas, mites, 2010 at four sites in Uvalde County, Texas. Animals were and ticks were mounted on slides using saline solution and live trapped by small squirrel cage traps (Havahart, Litz, identified to species with a light microscope and published PA) and large Sherman traps (H.B. Sherman Traps, taxonomic keys (Eads 1950; Keirans and Litwak 1989; Tallahassee, FL) baited with dried apricots. Trap stations Lewis 2000; Haas et al. 2004). Table 1 Oligonucleotide primers used in polymerase chain reaction assays Target organisma Gene target Primer Primer sequence (5′–3′) Reference Babesia/Hepatozoon (1°) 18S rRNA 3.1 CTCCTTCCTTTAAGTGATAAG Yabsley et al. (2005) Babesia/Hepatozoon (1°) 18S rRNA 5.1 CCTGGTTGATCCTGCCAGTAGT Yabsley et al. (2005) Babesia/Hepatozoon (2°) 18S rRNA RLBH-F GAGGTAGTGACAAGAAATAACAATA Yabsley et al. (2005) Babesia/Hepatozoon (2°) 18S rRNA RLBH-R TCTTCGATCCCCTAACTTTC Yabsley et al. (2005) Rickettsia (1°) 17 kDa antigen 17 k-3 TGTCTATCAATTCACAACTTGCC Labruna et al. (2004) Rickettsia (1°) 17 kDa antigen 17 k-5 GCTTTACAAAATTCTAAAAACCATATA Labruna et al. (2004) Rickettsia (2°) 17 kDa antigen 17Kd1 GCTCTTGCAACTTCTATGTT Labruna et al. (2004) Rickettsia (2°) 17 kDa antigen 17kD2 CATTGTTCGTCAGGTTGGCG Labruna et al. (2004) Cuterebra Cytochrome oxidase I (COI) C1-J-2183 CAACATTTATTTTGATTTTTTGG Noël et al. (2004) C1-N-2659 GCTAATCCAGTGAATAATGG C2-J-3138 AGAGCTTCACCCTTAATAGAGCAA C2-N-3661 CCACAAATTTCTGAACATTGACCA a 1°, primers used in the primary amplification; 2°, primers used in secondary amplification of a nested PCR protocol Parasitol Res (2012) 110:1855–1862 1857 During necropsy, the viscera of all woodrats were set of DNA extractions, and one water control for each set of grossly examined for the presence of parasites such as primary and secondary PCR reactions. Amplicons were Taenia and Besnoitia cysts. The entire length of gastroin- visualized by trans-illumination of an ethidium bromide- testinal tract and some organs (pancreas, liver, and spleen) stained 1.5% agarose gel. were removed from the abdominal cavity, dissected under a dissecting scope, and closely examined for helminths. Statistical analyses Contents were filtered through a 100 μm sieve (W.S. Tyler Incorporated, Mentor, OH) for concentration of parasites. Parasite prevalence, intensity and range were calculated as All parasites were stored in 100% ethanol and examined defined by Bush et al. (1997). Fisher’s exact test was used under a light or dissecting microscope for identification. to test for differences in parasite prevalence (by species and Large nematodes were cleared with a 70% ethanol/30% collectively) among age classes and gender. A two-way phenol solution. analysis of variance (ANOVA) implemented by SAS, was used to determine if gastrointestinal nematode intensity Histopathology varied according to age and/or gender. Tissue samples including brain, lung, liver, heart, kidney, spleen, lymph nodes, quadriceps, gonads and sections of Results the gastrointestinal tract were preserved in 10% buffered formalin for histopathological examination. Small sections A total of nine helminth species were recovered from of formalin-fixed tissues were embedded in paraffin,
Load more

Recommended publications
  • Genetic Evidence for a Tacaribe Serocomplex Virus, Mexico
    blood, samples of kidney and other solid tissues, and the Genetic Evidence skins and skeletons of the rodents were deposited into the Museum of Texas Tech University. for a Tacaribe The blood samples were tested by ELISA (10) for anti- body (immunoglobulin [Ig] G) to Whitewater Arroyo virus Serocomplex strain AV 9310135 (7). Samples of spleen and kidney from white-toothed woodrats TK133448 and TK133451, 7 oth- Virus, Mexico er white-toothed woodrats, 2 antibody-positive Nelson’s Catherine C. Inizan, Maria N. B. Cajimat, pocket mice (Chaetodipus nelsoni), and an antibody-pos- Mary Louise Milazzo, Artemio Barragán-Gomez, itive Merriam’s kangaroo rat (Dipodomys merriami) were Robert D. Bradley, and Charles F. Fulhorst tested for arenavirus by cultivation in monolayers of Vero E6 cells (11). Samples of kidney from the antibody-positive We isolated arenavirus RNA from white-toothed wood- rodents were tested for arenavirus RNA by using hemin- rats (Neotoma leucodon) captured in a region of Mexico in ested PCR assays. The fi rst-strand cDNA for the PCR was which woodrats are food for humans. Analyses of nucleotide synthesized by using SuperScript II Reverse Transcriptase and amino acid sequence data indicated that the woodrats were infected with a novel Tacaribe serocomplex virus, pro- (Invitrogen Life Technologies, Inc., Carlsbad, CA, USA) posed name Real de Catorce virus. in conjunction with oligont 19C-cons (2). The nucleotide sequence alignments were analyzed by using MRBAYES 3.1.2 (12) in the computer software package PAUP*, ver- he Tacaribe serocomplex (family Arenaviridae, ge- sion 4.0b10 (http://paup.csit.fsu.edu).
    [Show full text]
  • *For More Information, Please See
    Common Name Scientific Name Health Point Specifies-Specific Course(s)* Bat, Frog-eating Trachops cirrhosus AN0023 3198 3928 Bat, Fruit - Jamaican Artibeus jamaicensis AN0023 3198 3928 Bat, Mexican Free-tailed Tadarida brasiliensis mexicana AN0023 3198 3928 Bat, Round-eared - stripe-headed Tonatia saurophila AN0023 3198 3928 Bat, Round-eared - white-throated Lophostoma silvicolum AN0023 3198 3928 Bat, Seba's short-tailed Carollia perspicillata AN0023 3198 3928 Bat, Vampire - Common Desmodus rotundus AN0023 3198 3928 Bat, Vampire - Lesser False Megaderma spasma AN0023 3198 3928 Bird, Blackbird - Red-winged Agelaius phoeniceus AN0020 3198 3928 Bird, Brown-headed Cowbird Molothurus ater AN0020 3198 3928 Bird, Chicken Gallus gallus AN0020 3198 3529 Bird, Duck - Domestic Anas platyrhynchos AN0020 3198 3928 Bird, Finch - House Carpodacus mexicanus AN0020 3198 3928 Bird, Finch - Zebra Taeniopygia guttata AN0020 3198 3928 Bird, Goose - Domestic Anser anser AN0020 3198 3928 Bird, Owl - Barn Tyto alba AN0020 3198 3928 Bird, Owl - Eastern Screech Megascops asio AN0020 3198 3928 Bird, Pigeon Columba livia AN0020 3198 3928 Bird, Quail - Japanese Coturnix coturnix japonica AN0020 3198 3928 Bird, Sparrow - Harris' Zonotrichia querula AN0020 3198 3928 Bird, Sparrow - House Passer domesticus AN0020 3198 3928 Bird, Sparrow - White-crowned Zonotrichia leucophrys AN0020 3198 3928 Bird, Sparrow - White-throated Zonotrichia albicollis AN0020 3198 3928 Bird, Starling - Common Sturnus vulgaris AN0020 3198 3928 Cat Felis domesticus AN0020 3198 279 Cow Bos taurus
    [Show full text]
  • Presentation Abstracts/Resúmenes De Presentaciones
    1 PRESENTATION ABSTRACTS/RESÚMENES DE PRESENTACIONES WILKS AWARD COMPETITION/COMPETICIÓN PARA EL PREMIO WILKS W1 BIRD OCCUPANCY IN RELATION TO HABITAT STRUCTURE IN THE OAK SAVANNA CROSS TIMBERS OF KANSAS, USA / OCUPACION DE PAJAROS EN RELACION A ESTRUCTURAS DE HABITAT EN EL ROBLE SABANA A TRAVES DE BISQUES DE KANSAS, USA Nathan S. Holoubek and William E. Jensen Department of Biological Sciences, Emporia State University, 1200 Commercial Ave, Emporia, KS 66801 Oak savanna, once widespread across central North America, has functionally vanished from most of its range. Our objective was to quantify avian habitat associations across a gradient from open-canopy oak savanna to closed-canopy forest in the Cross Timbers region of southeastern Kansas. Using 2012 point-count data, we modeled species-specific detection (p) and occupancy (ψ) probabilities against vegetative variables using program Presence. We first established the best p predictors and then used these when modeling ψ. Of 28 species modeled, ψ for 7 was strongly associated with vegetative variables. Occupancies of Contopus virens, Polioptila caerulea, and Passerina cyanea peaked at intermediate tree densities or canopy coverages. Icterus spurius, Spiza americana, and Spizella pusilla occupancies were highest at low tree densities or canopy coverages. These species might benefit from reductions in tree density within otherwise closed-canopy forest. Moderate habitat relationships with ψ were found for three other species. Point counts will resume in 2013. Quantifying bird habitat use in oak savanna will be useful in guiding future savanna restoration for avian conservation. Roble Sabana, una vez extendido a traves de Norte America central, ha funcionalmente desaparecido en la mayoria de su extension.
    [Show full text]
  • PROCEEDINGS of the OKLAHOMA ACADEMY of SCIENCE Volume 98 2018
    PROCEEDINGS of the OKLAHOMA ACADEMY OF SCIENCE Volume 98 2018 EDITOR: Mostafa Elshahed Production Editor: Tammy Austin Business Manager: T. David Bass The Official Organ of the OKLAHOMA ACADEMY OF SCIENCE Which was established in 1909 for the purpose of stimulating scientific research; to promote fraternal relationships among those engaged in scientific work in Oklahoma; to diffuse among the citizens of the State a knowledge of the various departments of science; and to investigate and make known the material, educational, and other resources of the State. Affiliated with the American Association for the Advancement of Science. Publication Date: January 2019 ii POLICIES OF THE PROCEEDINGS The Proceedings of the Oklahoma Academy of Science contains papers on topics of interest to scientists. The goal is to publish clear communications of scientific findings and of matters of general concern for scientists in Oklahoma, and to serve as a creative outlet for other scientific contributions by scientists. ©2018 Oklahoma Academy of Science The Proceedings of the Oklahoma Academy Base and/or other appropriate repository. of Science contains reports that describe the Information necessary for retrieval of the results of original scientific investigation data from the repository will be specified in (including social science). Papers are received a reference in the paper. with the understanding that they have not been published previously or submitted for 4. Manuscripts that report research involving publication elsewhere. The papers should be human subjects or the use of materials of significant scientific quality, intelligible to a from human organs must be supported by broad scientific audience, and should represent a copy of the document authorizing the research conducted in accordance with accepted research and signed by the appropriate procedures and scientific ethics (proper subject official(s) of the institution where the work treatment and honesty).
    [Show full text]
  • Updated and Revised Checklist of the Mammals of Oklahoma, 2019
    1 Updated and Revised Checklist of the Mammals of Oklahoma, 2019 William Caire Biology Department, University of Central Oklahoma, Edmond, OK 73031 Lynda Samanie Loucks Biology Department, University of Central Oklahoma, Edmond, OK 73031 Michelle L. Haynie Biology Department, University of Central Oklahoma, Edmond, OK 73031 Brandi S. Coyner Sam Noble Oklahoma Museum of Natural History, Department of Mammalogy, Norman, OK 73072 Janet K. Braun Sam Noble Oklahoma Museum of Natural History, Department of Mammalogy, Norman, OK 73072 Abstract: An updated list of the mammals of Oklahoma was compiled from literature records, sight records, and museum specimens. A total of 108 native species, 4 extirpated species, and 5 introduced/exotic species are reported. jugossicularis, and Perognathus merriami), not Introduction included in the most recent checklist of Choate and Jones (1998), have been verified as occurring in the state. Choate and Jones (1998) included In a checklist of mammals of Oklahoma the domestic dog and cat as introduced/exotic (Caire et al. 1989), a total of 106 species of species which we did not. This document has mammals were listed as occurring in Oklahoma, been created in part to assist those working with including 4 extirpated and 4 introduced species. the many different and varied aspects related to In 1998, an updated checklist was published the state’s mammals. It will provide a common (Choate and Jones 1998) listing 111 species point of reference and terminology. of mammals including 4 extirpated and 7 introduced/exotic species. Since the publication Methods by Caire et al. (1989) and the updated checklist of Choate and Jones (1998), there have been To compile the updated list, we began with several changes in distributional occurrences Caire et al.
    [Show full text]
  • Mammals of Colorado, Second Edition
    1 Environments of Colorado Mammals are a familiar and important component of understand the distribution and abundance of mammals Earth’s biodiversity. Biodiversity is the kinds of organisms and the details of their daily lives we must fi rst understand and their genetic and ecological relationships—an evolu- the resource base, the mosaic of Colorado’s environments tionary and ecological phenomenon in space and time (E. in space and time. Wilson 1992). The mammalian fauna of Colorado is a fas- cinating piece of that whole. To understand the diversity of mammals we need to have a perspective of the ecosphere more generally. Such a perspective is the purpose of this Geography chapter, with a focus on environments of Colorado. Colorado is known for its scenic beauty—from majes- From the standpoint of political geography, Colorado is tic mountain peaks and rushing white rivers tumbling simple: it is roughly rectangular (if we neglect some minor down dark canyons, to red-rock deserts and ceaselessly old surveyors’ errors and the fact that Earth is spherical), shifting sand dunes, to the expansive sweep of the short- measuring approximately 607 km by 444 km (377 by 276 grass prairie. Grandeur is wherever we stop to appreciate mi.) and encompassing some 270,000 km2 (104,000 sq. mi.). it, at every scale, from canyons carved in crystalline rocks Colorado lies between approximately 102° and 109° west 2 billion years old, to bold peaks sculpted by the glaciers longitude and 37° and 41° north latitude, and is subdi- of the last Ice Age, to last night’s furtive trail of a mouse vided into 64 counties (Map 1-1).
    [Show full text]
  • Stable Grassland Ecosystem
    This file was created by scanning the printed publication. Errors identified by the software have been corrected; however, some errors may remain. Chapter 5 Desert Grassland and Shrubland Ecosystems Samuel R. Loftin, USDA Forest Service, Rocky Mountain Forest and Range Experiment Station, Albuquerque, New Mexico Richard Aguilar, Sandia National Laboratories, Albuquerque, New Mexico Alice L. Chung-MacCoubrey, USDA Forest Service, . Rocky Mountain Forest and Range Experiment Station, Albuquerque, New MexIco Wayne A. Robbie, USDA Forest Service, Watershed an~ Air Management Staff, Region 3, Albuquerque, New MexIco INTRODUCTION taken from a review by Dick-Peddie (1993). The ex­ tensive grasslands and shrublands of North America The productivity, stability, and health of the Middle developed in response to climate change and the Rio Grande Basin, arid and semiarid grassland and uplifting of the western mountain ranges, includ.ing shrub land ecosystems depend upon complex inter­ the Rocky, Cascade, and Sierra Nevada Mountains, actions. These relationships occur between factors which began in the early to mid-Tertiary period (65- such as climate, domestic livestock, and wildlife use, 26 million years ago). The vegetation of North and human activities such as urban development, ag­ America early in the Tertiary period has been riculture, and recreation. These grassland/ shrubland grouped into three major geoflora.s. The Artc~­ ecosystems are particularly sensitive to change because Tertiary Geoflora occupied cool, mOIst, upper latI­ they depend highly upon water availability. tudes, the Neotropical-Tertiary Geoflora occupied the Southwestern rangelands experienced heavy live­ warm, moist,lower latitudes, and the Madro-Tertiary stock grazing and human activities over the past cen­ Geoflora occupied intermediate, drier regions.
    [Show full text]
  • 2003 Baseline Inventory of Small Mammal Communities on The
    Baseline Inventory of Small Mammal Prey-base Communities on Carson National Forest, New Mexico A Final Contract R3-02-03-12 Completion Report Submitted by: Jennifer K. Frey, PhD Frey Biological Research 438 Diaz Rd. Las Cruces, New Mexico 88007 and Department of Fishery and Wildlife Sciences and Department of Biology New Mexico State University P.O. Box 30003, MSC 4901 Las Cruces, New Mexico 88003-8003 Submitted to: Carson National Forest 208 Cruz Alta Road Taos, New Mexico 87571 31 December 2003 Frey—Small mammal prey-base surveys 2 Table of Contents Executive Summary 3 Background and Purpose 6 Methods Field methods 6 Data analysis 9 Study Sites 10 Results and Discussion Terrestrial Small Mammal Communities General Patterns 14 Community Patterns 14 Species Patterns 20 Jicarilla District 25 Bats 26 Species Accounts 29 Recommendations 40 Acknowledgments 42 References 42 Appendix 1 44 Appendix 2: Mammals of Carson National Forest 45 Frey—Small mammal prey-base surveys 3 Executive Summary Purpose • The purpose of this study was to obtain baseline data about small mammal prey-base communities on Carson National Forest, especially with regards to prey of northern goshawk and Mexican spotted owl. Method • Small mammals were sampled in three major habitat types on Carson National Forest including ponderosa pine forest, mixed conifer forest, and riparian. Other minor habitat types found in proximity to the major habitat types were sampled as time and logistics allowed. • The primary inventory method was with Sherman live-traps; a minimum of 1,000 trap-nights was used in each major habitat type. Other sampling techniques (e.g., mist nets, gopher traps, and pitfalls) were used as time and logistics allowed.
    [Show full text]
  • Kills Rats, Mice & Meadow Voles*
    ™ CONTRACLABEL ® ALL-WEATHER BLOX ™ KILLS RATS, MICE & MEADOW VOLES* Kills Warfarin Resistant Norway Rats KEEP OUT OF REACH OF CHILDREN CAUTION See back panels for First Aid and additional precautionary statements. ACTIVE INGREDIENT: NET WT: Bromadiolone (CAS #28772-56-7): . 0.005% OTHER INGREDIENTS†: . 99.995% †Contains Denatonium Benzoate TOTAL 100.000% 18 lbs (8.2 kg) *Not permitted for use against the following species in California: Cotton rat, Eastern harvest mouse, Golden mouse, SPECIMANPolynesian rat, Meadow vole, White-throated woodrat, Southern plains woodrat, and Mexican woodrat. FIRST AID DIRECTIONS FOR USE (Continued from other panel) HAVE LABEL WITH YOU WHEN OBTAINING TREATMENT ADVICE IF SWALLOWED: Burrow baiting with Contrac All-Weather Blox is prohibited. • Call a poison control center, doctor, or 1-877-854-2494, or 1-800-858-7378** immediately for treatment advice. ® • Have person sip a glass of water if able to swallow. Do not place near or inside ventilation duct openings. Do not contaminate water, food, feedstuffs, food or feed handling • Do not induce vomiting unless told to do so by the poison control center or doctor. equipment, or milk or meat handling equipment or surfaces that come into direct contact with food. When used in USDA IF ON SKIN OR CLOTHING: inspected facilities, this product must be applied in tamper-resistant bait stations. Do not broadcast bait. Do not use this • Take off contaminated clothing. Rinse skin immediately with plenty of water for 15–20 minutes. CONTRAC product in sewers. • Call a poison control center or doctor for treatment advice. ALL-WEATHER BLOX ™ IF IN EYES: Do not sell this product in individual containers holding less than 16 pounds of bait.
    [Show full text]
  • Natural Resource Condition Assessment, Fort Union National
    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science Fort Union National Monument Natural Resource Condition Assessment Natural Resource Report NPS/FOUN/NRR—2011/440 ON THE COVER Shortgrass prairie at Fort Union National Monument. Photograph by Robert Bennetts. Fort Union National Monument Natural Resource Condition Assessment Natural Resource Report NPS/FOUN/NRR—2011/440 Authors Kristine Johnson, Teri Neville, and Jacqueline Smith Natural Heritage New Mexico Biology Department, MSC03 2020 1 University of New Mexico Albuquerque, New Mexico 87131 August 2011 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado publishes a range of reports that address natural resource topics of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate high-priority, current natural resource management information with managerial application. The series targets a general, diverse audience, and may contain NPS policy considerations or address sensitive issues of management applicability. All manuscripts in the series receive the appropriate level of peer review to ensure that the information is scientifically credible, technically accurate, appropriately written for the intended audience, and designed and published in a professional manner. This report received informal peer review by subject-matter experts who were not directly involved in the collection, analysis, or reporting of the data. Views, statements, findings, conclusions, recommendations, and data in this report do not necessarily reflect views and policies of the National Park Service, U.S.
    [Show full text]
  • Habitat Model for Species: Southern Plains Woodrat Distribution Map Habitat Map Neotoma Micropus Landcover Category
    Habitat Model for Species: Southern Plains Woodrat Distribution Map Habitat Map Neotoma micropus Landcover Category 12 - Sandsage Shrubland Braun and Mares, 1989 association chosen from habitat description in Mammalian Species account; usually inhabits rocky outcrops and shrubby grasslands, open areas dominated by short grass and cactus (Opuntia spp.), may also occupy rocky hillsides, ledges, or bluffs Choate and Terry, 1974 4 wood rats captured in rangeland - SUBOPTIMAL habitat Conditt and Ribble, 1997 Garner, 1974 Hill and Hibbard, 1943 McCulloch, 1962 most of the woodrats were captured in or near sand plum (Prunus angustifolia) or skunkbush (Rhus aromatica) as well as in sheds and other range buildings; woodrats relatively scarce in this habitat; MARGINAL habitat Thies and Caire, 1990 woodrat houses associated with two Opuntia spp., patches of cacti provided the greatest amount of cover near the ground, and they also provided the main foundation of the houses; cacti (Opuntia sp.) important source of food, water, shelter for woodrats 18 - Sand Prairie Yancey et al., 1995 22 - Mixed Prairie Hill and Hibbard, 1943 Windberg, 1998 Best et al., 1993 25 - Shortgrass Prairie Braun and Mares, 1989 association chosen from habitat description in Mammalian Species account; usually inhabits rocky outcrops, open areas dominated by short grass and cactus (Opuntia spp.), rocky hillsides, ledges, or bluffs; eats leaves, berries, roots, nuts, and seeds Choate and Terry, 1974 4 wood rats captured in rangeland - SUBOPTIMAL habitat Hill and Hibbard, 1943 Wu et al., 1996 19 woodrats captured; woodrat dens constructed of sticks, cacti, and other materials 37 - Winterfat - Blue Grama Prairie - not mapped Wu et al., 1996 3 wood rats captured; MARGINAL habitat Reference List 1.
    [Show full text]
  • Social Organization of <Em>Neotoma Micropus</Em>, the Southern
    Trinity University Digital Commons @ Trinity Biology Faculty Research Biology Department 4-1997 Social Organization of Neotoma micropus, the Southern Plains Woodrat Sarah A. Conditt Trinity University David O. Ribble Trinity University, [email protected] Follow this and additional works at: https://digitalcommons.trinity.edu/bio_faculty Part of the Biology Commons Repository Citation Conditt, S.A., & Ribble, D.O. (1997). Social organization of Neotoma micropus, the southern plains woodrat. American Midland Naturalist, 137(2), 290-297. doi:10.2307/2426848 This Article is brought to you for free and open access by the Biology Department at Digital Commons @ Trinity. It has been accepted for inclusion in Biology Faculty Research by an authorized administrator of Digital Commons @ Trinity. For more information, please contact [email protected]. Am. Midl. Nat. 137:290-297 Social Organizationof Neotoma micropus,the Southern Plains Woodrat SARAH A. CONDITT AND DAVID 0. RIBBLE Departmentof Biology, Trinity University, 715 StadiumDrive, San Antonio,Texas 78212 ABSTRACT.-This studydescribed the social organizationof Neotomamicropus, the southern plains woodrat,using radiotelemetry.We studied woodratsfrom September 1994 through April 1995 at the Urban WildernessReserve in S Bexar County,Texas. Sixteen individuals (threeadult males, 11 adult females,and twosubadult males) were radiocollaredand located in the eveningor earlymorning duringJanuary and February.Seventy-four percent of female radiolocationsand 57% of male radiolocationswere fromtheir respective nests. No more than one adult individualwas observed at any nest at the same time.Males had significantly larger(x = 1899 m2) home rangesthan females(x = 220 m2). Male home rangesoverlapped femalehome rangesmore (35.9%) thanfemale ranges overlapped other female home ranges (11.9%).
    [Show full text]