ACADEMY OF MARITIME EDUCATION AND TRAINING (AMET) (Declared as Deemed to be University u/s 3 of UGC Act 1956) 135, EAST COAST ROAD, KANATHUR, CHENNAI - 603 112. TAMILNADU, INDIA

IMPACT OF THE COVID-19 PANDEMIC ON CANCER PATIENTS AND ITS MANAGEMENT-THE UNTOLD STORY

A Report on Internship

In

Department of Marine Biotechnology

By NEETI KOTHARI AMBT19004

MAY 2020

1 | P a g e

INTERNSHIP CERTIFICATE

This is to certify that Ms. Neeti Kothari (Reg. No. AMBT19004) of M.Sc.,

Marine Biotechnology 1st Year II Semester has done the work titled ” Impact of the Covid-19 Pandemic on Cancer Patients And Its Management-The Untold Story” as a part of Home Based Internship for a partial fulfilment of academic records. She has taken 45 hours to complete the work and her report was found to be excellent.

Signature of the HOD Signature of the Mentor (Dr. L. Senthilnathan) (Dr. M. Jayaprakashvel)

INTERNSHIP ALLOCATION REPORT 2019-20 Name of the Department: Marine Biotechnology

(In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak)

Name of the Programme : M.Sc Marine Biotechnology Year of study and Batch/Group : I Year, Batch -12 Name of the Mentor : Dr. M. Jayaprakashvel Title of the assigned internship :

Impact of the Covid-19 Pandemic on Cancer Patients And Its Management-The Untold Story

Nature of Internship : Individual/Group

Reg No of Students who are assigned with this internship:

Reg. No. AMBT19004

Total No. of Hours Required to complete the Internship: 45 Hours

Signature of the Mentor Signature of the Internal Signature of HoD / Programme Examiner Head

INTERNSHIP EVALUATION REPORT 2019-20 Name of the Department: Marine Biotechnology (In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak) Name of the Student Neeti Kothari Register No and Roll No AMBT19004 Programme of study M.Sc Marine Biotechnology Year and Batch/Group I Year, Batch -12 Semester II Title of Internship Impact of the Covid-19 Pandemic on Cancer Patients And Its Management-The Untold Story Duration of Internship ………45……..Hours Mentor of the Student Dr. M. Jayaprakashvel Evaluation by the Department Sl Criterion Max. Marks Marks No. Allotted 1 Regularity in maintenance of the diary. 10 9 2 Adequacy & quality of information recorded 10 9 3 Drawings, sketches and data recorded 10 9 4 Thought process and recording techniques used 5 5 5 Organization of the information 5 5 6 Originality of the Internship Report 20 19 7 Adequacy and purposeful write-up of the Internship 10 9 Report 8 Organization, format, drawings, sketches, style, 10 9 language etc. of the Internship Report 9 Practical applications, relationships with basic theory 10 9 and concepts 10 Presentation Skills 10 10 Total 100 93

Signature of the Mentor Signature of the Internal Signature of HoD Examiner /Programme Head

CONTENTS

Sl. No. TITLE PAGE No.

1 ABSTRACT 4

2 INTRODUCTION 5

3 MATERIALS AND METHODS 7

4 DISCUSSION AND CONCLUSION 21

5 ACKNOWLEDGEMENT 23

6 REFERENCES 23

7 LIST OF FIGURES 9,10,12,14

3 | P a g e

IMPACT OF THE COVID-19 PANDEMIC ON CANCER PATIENTS AND ITS MANAGEMENT-THE UNTOLD STORY

NEETI KOTHARI, AMET UNIVERSITY, CHENNAI

ABSTRACT:

Coronavirus which has been induced by SARS-Cov-2 (Systemic acquired respiratory syndrome-Covid-2) or COVID-19 is a novel virus first disclosed in Wuhan, China is becoming a globally occurring threat and a major healthcare issue of the year 2020. Cancer research has straightaway been affected by the emergence of this disease. Thousands of people, in at least 186 countries have been impacted by cancer during the outbreak of the pandemic which has affected the cancer care delivery system apart from having an effect on the overall health system. The cancer patients being in an immunosuppressive state are more susceptible to coronavirus infection due to the malignancy, the anticancer treatment and are dependent on the availability of medical facilities, which makes them enormously prone to the impact of the epidemic and these medical facilities mean their lives are on the line. Thus, it is a great challenge to manage the patients as well as to resume their routine treatment which made many oncologists to change their daily practice in cancer care and their recommendations. The safety and management of cancer patients in the current scenario of SARS-CoV-2 outbreak is extremely important and needs a well-established full-proof plan. Moreover, with the coronavirus disease 2019 (Covid-19) cancer care has been neglected, delayed, and discontinued. These decisions taken during the pandemic will have severe out- turn on the cancer mortality for years to come. Countries must isolate, test, treat and trace to benchmark the coronavirus pandemic. Oncologist must confirm that the cancer patients should spend more time at home and less time out and should communicate to their patients to pass on right information regarding the Covid-19 outbreaks. In this review paper we focus on the challenges faced, its impact and cancer management during the pandemic and its outcomes on the population. Finally, we focus on strategies that are followed in cancer management with review of national and international guidelines. It is hoped that this review will help in recognizing and dealing with SARS-CoV-2, and provide a reference for future studies.

Keywords: Cancer, Pandemic, Covid-19, Oncology.

4 | P a g e INTRODUCTION:

In the month of December, 2019, Wuhan, Hubei, China, witnessed a gigantic outbreak of novel coronavirus disease 2019 (COVID-19) caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) which is a highly contagious disease. The World Health Organization (WHO) has proclaimed the ongoing outbreak to be a global public health crisis. Currently, the research going on SARS-CoV-2 is in its primary stages. Fighting the pandemic has become the main challenge throughout the globe. Zhong Nanshan (Guangzhou Medical University, Guangzhou, Guangdong), head of the National Health Commission's team investigating the novel coronavirus outbreak, pointed out that SARS-CoV-2 carried the risk of human-to-human transmission on Jan 20, 2020(Heng Mei, X.D.,01 May 2020).

During the Mid-December,2019, a case of pneumonia was reported in Wuhan, Hubei Province, People's Republic of China (PRC). Its clinical characteristics were very much similar to those of viral pneumonia. After analysis of respiratory samples, the experts at the PRC Centres for Disease Control declared that the pneumonia is none other than the novel coronavirus pneumonia (NCP), which was caused by a novel coronavirus. Officially the disease was named ‘COVID-19’ by the World Health Organization (WHO). The International Committee on Taxonomy of Viruses (ICTV) named the virus as ‘severe acute respiratory syndrome coronavirus 2’ (SARS-CoV-2). SARS-CoV-2 has high transmission and infectivity rate but a low mortality rate, when compared with severe acute respiratory syndrome and Middle East respiratory syndrome coronaviruses (SARS-CoV and MERS- CoV, respectively). After the outbreak of the pandemic, around 12,784 people have died and more than 2,92,142 confirmed cases have been reported in at least 186 countries, territories, according to the World Health Organization (WHO) by 21st March, 2020. Europe has turned into a new epi-centre for COVID-19 with mortality and morbidity increasing daily.

Coronaviruses are enveloped non-segmented positive-sense RNA viruses of the family Coronaviridae and the order Nidovirales. They have a diameter of 80–120 nm and are of four types: α-coronavirus, β-coronavirus, δ-coronavirus and γ- coronavirus. The genome sequence homology of SARS-CoV-2 and SARS is approximately 79%. Transmission of Covid-19 involves 3 factors and are source of infection, route of transmission and susceptibility. Bats are considered to be the natural hosts of SARS-CoV-2 with pangolins and snakes to be intermediate hosts. A study from Peking University suggested that SARS-

5 | P a g e CoV-2 infection is probably caused by snakes, but a later study found no evidence that snakes are the hosts of SARS-CoV-2. A study from Wuhan Institute of Virology showed 96.2% similarity in the gene sequence between SARS-CoV-2 and bat coronavirus using sequencing technology. This implied that bats are the potential source of SARS-CoV-2. Using macrogenomic sequencing, molecular biological detection and electron microscopic analysis, it showed 99% similarity between SARS-CoV-2 isolated from pangolins and the virus strains currently infecting humans. (Xu et al.,2020). The most common routes of transmission of SARS-CoV-2 are Droplets and Close contact, in addition with aerosol transmission. In addition, researchers have detected SARS-CoV-2 in samples of stool, gastrointestinal tract, saliva and urine. Based on the information obtained, evidence has stipulated that the digestive tract may be a route of SARS-CoV-2 infection. Covid-19 produces an acute viral infection in humans with an incubation period of 3 days which is similar to SARS-CoV with an incubation period of 2–10 day. The most common symptoms of COVID-19 are fever (87.9%), cough (67.7%), fatigue (38.1%), diarrhoea (3.7%) and vomiting (5.0%). Moreover, severe cases show several complications such as acute respiratory distress syndrome, acute heart injury and secondary infection.

Approximately 2.5 million individuals live with, or have a history of, cancer in the UK, with

1000 new diagnoses each day. Of these patients, a substantial proportion require, are undergoing, or are recovering from surgery and complex treatments. “The pandemic has meant a transformation of every aspect of cancer care, irrespective of treatment, inpatient or outpatient, and radical or palliative intent,” said James Spicer (Guy's and St Thomas' Hospital NHS Foundation Trust, London, UK). Treatment regimens are being changed to reduce hospital visits. “Regimens with less intensive treatment visits are now strongly favoured, such as 400 mg pembrolizumab six-weekly instead of 200 mg three-weekly,” reported Spicer.

Cancer patients are more susceptible to COVID-19, than individuals without cancer because of their s immunosuppressive state due to the malignancy and anticancer treatments, such as chemotherapy, targeted therapy and immunotherapy. There will be more detailed studies of COVID-19 in future as currently a lot is still unknown about this disease and how it is spreading. In addition, there has not been any specific information regarding cancer patients and COVID-19. However, one study suggested a small percentage of patients had pre- existing conditions including diabetes (6.4%), hypertension (12.8%), cardiovascular disease (3.7%), liver diseases (2.7%), malignancy (1.4%), and others (3.7%) (Cai et al., 2020). The

6 | P a g e major risk for cancer patients is the inability to receive necessary medical services (both in terms of getting to hospital and provision of normal medical care once there) because of the outbreak. As per the Report of the WHO-China Joint Mission on COVID-19, cancer patients had an estimated 2-fold increased risk of COVID-19 than the general population. Patients with comorbid conditions had much higher rates: 13.2% for those with cardiovascular disease, 9.2% for diabetes, 8.4% for hypertension, 8.0% for chronic respiratory disease, and 7.6% for cancer (WHO, 2020, February 28).

Studies suggested that hospital visit is one of the major factors contributing to the increased incidence in cancer patients. For the management of hospitalised patients with cancer, the top priority is the control of nosocomial infection. After the outbreak of the pandemic in China from December 2019, till the 5th of April 2020,it has affected more than a million of people and caused 62,773 deaths globally (20200405-sitrep-76-covid-19.pdf, 2020). The death toll in Italy is approaching 12,000 people, with Spain right after it. The USA has reported more than 164,000 cases of the disease, and more than 38,000 cases in New York City alone. In the United States, the virus has now spread to all the 50 states, infecting a total of 15219 people with death being reported in 201 patients by 21st March, 2020. India has confirmed infection in 396 patients with mortality reported in 6 patients by 22nd March 2020 (ICMR, 2020, March 22). These numbers are changing every minute and has captured the whole world under the lockdown mode. According to WHO, the person infected with COVID-19 can pass it on to more than two people. Thus, Oncologist must ensure that patients undergoing active cancer treatment tend to spend more time at home and less time out in the community.

MATERIALS AND METHODS:

With the inrush of a large number of patients affected with COVID-19, requiring intensive care and support of ventilation has led to exploitation of medical resources and hospital systems in the affected regions and countries, interrupting the routine treatment of haematology and cancer patients who are extremely fragile and vulnerable due to their immunosuppressive state, malignancy, treatment and are likely to be negatively affected if the standard of care is delayed. Due to the outbreak of the pandemic many of the cancer outpatient visits has been replaced by telephone consultation to avoid multiple comorbidities.

7 | P a g e Impact on Cancer patients:

Patients affected with leukaemia, lymphoma or myeloma, receiving radiotherapy, chemotherapy, immunotherapy, antibodies, protein kinase inhibitors, and those with recent bone marrow or stem cell transplants have more risk of acquiring COVID-19.The European Society of Medical Oncology and National Health Service England have graded patients into different priorities for receiving active cancer treatment during the pandemic. Utmost care should be given to patients with life threatening or clinically unstable conditions to improve the quality of life.

Oncologists should think of changing intravenous treatments to subcutaneous or oral routes or could move to using non-urgent supportive therapies or using granulocyte-colony stimulating factor as primary prophylaxis, and could consider treatment breaks for patients on long-term therapy. Radiation treatment should be considered prior for patients with rapidly proliferating tumours and for those whose planned radiotherapy has already begun, and hypofractionation should be considered to shorten the treatment duration. Patients who have developed COVID-19 during cancer treatment should be treated in the respiratory or intensive care units rather than in the oncology or radiotherapy unit. The fatality rate in Wuhan, China was six (46·2%) of 13 patients with blood cancer and two (10·0%) of 20 patients with solid tumours in our centre. Patients with blood cancer are more predisposed to SARS-CoV-2 infection than were patients with solid tumours. The higher fatality rate in patients with blood cancer might be due to their aggressive chemotherapeutic protocols, agranulocytosis, and impaired immunity.

One patient tried to die by suicide after he became infected with SARS-CoV-2 following stem cell transplantation. Although his blood virus tests turned negative after an initial positive result, the long isolation and the pain physically and mentally affected the patient. Therefore, psychological intervention is extremely important for patients with COVID-19 who have experienced other issues, physically and mentally, apart from their primary disease (Heng Mei, X.D.,01 May 2020). A group of patients with lymphoma for whom CAR-T therapy is potentially curative are unable to continue their treatment for the cancer due to the lockdowns and even if they permit the major concern is about the need for ICU care in a resource constrained system. A similar issue is for patients requiring bone marrow transplants, but poses high risk of infection and need for ICU care.

8 | P a g e In a study conducted, a total of 1,524 cancer patients at tertiary cancer Institution of Wuhan University were reviewed in which cancer patients were estimated to have a 2-fold increased risk of COVID-19 in comparison to the general population. Studies suggested that hospital visit was a likely factor contributing to the increased incidence in cancer patients. Oncologists should be attentive as patients with any type of advanced cancer are going to be at much higher risk for bad outcomes if they are infected with the coronavirus. The potential risk factors of older age, comorbidities and smoking history could help oncologists to identify patients with poor prognosis at an early stage.

Oncology communities must ensure that patients undergoing active cancer treatment tend to spend more time at home and less time out in the community. (Zhou et al., 2020). In contrast from China, a report from Italy proves that 20% of patients with COVID-19 had an history of cancer in the past 5 years. However, in this analysis, the identification of comorbidities was confined to patients who died of Covid-19. Therefore, the immunosuppressive state in cancer could be a factor for developing Covid-19. Assessing the link between the cancer patients and Covid19 would aid in a better understanding of the associated risks.

9 | P a g e

Figure 1: Categorisation of patients with cancer with COVID-19 and treatments they received in China (Heng Mei.,2020)

10 | P a g e

Impact on Cancer Research during the Pandemic:

With the pronouncement of COVID-19 pandemic, stringent measures are recommended by the authorities to limit the virus spread. These measures also apply to cancer research centres where the research activity is found to be declining due to quarantining measure, working in shifts, lacking supplies and also because the funds allocated have been used in the virus treatment. Thus, researchers are facing a lot of challenges to continue the trials without any interruption(Covid-19 Challenges Basic Researchers.,2020) While experimental researches are crucial to providing the best care for cancer patients, many centres are trying to make changes to their programs and adapt to the new situation without interrupting their activity such as telemedicine, online check-ups and etc.

Moreover, higher authorities such as the FDA issued guidelines that recommending to be more flexible about the protocols. Some measure can be taken from remoting communication with patients for follow up, making changes and exceptions to trials protocols to reducing multiple hospital visits and routine follow up, postponing new clinical trials, etc. Many other cancer drugs are being investigated in this field. For example, a theoretical role of kinase inhibitors in the reduction of infectivity of well-known viruses such as Ebola and Hepatitis C is described, suggesting that drugs like sunitinib and erlotinib would potentially be effective against SARS-CoV-2(Stabbing et al.,2020).

Moreover, a group of researchers are working on to identify repurposable drugs and potential drug combinations for the treatment of SARS-CoV-2. Three combinations were deemed to be effective and are sirolimus plus dactinomycin, mercaptopurine plus melatonin, and toremifene plus emodin, all of which consisting of at least one anti–cancer agent (an immunosuppressant, an antineoplastic agent and a selective estrogen receptor modulator respectively)(Zhou et al.,2020).

During this era of COVID-19 it should be kept in mind the need to respect the clinical research ethics. In fact, the medical ethics editorial team of The Oncologist focused on three crucial considerations in cancer research. First one is non-abandonment of a patient whose prognosis and wellbeing is dependent on an investigational treatment and a protocol to which he is adhering. Second one is making an effort to flatten the curve of COVID-19 infection by minimizing any unnecessary exposure to a suspicious environment. Finally they

11 | P a g e emphasize on psychosocial support of the patient and of the research team in the middle of the outbreak (Shuman and Pentz.,2020).

With the outbreak of the pandemic, scientists all over the world are in a rush to come up with clinical trials of vaccines against the coronavirus, and treatments for COVID-19. But as hospitals are completely involved in treating critically ill patients and laboratories focusing on its treatment, researchers had to halt clinical trials for other disorders.

Thus, there is going to be a complete shut-down on the clinical trials of the disease, as the researchers, laboratories, hospitals are completely overloaded with the emergence of the disease. However, this delay would have a negative impact on the clinical trials as well as on the condition of the patients, leading to poor chances of survival.

Figure 2: Percentage Contribution of different countries in Covid-19 and Cancer Research (Elissar Moujaess et al.,2020).

Researchers in oncology are preoccupied by more than one aspect of the COVID-19. Subjects of interest in the papers could be divided in four categories:

• Cancer research in the era of COVID-19, and the effect of cancer therapy on COVID-19 patients (6 articles).

• Epidemiological, clinical, pathological and radiographic features of cancer patients with

COVID-19 (14 articles).

12 | P a g e • Outcomes of cancer patients with a SARS-CoV-2 infection (11 articles).

• Strategies for risk reduction and management of cancer patients during COVID-19 outbreaks (57 articles).

Many expert recommendations on the diagnosis and treatment of cancer patients during the novel coronavirus outbreak were formulated so far. Designs and strategies that focused on gastrointestinal and lung tumours are most prevalent, followed by urogenital neoplasms and breast and other gynaecological malignancies. The management of haematological cancers was also discussed in three papers. By the end of March, no universal guidelines have been adopted. However in the first week of April, guidelines from multiple national and international groups have been formulated (Elissar Moujaess.,2020).

Impact on Cancer during the pandemic in Netherland:

On 27th of Feb, 2020, in the southern part of the country, the very first case of Covid-19 in Netherlands came into picture, which had rapidly spread throughout the country, thus forcing to implement stringent measure and began with social distancing and curfew, to minimize the rapid spread of Covid-19. The pandemonium caused by COVID-19 has rapidly affected and altered the cancer diagnosis in the Netherlands. Data from the nationwide Netherlands Cancer Registry indicates that during the period from Feb 24, 2020 till April 12, 2020, there has been a rapid decrease in cancer diagnoses due to the outbreak of the pandemic when comparing it with the period before the COVID-19 outbreak. It has been more clearly articulated in the cases for skin cancers and has been observed in all the age groups and geographical regions, and nearly at all cancer sites. There are several reasons responsible for the decline in the diagnosis. First one being the individuals with non-specific or asymptomatic symptoms of cancer might face issues consulting a general practitioner, thinking that it could waste the practitioner's time and could increase the chances of exposure to the patients from COVID-19-related symptoms and could lead to depletion hospitals, medical staff and resources which would eventually lead to a situation to worry about. Thus, to solve the very first problem, hospitals could drift to telemedicine’s, video-calls, mails and deliver the medicines of the patients directly to their doorstep to avoid overuse or unnecessary use of medical resources, which will eventually help the critical patients to

13 | P a g e receive the right treatment at the right time. Along with the oncologist, the patient in unison should decide whether to postpone, delay or modify the treatment for patients who are not in a very critical condition. Third one being that the hospitals might had to postpone the diagnosis or delay the therapies as many hospital-based resources are being employed to tackle COVID-19.Last one is national screening programmes for breast, colorectal, and cervical cancer has been temporarily been halted as for now up to March 16, 2020, due to the shift of the health-care system towards the COVID-19. Due to the pause in cancer diagnosis, it might have grave consequences with increased mortality, fatality and morbidity in the near future. However, it would be less important for cervical cancer because the screening aims to identify precancerous lesions. However, it should be taken into mind that fewer cancer diagnoses in the COVID-19 should not lead to worsening of cancer conditions.

Figure 3: Number of cancer diagnoses by week in the Netherlands in the period between Jan 6, 2020 (calendar week 2) and April 12, 2020,week 15(Avinash Dinmohamed.,2020).

It was found that, with the fewer cancer diagnosis, Netherlands Cancer Registry felt to create awareness about of this issue. First steps to manage the scenario and to keep it under control are to encourage the patients to consult the practitioner or family doctor whenever symptoms arose to be troublesome. Second step is, general practitioners should be encouraged to refer patients suspected with cancer to oncologists. Third, an appeal should be made to restore

14 | P a g e the national cancer screening programmes. Lastly, misconceptions were eliminated about a heightened risk of contracting COVID-19 in a health-care setting because of inadequate policies for infection control at the institutional level and resource constraints in the delivery of essential oncological care.

The effect of a reasonable delay in the conduction of particular low-risk malignancies (e.g., many skin cancers) will only scarcely affect the quantity and quality of life. However, the treatment for potentially medicable cancers with an impending risk of early death (e.g., acute leukaemia’s) cannot be safely postponed (Avinash G Dinmohamed, O. V.,2020).

Provisions to minimize cancer spread:

The symptoms of COVID-19, such as fever, fatigue, dyspnoea and myalgia, are very much similar to cancer patients, especially the one’s receiving treatment. Therefore, identification of COVID-19 symptoms in such patients can be problematic. Thus, there are a few provisions which can be taken care of to minimize it’s spread. Cancer patients should be aware about the signs and symptoms of COVID-19 and should follow social distancing to avoid comorbid conditions. There is no specific guideline regarding the use of mask in cancer patients which needs to be traversed. Cancer patients when they come up with Covid- 19 symptoms should be examined thoroughly as there is no proper information available about COVID-19 testing in cancer patients. Cancer patients must proceed with their routine treatment except if they come in contact with a Covid-19 positive patient with symptoms of fever, cough, breathing difficulties and etc. a. Cancer patients undergoing radiotherapy:

Oncologists should try to postpone, change or can reduce the dosage therapy in cases where therapy is critical. Due to their comorbid conditions, it is advised to visit the hospital only in emergency situations and can consult doctor through telemedicine. b. Cancer patients due for Stem Cell transplantation:

Patients due for stem cell transplantation could be post-pone if not in a very critical stage and could be given other treatment to slow down the spread of the disease, until the pandemic’s spread is minimized and patients who have undergone the transplant need to be isolated from the Covid-19 positive. Patient’s should be provided physical and emotional support during this intensive treatment and visitors should not be allowed to meet the patients to protect both the patient as well as visitor from exposure.

15 | P a g e c. Cancer patients waiting for Surgeries:

Cancer patients waiting for surgery should be delayed if possible, so as to protect the patients. However, oncologist and patient should come together to discuss about the consequences of delaying the treatment and what could the secondary treatment to start if the surgery has to be post-pone.

d. Cancer Patients on Immunosuppressive therapy:

There is no proof which could say that changing, delaying the chemotherapy and immunotherapy could be beneficial to cancer patients. It should be decision of the patient as well as the oncologist to modify, delay or continue with the patient. Patients could switch to oral drugs instead of chemotherapy to minimize the risk of infection.

e. Counselling regarding cancer screening:

Patients are advised to plan later their cancer screening procedures for some time to minimize the risk of infection.

f. Cancer patients on follow up:

Cancer patients on regular follow up can later visit the hospitals. Instead the Patients can contact the Cancer Care Providers in case of any contact history with Covid-19, having symptoms.

Strategies for Cancer Management:

Both the oncologist as well as cancer patient are disturbed with the risk of transmission of COVID-19 due to the hospital settings, as well disease progression along with treatment delay is becoming a major concern during the pandemic, with the healthcare system focus drifting towards COVID-19 is having dreadful consequences on cancer patients. Thus, there is an urgent need for guidelines to protect cancer patients from acquiring COVID-19.In the absence of universal guidelines, most of the strategies adopted involves prioritizing urgent situations such as acute leukaemia, curative treatments for aggressive diseases, and adjuvant and neoadjuvant therapies while withholding or postponing palliative therapies for poor prognosis patients(Hanna et al.,2020).

Telemedicine is also encouraged. Measures to protect medical staff are proposed because this will directly affect patients’ safety. The measures consist of prioritizing laparoscopic

16 | P a g e procedures in cancer surgery to minimize the exposure to aerosolized specimen (Kimming et al.,2020) and limiting endoscopic diagnostic procedures to the necessary with application of strict protective measures particularly in bronchoscopy (Ost.,2020). Some medical and imaging oncology wards have been completely re-organized to safely accommodate cancer patients

International guidelines and recommendations:

Several efforts have been made by various oncologists and national authorities to execute the guidelines which will help doctors to decide the cancer treatment during the SARS-CoV- 2 pandemic. An international group of people reviewed the challenges faced in cancer care and proposed some practical measures for the management of cancer patients based on the available data on the 26th of March (Al Shamsi et al.,2020). International guidelines were released with general principles, and few specifications.

➢ In hematology, researchers are most interested in hematopoietic stem cell transplantation, first because of a higher risk of infection in neutropenic patients, and second because of the risk carried by stem cells donation, transportation and preservation as well as the difficulty

to find donors due to travel bans (Szer et al.,2020, Dholaria et al.,2020). A case of a Chinese patient who was treated with the drug Cyclosporine A for seven months followed by a bone marrow transplantation after which he died after acquiring a COVID-19 infection in spite of getting good amount of care should make the physicians rethink about the transplantation practice during the pandemic. The European Society of Blood and Marrow Transplantation EBMT issued guidelines to protect patients during the COVID-19 outbreak. It consists of different transplantation for confirmed cases, at least 3 months for low risk disease or until recovery for high risk disease. Symptomatic patients should be screened with PCR (with or without COVID-19 RT-PCR) and should be intervene. Postponing applies for patients with low risk. Patients traveling from an endemic region should be isolated and quarantined for 14–21 days especially in low risk disease. Donors, those who have a confirmed infection with COVID-19 must be eliminated from donation. Those who were in close contacts with a positive patient and those who are travelling from an endemic zone have to be excluded for 21–28 days and isolated with close monitoring. (EBMT.,2020)

➢ In breast cancer, guidelines on radiation therapy were issued by an international group of practitioners and insisted on the following (Coles et al.,2020):

17 | P a g e

a. Avoiding radiotherapy for patients 65 years or older with invasive breast cancer without adverse features who are planned for hormone therapy. b. Delivering only 5 fractions for patients with node negative tumours that do not require a boost. c. Omitting nodal radiotherapy in post-menopausal women who require whole breast radiotherapy following sentinel lymph node biopsy and primary surgery without adverse pathological features. d. Providing moderate hypofractionation for all breast/chest wall and nodal radiotherapy.

Recommendations for cancer care during the COVID-19 crisis:

• Expanding telemedicine for outpatient care.

• Maintaining adjuvant therapy with curative intention for solid tumours.

• Continuing therapy with low dosage for metastatic disease to minimize hospital admission.

• Prioritizing cancer patients based on the degree of the disease evolution.

• Providing emotional and physical support to the patients as well as medical staff well and providing protective measures to those suffering from chronic conditions which can make them more prone to the complications of the COVID-19 infection.

• Limiting the admission of cancer patients and focusing on those patients which require immediate care.

• Making the patient aware about the signs and symptoms of the disease and advising the patient to stay at home during the pandemic and to use online modes for communicating with the Oncologist.

• If the patient belongs to Senior Citizen category, avoid stepping out of the house as it could lead to comorbid conditions.

18 | P a g e Re-designing the Amenities:

Social distancing, lockdowns and curfews are the major long-term issues for both the patient as well as the oncologist where modifying the patient’s treatment is exerting a lot of pressure on the oncologist. Patients care need to be taken as far as possible, from their houses only to avoid infection risk and by following the precautions, patients could be safeguarded. With the depletion of hospitals, staffs and medical resources, there is need for re-deployment of resources for acute treatment of COVID-19 care, which would lead to no delay in the treatment, continuous care and would start the clinical trials, most of which are now closed. Patients with Covid-19 symptoms can be isolated in order to reduce the risk of exposure to other patients and staff. Testing the patients on a frequent basis could reduce the risk. Testing the medical staff and providing support to them would help in for maintaining a more stable workforce.

For outpatients, facilities such as consulting via telephone, video-calls, mails could benefit both the patients and the hospitals, as well as minimize the chances of exposure to the infection. To minimize patient’s travel, home deliveries of oral medicines, consenting and investigations could be managed by patients from home. Increasing operating hours for outpatient services and making provisions for acute cancer cases could all help to relieve the burden placed on emergency departments. Blood product shortages arising due to lockdown, curfew can be done by raising the thresholds for transfusion and with the greater use of erythropoietin. Oncology inpatient activity is going to drastically affect, due to reallocation of dedicated beds and ventilator for those co-diagnosed of cancer and COVID- 19.

Effects on infrastructure and the no of staffs has critically affected the cancer service because of COVID-19. As highlighted by the UK National Health Service (NHS) guidelines, restriction on accessing the operating theatres, continuing clinical trials and anaesthetic support is a major problem for patients requiring surgery, chemotherapy. Prioritization of treatment for patients with cancer should be implemented to ensure that those with the most severe complications are delivered medical resources first, when resources become constrained. Prioritization of treatment means intensive care, and these decisions should be taken as a team and be discussed fully after thinking about the pros and cons with the patient. When treatment plans deviate from standard practice, this should be

19 | P a g e carefully documented. Prioritization must also take into consideration the associated benefits of treatment against the estimated increased risks of infection. Although we recognize the substantial risks of viral infection to all members of the population, COVID- 19 will not each and every patient with cancer.

Routine screening and nucleic acid tests can be put off until the pandemic is over. We can operate a 24 h emergency department for patients who needed emergency care and are in a serious condition. We can open a green passage which would be a rapid and efficient for pregnant women and patients with cancer who have to be treated immediately. Delays in the delivery of palliative care, which are having a risk of low-level prioritization, might lead to worsening of symptoms. For most patients with solid tumours, the survival benefits received with adjuvant treatments are quite less when compared to the risks posed by regular attendance for myelosuppressive therapy. Addition of growth factor is quite supporting in this setting and is been now widely advocated.

Prioritization of critical case is also very important, especially in radiotherapy and safe methods for delaying the need for surgery such as in women with certain types of breast cancer using endocrine therapy and in men with prostate cancer using androgen-deprivation therapy. Further more information is required to understand of the immunology of SARS- CoV-2 to the effects of anticancer immunotherapy. A review claimed that immuno- modulatory agents, such as steroids, cytotoxic agents, tacrolimus, JAK inhibitors and anti- TNF antibodies, increase the risk of severe COVID-19 symptoms. Thus, the use of anti-PD- 1 antibodies might, theoretically, limit the extent of T cell exhaustion and thus promote viral elimination, or could potentially contribute to the excessive inflammatory response to viral infection (James Spicer.,2020).

Adopt WHO Isolate, Test, Treat, Trace policy:

To defeat and manage the pandemic, countries must adopt isolate, test, treat and trace policy. If this is not adopted, transmission chains can continue at a low level and could relapse again once physical distancing measures are lifted (WHO, 2020, March 18). Every community needs to take stringent measures to stop the transmission of the epidemic. Everybody must think, plan and perform in synchronization. We need to follow the lockdown and maintain social- distancing and try to come up with but long-term survival solutions. It is time for everyone to

20 | P a g e think globally and act locally to ensure that their intervention is relevant, appropriate, latest, and right in action.

DISCUSSION AND CONCLUSION: It is very well known that cancer patients are at a higher risk of being affected by Covid-19 due to their malignancy which puts them into immunosuppressive state, as well as their treatment and their age are some of the factors making them more prone to the Covid-19 infection. Thus, their safety and management are of utmost importance and proper plans need to be established before putting their life into stake. For patients who are not in a very critical condition, post- ponement of the chemotherapy could be an option, where instead of intravenous route, oral administration could be set-up and delivered at the patients door step, thus minimizing the risk to the patient along with less use of medical resources and availability of the resources to whose requiring it.

For outpatient, expansion of telemedicine could be done where doctor can interact and advise the patients on how to proceed further. For patients at home, their therapy dosages could be reduced and instead of radiotherapy, hypofractionation could be done. Patients with extremely critical condition should be given intensive treatment for the respective treatment and should be kept isolated even if the Covid-19 symptoms persists which could eventually lead to comorbid conditions. Patients undergoing intensive treatment should be provided counselling, as well as the medical staff to minimize the pressure and for the betterment of their health. Along with patients, doctors should also be screened frequently to prevent doctors being the barriers for transmission of the highly contagious disease.

For cancer patients who have undergone surgery, radiotherapy or chemotherapy should not be permitted to meet anybody and should be kept isolated to prevent secondary infection. Thus, hospitals could be divided into different sections where treatment for particular complication is provided to prevent cross infection. Special zones could be allocated for pregnant women who require immediate and efficient care and should be triaged from Covid-19 positive. Senior citizens should strictly not be allowed to leave the house for any work, if daily requirement articles are required then they could take the help of many NGO’s who would delivers the items required.

21 | P a g e Some of the problems faced by the patients is fear for ‘bothering the doctor’, sharing their problems and the risk to exposure which could lead to loss of lives. This could be well explained with an example is of a patient who was suffering from breast cancer and was feeling guilty to ask the oncologist on how Covid-19 could affect her and thought of herself as a selfish woman, as the entire world is facing crisis but she was thinking about herself. She did not know whether her mastectomy could be able to proceed, but doctors and nurses took utmost care of her and they came up with alternative therapies which created a hope among her and the chance to fight during the outbreak of the contagious pandemic. Thus, the medical staff play’s a major role in the life of the patients who are the actual warriors and our real super-heroes, who have pledged to save life of countless number of people and are saving a number of people’s life during this public health crisis. It is the duty of all of us to help the people come out of this fear and consult a doctor along with maintaining social distancing norms. ‘‘So Covid or no Covid be fearless as the warriors are there to care.’’

Due to the emergence of this disease, considerable amount of people has been aware about frequent handwashing, disinfection, sanitization, social distancing, personal protective equipment’s and quarantine. Thus, making them more aware about the importance of hygiene and the benefits of social distancing. Oncologist must make sure that there is early detection of Covid-19, otherwise it could lead to advanced forms of cancer. They must ensure that the cancer patients spend time at home and not outside as it could lead to comorbid conditions.

Furthermore, there is need to setup camps at various locations so as to ensure that no patients run short of medical resources, staffs and beds and adequate isolation. In the current scenario it is difficult to predict when this pandemic would end but all we could do is stand together, support each other and fight this pandemic. We should learn from our mistakes and try to have well established services where none of the patient remains unattended and loses his life due to the hospital’s negligence.

We cannot stop the virus, but all we can do is follow social distancing norms, avoid going out and if needed only one person should go. These small steps of us could help the police officers as well as lower the chances of transmission, which would be the biggest help to control the pandemic.

22 | P a g e ACKNOWLEDGEMENT:

I am grateful to my College, AMET University as well as to our HOD, Dr. Jayaprakashvel for giving this opportunity to write a review article during this lockdown period. I would also like to thank the Advisor Dr. K. Altaff, without his help and his trust this would have not been possible. Your constant encouragement has enabled me to complete this review article. I would extend my gratitude to the faculty in-charge Dr. Sylvester Frederick and Dr. Senthil

Nathan for believing in me.

I would also like to thank the Ph.D. Scholars for their support and technical help during the writing of this article. This acknowledgement would be incomplete without thanking my family for their constant love and support and my classmate and my friend Rohan Sharma and Nicky Macarius for their technical support.

REFERENCES:

1) Liang, W. et al. Cancer patients in SARS-CoV-2 infection: a nationwide analysis in

China. Lancet Oncol. 21, 335–337 (2020).

2) Xia, Y., Jin, R., Zhao, J., Li, W. & Shen, H. Risk of COVID-19 for cancer patients. Lancet

Oncol. 21, e180 (2020).

3) Wu, Z. & Mcgoogan, J. M. Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in china. JAMA 323, 1239–1242 (2020). 4) Hanna, T. P., Evans, G. A. & Booth, C. M. Cancer, COVID-19 and the precautionary principle: prioritizing treatment during a global pandemic. Nat. Rev. Clin. Oncol. https://doi.org/10.1038/s41571-020-0362-6 (2020). 5) NHS England. Clinical guide for the management of non-coronavirus patients requiring acutetreatment. https://www.england.nhs.uk/coronavirus/wp- content/uploads/sites/52/2020/03/specialty-guide-acute-treatment-cancer-23-march- 2020.pdf (2020).

6) World Health Organization Coronavirus disease 2019 (COVID-19) WHO, Geneva (2020)?

Situation Report 40 7) N. Zhu, D. Zhang, W. Wang, X. Li, B. Yang, J. Song, et al., A novel coronavirus from patients with pneumonia in China, 2019.

23 | P a g e 8) Heng Mei, X. D. (01 May 2020). Managing patients with cancer during the COVID-19 pandemic: frontline experience from Wuhan. The Lancet Oncology.

9) The Lancet Oncology. (2020). Safeguarding cancer care in a post-COVID-19 world. The

Lancet Oncology, 21(5), 603. doi:10.1016/s1470-2045(20)30243-6.

10) Avinash G Dinmohamed, O. V. (April 30 2020). Fewer cancer diagnoses during the

COVID 19 epidemic in the Netherlands. The Lancet Oncology.

11) Daniel Jones, Richard D Neal, Sean R G Duffy, Suzanne E Scott, Katriina L Whitaker, Kate Brain, Impact of the COVID-19 pandemic on the symptomatic diagnosis of cancer: the view from primary care, The Lancet Oncology,2020. 12) Iris Anil, Roland Arnold, Sam Benkwitz-Beford, Simon Branford, Naomi Campton, Jean- Baptiste Cazier, Vinton Cheng, Helen Curley, Jamie D'Costa, Andrew Edmondson, Anshita Goel, Simon Hartley, Daniel J Hughes, Rachel Kerr, Alvin Lee, Lennard YW Lee, Naomi Longworth, Christopher Middleton, Gary Middleton, Piangfan Naksukpaiboon, Anna Olsson-Brown, Claire Palles, Karin Purshouse, Carol Sandys, Archana Sharma- Oates, Shivan Sivakumar, Ashley Smith, Thomas Starkey, Simon Thompson, Csilla Varnai,The UK Coronavirus Cancer Monitoring Project: protecting patients with cancer in the era of COVID-19,The Lancet Oncology,Volume 21, Issue 5,2020,Pages 622-624.

13) Susan Mayor, COVID-19: impact on cancer workforce and delivery of care,The Lancet

Oncology, Volume 21, Issue 5,2020,Page 633.

14) Kamal S Saini, Begoña de las Heras, Javier de Castro, Ramachandran Venkitaraman, Martine Poelman, Gopalakrishnan Srinivasan, Monika Lamba Saini, Sanjeev Verma, Manuela Leone, Philippe Aftimos, Giuseppe Curigliano, Effect of the COVID-19 pandemic on cancer treatment and research, The Lancet Haematology, 2020. 15) Chaolin Huang, Yeming Wang, Xingwang Li, Lili Ren, Jianping Zhao, Yi Hu, Li Zhang, Guohui Fan, Jiuyang Xu, Xiaoying Gu, Zhenshun Cheng, Ting Yu, Jiaan Xia, Yuan Wei, Wenjuan Wu, Xuelei Xie, Wen Yin, Hui Li, Min Liu, Yan Xiao, Hong Gao, Li Guo, Jungang Xie, Guangfa Wang, Rongmeng Jiang, Zhancheng Gao, Qi Jin, Jianwei Wang, Bin Cao, Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China,The Lancet, Volume 395, Issue 10223,2020, Pages 497-506.

16) Zhou, F. et al. Clinical course and risk factors for mortality of adult inpatients with COVID-

19 in Wuhan, China: a retrospective cohort study. Lancet Oncology 1054–1062 (2020).

24 | P a g e 17) Talha Khan Burki,Cancer guidelines during the COVID-19 pandemic,The Lancet

Oncology, Volume 21, Issue 5,2020, Pages 629-630.

18) Luana Calabrò, Solange Peters, Jean-Charles Soria, Anna Maria Di Giacomo, Fabrice Barlesi, Alessia Covre, Maresa Altomonte, Virginia Vegni, Cesare Gridelli, Martin Reck, Naiyer Rizvi, Michele Maio,Challenges in lung cancer therapy during the COVID-19 pandemic,The Lancet Respiratory Medicine,2020. 19) Lisheng Wang, Yiru Wang, Dawei Ye, Qingquan Liu,Review of the 2019 novel coronavirus (SARS-CoV-2) based on current evidence,International Journal of Antimicrobial Agents,2020. 20) 20200331-sitrep-71-covid-19.pdf [Internet]. [cited 2020 Apr 13]. Available from: https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200331- sitrep-71-covid-19.pdf?sfvrsn=4360e92b_8. 21) 20200405-sitrep-76-covid-19.pdf [Internet]. [cited 2020 Apr 13]. Available from: https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200405- sitrep-76-covid-19.pdf?sfvrsn=6ecf0977_4. 22) Al-Shamsi H.O., Alhazzani W., Alhuraiji A., Coomes E.A., Chemaly R.F., Almuhanna M.

A practical approach to the management of cancer patients during the novel coronavirus disease 2019 (COVID-19) pandemic: an international collaborative group. Oncologist. 2020;(April (3)) 23) Burki T.K. Cancer care in the time of COVID-19. Lancet Oncol. 2020;(March (23))

24) Dholaria B., Savani B.N. How do we plan hematopoietic cell transplant and cellular therapy with the looming COVID-19 threat? Br. J. Haematol. 2020;(March (16)). 25) Hanna T.P., Evans G.A., Booth C.M. Cancer, COVID-19 and the precautionary principle:

prioritizing treatment during a global pandemic. Nat. Rev. Clin. Oncol. 2020;(April (2)).

26) Kimmig R., Verheijen R.H.M., Rudnicki M., SERGS Council Robot assisted surgery during the COVID-19 pandemic, especially for gynecological cancer: a statement of the Society of European Robotic Gynaecological Surgery (SERGS) J. Gynecol. Oncol. 2020;(April (3)). 27) Elissar Moujaess, Hampig Raphael Kourie,⁎ and Marwan Ghosn; Crit Rev Oncol Hematol.

2020 Apr 22,doi: 10.1016/j.critrevonc.2020.102972

28) Spicer, J., Chamberlain, C. & Papa, S. Provision of cancer care during the COVID-19 pandemic. Nat Rev Clin Oncol (2020). https://doi.org/10.1038/s41571-020-0370-6. 29) Lisa Rosenbaum, M.D. The Untold Toll — The Pandemic’s Effects on Patients

withoutCovid19April17,2020, DOI: 10.1056/NEJMms2009984.

25 | P a g e 30) Abhishek Shankar1 , Deepak Saini2 , Shubham Roy3 , Alireza Mosavi Jarrahi4 , Abhijit Chakraborty5 , Sachidanand Jee Bharati6 , Farzad Taghizadeh-Hesary; March 2020; Cancer Care Delivery Challenges Amidst Coronavirus Disease – 19 (COVID-19) Outbreak: Specific Precautions for Cancer Patients and Cancer Care Providers to Prevent Spread, 10.31557/APJCP.2020.21.3.569. 31) Wang, Hanping, and Li Zhang. "Risk of COVID-19 for patients with cancer." The Lancet

Oncology 21.4 (2020): e181.

32) Zhang, L., Zhu, F., Xie, L., Wang, C., Wang, J., Chen, R., ... & Peng, P. (2020). Clinical characteristics of COVID-19-infected cancer patients: A retrospective case study in three hospitals within Wuhan, China. Annals of Oncology. 33) Cortiula, F., Pettke, A., Bartoletti, M., Puglisi, F., & Helleday, T. (2020). Managing

COVID-19 in the oncology clinic and avoiding the distraction effect. Annals of

Oncology, 31(5), 553.

26 | P a g e

ACADEMY OF MARITIME EDUCATION AND TRAINING (AMET) (Declared as Deemed to be University u/s 3 of UGC Act 1956) 135, EAST COAST ROAD, KANATHUR, CHENNAI - 603 112. TAMILNADU, INDIA

A Review on Mitochondrial genome analysis of pufferfish (Carinotetraodon travancoricus) and Phylogeny of Tetraodontidae

A Report on Internship

In

Department of Marine Biotechnology

By Nazarene Marylene Nicky Macorious AMBT19005

May 2020

1

INTERNSHIP CERTIFICATE

This is to certify that Mr. Nazarene Marylene Nicky Macorious (Reg.

No. AMBT19005) of M.Sc., Marine Biotechnology 1st Year II Semester has done the work titled ”A Review on Mitochondrial genome analysis of pufferfish (Carinotetraodon travancoricus) and Phylogeny of Tetraodontidae” as a part of Home Based Internship for a partial fulfillment of academic records. He has taken 45 hours to complete the work and his report was found to be excellent.

Signature of the HOD Signature of the Mentor (Dr. L. Senthilnathan) (Dr. M. Jayaprakashvel)

INTERNSHIP ALLOCATION REPORT 2019-20 Name of the Department: Marine Biotechnology

(In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak)

Name of the Programme : M.Sc Marine Biotechnology Year of study and Batch/Group : I Year, Batch -12 Name of the Mentor : Dr. M. Jayaprakashvel Title of the assigned internship :

A Review on Mitochondrial genome analysis of pufferfish (Carinotetraodon travancoricus) and Phylogeny of Tetraodontidae

Nature of Internship : Individual/Group

Reg No of Students who are assigned with this internship:

Reg. No. AMBT19005

Total No. of Hours Required to complete the Internship: 45 Hours

Signature of the Mentor Signature of the Internal Signature of HoD / Programme Examiner Head

INTERNSHIP EVALUATION REPORT 2019-20 Name of the Department: Marine Biotechnology (In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak) Name of the Student Nazarene Marylene Nicky Macorious Register No and Roll No AMBT19005 Programme of study M.Sc Marine Biotechnology Year and Batch/Group I Year, Batch -12 Semester II Title of Internship A Review on Mitochondrial genome analysis of pufferfish (Carinotetraodon travancoricus) and Phylogeny of Tetraodontidae Duration of Internship ………45……..Hours Mentor of the Student Dr. M. Jayaprakashvel Evaluation by the Department Sl Criterion Max. Marks Marks No. Allotted 1 Regularity in maintenance of the diary. 10 9 2 Adequacy & quality of information recorded 10 9 3 Drawings, sketches and data recorded 10 9 4 Thought process and recording techniques used 5 5 5 Organization of the information 5 5 6 Originality of the Internship Report 20 19 7 Adequacy and purposeful write-up of the Internship 10 10 Report 8 Organization, format, drawings, sketches, style, 10 10 language etc. of the Internship Report 9 Practical applications, relationships with basic theory 10 9 and concepts 10 Presentation Skills 10 10 Total 100 95

Signature of the Mentor Signature of the Internal Signature of HoD Examiner /Programme Head

CONTENTS

LIST OF NOTATIONS PAGE NO

Abstract 4

Introduction 5

Methodology 7

Mitogenome analysis 11

Phylogeny of Tetraodontidae 13

Discussion and conclusion 16

List of photographs 19

Acknowledgments 20

References 20

3 A Review on Mitochondrial genome analysis of pufferfish (Carinotetraodon travancoricus) and Phylogeny of Tetraodontidae

NAZARENE MARYLENE NICKY MACARIUS

Abstract

Malabar puffer fish (Carinotetraodon travancoricus) is also known as the pea pufferfish, dwarf Indian puffer or pygym puffer is endemic Kerala and Karnataka. Puffer fish is characterized by a brownish to green dorsal side with irregular spots. Male puffers are less rounded in appearance. Tetraodontiforms consists of 10 extant families and 349 species in which Tetraodontidae family (pufferfish). Genes on mitochondrial genomes are preferred due to high copy number per cell. The animal mitochondrial genome (mitogenome) generally exhibits several characteristics such as high substitution rate, maternal inheritance. The mito -genomes were amplified using PCR technique, DOGMA and BLAST are used to identify protein encoding genes. Fragments produced with each random primers are numbered sequentially. The presence or absence of fragments in each sample is recorded in a binary matrix for each taxa as 1(present) or 0(absent). The mitogenome of Malabar puffer fish is 16487 bp in size consists of 13 protein-coding genes, 22 tRNA genes, two rRNA and 16s rRNA and one control region (D-loop region). Mitochondrial DNA (mtDNA) is the only genetic material outside the nuclear DNA. mtDNA is widely used to analyzing genetic relationship of animal, population differentiation. Mitochondrial DNA encode 13 protein-coding genes, 22 tRNA genes, distributed between the protein-coding genes and rRNA genes. Phylogeny analysis is performed by using 13 linked together in a series of mitochondrial protein-coding gene amino acid sequences to provide evolutionary relationships. Tetraodontid pufferfishes have long attracted biologists across diverse fields, such as morphology, toxicology and molecular biology.

Key words: Malabar puffer fish, Tetraodontiforms, mitogenome, Phylogeny,

Carinotetraodon travancoricus.

4 Introduction

The Malabar puffer fish (Carinotetraodon travancoricus), also known as the pea pufferfish, dwarf Indian puffer or pygym puffer is endemic to southwest India. Carinotetraodon travancoricus commonly known as Malabar puffer fish inhibits in the freshwater and estuaries which is endemic to Kerala and Karnataka (Talwar & Jhingran 1991; Jayaram 1999; Remadevi 2000). Carinotetraodon travancoricus was first described from Pamba River by Hora & Nair (1941). This fish is present in 13 rivers of Kerala including Chalakudy, Pamba, Periyar, Kabani, Bharathapuzha and Muvattupuzha and are reported from the coastal regions of the state such as Lake Vembanad, and Kole wetlands of Trichur (Easa & Basha 1995).

The Malabar Dwarf Puffer (Carinotetraodon travancoricus) is characterized by a brownish to green dorsal side with irregular spots and some yellow tint. The belly is whitish or yellowish. The fins are rounded, and are tinged with yellow toward the base, becoming clear at the ends. There is some evidence that mature male dwarf puffers can identified by a horizontal stripe located from behind the pectoral fins to the tail, which darkens during mating. Male puffers are generally slimmer and less rounded in appearance.

Fig 1: Malabar dwarf puffer (Carinotetraodon travancoricus) (This picture is available online at https://www.allpondsolutions.co.uk/fishkeeping-advice/dwarf-puffer.html)

5 Tetraodontiforms are widely distributed in freshwater, deep sea, coastal, open water pelagic and reef habitat, especially across the tropical seas of South America, central Africa and Southeast Asia. They consist of 10 extant families and 349 spicies in which Tetraodontidae family (pufferfish) is represented by 29 genera with 191 species (Tyler 1980; Yamanoue et al. 2011; Matsura 2015).

Fig 2 : Distribution patterns of marine(shaded) and freshwater(coloured) species in Tetraodontidae(https://doi.org/10.1371/journal.pone.0017410.g001)

They are found in Asia, Sri Lanka to Indonesia and north to China. They inhabit freshwater to brackish coastal estuaries; streams, rivers and flood plains where they are found singly or in small groups. They are endemic to the state of Kerala, India. They are very small in size (30 nm) but the other fishes in the family vary in size upto 3 feet.

The animal mitochondrial genome (mitogenome) generally exhibits several characteristics: high substitution rate, maternal inheritance, and lack of recombination. In contrast, most of the mitochondrial genes studied show slow rates of nucleotide substitution, sometimes yielding few or no differences between closely related species (Shearer et al. 2002; Hellberg 2006; Prada et al. 2014). However, the recent study of the complete mitochondrial genome in this group have revealed different mitochondrial gene rearrangements (Lin et al. 2014; Figueroa and Baco 2015), the discovery of some variable mitochondrial markers (Flo t and Tillier 2007; Luck et al. 2013), and congruence between mitochondrial and morphological groups of species (Luck et al. 2013; Schimidt-Roach et al. 2014) have helped in understanding of their evolutionary history (Medina et al. 2006; Lin et al. 2011, 2014).

6 Genes on mitochondrial genomes are preferred due to high copy number per cell, making them more likely be picked up than single-copy nuclear genes. Mitochondrial genome also records maternal inheritance information and is extensively utilized to infer phylogenetic relationship between diverse lineages. PCR followed by primer walking strategy and sanger dideoxy sequencing, quite some mitogenomes were obtained using a reference-based method via High Throughput Sequencing (HTS) platform. Traditionally genome assembly software, for instance, SOAPdenovo2, ALLPATHS-LG, Platunus, can hardly assemble complete mitogenomes. The two frequently used mitogenome assembly software, MITObim and NOVOplasty, require closely related mitochondrial fragments as seeds to anchor short reads and build initial datasets.

3. Methodology

Sampling

The C. travancoricus collected from the muscle tissue samples and preserved in absolute ethyl alcohol and -20° C.

DNA extraction

Total genomic DNA was obtained by phenol-chloroform extraction from the tissues. The mitochondrial genomic DNA was extracted by removing nuclear DNA by differential centrifugation using DNeasy tissue kits.

DNA amplification

DNA sequence was carried out to elucidate the complete mitogenome of C. travancoricus. primers are designed based on Mitochondrial DNA (mtDNA) sequences.

PCR

The mitogenomes were amplified using PCR technique. A total of 12 PCR primers were used in various combinations to amplify entire mitogenome. Different homology- degenerate primers were designed based on the aligned mitogenome sequence of C. lorteti(GenBank: AP011918) and C. salivator (GenBank: AP011918).The long PCR products were diluted TE buffer (1:19) for subsequent analysis. Labelled fragments were analyzed using Model 3130 DNA sequencers (Applied Biosystems). Amplification was done by NEB long AMP Taq DNA polymerase.

7

Fig 3: PCR machine (This image is available online at https://www.fishersci.co.uk/)

RAPD amplification

These amplification conditions were based on William et al. 1990 with some modification. 200 random sequence 10-mer primers used in the study. Fragments generated by amplification were separated according to size on 2% agarose gels run in TBE buffer, stained with Ethidium Bromide visualized with ultraviolet light.

Fig 4 :RAPD amplification (This image is available online at https://www.omicsonline.org/blog/2015/04/20/9526-Random-amplification-of-polymorphic-DNA.html)

8 Sequence analysis and gene annotation

Fig 5: Amino acid composition of 13 protein-coding genes of C. travancoricus mitogenome(https://doi.org/10.1007/s12041-019-1151-9).

The DNA fragment was preliminary analyzed by using sequencing analysis. DOGMA, ORFfinder and BLAST were used to identify protein encoding genes. The locations of the rRNA genes were determined based on alignments with the other mitogenomes.

Fig 6: The complete Mitochondrial genome organization of C. travancoricus (https://doi.org/10.1007/s12041- 019-1151-9).

9 The AT skew = [A-T]/ [A+T] and GC skew = [G-C]/ [G+C] were used to describe the base composition different between different class of Tetraodontidae. The best-fit substitution models for each data partition were selected by ProtTest version. The position of protein- coding genes and rRNA genes was identified by sequence homology. Nucleotide composition was calculated by MEGA4.0.

Fig 7: AT-skew and GC-skew in all the 13 protein-coding genes of coding (sense) strands of C. travancoricus mitogenome (https://doi.org/10.1007/s12041-019-1151-9)

Positive selection analysis

The CODEML program was used to identify selection. All the models corrected the average nucleotide frequencies at the three codon positions and this model were used in the combined dataset of protein-coding genes. Bayes Empirical Bayes (BEB) analysis was used to calculate the posterior probabilities of the positively selected sites.

Data Analysis

Fragments produced with each random primer were numbered sequentially. The presence or absence of fragments in each sample was recorded in a binary matrix for each taxa as 1(present) or 0(absent). The distance matrices were subjected to cluster analysis using the neighbor-joining (NJ) program in PHYLIP software. Phenograms were plotted with the DRAWGRAM program in PHYLIP software. CLUSTAL W (Thompson et al. 1994) was used

10 to align the sequences. Pairwise distance matrix was constructed for the sequence from 16S nDNA based on 2-parameter model.

4. Mitogenome Analysis

Organisation

The mitogenome of C. travancoricus is 16487 bp in size consists of 13 protein-coding genes, 22 tRNA genes, two rRNA and 16s rRNA and one control region (D-loop region). Mitochondrial DNA (mtDNA) is the only genetic material outside the nuclear DNA. It is characterized of small molecular weight, simple construction, fast evolutionary rate, maternal heredity and non-tissue specificity (Curole and Kocher 1999). mtDNA is widely used to analyzing genetic relationship of animal, population differentiation (Knudsen et al., 2006; Lavoue et al., 2007; Morin et al., 2010; Stoneking and Soodyall, 1996). Most of the genes of the sense strands were in the light strand (L-strand). The mitochondrial genes of C. travancoricus were overlapped by a total of 7 bp in two locations from 8109 to 10360 bp, between the protein coding genes. All GC-skew and AT-skew values were negative except for the H-strand genes. AT-skew and L-strand gene nad6 had a positive GC-skew. This indicates that heavy strand consists of equal amount of A and T, but the overall base composition was mainly C skewed.

Protein coding genes

Mitochondrial DNA of C. travancoricus encode 13 protein-coding genes. The mitogenome contained seven subunits of NADH ubiquinone oxidoreducta -se complex, three subunits of cytochrome c oxidase, one subunit of the ubiquinol cytochrome b oxidoreductase complex and two subunits of ATP synthases. Protein-coding genes of C. travancoricus constitute nearly 68.5% of the mitogenome and vary in size from 165 bp (atp8) to 1812 bp (nad5). Gene overlapping by seven nucleoides was observed on the same strand between atp8, atp6, nad4L and nad4. All protein-coding genes, the more often used amino acid is was Leu, Ala and Thr, while codons encoding Asp and Cys recorded the lowest. The Leu was coded by six codons (UUA, UUG, CUU, CUC, CUA and CUG) as well as Ser (UUC, UCC, UCA, UCG, AGU and AGC). In protein coding genes, the intiation codon is ATG except for cox1 gene.

11 Stop codons nad1, atp8, nad4L, nad5 and cob were terminated with TAA whereas incomplete codons (S. Chandhini et al. 2018, 2019).

Table 1: The organization and characterization of the complete mitochondrial genome of C. travancoricus. (This picture is available online at https://doi.org/10.1007/s12041-019-1151-9)

tRNA and rRNA genes

Each tRNA gene coded for specific amino acid and an additional copy of tRNA gene was observed in serine (AGC) and leucine (CTU) amino acid. The mitogenome of C. travancoricus comprised 22 tRNA genes, distributed between the protein-coding genes and rRNA genes. All tRNAs had typical cloverleaf secondary structure except trnS (GCU) which lacks a dihydrouridine (DHU) stem (S. Chandhini et al. 2019).

12 Non coding region

The noncoding D-loop region is 869bp in C. travancoricus with a sequence similarity of nearly 71.5% with C. salivatory and C. lorteti. Blocks such as CSB-F, CSB-E, CSB-D, CSB- 1, CSB-2 and CSB-3, which is involved in mitochondrial metabolism and in regulation of transcription primer strand synthesis and in replication priming. CSB-1 was involved in the initiation of mtDNA duplication. The consensus sequence of CSB-1 in fishes was recognized, as AT CTGGATATCAAGAGCATAAA and highly conserved sequence is AGCATA. Other conserved sequence blocks CSB-F, CSB-D and CSB-2 is nearly 100% conserved in these fishes (S. Chandhini et al. 2019).

Table 2: Comparison of conserved sequences in the noncoding D-loop region (https://doi.org/10.1007/s12041- 019-1151-9)

5. Phylogeny of Tetraodontidae

Phylogeny analysis is performed by using 13 linked together in a series of mitochondrial protein-coding gene amino acid sequences to provide evolutionary relationships. Almost all the clades were strongly supported (Wenden Mu et al. 2018). All sequences are linked like a chain and aligned using ClustalX2.1. Phylogenetic analysis were performed using neighbour-joining (NJ) in MEGA 4.0 (Tamura et al., 2007) and Maximum Likelihood (ML) in PhyML 3.0 (Guindon et al., 2010). The bootstrap of NJ and ML was 1000.

13

Fig 8: The illustrations of Takifugu species are reproduced courtesy of the Tokai University Press (Yamada 2000). (This figure is available online at https://www.researchgate.net/figure/Timescale-for-the-divergence-of- Takifugu-species-based-on-the-ML-tree)

phylogenetic analysis utilizing full mitogenomes have additionally been performed utilizing DNA acquired from historical museam specimens, whose DNA is regularly so much or significantly progressively debased as the DNA got from subfossil remains. As of late, the capability of sequencing mitogenomes from antiquated examples utilizing genuine Single Molecule Sequencing (tSMS or third generation sequencing) has been illustrated. As the name proposes, tSMS platforms can peruse the first format DNA particles straightforwardly without the need of earlier intensification, which has some 5/potential advantages for exploring ancient DNA sequences. Ginolhac et al. 2012 used the Helicos tSMS platform to sequence the mitogenome of a Pleistocene harse bone with ~85% coverage. With the turn of events and use

14 of NGS, bigger scope concentrates on ancient DNA have gotten conceivable, making ready for additional inside and out analyses of population hereditary qualities and phylogeography. Museum samples

Authentic samples from historical centers and different documents are progressively utilized for phylogenetic and phylogeographic examinations. Therefore, historical or museum specimens regularly give comparable innovative difficulties as Pleistocene or Early Holocene samples, which makes the methodological approches utilized comparable. There are a few angles that make museum specimens fascinating for phylogenetic and phylogeographic analysis. Phylogenetic and phylogeographic analysis from museum specimens informing about genetic diversity prior to preceding human effect are significant expansion to the development of preservation systems. Phylogenetic analysis of single mt genes such as the rRNA (Hillis and Dixon, 1991) and cytochrome b (Lydegard and Roe, 1997) have resolved some intraordinal teleostean relationships. Teleostean species that were selected with particular aim of providing a broad phylogenetic picture of this group (Miya et al., 2001). Analysis confidently recovered monophyly of Tetraodontidae as well as its sister-group relationship with Diodontidae with 100% bootstrap probabilities (BP). Tetraodontidae is composed of 4 major lineages (Clade A- D) that are supported by 100% BPs. Clade A is the most basal, followed by the divergence of Clade B and Clade C+D. Two species of Central Africa Tetraodon form a well-supported clade (BP=100%), with a sister -group relationship with Chelonodon species (BP=100%). Southeast Asian freshwater species also form a clade in the resulting phylogenies, but this clade is partially supported (Yasuke Y, Miya M, Doi H, Mabuchi K, Sakai H et al., 2011).

Phylogeny of Tetraodontid pufferfish

Tetraodontid pufferfishes have long attracted biologists across diverse fields, such as morphology, toxicology and molecular biology, but their phylogenetic relationships have remained unexplored. A morphology-based classification that divides this family into two subfamilies, Canthigasterinae and Tetraodontidae. Tyler provided osteological and external morphological descriptions of representative species of Tetraodontid genera. Tetraodontid phylogeny has 16 genera and illustrated without the use of cladistic methods. Holcroft and Alfaro et al., attempted to resolve the phylogeny of the entire Tetraodontiformes by using nuclear RAG1 and mitochondrial 12s and 16s rRNA gene sequences. (Yasuke Y, Miya M, Doi H, Mabuchi K, Sakai H et al., 2011).

15

Tetraodontid pufferfishes have caught the attention of many researchers in various fields, because of their morphological peculiarity, tetrodotoxin and as model organism in molecular biology research (Hedges et al. 2002).

6. Discussion and conclusion

The mitochondrial genome interacts with hundreds of nuclear encoded proteins, thus it needs to coordinate its function with the nuclear genome (Ballard and Dean, 2001). Mitogenome size of C. travancoricus is higher than C. lorteti and C. salivator. These changes occur due to the variations in the control and intergenic spacer regions. The mitogenome of C. travancoricus is composed of 13 protein-coding genes, 22 tRNA and 2 rRNA and a control region.

The overall composition of C. travancoricus mitogenome was AT biased and C skewed. High A+T content reveals strand asymmetry, which is similar in many fishes. AT skews and GC skews are less in C. travancoricus with respect to C. lorteti and C. salivator. Codon usage by different genes and among the species varies according to nonrandomness in mutation and selection (Hershberg and Petrov 2008). For example, the codon for Gly (GGU) is not really utilized and codons GGC, GGA and GGG are utilized by all species with inclination for GGC. D-loop region contains many regulatory elements, so evolutionary rate is more when compared to protein-coding regions. These days, we are able to obtain mitogenomes with higher efficiency and low cost. Advancement of HTS strategy and low sequencing cost enormously encourages mitogenome sequencing. Phylogeny analysis performed by using 13 linked together in a series of mitochondrial protein coding gene amino acid sequences to provide evolutionary relationships. Since the primary publication of mitogenome datasets from antiquated DNA got from subfossil mao bone, to date at least 124 complete or practically complete mitogenomes have been distributed till 2012. Phylogenetic studies have been the soonest utilization of antient DNA investigations and stay to be one of the most significant parts of this exploration/research field. Because phylogenetic studies often investigate relatively deep in difference occasions, the short mitochondrial DNA (mtDNA) sections investigated in the beginning of old DNA regularly gave inadequate data to understanding phylogenetic inquiries. The high duplicate number and raised articulation levels of mitochondrial genomes imply that they represent a significant proportion of the reads created from next-generation DNA and RNA sequencing experiments.

16

Fig 9: ML tree using the 12n3rRTn data set. Arrowheads indicate the topological difference between the ML analysis for the 12n3rRTn and the 123nRTn datasets. The numbers near internal branches indicate bootstrap probabilities of 12n3rRTn(left) and 123nRTn(right) datasets, respectively (values less than 50% not shown). Single numbers indicate that ML analyses for the 12n3rRTn and 123nRTn datasets resulted in identical values. *Freshwater species (https://doi.org/10.1007/s12041-019-1151-9).

17 Mitochondrial transcripts are regularly rich in adenine and thymine, and in certain heredities polyadenylated, their commitment to the general number of reads has been appeared to go up with expanded poly-A RNA determination. There are many number of free, online bioinformatics resources devoted to analysing mtDNAs, such as MFannot an automated annotation tool for mitochondrial genomes (D R smith et al., 2015).

There is also an extremely high rate of publications for mitochondrial genomes. 2014 can be named as glorious year for mitochondrial genomes as more than 1100 peer-reviewed articles had the word ‘the complete mitochondrial genome’ in the papers published from the previous 10 years studies. There have been some recent innovations in understading the genetics of mitochondrial disorders/ diseases. Few would scrutinize the utility of mtDNA as genetic marker, yet few would likewise scrutinize that the sequencing of mtDNAs has become a fast and simple method to peer-checked on publications.

I contend that in addition to mtDNA sequencing, more vitality could be spent portraying orther parts of mitochondrial genomes, especially chromosome stuctures, transcriptional and translational architechtures, populace hereditary qualities and methods of fix and replication. Mitochondria and their genomes is personally attached to the investigation of endosymbiosis. The endosymbiotic inception of mitochondria has become universality. A portion of the underlying convincing perceptions supporting the endosymbiotic speculation incorporated the disclosure, during the 1960s, that mitochondria contain DNA and an unmistakable RNA translation system. These discoveries unequivocally certified the bacterial cause of a mitochondrion, which likely includes its underlying foundations inside the phylum α- Proteobacteria.

Mitogenome analysis has developed as a significant apparatus in many research regions, for example, studying population genetics, evolutionary relationships, phylogenetic relationships and phylogeography. (Behura et al. 2011). Also, entire mtDNA genome sequencing has improved the goals of phylogenetic analysis contrasted with single gene or single region studies (Simon et al. 2006; Santamaria et al. 2007).

For many groups, mtDNAs are so well sampled that newly published genomes are no longer contributing to the progression of science and are tying up valuable resource (D R smith et al. 2015). The mitogenome analysis has helped to find the ways to conserve the endangered

18 species but many groups are thinking that mitogenome analysis is the simple way to publish a paper. The research articles and review articles which I studied to give this review has the same old information regarding the mitogenome analysis. But some articles really helped in saving the species which come under critically endangered by knowing their mtDNA in detail. As of my review is regarding specific group of puffer fish (C. travancoricus) which was critically endangered is saved by the studies made on their mitogenome.

7. List of photographs

FIGURE 1 Malabar dwarf puffer (Carinotetraodon travancoricus)

FIGURE 2 Distribution patterns of marine(shaded) and freshwater(coloured) species in Tetraodontidae FIGURE 3 PCR machine

FIGURE 4 RAPD amplification

FIGURE 5 Amino acid composition of 13 protein- coding genes of C. travancoricus mitogenome FIGURE 6 The complete Mitochondrial genome organization of C. travancoricus

FIGURE 7 AT-skew and GC-skew in all the 13 protein- coding genes of coding (sense) strands of C. travancoricus mitogenome FIGURE 8 The illustrations of Takifugu species are reproduced

FIGURE 9 ML tree using the 12n3rRTn data set

TABLE 1 The organization and characterization of the complete mitochondrial genome of C. travancoricus TABLE 2 Comparison of conserved sequences in the noncoding D-loop region

19 8. Acknowledgments

This review article study was supported AMET university, Chennai, India; and I would like to thank all my professors. I would like to thank all the anthors and their research work without which this review would have not been possible.

9. References

1. Sathyajith, C., Yamanoue, Y., Yokobori, S. I., Thampy, S., & Jayadradhan, R. K. V. (2019). Mitogenome analysis of dwarf pufferfish (Carinotetraodon travancoricus) endemic to southwest India and its implications in the phylogeny of Tetraodontidae. Journal of Genetics, 98(5), 105. 2. Alfaro, M. E., Santini, F., & Brock, C. D. (2007). Do reefs drive diversification in marine teleosts? Evidence from the pufferfish and their allies (Order Tetraodontiformes). Evolution: International Journal of Organic Evolution, 61(9), 2104-2126.

3. Hedges, S. B. (2002). The origin and evolution of model organisms. Nature Reviews

Genetics, 3(11), 838-849.

4. Hershberg, R., & Petrov, D. A. (2008). Selection on codon bias. Annual review of genetics, 42, 287-299. 5. Holcroft, N. I. (2005). A molecular analysis of the interrelationships of tetraodontiform fishes (Acanthomorpha: Tetraodontiformes). Molecular Phylogenetics and Evolution, 34(3), 525-544. 6. Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular biology and evolution, 33(7), 1870-1874. 7. Prasad, G., Sabu, K., & Prathibhakumari, P. V. (2012). The first report of the Malabar puffer, Carinotetraodon travancoricus (Hora & Nair, 1941) from the Neyyar wildlife sanctuary with a note on its feeding habit and length-weight relationship. Journal on New Biological Reports, 1(2), 42-46. 8. Tyler, J. C. (1980). Osteology, phylogeny, and higher classification of the fishes of the order Plectognathi (Tetraodontiformes) (Vol. 434). US Department of Commerce, National Oceanic and Atmospheric Administration, National Marine Fisheries Service.

20 9. Yamanoue, Y., Miya, M., Doi, H., Mabuchi, K., Sakai, H., & Nishida, M. (2011).

Multiple invasions into freshwater by pufferfishes (Teleostei: Tetraodontidae): a mitogenomic perspective. PLoS One, 6(2). 10. Yang, T., Meng, W., Xuhui, W., Gao, T., & Liu, Y. (2019). The Complete Mitochondrial Genome of Endemic Freshwater Sculpin Cottus dzungaricus (Scorpaeniformes: Cottidae) Revealed by High-Throughput NGS: Genome Structure and Its Phylogenetic Relationships. Turk. J. Fish. & Aquat. Sci, 20(1), 29-37. 11. Yuan, M. L., Zhang, Q. L., Guo, Z. L., Wang, J., & Shen, Y. Y. (2015). The complete mitochondrial genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and phylogenetic analysis of Pentatomomorpha. PLoS One, 10(6). 12. Xie, J., Feng, J., Guo, Y., Ye, Y., Li, J., & Guo, B. (2019). The complete mitochondrial genome and phylogenetic analysis of Nerita yoldii (Gastropoda: Neritidae). Mitochondrial DNA Part B, 4(1), 1099-1100. 13. Chandhini, S., Arjunan, V. M., Ali, P. A., Raghavan, R., Pillai, D., & Kumar, V. R. (2019). Complete mitogenome analysis of endangered Malabar mahseer (Tor malabaricus). Conservation Genetics Resources, 11(2), 185-189. 14. Goryunov, D. V., Nagaev, B. E., Nikolaev, M. Y., Alexeevski, A. V., & Troitsky, A.

V. (2015). Moss phylogeny reconstruction using nucleotide pangenome of complete mitogenome sequences. Biochemistry (Moscow), 80(11), 1522-1527. 15. Paz-García, D. A., Galván-Tirado, C., Alvarado, J. J., Cortés, J., García-De-León, F. J., Hellberg, M. E., & Balart, E. F. (2016). Variation in the whole mitogenome of reef- building Porites corals. Conservation genetics resources, 8(2), 123-127. 16. Luck, D. G., Forsman, Z. H., Toonen, R. J., Leicht, S. J., & Kahng, S. E. (2013).

Polyphyly and hidden species among Hawaiʻi’s dominant mesophotic coral genera,

Leptoseris and Pavona (Scleractinia: Agariciidae). PeerJ, 1, e132.

17. Medina, M., Collins, A. G., Takaoka, T. L., Kuehl, J. V., & Boore, J. L. (2006). Naked corals: skeleton loss in Scleractinia. Proceedings of the National Academy of Sciences, 103(24), 9096-9100. 18. He, S., Lu, J., Jiang, W., Yang, S., Yang, J., & Shi, Q. (2016). The complete mitochondrial genome sequence of a cavefish Sinocyclocheilus anshuiensis (Cypriniformes: Cyprinidae). Mitochondrial DNA Part A, 27(6), 4256-4258. 19. Song, L., Liu, B., Xiang, J., & Qian, P. Y. (2001). Molecular phylogeny and species identification of pufferfish of the genus Takifugu (Tetraodontiformes, Tetraodontidae). Marine Biotechnology, 3(4), 398-406.

21

20. Swofford, D. L. (1996). Phylogenic inference. Molecular systematic.

21. Mu, W., Liu, J., & Zhang, H. (2018). Complete mitochondrial genome of Benthodytes marianensis (Holothuroidea: Elasipodida: Psychropotidae): Insight into deep sea adaptation in the sea cucumber. PloS one, 13(11). 22. Smith, D. R. (2016). The past, present and future of mitochondrial genomics: have we sequenced enough mtDNAs?. Briefings in functional genomics, 15(1), 47-54. 23. Bignell, G. R., Miller, A. R., & Evans, I. H. (1996). Isolation of mitochondrial DNA.

In Yeast Protocols (pp. 109-116). Humana Press

24. Smith, D. R. (2013). Death of the genome paper. Frontiers in genetics, 4, 72.

25. Andersson, S. G., Zomorodipour, A., Andersson, J. O., Sicheritz-Pontén, T., Alsmark, U. C. M., Podowski, R. M., ... & Kurland, C. G. (1998). The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature, 396(6707), 133-140. 26. Cummings, D. J., McNally, K. L., Domenico, J. M., & Matsuura, E. T. (1990). The complete DNA sequence of the mitochondrial genome of Podospora anserina. Current genetics, 17(5), 375-402. 27. Paijmans, J. L., Gilbert, M. T. P., & Hofreiter, M. (2013). Mitogenomic analyses from ancient DNA. Molecular phylogenetics and evolution, 69(2), 404-416. 28. Duchêne, S., Archer, F. I., Vilstrup, J., Caballero, S., & Morin, P. A. (2011).

Mitogenome phylogenetics: the impact of using single regions and partitioning schemes on topology, substitution rate and divergence time estimation. PloS one, 6(11). 29. Orlando, L., Leonard, J. A., Thenot, A., Laudet, V., Guerin, C., & Hänni, C. (2003).

Ancient DNA analysis reveals woolly rhino evolutionary relationships. Molecular phylogenetics and evolution, 28(3), 485-499. 30. Orlando, L., Ginolhac, A., Raghavan, M., Vilstrup, J., Rasmussen, M., Magnussen, K.,

... & Froese, D. (2011). True single-molecule DNA sequencing of a pleistocene horse bone. Genome research, 21(10), 1705-1719. 31. Wandeler, P., Hoeck, P.E.A., Keller, L.F., 2007. Back to the future: museum specimens in population genetics. Trends Ecol. Evol. 22 (12), 634–642. 32. Miller, W., Drautz, D.I., Janecka, J.E., Lesk, A.M., Ratan, A., Tomsho, Lynn P., Packard, Mike, Zhang, Yeting, McClellan, L.R., Qi, J., Zhao, F., Gilbert, M.T.P., Dalén, L., Arsuaga, J.L., Ericson, P.G.P., Huson, D.H., Helgen, K.M., Murphy, W.J., Götherström, A., Schuster, S.C., 2009. The mitochondrial genome sequence of the Tasmanian tiger (Thylacinus cynocephalus). Genome Res. 19 (2), 213–220.

22

33. Mason, V.C., Li, G., Helgen, K.M., Murphy, W.J., 2011. Efficient cross-species capture hybridization and next-generation sequencing of mitochondrial genomes from noninvasively sampled museum specimens. Genome Res. 21 (10), 1695–1704 34. Rasmussen, M., Guo, X., Wang, Y., Lohmueller, K.E., Rasmussen, S., Albrechtsen A, Skotte L, Lindgreen S, Metspalu M, Jombart T, Kivisild T, Zhai W, Eriksson A, Manica A, Orlando L, De La Vega FM, Tridico S, Metspalu E, Nielsen K, Ávila- Arcos MC, Moreno-Mayar JV, Muller C, Dortch, J., Gilbert, M.T., Lund, O., Wesolowska, A., Karmin, M., Weinert, L.A., Wang, B., Li, J., Tai, S., Xiao, F., Hanihara, T., van Driem, G., Jha, A.R., Ricaut, F.X., de Knijff, P., Migliano, A.B., Gallego Romero, I., Kristiansen, K., Lambert, D.M., Brunak, S., Forster, P., Brinkmann, B., Nehlich, O., Bunce, M., Richards, M., Gupta, R., Bustamante, C.D., Krogh, A., Foley, R.A., Lahr, M.M., Balloux, F., Sicheritz-Pontén, T., Villems, R., Nielsen, R., Wang, J., Willerslev, E., 2011. An Aboriginal Australian genome reveals separate human dispersals into Asia. Science 334 (6052), 94–98. 35. Rowe, K.C., Singhal, S., Macmanes, M.D., Ayroles, J.F., Morelli, T.L., Rubidge, E.M., Bi, K., Moritz, C.C., 2011. Museum genomics: low-cost and high-accuracy genetic data from historical specimens. Mol. Ecol. Resour. 11 (6), 1082–1092. 36. Willerslev, E., Gilbert, M.T.P., Binladen, J., Ho, S.Y., Campos, P.F., Ratan, A., Tomsho, Lynn P, da Fonseca, R.R., Sher, A., Kuznetsova, Tatanya V., Nowak-Kemp, M., Roth, T.L., Miller, W., Schuster, S.C., 2009. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution. BMC Evol. Biol. 9, 95. 37. Elmerot, C., Arnason, U., Gojobori, T., & Janke, A. (2002). The mitochondrial genome of the pufferfish, Fugu rubripes, and ordinal teleostean relationships. Gene, 295(2), 163-172.

38. Yamanoue, Y., Miya, M., Inoue, J. G., Matsuura, K., & Nishida, M. (2006). The mitochondrial genome of spotted green pufferfish Tetraodon nigroviridis (Teleostei: Tetraodontiformes) and divergence time estimation among model organisms in fishes. Genes & genetic systems, 81(1), 29-39. 39. Hillis, D. M., & Dixon, M. T. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly review of biology, 66(4), 411-453. 40. Meng, G., Li, Y., Yang, C., & Liu, S. (2019). MitoZ: a toolkit for animal mitochondrial genome assembly, annotation and visualization. Nucleic acids research, 47(11), e63- e63.

23

41. Shaw, J. L., Clarke, L. J., Wedderburn, S. D., Barnes, T. C., Weyrich, L. S., & Cooper, A. (2016). Comparison of environmental DNA metabarcoding and conventional fish survey methods in a river system. Biological Conservation, 197, 131-138. 42. Yamamoto, S., Masuda, R., Sato, Y., Sado, T., Araki, H., Kondoh, M., ... & Miya, M. (2017). Environmental DNA metabarcoding reveals local fish communities in a species-rich coastal sea. Sci Rep 7: 40368. 43. Goldberg, C. S., Turner, C. R., Deiner, K., Klymus, K. E., Thomsen, P. F., Murphy, M.

A., ... & Laramie, M. B. (2016). Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods in ecology and evolution, 7(11), 1299-1307. 44. Chen, J. N., Samadi, S., & Chen, W. J. (2015). Elopomorpha (Teleostei) as a New Model Fish Group for Evolutionary Biology and Comparative Genomics. In Evolutionary Biology: Biodiversification from Genotype to Phenotype (pp. 329- 344). Springer, Cham.

45. Yamanoue, Y., Miya, M., Matsuura, K., Miyazawa, S., Tsukamoto, N., Doi, H., ... & Sakai, H. (2009). Explosive speciation of Takifugu: another use of fugu as a model system for evolutionary biology. Molecular biology and evolution, 26(3), 623-629. 46. Aparicio, S., Chapman, J., Stupka, E., Putnam, N., Chia, J. M., Dehal, P., ... & Gelpke, M. D. S. (2002). Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes. Science, 297(5585), 1301-1310. 47. Bolnick, D. I., & Near, T. J. (2005). Tempo of hybrid inviability in centrarchid fishes

(Teleostei: Centrarchidae). Evolution, 59(8), 1754-1767.

48. Cheng, S., Higuchi, R., & Stoneking, M. (1994). Complete mitochondrial genome amplification. Nature genetics, 7(3), 350-351. 49. Crnogorac-Jurcevic, T., Brown, J. R., Lehrach, H., & Schalkwyk, L. C. (1997).

Tetraodon fluviatilis, a new puffer fish model for genome studies. Genomics, 41(2),

177-184.

50. Hinegardner, R., & Rosen, D. E. (1972). Cellular DNA content and the evolution of teleostean fishes. The American Naturalist, 106(951), 621-644. 51. Jaillon, O., Aury, J. M., Brunet, F., Petit, J. L., Stange-Thomann, N., Mauceli, E., ... & Nicaud, S. (2004). Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature, 431(7011), 946-95.

24

ACADEMY OF MARITIME EDUCATION AND TRAINING (AMET) (Declared as Deemed to be University u/s 3 of UGC Act 1956) 135, EAST COAST ROAD, KANATHUR, CHENNAI - 603 112. TAMILNADU, INDIA

CHARACTERISTICS OF BIOLOGICALLY ACTIVE MARINE PIGMENTS: A REVIEW

A Report on Internship

In Department of Marine Biotechnology

By S.PORSELVAM AMBT19006

May 2020

1

INTERNSHIP CERTIFICATE

This is to certify that Mr. S. Porselvam (Reg. No. AMBT19006) of M.Sc., Marine Biotechnology 1st Year II Semester has done the work titled “Characteristics of Biologically Active Marine Pigments: A Review” as a part of Home Based Internship for a partial fulfillment of academic records. He has taken 45 hours to complete the work and his report was found to be excellent.

Signature of the Mentor Signature of the HOD (Dr. M. Jayaprakashvel) (Dr. L. Senthilnathan)

2

INTERNSHIP ALLOCATION REPORT 2019-20 Name of the Department: Marine Biotechnology

(In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak)

Name of the Programme : M.Sc Marine Biotechnology Year of study and Batch/Group : I Year, Batch -12 Name of the Mentor : Dr. M. Jayaprakashvel Title of the assigned internship :

Characteristics of Biologically Active Marine Pigments: A Review

Nature of Internship : Individual/Group

Reg No of Students who are assigned with this internship:

Reg. No. AMBT19006

Total No. of Hours Required to complete the Internship: 45 Hours

Signature of the Mentor Signature of the Internal Signature of HoD / Programme Examiner Head

INTERNSHIP EVALUATION REPORT 2019-20 Name of the Department: Marine Biotechnology (In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak) Name of the Student S. Porselvam Register No and Roll No AMBT19006 Programme of study M.Sc Marine Biotechnology Year and Batch/Group I Year, Batch -12 Semester II Title of Internship Characteristics of Biologically Active Marine Pigments: A Review Duration of Internship ………45……..Hours Mentor of the Student Dr. M. Jayaprakashvel Evaluation by the Department Sl Criterion Max. Marks Marks No. Allotted 1 Regularity in maintenance of the diary. 10 8 2 Adequacy & quality of information recorded 10 9 3 Drawings, sketches and data recorded 10 9 4 Thought process and recording techniques used 5 5 5 Organization of the information 5 5 6 Originality of the Internship Report 20 15 7 Adequacy and purposeful write-up of the Internship 10 9 Report 8 Organization, format, drawings, sketches, style, 10 9 language etc. of the Internship Report 9 Practical applications, relationships with basic theory 10 10 and concepts 10 Presentation Skills 10 9 Total 100 88

Signature of the Mentor Signature of the Internal Signature of HoD Examiner /Programme Head

CONTENTS

TOPIC PAGE NO

1. ABSTRACT 3 2. INTRODUCTION 4 3. METHODOLOGY 6 4. CONCLUSION 17 5. REFERENCES 18 6. LIST OF TABLES 22

3

Abstract

Research into natural products from the marine environment, including microorganisms, marine animals, and marine plants have rapidly increased over the past two decades. Despite the enormous difficulty in isolating and harvesting marine pigment, microbial metabolites are increasingly attractive to science because of their broad-ranging pharmacological activities, especially those with unique color pigments. Many of these pigments have a variety of biological activities, including antitumor, antibacterial, antioxidant and anti-inflammatory. Pigments from natural sources are gaining more importance mainly due to health and environmental issues. This current review paper gives an overview of the pigmented natural compounds isolated from marine bacteria, marine invertebrates, marine plants based on accumulated data in the literature. This review discuss about the biological activities of pigments extracted from marine origin.

Key words: Marine pigments, biological activities, marine invertebrates, marine plant, marine bacteria

4

Introduction

Pigments are colored, black, white or fluorescent particulate organic or inorganic solids which usually are insoluble in, and essentially physically and chemically unaffected by, the vehicle or substrate in which they are incorporated. They alter appearance by selective absorption and/or by scattering of light. Pigments are used for coloring paint, ink, plastic, fabric, cosmetics, food, and other materials. Most pigments used in manufacturing and the visual arts are dry colorants, usually ground into a fine powder (Minal. R. Dave, 2018).

Natural pigments are a group of chemically heterogeneous molecules that occur across several taxonomical groups. Due to the remarkable chemistry of marine organisms, many species exhibit a wide range of colours, many of which display several biological properties and constitute an evolutionary adaptation (David M. Pereira, 2014). There is a growing interest for the use of natural colours mainly from the consumers due to the harmful concerns associated and synthetic dyes and pigments. Humans have traditionally preferred natural sources to add colors to food, clothing, cosmetics, and medicines (Mekala Venkatachalama, 2017). Natural pigments are normally products of complex biosynthetic pathways involving numerous enzymes. The chemical pigments resulting from metabolic processes can be broadly classified into two classes: Those pigments directly responsible for animal colours, and the coloured secondary metabolites (Bandaranayake, 2006).

Natural pigments are derived from various sources, mainly from plants and microalgae, they produces an abundant pigments, such as carotenoids, phycobiliproteins and chlorophyll. Marine animals such as fish and invertebrates have attracted considerable attention, and a number of novel classes of natural pigments with potential economic importance have been reported. (Kai-Xiong Ye, 2013)

The pigments from the source of microorganisms are relatively abundant, and the microorganisms that can produce pigments mainly include bacteria, cyanobacteria, actinobacteria, yeast, and fungi. These marine microorganisms are isolated from different places, including algae, fishes, molluscs, sponges, mangroves, seawater, and sediments and the compunds of the pigments are Carotenoids, melanins, flavins, phenazines, quinones, and bacteriochlorophylls, and more specifically monascins, violacein, and indigo. (Dufosse, 2014)

5

Marine natural pigments

Many of the microbial pigments not only act as coloring agents in various food processing and cosmetics industry but also possess anticancer, antioxidant, anti-inflammatory, anti-microbial activities.

METHODOLOGY

For bacteria, The isolated bacterial sp. were subjected to the following biochemical tests i.e. Indole test, methyl red and voges proskauer test, citrate test, oxidase test, catalase test, triple sugar iron agar test, urease test, and carbohydrate fermentation test. the optimization for the production of pigment from the isolates was carried out with nutrient broth. Optimization was carried out to increase the pigment production as well as growth rate of isolates. Temperature and pH are important parameter for growth of pigment (Minal. R. Dave, 2018) Cultivations for production of biomass for characterization of the culture collection were performed in 96-well plates, shake flasks, and fermentors (Marit H. Stafsnes1, 2010). The bacterial cell isolates were grown in Luria Bertini broth and the pigments were extracted from the organisms. After obtaining the pigment Silica gel TLC plates are cut as per need. The bacterial pigment extracts, the carotenoid yellow, orange, pink red pigment spots observed were marked and Rf value determined. The bacterial pigments were purified by column chromatography whereas, the fractions collected were evaporated and the thickly concentrated carotene fractions are used for TLC. The stationary phase of silica gel (100–200 μm) and mobile phase of chloroform: methanol 95: 5 are used (Selvi & Iyer, 2018) For marine invertebrates, in sea urchins Dissolution of the spines was accomplished by using -2.25 ml of concentrated hydrochloric acid per g of spines. The resulting dark red solution was then filtered over acid-washed (IN HC1) celite. The filtrate was then made basic with sodium bicarbonate in small portions. Removal of the lipid material was carried out by using peroxide-free ether and regeneration of the spinochromes from the bluish black solution was accomplished by careful acidification using hydrochloric acid. The ether extracts containing the spinochromes were combined and dried over anhydrous sodium sulfate. After gravity filtration and removal of the ether in vacuo, the crude spinochrome mixture was analyzed by thin-layer chromatography with acid-treated silica gel as the adsorbent and 5% methanol in chloroform as

6

the eluting solvent. After that the extract purified by silica gel based column chromatography (Chang & Moore, 1971). For marine plants, such as algae, sea grass, diatoms: To extract a pigment have to grow a algae: dark illumination provided by 36 W white fluorescent lamps as per standard laboratory conditions for 7 days and the growth of the cyanobacteria was observed in the 3rd dilution. The cells were counted and the results were expressed as colony forming units per volume (CFU mL−1). The phycocyanin pigment was extracted from cyanobacteria by cold maceration method For extraction of the pigment, 5 g of 15 days old cyanobacterial culture was used. The biomass was homogenised and centrifuged at 4000 rpm. The pellet was suspended in 100 mL of 20mM acetate buffer containing 50mM NaCl and 0.002mM sodium azide. Phycocyanin was extracted by repeated freezing and thawing till the acetate buffer turns blue. The cell debris was removed by centrifugation and the crude pigment extract was precipitated with 62% ammonium sulphate. The extracted phycocyanin was characterized by UV–Visible spectrometry and HPLC (K. Renugadevi, 2018).

Pigments from marine bacteria

Marine bacteria are attractive to researchers because they can potentially produce compounds with unique biological properties (Azamjon B. Soliev, Bioactive Pigments fromMarine Bacteria: Applications and Physiological Roles, 2011) and one of the main sources of natural pigments, are often isolated from algae, sponges, mangroves, and sediments. These pigments are mainly divided into indole derivatives (quinones and violaecin), alkaloids (prodiginines and tambjamines), polyenes, macrolides, peptides, and terpenoids (Kai-Xiong Ye, 2013) Bacterial strain Therapeutic activity Pigment Reference Streptomyces rubber Anti-cancer Undecylprodigiosin (Gerber, 1975) Pseudoalteromonas Immunosuppressant; anticancer; Cycloprodigiosin (C. Yamamoto, denitrificans antimalarial 1999) (K. Anti-plasmodial Kawauchi, 1997) α-Proteobacteria Anti-plasmodial Heptyl prodigiosin (J. E. Lazaro, 2002)

7

Pseudoalteromonas rubra Antibacterial; Anticancer; Algicidal Prodigiosin (Gauthier N. N., 1979) Hahella chejuensis Antibacterial; Anticancer; Algicidal Prodigiosin (H. Yi, 2003) Agrobacterium aurantiacum Antioxidation Astaxanthin (N. Misawa, (carotene) 1995) Pseudoalteromonas Antioxidation Astaxanthin (M. J. Gauthier, luteoviolacea (carotene) 1976) Pseudoalteromonas tunicata Antibiotic; Antiprotozoan; Violacein (C. Matz, 2004) Anticancer Pseudoalteromonas sp. 520P1 Antibiotic; Antiprotozoan; Violacein (S. Yada, 2008) (S. Hakvag, 2009)Anticancer Collimonas CT Antibiotic; Antiprotozoan; Violacein (S. Hakvag, Anticancer 2009) Pseudonocardia sp. B6273 Antibiotic Methyl saphenate (R. P. Maskey I. (phenazine K., 2003) derivative) Bacillus sp. Cytotoxic Phenazine (D. Li, 2007) derivatives Pseudomonas aeruginosa Antibacterial Pyocyanin and (S. Saha, 2008) pyorubrin Pseudomonas aeruginosa Antibiotic Phenazine-1- (A. Nansathit, carboxylic acid 2009) Streptomycete sp. Antibiotic 5,10- (K. Pusecker, dihydrophencomyci 1997) n methyl ester Streptomycete sp. B6921 Antibacterial Fridamycin D, (R. P. Maskey Himalomycin E. H., 2003) A, Himalomycin B Streptomycete sp. M045 Anticancer Chinikomycin A and (F. Li, 2005) Chinikomycin B, Manumycin A Pseudoalteromonas tunicata Antibiotic, Anticancer Tambjamines (BE- (A. Franks, 18591, 2005)

8

pyrrole and their (D. M. synthetic analogs) Pinkerton, 2010) Vibrio cholerae Protection from UV irradiation Melanins (S. I. Kotob, 1995) Cyanobacteria Protection from UV irradiation Scytonemin (C. S. Anti-inflammatory, Antiproliferative Stevenson, 2002) Shewanella colwelliana Protection from UV irradiation Melanins (S. I. Kotob, 1995) Cytophaga/Flexibacteria Antibiotic Tryptanthrin (I. Wagner- AM13,1 D¨obler, 2002) Strain Alteromonas nigrifaciens Protection from UV irradiation Melanins (E. P. Ivanova, 1996) Cellulophaga tyrosinoxydans Protection from UV irradiation Melanins (H. Y. Kahng, 2009) Micromonospora lupine Antitumor agent Anthraquinone (Igarashi, 2007) Chromobacterium Anti-tumor, anti-microbial, and anti- Violacein (Duran, 2007) parasitic agent Streptomyces glaucescens Anti-cancer agent and anti-oxidant Melanin (El-Naggar, NEAE-H 2017) Pseudomonas aeruginosa Anti-microbial agent Pyocyanin (El-Fouly, 2015) Pedobacter Antioxidant Carotenoid (Correa Llanten, 2012) Table 1 : Therapeutic activities of pigment from marine bacteria Pigments from invertebrates

Marine invertebrates are classified into several phyla, including some major ones mentioned in parentheses: Protozoa (flagellates, amoeba, foraminifera, etc.); Porifera (sponges); Coelenterata (jellyfishes, sea anemones, corals); Platyhelminthes and Nemertinea (flatworms and ribbon

9

worms); Echinodermata (sea stars, brittlestars, sea urchins, sea cucumbers, sea lilies); and Mollusca (snails, slugs, bivalves, squids, octopus, etc.) (Chang, 1973) Several studies of the chemical defences of marine invertebrates point to an increased interest in understanding the ecological rationale for the production of these compounds, and their biological activities. Pigments in marine invertebrates and their distribution and functions seem to differ between invertebrate groups. (Bandaranayake, 2006)

Invertebrates Scientific name Therapeutic activities Pigments reference species Nudibranch Nembrotha Antimicrobial blue tetrapyrrole (P. Karuso and kubaryana P. J. Scheuer, 2002) Nudibranch Nembrotha antimicrobial, Tambjamines – (P. Karuso and kubaryana antitumour and A,B,C,D P. J. Scheuer, immunosuppressive 2002) activities Sea slug Nembrotha antibacterial, guaiazulenes (Y. Seo, 1996) kubaryana antimicrobial, cytotoxic, antitumour, and immunoregulating activities Sea slug Nembrotha antibacterial, sesquiterpenoids (Y. Seo, 1996) kubaryana antimicrobial, cytotoxic, antitumour, and immunoregulating activities sponge Phakellia stelliderma mild cytotoxicity carotenoids (Achuthankutty, against mouse 2005) leukemia cells sponge Fascaplysinopsis sp. Anti-microbial and fascaplysin (Gribble, 1990) cytotoxic

10

Tunicate Eudistoma sp. Inhibits the auto staurosporine (P. A. Horton, phosphorylation of c- aglycone 1994) Met and activation of MAPK and Akt in cancer cells. Tunicate Polycarpa clavata cytotoxic disulfide (Fenical, 1996) polycarpine Tunicate Polycarpa aurata cytotoxic polycarpine (S. A. Abas, 1996) sponge Latrunculia apicalis cytotoxic discorhabdins (Z. Ding, 1999) 71a+b Tunicate Aplydium Cytotoxic, protein meridianin (M. Gompel M. meridianum kinase inhibitor L., 2004) sponge Coscinoderma sp. Cytotoxic, protein coscinamide (M. Gompel M. kinase inhibitor L., 2004) sponge Trikentrion loeve inhibitor of HIV-1 trikendiol (Guyot, 1994) Sponge Fascaplysinopsis cytotoxic chromopeptide (P. Ivanova, reticulata 2002) sea urchins Strongylocentrotus antioxidant Echinochrome (R. K. Cannan, lividus properties 1927) E. sphaera E. Esculentu sponge Kirkpatrickia cytotoxins towards the variolins (C. D. Amsler, variolosa P388 cell line 2001) Sponge Aaptos aaptos protein kinase C Aaptamine, (A. D. Patil, inhibitors isoaaptamine 1997) sea squirt Rhopalaea sp., c-erbB-2 kinase and Rhopaladins, bis- (U. Pindur and cyclin-dependent alkaloids T. Lamster, kinase 4 inhibitors 2001) Ascidian Didemnum G2 cell cycle check- didemnimides (U. Pindur and

11

conchyliatum point T. Lamster, Inhibitors in fish 2001) Red sponge Dendrilla antibiotic and quinoline (T. F. Molinski membranosa antibacterial and D. J. activities for sponge Faulkner, 1987) (Gauthier J. B., 1992) calcareous sponge Leucetta anthelmintic and Naamidines, (D. J. Faulkner, chagosensisis antiparasitic properties isonaamidines 2002) sea urchin Scaphechinus antibacterial activity echinamines A (N. P. mirabilis Mischenko, 2005) sea urchin Scaphechinus antibacterial activity echinamines B (N. P. mirabilis Mischenko, 2005) sea urchin Echinometra high antioxidant Spinochromes A (L. Brasseur, mathaei effects and cytotoxic Spinochromes B 2017) Diadema savignyi activity Spinochromes C Tripneustes gratilla Spinochromes D Toxopneustes pileolus mussel Mytilus spp high antioxidant Chlorophyllone-a (C. Utermann, activity 2018) Table 2 : Therapeutic activities of pigment from marine invertebrates Pigments from marine plants

Pigments from marine plants are mainly found in phytoplankton and algae. The pigments are mainly divided into three groups: chlorophylls (a, b, c1, c2, c3, d), carotenoids (carotenes and their oxygenated derivatives known as xanthophylls), and phycobiliproteins (allophycocyanins, phycocyanins, phycoerythrins) (Kai-Xiong Ye, 2013)

12

Chlorophylls are the famous photosynthetic greenish pigments found in algae, plants, and cyanobacteria. Chlorophylls contain a porphyrin ring and belong to a major class of tetrapyrroles. Carotenoids are the most common pigments in the marine environment. They are generally biosynthesized by all autotrophic marine organisms; therefore, they can be easily found in marine plants. The most common carotenoids in marine plants include: fucoxanthin, astaxanthin, zeaxanthin, lutein, neoxanthinand violaxanthin. Phycobiliproteins are composed by a protein and a chromophore part (linked by covalent bonds) called phycobilin. Phycocyanin from Arthrospira and phycoerythrin from Porphyridium are two of the most known phycobiliproteins. (Kai-Xiong Ye, 2013) Speices Scientific name Therapeutic activities pigment reference Brown algae Eisenia bicyclis antiviral activity against Chlorophyll c-2 (Aoki, 2007) other salmonid enveloped viruses such as Paralichthys olivaceus virus Sea weed Undaria pinnatifida antiproliferative Fucoxanthin (M. Hosokawa, activity 2004) diatoms Phaeodactylum potential role in maintaining Zeaxanthin (Waesarat tricornutum eye health Soontornchaiboon, Anti-inflammatory Effects of Violaxanthin Isolated from Microalga Chlorella ellipsoidea in RAW 264.7 Macrophages, 2012) Microalgae Chlorella Strong ntiproliferative violaxanthin (W. Fu, 2014) ellipsoidea activity against McF- 7 human breast cancer cells grown in vitro. active compound for induction of apoptosis green Dunaliella salina protective compound against lutein (R. P. Utomo, microalgae the early stages of 2013)

13

the atherosclerotic process Diatoms Phaeodactylum nontoxic and anti-oxidative b-carotene (Waesarat tricornutum properties applications in the Soontornchaiboon, food, drug and cosmetic 2012) industry algae Haematococcus colouring, anti-oxidation, Astaxanthin (Olaizola, 2000) pluvialis photoprotection, promotion of reproduction, enhancement of immunity, and maintenance of central nervous system health Marine algae Enteromorpha Antioxidant Chlorophyll a (Le Tutour, 1988) prolifera E.ucus Red algae Porphyra tenera Antimutagenic Pheophytin a Enteromorpha Lutein (Okai, 1996) prolifera b-Carotene Brown algae Sargassum fulvellum Neuroprotective Pheophytin a (Ina, 2007) Stag seaweed Codium fragile Anticancer Siphonaxanthin (Ganesan, 2011) Marine algae Myagropsis Anti-inflammatory Fucoxanthin (Heo, 2010) myagroides Marine algae Undaria pinnatifida Anti-obesity Fucoxanthin (Maeda, Fucoxanthin from edible seaweed,Undaria pinnatifida, shows antiobesity effect through UCP1 expression in white adipose tissues, 2005) (Maeda, Effect of medium-chain triacylglycerols on anti-obesity effect of fucoxanthin, 2007) Table 3 : Therapeutic activity of pigment from marine plants

14

Biological activities of marine natural pigments

Marine natural pigments are valuable source of bioactive compounds (Ratih Pangestutia, 2011). Marine organisms and their metabolite has therefore become a major task in the search for novel pharmaceuticals. Although many compounds show promising biological activities, it is difficult to point out any particular bioactive agent that has readily been commercialized as a medicine. (Azamjon B. Soliev, 2011) The marine environment has recently become an attractive research subject for many investigations, because of its rich biodiversity. Despite being comprised of a diverse ecosystem, the search for marine metabolites is difficult because of the inaccessibility and non culturability of the majority of organisms. Bioactive compounds are generated by the marine organisms in order to protect themselves from the hazardous effects of light and high oxygen concentrations. Different types of microalgae, fungi, bacteria, actinomycetes, invertebrates and vertebrates present in the marine environment are able generate a substantial amount of bioactive compounds which possess great pharmacological activity. Marine natural products include a wide variety of secondary bioactive metabolites, peptides, sulfated polysaccharides, sterols, carotenoids and derivatives obtained from chitin, chitosan and chitooligosaccharides (Verónica Ruiz-Torres, 2017) Many natural products isolated from marine microorganisms, microalgae, marine invertebrate are being tested in different phases of clinical trials, and a large number of others are in preclinical investigations (A. M. S. Mayer, 2010). Pigments serve as antimicrobial agents against a wide range of pathogens. Pigments such as carotenoids, melanins, flavins, quinones, monascins, violacein, and indigo have been reported as good antimicrobial agents (K, J, & S., 2012). An increase in free radicals in the body enhances the chances of occurrence of chronic diseases such as cancer, diabetes, cardiovascular and autoimmune disorders, to avoid these antioxidants are used. Pigments such as carotenoid, and naphthaquinone demonstrated antioxidant activities (Tuli, 2015) One of the most leading causes of mortality among humans is cancer and much attention is required to prevent its progression. Several molecules derived from marine sources have proven to be beneficial in combating this disease by either preventing the proliferation of cancerous cells or by being enhancers of apoptosis in cancerous cell lines present in humans. Efforts to use

15 microbial pigments as anticancer agents have laid the foundation for successful treatments. Many microbial pigments possess anticancer activity.

CONCLUSION Marine natural pigments are a valuable source of bioactive compounds and could be introduced for the preparation of novel functional ingredients in food and also a good approach for the treatment or prevention of chronic diseases. Natural pigments are an alternative source for synthetic ingredients that can contribute to consumer’s well-being, by being a part of new functional foods and pharmaceuticals. Recently, there has been a general tendency to move towards the use of natural rather than synthetic dyes in cosmetics. Many synthetic pigments are being excluded from food and cosmetics use on the grounds that they are toxic, carcinogenic or otherwise unsafe. Exploration of pigment chemodiversity remains widespread in agronomy, in aquaculture, in biotechnologies, in cancerology, for health food supplements, or even in oceanography and limnology. There is huge demand for coloring agents in industries like textile, plastic, paint, paper and printing. There is an increasing demand for natural colour in the food, pharmaceutical, cosmetics, textile, printing and dye industry. In fact, latest report shows this a multibillion dollar industry with staggering annual growth around 10-15% and many of the top molecules used, such as astaxanthin or cantaxanthin, are already of marine origin.

16

REFERENCE A. D. Patil, A. J. (1997). Nat. Prod. Lett.,9, 201.

A. Franks, P. H. (2005). Isolation and structure elucidation of a novel yellow pigment from the marine bacterium Pseudoalteromonas yellow pigment from the marine bacterium Pseudoalteromonas tunicata. Molecules, vol. 10, no. 10, pp. 1286–1291.

A. M. S. Mayer, K. B. (2010). The odyssey of marine pharmaceuticals: a current pipeline perspective, Trends in Pharmacological Sciences.

A. Nansathit, S. A. (2009). Synthesis, isolation of phenazine derivatives and their antimicrobial activities. Walailak Journal of Science and Techology, vol. 6, no. 1, pp.79–91.

Achuthankutty, P. S. (2005). Proc. Andhra Pradesh Akad. Sci.,.

Aoki, Y. K. (2007). A chlorophyll c2 analogue from the marine brown alga Eisenia bicyclis inactivates the infectious hematopoietic necrosis virus, a fish rhabdovirus.

Azamjon B. Soliev, K. H. (2011). Bioactive Pigments fromMarine Bacteria: Applications and Physiological Roles.

Azamjon B. Soliev, K. H. (2011). Bioactive Pigments fromMarine Bacteria: Applications and Physiological Roles.

Bandaranayake, W. M. (2006). The nature and role of pigments of marine invertebrates.

C. D. Amsler, K. B. (2001). in Marine Chemical Ecology, ed. J. B. McClintock and B. J. Baker. CRC Press,New York, .

C. Matz, P. D. (2004). Impact of violaceinproducing bacteria on survival and feeding of bacterivorous nanoflagellates. Applied and Environmental Microbiology,vol. 70, no. 3, pp. 1593–1599.

C. S. Stevenson, E. A. (2002). Scytonemin -a marine natural product inhibitor of kinases key in hyperproliferative inflammatory diseases. Inflammation Research, vol. 51, no. 2, pp. 112–114.

C. Utermann, D. P. (2018). Sci. Rep., 8.

C. Yamamoto, H. T. (1999). Cycloprodigiosin hydrochloride, a new H+/Cl− symporter, induces apoptosis in human and rat hepatocellular cancer cell lines in vitro and inhibits the growth of hepatocellular carcinomaxenografts in nude mice. Hepatology, vol. 30, no. 4, pp. 894–902.

Chang, C. W. (1973). Marine Natural Products. University of West Florida: Journal of Chemical Education.

Correa Llanten, D. N. (2012). Antioxidant capacity of novel pigments from an Antarctic bacterium. J. Microbiol. 50,374–379. doi: 10.1007/s12275-012-2029-1.

D. J. Faulkner. (2002). Nat. Prod. Rep., 19, 1.

17

D. Li, F. W. (2007). A new cytotoxic phenazine derivative from a deep sea bacterium Bacillus sp.,. Archives of Pharmacal Research, vol. 30, no. 5, pp. 552–555.

D. M. Pinkerton, M. G. (2010). Antimicrobial and cytotoxic activities of synthetically derived tambjamines C and E-J, BE-18591, and a related alkaloid from the marine bacterium Pseudoalteromonas tunicata. Chemistry & Biodiversity, vol. 7, no. 5, pp. 1311–1324.

David M. Pereira, P. V. (2014). Marine natural pigments: Chemistry, distribution and analysis.

Dufosse, L. F. (2014). Filamentous fungi are large-scale producers of pigments and colorants for the food industry. Curr. Opin. Biotechnol. 26, 56–61. doi: 10.1016/j.copbio.2013.

Duran, N. J. (2007). Violacein: properties and biological activities. Biotechnol. Appl. Biochem. 48, 127– 133.

E. P. Ivanova, E. A. (1996). Characterization and identification of marine Alteromonas nigrifaciens strains and emendation of the description. International Journal of Systematic Bacteriology, vol. 46, no. 1, pp.223–228.

El-Fouly, M. Z.-B. (2015). Biosynthesis of pyocyanin pigment by Pseudomonas aeruginosa. J. Radiat. Appl. Sci. 8, 36–48. doi: 10.1016/j.jrras.2014.10.007.

El-Naggar, N. E.-E. (2017). ioproduction, characterization, anticancer and antioxidant activities of extracellular melanin pigment produced by newly isolated microbial cell factories Streptomyces glaucescens NEAE-H. Sci.

F. Li, R. P. (2005). Chinikomycin A and B: isolation, structure elucidation and biological activity of novel antibiotics from a marine Streptomyces sp. isolate M045. Journal of Natural Products, vol. 68, no. 3, pp. 349–353.

Fenical, H. K. (1996).

Ganesan, P. N. (2011). Siphonaxanthin, a marine carotenoid from green algae, effectively induces apoptosis in human leukemia (HL-60) cells. Biochimica et Biophysica Acta (BBA): General Subjects, 1810, 497–503.

Gauthier, J. B. (1992). Antarctic Sci., 179.

Gauthier, N. N. (1979). New prodigiosin-like pigment from Alteromonas rubra,” Applied and Environmental Microbiology, vol. 37, no. 6, pp. 1176–1179.

Gerber, N. N. (1975). CRC Critical Reviews in Microbiology, vol. 3, no. 4, pp. 469–485. Prodigiosin-like pigments.

Gribble, B. P. (1990). TOTAL SYNTHESIS OF THE MARINE SPONGE PIGMENT FASCAPLYSIN.

Guyot, A. L. (1994). Tetrahedron Lett.,35, 6869.

18

H. Y. Kahng, B. S. (2009). Cellulophaga tyrosinoxydans sp. nov., atyrosinase-producing bacterium isolated from seawater. International Journal of Systematic and Evolutionary Microbiology, vol. 59, no. 4, pp. 654–657.

H. Yi, Y. H. (2003). Zooshikella ganghwensis gen. nov., sp. nov., isolated fromtidal flat sediments. International Journal of Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1013–1018.

Heo, S. J. (2010). Evaluation of anti-inflammatory effect of fucoxanthin isolated from brown algae in lipopolysaccharide stimulated RAW 264.7 macrophages. Food and Chemical Toxicology, 48, 2045–2051.

I. Wagner-D¨obler, W. B. (2002). Integrated approach to explore the potential of marine microorganisms for the production of bioactive metabolites. Advances in Biochemical Engineering/Biotechnology,vol. 74, pp. 207–238.

Igarashi, Y. T.-M. (2007). Antitumor anthraquinones from an endophytic actinomycete Micromonospora lupini sp. nov. Bioorg. Med. Chem. Lett. 17,3702–3705.

Ina, A. H. (2007). Pheophytin a, a low molecular weight compound found in the marine brown alga Sargassum fulvellum, promotes the differentiation of PC12 cells. International Journal of Developmental Neuroscience, 25,63–68.

J. E. Lazaro, J. N. (2002). Heptyl prodigiosin a bacterial metabolite, is antimalarial in vivo and nonmutagenic in vitro. Journal of Natural Toxins, vol. 11, no. 4,pp. 367–377.

K, M., J, T., & S., a. G. (2012). Microbial pigments: a review. Int. J.Microb. Res. Technol. 1, 361–365.

K. Kawauchi, K. S. (1997). A possibleimmunosuppressant, cycloprodigiosin hydrochloride, obtained from Pseudoalteromonas denitrificans. Biochemical and Biophysical Research Communications, vol. 237, no. 3, pp.543–547,.

K. Pusecker, H. L. (1997). Dihydrophencomycin methyl ester, a new phenazine derivative from a marine streptomycete. Journal of Antibiotics, vol. 50,no. 6, pp. 479–483.

Kai-Xiong Ye, T.-T. F.-N. (2013). A Review of Pigments Derived from Marine Natural Products.

L. Brasseur, E. H. (2017). The Roles of Spinochromes in Four Shallow Water Tropical Sea Urchins and Their Potential as Bioactive Pharmacological Agents.

Le Tutour, B. B. (1988). Antioxidant and pro-oxidant activities of the brown algae, Laminaria digitata, Himanthalia elongata,Fucus vesiculosus, Fucus serratus and Ascophyllum nodosum. Journal of Applied Phycology,.

M. Gompel, M. L. (2004). Bioorg. Med. Chem. Lett.,14, 1703.

M. Gompel, M. L. (2004). Bioorg. Med. Chem. Lett.,14, 1703.

19

M. Hosokawa, M. K. (2004). Fucoxanthin induces apoptosis and enhances the antiproliferative effect of the PPARγ ligand, troglitazone, on colon cancer cells.

M. J. Gauthier. (1976). Morphological, physiological, and biochemical characteristics of some violet- pigmented bacteria isolated from seawater. Canadian Journal of Microbiology,vol. 22, no. 2, pp. 138–149,.

Maeda, H. H. (2005). Fucoxanthin from edible seaweed,Undaria pinnatifida, shows antiobesity effect through UCP1 expression in white adipose tissues. Biochemical and Biophysical Research Communications, 332, 392–397.

Maeda, H. H. (2007). Effect of medium-chain triacylglycerols on anti-obesity effect of fucoxanthin. Journal of Oleo Science, 56,615–621.

Mekala Venkatachalama, M. Z. (2017). Partial characterization of the pigments produced by the marine- derived fungus Talaromyces albobiverticillius 30548. Towards a new fungal red.

Minal. R. Dave, R. S. (2018). Screening and Extraction of Microbial Pigment from Organism Isolated from Marine Water.

N. Misawa, Y. S. (1995). Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene cluster and astaxanthin biosynthetic pathway proposed at the gene level. Journal of Bacteriology, vol. 177, no. 22, pp.6575–6584.

N. P. Mischenko, S. A. (2005). Echinamines A and B, First Aminated Hydroxynaphthazarins from the Sea Urchin Scaphechinus mirabilis.

Okai, Y. H. (1996). Identification of antimutagenic substances in an extract of edible red alga, Porphyra tenera (Asadusa-nori). Cancer Letters.

Olaizola, M. (2000). Commercial production of astaxanthin from Haematococcus pluvialis using 25,000- liter outdoor photobioreactors.

P. A. Horton, R. E. (1994). Experientia,.

P. Ivanova, L. S. (2002). Int. J. Syst. Evol. Microbiol., 52, 263.

P. Karuso and P. J. Scheuer. (2002). Molecules.

R. K. Cannan. (1927). Biochem. J., 21, 184.

R. P. Maskey, E. H. (2003). Himalomycin A and B: isolation and structure elucidation of new fridamycin type antibiotics from a marine Streptomyces isolate. Journal of Antibiotics, vol. 56, no. 11, pp. 942–949.

20

R. P. Maskey, I. K. (2003). Isolation and structure determination of phenazostatin D, a new phenazine from a marine actinomycete isolate Pseudonocarphenazine from a marine actinomycete isolate Pseudonocardia sp. B6273. Zeitschrift f¨ur Naturforschung, vol. 58b, no. 7,pp. 692–694.

R. P. Utomo, Y. R. (2013). Lutein recovery from Chlorella sp. ESP-6 with coagulants.

Ratih Pangestutia, S.-K. K. (2011). Biological activities and health benefit effects of natural pigments derived from marine algae.

S. A. Abas, M. B. (1996). Org. Chem.,61, 2709.

S. Hakvag, E. F. (2009). Violacein producing Collimonas sp. from the sea surface microlayer of costal waters in Trøndelag, Norway. Marine Drugs, vol. 7, no.4, pp. 576–588.

S. I. Kotob, S. L. (1995). Homogentisic acid is the primary precursor of melanin synthesis in Vibrio cholerae, a Hyphomonas strain, and Shewanella colwelliana. Applied and Environmental Microbiology,vol. 61, no. 4, pp. 1620–1622.

S. Saha, R. T. (2008). Phenazine pigments from Pseudomonas aeruginosa and their application as antibacterial agent and food colourants. Research Journal of Microbiology, vol. 3, no. 3, pp. 122– 128.

S. Yada, Y. Y. (2008). Isolation and characterization of two groups of novel marine bacteria producing violacein. Marine Biotechnology, vol. 10, no. 2, pp. 128–132.

T. F. Molinski and D. J. Faulkner, J. (1987). Org. Chem.,52, 296.

Tuli, H. S. (2015). Microbial pigments as natural color sources: current trends and future perspectives.

U. Pindur and T. Lamster. (2001). Curr. Med. Chem., 8, 1681.

Verónica Ruiz-Torres, ,. J.-L.-S. (2017). An Updated Review on Marine Anticancer Compounds: The Use of Virtual Screening for the Discovery of Small-Molecule Cancer Drugs.

W. Fu, G. P. (2014). Effects of abiotic stressors on lutein production in the green microalga Dunaliella salina.

Waesarat Soontornchaiboon, S. S. (2012). Anti-inflammatory Effects of Violaxanthin Isolated from Microalga Chlorella ellipsoidea in RAW 264.7 Macrophages.

Waesarat Soontornchaiboon, S. S. (2012). Anti-inflammatory Effects of Violaxanthin Isolated from Microalga Chlorella ellipsoidea in RAW 264.7 Macrophages.

Waesarat Soontornchaiboon, S. S. (2012). Anti-inflammatory Effects of Violaxanthin Isolated from Microalga Chlorella ellipsoidea in RAW 264.7 Macrophages.

21

Waesarat Soontornchaiboon, S. S. (2012). Anti-inflammatory Effects of Violaxanthin Isolated from Microalga Chlorella ellipsoidea in RAW 264.7 Macrophages.

Y. Seo, J. R. (1996).

Z. Ding, K. C. (1999). Curr. Med. Chem.6, 1.

List of Tables:

Table 1 : Therapeutic activities of pigment from marine bacteria ...... 9 Table 2 : Therapeutic activities of pigment from marine invertebrates ...... 12 Table 3 : Therapeutic activity of pigment from marine plants ...... 14

22

ACADEMY OF MARITIME EDUCATION AND TRAINING (AMET) (Declared as Deemed to be University u/s 3 of UGC Act 1956) 135, EAST COAST ROAD, KANATHUR, CHENNAI - 603 112. TAMILNADU, INDIA

A REVIEW SQUID AQUACULTURE

A Report on Internship

In Department of Marine Biotechnology

By

Raghul K AMBT19007

May 2020

INTERNSHIP CERTIFICATE

This is to certify that Mr. Raghul K (Reg. No. AMBT19007) of M.Sc., Marine Biotechnology 1st Year II Semester has done the work titled ”A Review Squid Aquaculture” as a part of Home Based Internship for a partial fulfillment of academic records. He has taken 45 hours to complete the work and his report was found to be excellent.

Signature of the Mentor Signature of the HOD (Dr. M. Jayaprakashvel) (Dr. L. Senthilnathan)

INTERNSHIP ALLOCATION REPORT 2019-20 Name of the Department: Marine Biotechnology

(In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak)

Name of the Programme : M.Sc Marine Biotechnology Year of study and Batch/Group : I Year, Batch -12 Name of the Mentor : Dr. M. Jayaprakashvel Title of the assigned internship :

A Review - Squid Aquaculture

Nature of Internship : Individual/Group

Reg No of Students who are assigned with this internship:

Reg. No. AMBT19007

Total No. of Hours Required to complete the Internship: 45 Hours

Signature of the Mentor Signature of the Internal Signature of HoD / Programme Examiner Head

INTERNSHIP EVALUATION REPORT 2019-20 Name of the Department: Marine Biotechnology (In view of advisory from the AICTE, internships for the year 2019-20 are offered by the Department itself to facilitate the students to take up required work from their home itself during the lock down period due to COVID-19 outbreak) Name of the Student K Raghul Register No and Roll No AMBT19007 Programme of study M.Sc Marine Biotechnology Year and Batch/Group I Year, Batch -12 Semester II Title of Internship A Review - Squid Aquaculture Duration of Internship ………45……..Hours Mentor of the Student Dr. M. Jayaprakashvel Evaluation by the Department Sl Criterion Max. Marks Marks No. Allotted 1 Regularity in maintenance of the diary. 10 9 2 Adequacy & quality of information recorded 10 9 3 Drawings, sketches and data recorded 10 9 4 Thought process and recording techniques used 5 5 5 Organization of the information 5 5 6 Originality of the Internship Report 20 15 7 Adequacy and purposeful write-up of the Internship 10 9 Report 8 Organization, format, drawings, sketches, style, 10 9 language etc. of the Internship Report 9 Practical applications, relationships with basic theory 10 9 and concepts 10 Presentation Skills 10 8 Total 100 87

Signature of the Mentor Signature of the Internal Signature of HoD Examiner /Programme Head

CONTENTS

S.No LIST OF NATATIONS PAGE NO 1 Abstract 6 2 Introduction 7 3 Water Quality requirements 11 4 Temperature 12 5 Salinity 12 6 pH 13 7 Dissolved oxygen 13 8 Nitrogenous waste 14 9 Organic waste 14 10 Disinfection and Sterilization 14 11 Bacterial infection 15 12 Fungal infection 16 13 Viral infection 16 14 Treatment of diseases 16 15 Culture requirements at different life phase 16 16 Current limitation 22 17 Conclusions 24 18 References 25

Abstract This short review summarizes the current status of the squid fisheries,It primarily considers the historical classification and biological characteristics of squid culture with the context to Indian squid varieties. Squid is an economically important cephalopod in India represented mainly by Loligoduvauceli, Sepioteuthislessoniana, and Doryteuthis species. Among the squids, the Indian squid (Loligoduvauceli) is Dominant species. Cephalopods have high rates of growth and food conversion, which for aquaculture translates into short culture cycles, high ratios of production to biomass and high cost-effectiveness. However, at present, only small-scale culture is possible and only for a few species: the cuttlefish Sepia officinalis, the loliginid squid Sepioteuthislessoniana.Ofcephalopods of the life cycle regarded as essential for successful full- scale culture and to identify current limitations and the topics on which further research is required. Future research should focus on problems related to the consistentproductionofviablenumbersofjuveniles,theresolutionofwhichrequiresabetter understanding of nutrition at all phases of the life cycle and better broodstock management, particularly regarding developments in genetic selection, control of reproduction and quality of eggs and offspring.

Key words: squid fisheries ,historical classification, biological characteristics Dominant species, aquaculture translates, only small-scale culture ,research is required,

Introduction Interactions between human societies and fish stocks have played an important part in our history. Regrettably, it is now recognized that the humankind has failed in many instances to conserve marine species and obtain the optimal social and economic benefits from the marine environment. However, scientists and managers involved in cephalopod fisheries arguably find themselves in a better position than those responsible for finfish. Although the total world catch from marine and freshwater fish stocks appears to have peaked and may be declining (Hilborn et al., 2003), the catch of cephalopods has continued to increase as fishers concentrate efforts away from more traditional finfish resources. This is not a modern phenomenon, May et al. (1979) highlighted a shift toward harvesting “unconventional” stocks of marine organisms, which typically occupy lower trophic levels. There are about 800 living cephalopod species belonging to three main groups represented by different orders. Squids belong to the Order Teuthoidea. They are characterized by the presence of a remnant of the molluscan shell which has been retained in the form of the gladius, a stiff chitinous structure that lies inside the dorsal surface of the mantle muscle. The molluscan foot has evolved into the eight arms and two tentacles (the latter absent in some groups of squids), and these are armed with suckers and in some cases hooks which are modified suckers. Squid swim using the fins and by jet propulsion, using the mantle to expel water explosively from the mantle cavity through the funnel. There are some 290 species of squids and about 30–40 species have substantial commercial importance (Table 1). The other main cephalopod groups exploited for food are the cuttlefish and octopus, plus to a much lesser extent the sepiolids. There are a number of characteristics of squid that, although not unique, set them apart from many other commercially exploited marine species (although not necessarily from other cephalopods). They are short-lived, semelparous and fast growing, with high feeding rates and conversion efficiencies. They also have high reproductive rates, although loliginid squids usually produce fewer eggs than do ommastrephids. These features have adapted them to be ecological opportunists that can rapidly exploit favorable environmental conditions, but equally their abundance responds rapidly to poor conditions, so recruitment and abundance may be highly variable on annual time scales (Rodhouse et al., 2014). There is evidence that squid populations have benefited from ecological change driven by overexploitation of groundfish in some regions (Caddy and Rodhouse, 1998). Squids are important prey for large numbers of vertebrate predators including many fish species, toothed whales, pinnipeds, and seabirds (Clarke, 2006; Jereb and Roper, 2010). Estimates of global squid consumption by predators suggest that they consume a greater mass of squid than the total world catch of all marine species combined (Voss, 1973; Clarke, 1983). Squid are also predators themselves that make long migrations over their lifecycle, are responsible for spatial transfer of substantial biomass (Arkhipkin, 2013) and may be keystone species (Gasalla et al., 2010). There are therefore important relationships between squid fisheries and marine ecosystems and this is especially relevant in the context of ecosystem-based fishery management (EBFM). Squid fisheries themselves need to be managed with regard to their impact on the ecosystem but it is also important that squid stocks should be considered as a key element in many ecosystems in the context of the management of other fisheries. In order for squid species to be suitable for commercial exploitation they must be of suitable size (medium/large) and have an acceptable flavor and texture. Only the muscular, negatively buoyant, species meet all these criteria. The more neutrally buoyant squids store light ammonium ions in vacuoles in the muscle tissues, or in the case of the cranchiids, in the coelomic fluid (Clarke et al., 1979). As a result of these adaptations the flesh has an ammoniacal flavor and flaccid texture which humans find unacceptable. Nevertheless, predators are not deterred from consuming ammoniacal squids which may predominate in the diet of some species (Lipinski and Jackson, 1989). It has been proposed that chemical processing of the flesh of ammoniacal squids could result is a palatable product for human consumption (Pierce and Portela, 2014)( Taylor et al.,2015). A more recent spark for improving cephalopod culture arose mainly from the biomedical research community as their attention became drawn to the highly developed nervous system of cephalopods, along with their advanced vision and other organs as subjects for experimentation (Hanlon, 1987; Koueta and Boucaud-Camou, 1999). However, experimental studies have gone far beyond the initial surge in curiosity, and cephalopods per se have been an important means by which crucial research problems have been solved (e.g. Budelmann, 1995; Budelmann and Bleckmann, 1988; Fiorito and Scotto, 1992; Nyholm and McFall-Ngai, 2004; Shashar et al., 1998; Villanueva et al., 1995) and new ideas presented (e.g. models for tissue regeneration and observations on beak attachment as a new direction in improving the integration of prosthetic limbs with the human body; Chiao et al., 2011; Fox et al., 2013; Laschi et al., 2012; Miserez et al., 2008; Rohrbach and Schmidtberg, 2006). These have all contributed to enhancing knowledge of broad areas of cephalopod biology, physiology, life cycles, immunology, and behaviour. Other stimuli for cephalopod culture are the rapidly growing global industry for ornamental cephalopods, mainly octopus and cuttlefish, and the worldwide trend in commercial aquaculture production of food organisms. Cephalopods have many features considered favourable and attractive for aquaculture. Among those deserving attention are their short life cycles (mostly between 4 and 18 months) and the fact that eggs can be obtained readily since many species, particularly octopus and cuttlefish, will promptly lay eggs when introduced to captivity. The fecundity of some species is quite high and comparable to fish species (Saville, 1987), resulting in the production of large numbers of planktonic paralarvae, while other species show low fecundity but produce large eggs and developmentally advanced benthic hatchlings. These directly developing hatchlings are miniatures of the adults, born with a highly developed nervous system and innate hunting skills. The growth rate of some cephalopods is impressive, ranging across 5–13% of body wet weight(WW)d1 (Leeetal., 1994),and combined with high food conversion rates of 30–50% (Lee, 1994; O’Dor and Wells, 1987) they rate as one of the most attractive groups of marine invertebrates considered suitable for aquaculture. In addition, cephalopods are well appreciated as a high protein source (75–85% protein dry weight (DW)) and for the fact that 80–85% of their total body weight is edible for human consumption (Lee, 1994). This represents a significant impact on profitability and marketability, particularly when compared with only 40–45% for crustaceans and 40–75% for teleost fishes (Kreuzer, 1984). The implications of these biological features for commercial culture are obvious, as they translate into short culture cycles with high ratios of production to biomass and consequently high cost- effectiveness. However, profitability is also dependent on other factors, such as demand, markets and high trade value. It is therefore important to consider the markets likely to sustain potential commercial ventures involving cephalopod aquaculture. Small-scale cephalopod culture is already possible for a few species, such as the bigfin reef squid, Sepioteuthis lessoniana Lesson, 1839; the European cuttlefish, Sepia officinalis Linnaeus, 1758; the Mexican four-eyed octopus, Octopus maya (Voss and Solis, 1966); and (as the ongrowing of subadults in sea cages) the common octopus, Octopus vulgaris Cuvier, 1797 (Figure 1.1). All of these selected species except O. vulgaris produce large hatchlings without a vulnerable planktonic paralarval phase.( Erica A.G. Vidal ,1, Roger Villanueva). .For adult cephalopods, both latitude and depth range have a significant effect to n maximum body size,and temperature seems to be the most important factor in determining the distribution of adult body size along the continent a shelves of the Atlantic Ocean[6].These mollusks have both planktonic and benthic hatch ling mode so flifede pending on the species .For this reason they may be used as models to improve ou runder standing of the factors that influence marine species distribution al ranges. Most of the cephalopod species that have small hatchlings are planktonic during their early life, while those that produce larger hatchlings are usually benthic, with some exceptions. Depending on the environment in which they live and the ir early mode of life,cephalopods can be divided into the following groups:holo benthic,when the full life cycle is associated with the benthos(e.g.mostcuttlefishes);holopelagic,when the full life cycle is associated with the pelagic environment(e.g.,allsquids); and mero benthic, when hatchling sare planktonic followed by a benthic life from juvenile toadult(e.g.,someoctopuses).All three types of life cycle are observed in the octopods ,a group with holopelagic ,holobenthic and merobenthic representative species.In comparison with other molluscs, cephalopods have direct development, thus hatchling sare essentially miniature of the adults and the ear marked morphological changes during on togeny. Never the less,the term paralarva is used on an ecologica lcontext to refer to planktonic hatchlings that have a different mode of life than the adults and,the term juvenile is commonly used to refer individuals after the do the planktonic phase, as well as for benthic hatchlings Planktonic hatchlings are transported by currents and an inverse relationship should be expected between hatchling size and dispersal potential. Infact, transport by currents has been shown to be a powerful dispersal mechanism for planktonics quid and octopus paralarvae.In addition passive transport,the swimming capacities recorded in the laboratory for planktonic cephalopod hatchling sare with in the range or higher than those found for the larval fishes,which could enhance their dispersa lpotential.In contrast,mark and recapture experiments with hatchling so flarge,benthic cuttlefish,showed limited shallow water dispersal,as the individuals remain in the same or adjacent bays to those in which they hatched[23].Molecularstudiesrevealedsomelow- scalegeographicpopulationstructurein cuttlefish species[24],supporting the suspected low dispersal abilities of this group(Roger Villanueva et al., 2016). India is one of the major fish producing country in the world which holds second and third position in aquaculture and fisheries. Indian fisheries sector has high potentials for domestic nutritional security, employment generation, rural development, gender mainstreaming as well as export earnings. This sector has been witnessing a steady growth since First Five Year Plan. Indian fisheries contribute overall production of 4.39% to that of the global output. After declaration of the Exclusive Economic Zone (EEZ) in 1977, the oceanic resources available to India are estimated at 2.02 million sq. km, comprising 0.86 million sq. km (42.6% of the total) on the west coast, 0.56 million sq. km (27.7%) on the east coast and 0.60 million sq. km (29.7%) around the Andaman and Nicobar Islands (Fig. 1). These resources are one of the main sources of livelihood for the rural people around the coastal region. Considering the output of the sector, it can provide livelihood for over 90 lakhs at subsistence level of annual income. It was estimated that 14 million people are engaged in fishing, aquaculture and ancillary activities currently. Hence, the fisheries sector of India is an important player in the overall socioeconomic development. After 1947, it came into focus as blue revolution to promote fisheries production in order to ensure food security and social as well as economic development of fishers through subsidization of various assets. By generating income and employment for local people along the coasts, the marine fishery sector significantly develop the economy of the country. Most of the marine ecosystem concern to India is in coastal ecosystem. The modern research on marine biodiversity is established in most of the region in the country acts for saving the marine resources. The exploitation of marine fisheries resources in India has increased due to development in fishing gear. The invertebrates are the highly developed group and occupy a leading place among the exploited marine fishery resource of India. Cephalopods, which have gained great grandness in recent years due to the increasing, demand in the export trade(Anusha J.Retal et al .,2014).

Water quality requirements Water quality is of critical importance when keeping cephalopods in laboratories, aquaculture facilities and public aquaria, so careful monitoring is essential for successful culture, particularly for early stages of development (Boletzky and Hanlon, 1983). Without careful monitoring, water quality can deteriorate quickly and compromise animal health. It should be noted, however, that different developmental stages of the life cycle have different tolerance limits and this should always be pondered with care (Kinne, 1971). The animals, tanks, equipment (to maintain specific conditions), water flow and aeration should be checked first thing in the morning and at the end of the afternoon. Water quality parameters should be monitored daily and should be kept as similar as possible to natural sea water (see, e.g. Forsythe et al., 1991; Koueta and Boucaud- Camou, 1999; Oestmann et al., 1997). Trace elements, such as strontium and calcium, should be kept close to natural sea water values (Hanlon et al., 1989). Irrespective of the sea water system used, water flows should be strong enough to maintain water quality and sustain the best reproduction results for broodstock but very gentle for tanks holding paralarvae (Vidal et al., 2002a). Water and tanks should be kept clean from leftovers, faeces and other debris by removing them by water siphoning. Also, to avoid problems with cleaning, sand substrates (e.g. for Sepia spp.) should not be used (Forsythe et al., 1994).debris by removing them by water siphoning. Also, to avoid problems with cleaning, sand substrates (e.g. for Sepia spp.) should not be used (Forsythe et al., 1994).

Temperature Cephalopods are poikilothermic organisms, so their metabolism accelerates as temperatures rise. Temperature is the most influential water parameter in altering the life cycle of cephalopods in captivity (Forsythe et al., 2001) because it directly influences egg development, yolk absorption rate, growth rate ,feeding rate and lifespan (Dominguesetal.,2001a,2002;Forsytheetal., 2002; Grigoriou and Richardson, 2004, 2008;Mangold andBoletzky,1973; Vidal et al., 2002b). It is therefore open to manipulation to obtain the objectives required during culture. For instance, if the goal is to culture cephalopods for human consumption, the temperature can be elevated within the optimal temperature range of each species, maximizing growth over a shorter time period to boost production .However, if the go alisto maximize the lifespan of a certain species for public display or laboratory experiments,a cooler water temperature will promote longevity (Forsythe et al., 2001). The optimal temperature range is generally species-specific and stage specific and is the range within which individuals can maximize their growth, fitness and fecundity (Noyola et al., 2013b), so it is also an important consideration for the success of the grow-out period and sustained cephalopod culture (Delgado et al., 2011). A basic rule of thumb is that survival is optimized if the temperature (as well as other culture parameters) is close to that of the natural environment at the capture site (Boyle, 1991). If widely distributed, the temperature tolerance range will therefore depend on the natural geographic location of a given population. This is well illustrated by O. vulgaris, which has at least two genetically divergent populations in the Mediterranean (Fadhlaoui-Zid et al., 2012) and four off the Brazilian coast (Moreira et al., 2011). For populations in Europe, the recommended temperature is between 10 and 20 C(Vaz-Pires et al., 2004). Growth increases at higher temperatures within this range but death ensues above 23 C(Aguado Gime ´nez and Garcı ´a Garcı ´a, 2002; Garcı ´a Garcı ´a et al., 2009). However, in the Caribbean tropics, the populations of O. vulgaris in Bonaire are reported to thrive at sustained temperatures as high as 28 C(Putnam and Edmunds, 2011). System temperature not only influences juveniles and adults but also greatly affects cephalopod embryonic development (Boletzky, 1983, 1987; Boletzky and Hanlon, 1983; Caverivie `re et al., 1999; Choe, 1966a): warmer water temperatures are associated with shorter incubation periods and vice versa. Sepia officinalis embryos should be incubated at 18–25 C, with incubation time possibly doubling at 15 C and embryos not developing at temperatures below 12 C(Sykes et al., 2006b). High temperatures will decrease incubation time and increase the food requirements of paralarvae to support their high metabolic demand (Vidal and Boletzky, 2014). Thus, rearing temperature can be used to extend or reduce developmental time and overall lifespan (Forsythe and Hanlon, 1988; Villanueva et al.,1995). Salinity The ambient salinity of most tropical seas is around 34–37 psu, although coastal (estuarine) waters can range from 5 to 30 psu (Moe, 2009). Cephalopods are steno haline and salinities outside the range of 27–37 psu can be fatal, so salinity is a limiting factor in the distribution of most species (e.g., Vaz-Pires et al., 2004), with only two known exceptions: the squid Lolliguncula brevis, an estuarine species tolerating salinities as low as 16 psu (Hendrix et al., 1981), and the sepiid Sepiella inermis. Therefore, for the majority of species, the potential for freshwater influx (e.g. from nearby rivers or subsurface seeps or in regions subject to heavy rain) needs to be considered when planning an open culture or maintenance system (Vaz-Pires et al., 2004). In culture, research indicates a working salinity range of 27–35 psu for O. maya, O. vulgaris, S. officinalis and S. lessoniana (Boletzky, 1983; Boletzky and Hanlon, 1983; Farı ´as et al., 2009; Nabhitabhata et al., 2005b). Maintaining the salinity above 30 psu is recommended (Berger, 2010; Chapela et al., 2006), along with the slow addition of deionized (DI) or reverse osmosis (RO) water if salinity rises above 35 psu (Walsh et al., 2002). pH Like many animals, cephalopods are sensitive to pH, because of the impact on aerobic performance (see, e.g. P€ortner and Zielinski, 1998), and should be kept within the range of open sea water: between 7.8 and 8.2 (Boletzky and Hanlon, 1983; Boyle, 1991). Hanlon (1990) pointed out that a pH above 7.6, as well as high levels of dissolved oxygen, is necessary to accommodate the high metabolic demands of constant swimming in teuthoid squid. Eggs and paralarvae are extremely sensitive to pH changes. Lacoue-Labarthe et al. (2011) studied the combined effects of low pH and high CO2 partial pressure on the metabolism of embryos and paralarvae of Loligo vulgaris and observed changes in the bioaccumulation of metals. The addition of sodium bicarbonate can be used to adjust low-pH conditions (Boletzky and Hanlon, 1983), but this should be done very slowly as rapid changes in pH can be detrimental to animal health. Elevated pH can be reduced by slowly adding sea water or DI/RO freshwater to the system (while carefully monitoring salinity) or by increasing tank aeration (Moe, 2009). However, the best solution for conditions of low pH is to gradually replace tired water with fresh sea water. Dissolved oxygen Oxygen is the most important of all the dissolved gases for water quality because it is essential for respiration, oxidizing the nutrients that release the energy necessary for locomotion, reproduction, feeding and other vital activities (Cerezo Valverde and Garcı ´a Garcı ´a, 2005). Oxygen consumption can be affected by metabolism, ambient temperature and body weight. Higher temperatures induce higher oxygen consumption(Wellsetal.,1988) and decreased oxygen solubility (Weiss, 1970). Smaller animals have a relatively higher mass-specific oxygen consumption than larger animals, and both feeding and movement lead to large increases in oxygen consumption (Cerezo Valverde and Garcı ´a Garcı ´a, 2004; Grigoriou and Richardson, 2009; Melzner et al., 2007; Wells et al., 1983). Parra et al. (2000) evaluated the respiration rates of O. vulgaris late embryos and hatchlings at 20 C and observed that oxygen consumption rates increase threefold at hatching, because of the high energy demands of jet propulsion. They also observed that the oxygen consumption of a medium-sized egg mass is approximately twice that of the female brooding them. In general, then, DO levels for most cephalopods should always be near saturation, although benthic octopods are more tolerant to lower oxygen levels (Boletzky and Hanlon at el., 1983).

Nitrogenous wastes Like most aquatic invertebrates, cephalopods are ammonotelic, releasing their nitrogen end products mainly as ammonia (Boucher-Rodoni and Mangold, 1985; Katsanevakis et al., 2005). The harmful inorganic nitrogenous compounds are unionized ammonia (NH3), nitrite (NO2) and nitrate (NO3). Total ammonia nitrogen (TAN) includes both the ionized form, ammonium (NH4 + ), and the unionized form, which occur in an equilibrium determined by water temperature, salinity, pH and pressure. Ammonia management deserves special attention in closed systems as its unionized form is considerably toxic even at very low concentrations. The levels of TAN, nitrite and nitrate must be monitored carefully to avoid reaching lethal levels (Boletzky and Hanlon, 1983). Numerous publications suggest the importance of keeping unionized ammonia <0.1 mg L1, nitrate <20.0 mg L1 and nitrite <0.1 mg L1 in cephalopod culture (Boletzky and Hanlon, 1983; Vidal and Boletzky, 2014). Segawa and Hanlon (1988) observed that, except at hatching, oxygen consumption and ammonia excretion rates increase linearly with increasing body weight. This emphasizes the importance of carefully monitoring captive bioload to tank volume ratio ascephalopods grow incaptivity. Increase inand breakdownof nitrogenous compounds can also decrease pH, causing additional animal stress and health concerns (Moe, 1993). Removing harmful nitrogenous wastes from the sea water is critical in maintaining cephalopod culture. This is the main function of biological filtering, but if levels still rise above the recommended minima, replacement of the sea water is the only option.

Organic wastes All animals produce various organic wastes that must be removed, primarily because of the decomposition of the organic wastes of digestion, which can quickly cause water quality to deteriorate by encouraging microbial growth and add stress to captive animals. Organic matter should not represent a problem if it is quickly removed from the system. Solid particulate organic matter sinks and can be removed efficiently by siphoning. Suspended particulate matter and excreted waste can be physically removed by mechanical filtration using sand, gravel, floss, filter pads or filter bags, helping to reduce variations in pH and also levels of nitrogenous compounds (Vidal et al., 2002a). The type of mechanical filtration should be selected based on specific culture needs. However, protein skimmers and chemical filtration such as activated carbon should be considered to effectively reduce dissolved and particulate organic matter. Protein skimmers are also very effective for ink removal. Filtration to remove suspended particles should occur before sterilization, as particulate organic matter is the main substrate for bacteria in recirculation systems (Appleford et al., 2003). Disinfection and sterilization The delicate skin of cephalopods is characterized by a single layer of columnar epithelialcells. Substantial damage causedby capture, transport,handling and constant contact with the tank environment (bumping into walls and abrasion of skin) can produce small wounds in the epidermis followed by bleeding. Bacteria in sea water (see Section 2.3.1) can enter these wounds leading to infection and death (Hanlon, 1990). Thus, disinfection and sterilization are very important to efficiently remove potentially harmful organisms such as bacteria, microalgae, fungi, protozoans and viruses. Such procedures have proven effective for maintaining healthy cephalopods from paralarvae through to adults (Hanlon, 1990; Vidal et al., 2002a). Sterilization can be accomplished by either UV or ozone. Ozone sterilization requires careful monitoring because ozone leakage into the culture system can harm and kill cephalopods, particularly eggs and paralarvae. UV sterilizers are usually safe, as long as they are securely housed to protect both animals and maintenance staff from the harmful effects of UV light on the retina and skin. Additionally, careful cleanliness protocols are advisable. Examples include, in addition to daily siphoning, weekly cleaning of airlifts, air stones and water outlet filters, using a scrubber under running tap water. In order to assure proper disinfection, the cleaning process must be followed by immersion of these circuit components for 24 h in Atlantol 914 (Atlantol, Belgium), rinsing under running tap water, and immersion for 15 min in Virkon S (DuPont Animal Health Solutions, Europe). Finally, all components should be abundantly rinsed under running tap water. This cleaning procedure must be applied to nets and all other materials used in animal handling and will contribute to decrease contamination rates, pathologies and the risk of spreading disease Diseases and parasites Most pathogenic agents described in the literature are gram-negative Vibrio bacteria, fungi, parasites and viruses, and they will be briefly presented here Bacterial infection Cephalopods are susceptible to bacterial infections of the skin, as a result of secondary infection of wounds by opportunistic pathogens (CastellanosMartı ´nez and Gestal, 2013), particularly Vibrio spp., which are primarily located on the epidermis and produce ulcers. In severe cases, the circulatory system and reproductive organs can be affected (Sangster and Smolowitz, 2003), leadingto death withina few days. Cases ofVibrio spp.infections have been described in Loligo pealei, O. vulgaris, O. joubini, O. briareus, O. maya, L. brevis, S. officinalis, Sepia pharaonis and S. apama (Cruz et al., 2008; Farto et al., 2003; Ford et al., 1986; Gamboa, 2011; Hanlon et al., 1984; Harms et al., 2006; Leibovitz et al., 1977; Reimschuessel et al., 1990; Sangster and Smolowitz, 2003; Scimeca, 2012). This bacterium is common in coastal waters and has been found in higher densities associated with tank walls in cephalopod culture (Elston and Wood, 1983; Sangster and Smolowitz, 2003) compared to natural conditions (Ford et al., 1986). This highlights the possibility that infection is indirect and occurs secondary to wounding, especially if injury is caused by collisions or abrasion in a captive environment (Harms et al., 2006; Hulet et al., 1979; Sangster and Smolowitz, 2003; Sherrill et al., 2000). Enzymatic analyses of S. officinalis tissues indicate the presence of strong immuneactivities in the skin(C. LePabic, personal observation). Therefore, reducing stress and skin damage is paramount when keeping cephalopods in long-term captive conditions (Harms et al., 2006; Sangster and Smolowitz, 2003). This can be achieved by the use of specific holding techniques, such as circular tanks separated from water conditioning facilities to prevent friction and resulting epidermal damage (Hanlon, 1990) and maintain optimal water quality to suppress bacterial outbreak.

Fungal infection Reports of fungal infections are rare in cephalopods and treatments have not been evaluated (Harms et al., 2006). Cladosporium sp. has been reported in an unidentified octopus but was not described in detail (Scimeca, 2012). It was also reported in an adult female S. officinalis, with local bacterial infection associated with subsequent ulceration (Harms et al., 2006). These infections appear on the epidermis as described for Vibrio spp. Similar to bacterial infections, most fungal infections in cephalopods are secondary, as a result of trauma or a compromised immune system (Harms et al., 2006). Viral infection The potential pathogenic effect of viruses in aquaculture is a new area of research. Recent studies have been conducted on O. maya to determine the presence of the white spot syndrome virus (WSSV) that adversely affects the shrimp aquaculture industry. Artisan fisheries commonly use crustaceans asbait forO. maya,raisingthe possibilitythat O.mayacould potentially actas a vector for this virus. Although no infection was observed in the wild, laboratory experiments have demonstrated direct transfers of WSSV from O. maya to Litopenaeus vannamei and vice versa (Rodrı ´guez-Canul et al., 2012). Octopus maya hosts WSSV in its gills and digestive gland, causing no apparent symptoms, and may, therefore, be a paratenic host for this viral agent (Rodrı ´guez-Canul et al., 2012). Treatment of diseases There have been few studies of treatments for cephalopod pathogens. The available information was recently summarized by Scimeca (2012), identifying six antibiotics and one antiprotozoal treatment. Only one study has described the pharmacokinetic parameters and intravenous, oral or bath administration of the fluoroquinolone antimicrobial enrofloxacin on S. officinalis (Gore et al., 2005). Of particular interest is a potentially practical and efficient use of enrofloxacin by oral administration (10 mg/kg in live shrimp). Enrofloxacin appears to have a very fast elimination rate and a very low distribution in cuttlefish tissues compared to fish, birds, reptiles and mammals, emphasizing the fact that pharmacokinetic studies in cephalopods are in their infancy. CULTURE REQUIREMENTS AT DIFFERENT LIFE PHASES A) Brood stock Cephalopod brood stocks for culture can be obtained directly from wild populations but the selection of individuals is a key factor: they should be healthy, with undamaged skin, arms and tentacles. Capture methods should be the most appropriate to minimize stress and maintain the physical integrity oftheanimals. The use ofpots (Brazil, Japan,Portugal andSpain)or lineswith crabs as bait without hooks is recommended for octopus capture. Size and weight should also be considered as key factors for the selection of potentially mature individuals. This section addresses the actual status of broodstock management of the four biological models under culture conditions. Sepia officinalis This common European cuttlefish has a broad distribution from the North Atlantic, throughout the English Channel, and south into the Mediterranean Sea to the coast of West Africa. A demersal, neritic species occurring predominantly on sandy to muddy bottoms from the coastline to about 200 m depth, it has a maximum size of 450 mm ML and weight up to 4 kg in temperate waters but around 300 mm ML and 2 kg in subtropical seas (Reid et al., 2005). This species produces large eggs(20–30 mm in length),attains sexual maturity at very different sizes and weights (Hanlon, 1990; Sykes et al., 2006a) and has a maximum estimated potential fecundity of up to 8000 eggs in nature (Laptikhovsky et al., 2003). Females mate repeatedly (Hanlon et al., 1999) and display intermittent or chronic spawning (Boletzky, 1987), depending on captive conditions. It is not advisable to separate females from males after copulation since this will not promote a reproduction resembling wild conditions and might have an indirect influence on egg quantity and quality (Figure 1.4).According to Boletzky(1983), larger females will lay bigger eggs, although this does not agree with recent observations by Sykes et al. (2013a). Noparentalcareofeggshasbeenobservedincuttlefish,andsenescentfemales, whichallocatealltheirenergyreservestotheeggs,dieaftertheirlastspawning. As with S. lessoniana, there are two possible brood stock sources for breeding cuttlefish: captive cultured individuals or direct from the wild (Sykes et al., 2006b). Koueta et al. (2002) and Perrin (2004) obtained smaller eggs when these were produced by a captive brood stock, except when enriched feeds were used. When establishing brood stock, all phases of the life cycle require great care because reproduction in captivity is still one of the bottlenecks in cuttlefish culture (Sykes et al., 2006b). Closed systems can be used for experimental rearing and so can open systems if the quality of water is excellent. Semiopen systems in which 80% of water is renewed each day might also be a good alternative (Koueta and Boucaud-Camou, 1999). Conditions to accommodate breeders have progressed from the use of 250 L tanks (Correia et al., 2005, Sykes et al., 2006a) up to 9000 L, and recommendations suggest that increased bottom areas should be used (Domingues and Ma ´rquez, 2010; Sykes et al., 2013a; Figure 1.5). Low disturbance areas should be elected to settle tanks, irrespective of their indoor or out door location on the husbandry facility.Tank design should allow correct water circulation inside the tank in order to ensure that no anoxic areas are potentially created. Additionally, there must beno sharp objects or rough surfaces inside the tank since they may cause skin damage. Round fibre glass tanks should be used and must comprise enough airlifts fixed on the tank walls and air stones deployed in the middle of the tank. These will ensure slow water movement and draining through the outlet piping located in the centre of the tank, reducing turbulence and improving conditions for egg laying and maintenance. Broodstock must be kept under low light intensities (200 lux or less), and photoperiod should replicate that occurring during spawning in the wild for each particular geographic area. Ideal photo period will correspond to a combination of 12–14 hs light versus 12–10 hs dark, at a mean temperature of 23–25 C. The combined effects of photoperiod and feeding can be used to increase survival and growth (Koueta and Boucaud-Camou, 2003; Perrin et al., 2004). When using outdoor tanks, the use of water-repellent masking nets is strongly advised to prevent excessively bright conditions and sunburn and decreases in pH and salinity caused by rainfall. Sex ratio and stocking densities have significant effects on the fecundity and fertility of this species (Boal and Golden, 1999; Forsythe et al., 2002). Forsythe et al. (1991) suggested a male/female sex ratio of 1:3 to limit the likelihood of male aggression and aggressive mating behaviour, and Forsythe et al. (1994) suggested a density of two cuttlefish m2. However, fecundity results obtained under different culturing conditions(tankvolumes, stocking densities, sex ratios, temperature and food; Table 1.3) indicate that thesexratioshouldbemaintainedat2:1andstockingdensitieskeptlowwhen setting up a broodstock. For instance, a 9000 L tank should have 21 individuals, 14 ♂♂ and 7 ♀♀, which is a stocking density of four cuttlefish m2. The onset of maturation and reproduction in cuttlefish determines a shift in the diet, from a predominant composition of crustaceans (crabs, prawns and shrimps) during the juvenile phase to a mixture of fish and crustaceans as individuals mature and reproduce (Boletzky, 1983; Nixon, 1985). This agrees with published information on the diet of other cephalopod species, such as L. vulgaris (Coelho et al., 1997), in which changes in diet are also attributed to the onset of sexual maturation. In spite of this, Sykes et al. (2006a, 2013a) had demonstrated that it is possible to base successful cuttlefish culture on a diet composed exclusively of frozen grass shrimp, Palaemonetes varians. Perrin (2004) and Perrin et al. (2004), however, reported lower survival and growth rates and smaller egg size when captive animals are fed with frozen prey, noting that they adjust their enzymatic activity to the feed and that frozen feed delays the development of the digestive system. This may have a direct impact on juvenile growth and also on egg size once the animals reach maturity and spawn. B) Embryonic phase Embryonic incubation and maintenance does not represent a major problem for the production of paralarvae and juveniles in most species. However, egg care is one of the key factors to promote rearing success. Eggs can be obtained from broodstock, from the wild (Figure 1.8) or from in vitro Embryonic phase Embryonic incubation and maintenance does not represent a major problem for the production of paralarvae and juveniles in most species. However, egg care is one of the key factors to promote rearing success. Eggs can be obtained from broodstock, from the wild (Figure 1.8) or from in vitro fertilization. Embryonic development should be monitored closely to evaluate developmental progress and to predict hatching time by following the different stages with an illustrated scale (e.g. Arnold, 1965; Naef, 1928) adapted to each species. Handling and maintenance of egg masses and brooding females should be done with care to avoid egg mass mortality. Husbandry conditions during embryonic development should be maintained ideal according to established requirements for each species; otherwise, the quality of the eggs will be compromised, which will inevitably be reflected in the quality of the hatchlings produced (i.e. normal, abnormal and/or premature). From a practical point of view in the laboratory, cephalopod species can be classified according to whether or not they require maternal care. The following section attempts to identify the main factors influencing embryonic development and methods to avoid death of the embryos and premature hatching.

C) Planktonic paralarval phase Paralarval rearing is at present one of the main bottlenecks for cephalopod culture. The term paralarva defines a cephalopod that is planktonic after hatching and has a habitat different from older conspecific individual (Young and Harman, 1988). Newly hatched planktonic paralarvae are delicate and have relatively short arms and limited swimming ability (Villanueva et al., 1995). During the first days after hatching, paralarvae use a combination of endogenous (yolk) and exogenous (prey) food sources (Boletzky, 1975; Vidal et al., 2002b). Both the rate and efficiency of yolk absorption are temperature-dependent and the time required to deplete yolk reserves decreases exponentially with increasing temperature. Feeding rates increase as the inner yolk sac is being absorbed and more space becomes available to accommodate meals for digestion (Vidal et al., 2002b). Thewhole planktonic phase has been coveredfor 21 cephalopod species, but only at the experimental level. Eight sepiid cephalopods with a relatively brief planktonic phase have been reared: Sepiella inermis (Choe, 1966a; Nabhitabhata, 1997), S. japonica (Zheng et al., 2010), Euprymna berryi (Choe, 1966a), E. hyllebergi (Nabhitabhata et al., 2005a), E. scolopes (Hanlon et al., 1997), E. tasmanica (Moltschaniwskyj and Johnston, 2006), Idiosepius paradoxus (Natsukari, 1970) and I. pygmaeus (Nabhitabhata et al., 2005b). These sepioid species are relatively large at hatching and their planktonic phases range from a few hours to 1 month. Six species of loliginid squid have been reared to the juvenile phase: Doryteuthis opalescens (Chen et al., 1996; Vidal et al., 2002a; Yang et al., 1986), D. pealeii (Hanlon et al., 1987), Heterololigo bleekeri (Ikeda et al., 2005), Loligo forbesii (Hanlon et al., 1989), L. reynaudii (Vidal et al., 2005) and L. vulgaris (Turk et al., 1986; Villanueva, 2000). Their planktonic phases differ, depending on the hatchling size of the species and temperature, but none lasts longer than 2 months. Sepioteuthis lessoniana (Choe, 1966a; Lee et al., 1994; Nabhitabhata, 1996; Segawa, 1990; Sugimoto and Ikeda, 2012) and S. sepioidea (LaRoe, 1971) hatch at a large size and can thus be considered juveniles. Five species of octopus with a planktonic phase (merobenthic octopuses) have been reared to settlement: Amphioctopus aegina (Promboon et al., 2011), Enteroctopus dofleini (Okubo, 1979, 1980; Snyder, 1986a,b), O. joubini (Forsythe and Toll, 1991), O. vulgaris (Carrasco et al., 2006; De Wolf et al., 2011; Iglesias et al., 2004; Itami et al., 1963; Villanueva, 1995) and Robsonella fontaniana (Uriarte et al., 2010). Their planktonic phase ranges from 3 weeks to 6 months, depending also on species and temperature. There are still many questions to be answered in relation to paralarval rearing, particularly regarding their feeding, nutrition and husbandry requirements. Most information has been obtained from just a few species, and the most intense research during recent years has been on O. vulgaris, which is the focus of the next section Sepia officinalis This species has pelagic–demersal hatchlings of 6–8 mm ML and 950 mg WW (Hanlon, 1990) and should be fed on live grass shrimp (P. varians) diet for the first 20–30 DAH and thereafter frozen grass shrimp (Sykes et al., 2006b). After this period, juveniles should have a fully developed digestive system and a mean WW of 5g(Sykes et al., 2006b). At this stage, they are ready to be transferred to tanks with increased bottom area, which can be a saline earth pond or an experimental fibre or plastic tank. If kept in tanks, the. sea water systems and conditions used should be similar to those described for broodstock (see Section 3.1.2). Settings recommended for hatchlings and juveniles are the use of black tanks and low light intensities. At this point, new spawners should be selected from fast growers and deployed in outside tanks, while the other individuals should remain in the hatchery. For both hatchery and new spawner tanks, the number of individuals (up to 10 juveniles) and minimum bottom areas (1100 cm2) should be taken into account (Sykes et al., 2003). The water height in the tanks should be low (less than 1 m) in order to favour prey encounters, thus reducing the energy allocated to catch prey (Figure 1.14B). Water height might be gradually increased as cuttlefish grow, providing increased water volume in the tanks (Forsythe et al., 1994). If the individuals are to be cultured in ponds, abrupt changes in water temperature, salinity and pH must be avoided in order to reduce mortality rates associated with the transfer from the hatchery to the ponds. When individuals are kept in ponds, extensive culture should be used. In this case, live prey should be naturally present or deliberately introduced. Depending on the final size needed and the culture temperature, approximately 50–60 d are required to obtain individuals of 50 g at 25.05.0 C. Water inlet and outlet filters of appropriate size should be used to prevent both the entrance of predators and the escape of cuttlefish from the ponds. Predation by birds can be considerably reduced if a set of netting barriers is used to cover the tanks. The use of mechanical water oxygenators is recommended in order to keep adequate levels of DO (>80%), particularly during the night-time in the warmer months of the year. A number of studies have addressed the densities to be used under different culturing conditions: closed, semiclosed or open water circulation. Forsythe et al. (1994) suggested a density of 20 cuttlefish m2 in closed sea water systems during the juvenile phase but provided no information on the bottom area, an important parameter that is associated with culturing densities, as recognized by the ones from this paper authors. In a later study, Forsythe et al. (2002) suggested a density of 400 cuttlefish m2 when using 1800 L circular tanks in a closed water system. These density values, coupled with culturing temperatures of around 25 C, might be on the verge of impactingbothgrowthandsurvivalratesduetotheincreaseofcuttlefishbiomass in the tanks. Sykes et al. (2003) suggested culturing densities of 120 cuttlefish m2 for 5 g juveniles and a minimum bottom area of around 1083 m2 when using 10 L raceway tanks in a flow-through water system. These reference values might be used when culturing cuttlefish juveniles up to 25 g. The effects of both density and bottom area on the growth of juvenile cuttlefish (Figure 1.14B) when using concrete raceway tanks in an open sea water system have been addressed by Domingues and Ma ´rquez (2010). Results from that investigation suggest that higher densities (33 individuals m2, mean weight of 9.5 g) and broader bottom areas might promote higher growth and survival rates and, furthermore, that irrespective of culture densities, higher survival and growth rates were obtained when using tanks with larger bottom areas. These results suggest that bottom area seems to be a more significant culturingparameter than density for cuttlefish. Thus, irrespectiveof the rearing/culture water system, density must decrease and tank bottom area increase with cuttlefish growth (Domingues and Ma ´rquez, 2010; Sykes et al., 2003). According to Forsythe et al. (1994), no substratum is necessary to obtain adequate growth and survival rates. In addition, this practice consistently facilitated cleaning, prevented disease and promoted good welfare conditions during cuttlefish rearing and culture (Sykes et al., 2012). Culture density and bottom area are particularly important parameters when using earth ponds because high growth rates have been recorded on a pilot study under these conditions (Domingues, Sykes and Andrade, unpublished data). However, the rate of prey intake by cuttlefish can be reduced due to the high turbidity and the impossibility of cleaning ponds sufficiently, which might result in an excessive increase in nitrogenous compounds and a drop in DO. When coupled with increased carrying capacity, this situation could lead to mass mortalities and, eventually, a total loss of cuttlefish biomass. As feed, live grass shrimp P. varians was used during the first 2 months after hatching and frozen Carcinus maenas for the remaining life cycle, with no significant effects on cuttlefish fecundity (Domingues et al., 2001b, Sykes et al., 2013a,b). However, P. varians was demonstrated to adequately replace C. maenas in the diet (Domingues et al., 2002) and a mixture of live P. varians, C. maenas and fish (Correia et al., 2005) delivered one of the highest individual fecundities ever recorded in the 250 L tanks (834 eggs ♀1). The latter result might relate to temperature, cuttlefish density or sex ratio rather than to food quality, but this requires confirmation. Information recently published by Sykes et al. (2012) provides the highest values for individual and overall fecundity (1383 and 16593 eggs, respectively) and acceptable individual fertility (72%) after feeding cuttlefish on live grass shrimp for the first 20–30 DAH and frozen grass shrimp from that period onwards. A hypothesis to explain this optimal result is that the use of frozen grass shrimp might influence cuttlefish fecundity by promoting lower energy expenditure associated with prey capture and feeding. However, tanks with increased bottom area were used, so factors other than diet might have affected fecundity and further research will be needed to clarify these findings. D)Grow-out Cuttlefish are usually conditioned in open sea water systems due to logistics, welfare and economic aspects. None the less,as technology used in closed and semi closed systems is becoming cheaper and aquaculture environmental concerns are scaled up, the use of closed sea water systems similar to those reported by Hanlon (1990) for cephalopods and recently by Martins et al. (2010) for fish is predicted. Recent investigations suggest an ideal tank volume of 9000 L (Sykes et al., 2013a), cylindrical in shape and made of fibreglass, with sufficient airlifts fixed on the tank walls and air stones arranged centrally to maintain steady water flow towards the outlet piping at the centre of the tank. Since cuttlefish are benthic organisms (Boletzky, 1983), culture tanks should have maximum base area (Domingues and Ma ´rquez,2010;Sykes etal., 2013a).If closed and semi open systems are used, UV sterilization will be necessary to avoid disease (see Section 2.2.7). The tank environment should enable cuttle fish to camouflage themselves easily; tanks should be kept under low light intensities (<200 lux) and a normal photoperiod replicating natural geographic conditions during spawning in the wild. This may be achieved using a combination of natural or artificial light sources and tank color . If placed outdoors, reduced light intensity can be afforded with water-repellent masking nets, which will also prevent pH and salinity decline due to rain fall. Temperature should be maintained at 23 C with high levels of DO. Currently, the grow-out of cuttlefish juveniles uses crustacean feed, mainly grass shrimp P. varians (Sykes et al., 2006a). Nonetheless, several different food items have been tested, either solely or as mixed diets (e.g. Almansa et al., 2006; DeRusha et al., 1989; Domingues et al., 2001a,b, 2002; Sykes et al., 2006a). Despite all this effort, it is not yet economically viable to produce cuttlefish in large numbers with a grow-out based on wild- collected food because the amount of feed biomass required is high and availability is too low. Attempts to feed cuttlefish on a prepared diet have failed to achieve suitable growth and survival rates (Castro, 1991; Castro and Lee, 1994; Castro et al., 1993; Domingues et al., 2005, 2008; Ferreira et al., 2010; Lee et al., 1991), so further research is necessary to produce a well- designed, inexpensive and storable artificial diet for S. officinalis. Development time to attain marketable size will greatly depend on the product desired. For instance, in some Mediterranean countries, such as Portugal and Italy, undersized cuttlefish individuals (5–25 g) are prized and their commercial value is higher than that of animals weighing over 100 g. Time to market will also be dependent on culture conditions, especially temperature and food. Sepia officinalis is cultured extensively in Portugal, Italy and Tunisia, where human action is not involved at the feed level, with eggs caught and left in earthen ponds with naturally occurring prey, for animals to grow and be collected a few months later on reaching marketable size. According to Palmegiano and Sequi (1981), in this type of culture, 150–300 g of eggs will produce 800–1200 kg of cuttlefish with a mean WW of 40–80 g. The semi-intensive experiments performed in Italy in the 1980s obtained fast growth rates: 14.2 g in 60 d at 21–24 C in ponds, 25 g in 40 d and 80 g in 100 d at 21–24 C in concrete tanks (Palmegiano and Sequi, 1981, 1984) and 80 kg/Ha in 90 d at 21–24 C in net cages in ponds (Sequi and Palmegiano, 1984). Analysis of growth rates obtained during a set of trials using earthen ponds (Domingues, Sykes, Andrade, unpublished data) indicates that if sufficient food is available and other important conditions are met, cuttlefish will grow faster outdoors than indoors, which is in accordance with the findings of Domingues et al. (2006). Thus, it is possible to grow individuals to marketable size in 2–3 months or even less at water temperatures ranging from 23 to 25 C(Figure 1.17). Market prices for S. officinalis are high and the short life cycle will support an easy short-term return on investment. In fact, the return on investment can be shortened to become more profitable if cuttlefish culture uses integrated aquaculture. The increase in nitrogenous compounds originating in the excretion products from cuttlefish metabolism will boost primary production, providing an increase in secondary production that will benefit other cultured species inside the ponds. CURRENT LIMITATIONS As can be understood from the preceding account, there has been significant progress in cephalopod culture methods and it is now possible to maintain many species for relatively long periods in laboratories and aquarium facilities. However, the more rigorous demands required for aquaculture mean that for many species, there are still some major obstacles to overcome before it becomes possible to sustain them throughout multiple life cycles to a level of production that is industrially stable and economically viable. This section emphasizes the major obstacles defining the current limitations on developing cephalopod aquaculture into an industrial-scale enterprise. Basic culture system design for cephalopod aquaculture has progressed from rectangular–cubic to circular–cylindrical designs, populated with simple pipe-based housing units for octopuses arranged more or less at random but yet to take full advantage of the available three-dimensional water volume. Feed delivery in large aquaria is generally by hand and random, with a few animals tending to dominate feed reception, resulting in variable growth rates and consequently a broad size range at the end of each production cycle. Water quality requirements raise the risks for large-scale (particularly landbased) aquaculture in the absence of an open sea water system that is stable in composition over the long term, and of high quality, since all cephalopods are highly vulnerable to natural and man-made pollutants and to sudden changes in parameters such as temperature, salinity, pH and concentrations of various solutes. It is therefore necessary to budget for sufficient monitoring, particularly regular measurement of pH and the content of nitrogenous compounds as the cultured biomass increases, taking care that the capacity of the system is not exceeded. Seeding aquaculture systems requires that temperatures are kept close to those of the source population (Boyle, 1991), which demands careful budgeting of the energy requirements for cooling and heating if local and source temperatures are significantly different. One of the greatest bottlenecks to culture is the production of sufficient quantities of quality offspring. This is directly related to the control of reproduction that remains as a cornerstone for the development of cephalopod aquaculture. The quality and quantity of eggs and hatchlings produced will be reliant on the environmental influences during the maturation process and during embryonic development. It has been shown that egg viability is reduced after several culture generations due to inbreeding (e.g. Walsh et al., 2002); thus, control over reproduction is necessary to achieve mass production. The paralarval phase and the settlement period found in a number of small-egged species have proven to be critical bottlenecks: thus far, all species with a paralarval phase can only be raised experimentally in numbers too small to be commercially viable. Nutrition is a problem common to culturing most species and many phases and stages in the life cycle because little is known about (1) what cephalopods at different life stages eat in the wild, (2) their nutritional physiology and (3) how and when to present them with appropriate food items in an enclosed system. Advances have been made in artificial feed formulations but there are still no available routine methods for rearing and providing suitable living prey items to paralarvae on a commercial basis and for relating this impact on profitability as there is yet no completely reliable artificial feed available for any cephalopod. The main limitations here are that cheap carbohydrate sources of feed cannot be used for cephalopods, which require high- protein diets fortified with certain lipids. There is ample evidence for different quantitative (as well as qualitative) requirements at different life stages, particularly during the posthatching period when the presence of yolk can delay the start of predatory responses to food items. Consequently, incomplete information about the timing of feed introduction and the appropriate amounts to introduce is therefore another limiting aspect for several species. The extraordinarily high intelligence of cephalopods has led to the recognition of the importance of enrichment (e.g. Wood and Wood, 1999), such as play and other forms of stimulation that might provide distraction from negative behavioural traits such as cannibalism (Budelmann, 2010). The absence of opportunities for enrichment in the captive environment, particularly for octopuses, may detract from optimum health and therefore from the optimum growth required for commercial aquaculture. In terms of possible future limitations, the value of polyculture (to overcome limitations of yield per unit water volume) at the commercial level has yet to be investigated. Algae have been used as part of in-series filtering during water reprocessing in closed circulations (see, e.g. Yang et al., 1989), but polyculture in terms of attempts to raise scavengers on waste and uneaten food from octopus culture systems is largely unexplored (cf. Al-Hafedh et al., 2012; Martı ´nez-Porchas et al., 2010). CONCLUSIONS While there has been significant progress in cephalopod culture methods, particularly during the last three decades, much remains to be done. This section explores the research priorities critical to advancing efforts to culture cephalopods according to the current limitations identified in the previous section and presents the main conclusions of this chapter. These species were selected for their very attractive aquaculture characteristics, such as high rates of growth and food conversion, which for aquaculture translates into short culture cycles, high ratios of production to biomass, high cost-effectiveness and well-established markets. The scientific objectives of laboratories actively working with live cephalopods around the world determine the target species selected for experiments, which usually correspond to local coastal species easily adapted to water systems in captivity. From current maintained under approved ethical and welfare conditions similar to those required for fishes in relation to maintenance, anaesthesia and killing humanely with suitable technique knowledge, it is known that water quality is of critical importance and should be closely monitored according to each species and developmental stage. Water quality should be maintained during housing and transportation to ensure optimal survival and to avoid diseases. One of the main bottlenecks for the culture of cephalopods and that should be ranked as a high-priority research topic is the control of reproduction. Research on methods to optimize broodstock efficiency, including accelerating or decelerating sexual maturity and inducing or delaying spawning, will help advance efforts to culture these animals. Genetic selection or manipulation of cephalopod species for aquaculture suitability is largely unexplored.

REFFERENCE Anusha J.R., Albin T. Fleming 17.2. 2014,. Cephalopod: Squid Biology, Ecology and Fisheries in Indian waters. Taylor & Francis 12 June 2015, Reviews in Fisheries Science & Aquaculture. ABARES. Australian fisheries statistics 2010, Canberra (2011). Abdussamad, E. M., and K. R. Somayajulu. Cephalopod fishery at Kakinada along the east coast of India: Resource characteristics and stock assessment of Loligo duvauceli. Bangladesh J. Fish. Res., 8(1): 64–69 (2004). Abraham, E. R. Summary of the capture of seabirds, marine mammals, and turtles in New Zealand commercial fisheries, 1998–99 to 2008–09. New Zealand Aquatic Environment and Biodiversity. Report 80 (2011). Agnew, D. J., R. Baranowski, J. R. Beddington, S. des Clers, and C. P. Nolan. Approaches to assessing stocks of Loligo gahi around the Falkland Islands. Fish. Res., 35: 155–169 (1998). Roger Villanueva1*, Erica A. G. Vidal1,2, Fernando A ´. Ferna ´ndez-A ´lvarez1, Jaruwat Nabhitabhata (2016)Early Mode of Life and Hatchling Size in Cephalopod Molluscs: Influence on the Species Distributional Ranges. Alagarswami, K., and M. M. Meiyappan. Prospects for increasing cephalopod production of India. In: CMFRI Bulletin: National Symposium on Research and Development in Marine Fisheries Sessions I & II 1987, 44 (Part -1). pp. 146–155 (1989). Alarcon-Mu~noz, R., L. Cubillos, and C. Gatica. Jumbo squid (Dosidicus gigas) biomass off Central Chile: effects on Chilean hake (Merluccius gayi). California Coop. Ocean. Fish. Inv. Rep., 49: 157–166 (2008). Alverson, D. L., M. H. Freeberg, J. G. Pope, and S. A. Murawski. A global assessment of fisheries bycatch and discards. FAO Fisheries Technical Paper. No. 339. Rome, FAO. 233p (1994). Amaratunga, T. Biology and distribution patterns in 1980 for squid, Illex illecebrosus, in Nova Scotian waters. NAFO SCR Doc. 81/VI/ 36, Ser. No. N318 (1981b). Amaratunga, T. The short-finned squid (Illex illecebsrosus) fishery in eastern Canada. J. Shellfish Res., 2(2): 143–152 (1981a). Amaratunga, T., M. Roberge, and L. Wood. An outline of the fishery and biology of the short- finned squid Illex illecebrosus in eastern Canada. In: Proceedings of the workshop on the squid Illex illecebrosus, pp. (Balch, N., T. Amaratunga, and R. K. O’Dor, Eds.). Dalhousie University, Halifax, Nova Scotia (1978). Anderson, C. I. H., and P. G. Rodhouse. Life cycles, oceanography and variability: ommastrephid squid in variable oceanographic environments. Fish. Res., 54: 133–143 (2001). Anderson, F. E., A. Pilsits, A., S. Clutts, V. Laptikhovsky, G. Bello, E. Balguerias, M. Lipinski, M., C. Nigmatulin, J. M. F. Pereira, U. Piatkowski, J.-P. Robin, A. Salman, and M. G. Tasende. Systematics of Alloteuthis (Cephalopoda: Loliginidae) based on molecular and morphometric data. J. Exp. Mar. Biol. Ecol., 364: 99–109 (2008). Meiyappan MM, Mohamad KS, Vidyasagar K, Nair KP, Ramachandran N, Lipton AP, Rao GS, Kirupa V, Joshi KK, Abdussamand EM, Sreenivasan R, Achari GPK. A review of cephalopod resources, biology and stock assessment in Indian waters. In: Marine Fisheries Research and Management. Central Marine Fisheries Research Institute, Cochin 2000; 546-562. Silas EG, Meiyappan MM, Sarvesan R, Nair KP, Srinath M, Rao KS. Stock assessment: Squids and cuttlefishes at selected centres. In: (E.G.Silas Ed) Cephalopod bionomics, fisheries and resources of the EEZ of India. Bull Cent Mar Fish Res Inst 1985; 37:71-79. . Rajasekharan NJ, Devika P, Sophia MJ, Gomathi P, Priya VS, Sherief PV. Cephalopod research and bioactive substances. Indian J of Geo-Marine Sciences 2011; 40:13-27. Meiyappan M, Mohamed KS. Cephalopods. Status of Exploited Marine Fishery Resources of India. Kochi, India. Central Marine Fisheries Research Institute 2003; 221-227. Zuev GV, Nesis KN. Kal’mary (Biologiya I Promysel) (Squids [Biology and Fishery]). Pishchevaya Promyshlennost, Moscow, 1971; 360. Zuev GV, Nigmatullin CHM, Nikol’skii VN. Nektonnye Okeanicheskie kal’mary (Nectonic Oceanic Squids). Agropromizdat, Moscow, 1985, 224. Beninca, E. M. As pescarias industriais de arrasto-duplo em Santa Catarina – Brazil: din^amica vs. permissionamento. MSc. Thesis, Universidade do Vale do Itajaı, Itajaı, Brazil (2013). Benites, C. Resultado de las investigaciones biologico-pesqueras de la jibia Dosidicus gigas (d’Orbigny, 1835) en el litoral peruano de julio 1983 a marzo 1984, pp. 10–15. In: Anales del Congreso Nacional de Biologıa Pesquera 1984 (A. E. Tresierra, Ed.) Trujillo, Peru (1985). Benites, C., and V. Valdivieso. Resultados de la pesca exploratoria de 1979/80 y desembarque de cefalopodos pelagicos en el litoral peruano. Bol. Inst. Mar Per u., 10: 107–138 (1986). Bergman, A. M. Phylogeography of Sepioteuthis lessoniana (the bigfin reef squid) and Uroteuthis duvauceli (the Indian squid). Honors Theses, Southern Illinois University, Carbondale, United States of America (2013). Berry, S. S. A note on the Genus Lolliguncula. Proc. Acad. Nat. Scien. Philadelphia, 63: 100– 105 (1911a). Berry, S. S. Notes on some cephalopods in the collection of the University of California. Univ. California Publ. Zool., 8: 301–310 (1911b). Bettencourt, V., Coelho, M. L., Andrade, J. P., and Guerra, A. Age and growth of Loligo vulgaris of south of Portugal by statolith analysis. J. Moll. Stud., 62: 359–366 (1996). Bigelow, H. B. Plankton of the offshore waters of the Gulf of Maine. Bull. U.S. Bur. Fish., 40 (Part II): 1–509 (1924). Bizikov, V. A. Distribution and stock abundance of the commander squid in the northwestern Bering Sea. In: Commercial Aspects of Biology of the Commander Squid Berryteuthis magister and of Fishes of Slope Communities in the Western Part of the Bering Sea, pp. 82–87 (A. A. Elizarov, Ed.) Moscow, Russia: VNIRO (1996) [In Russian]. Bjarnason, B. A. Handlining and squid jigging. Rome: Food and Agriculture Organization of the United Nations (1992). Bjørke, H., and H. Gjøsæter. Who eats the larger Gonatus fabricii (Lichtenstein) in the Norwegian Sea? ICES Document CM 1998/ M: 10. 11 pp (1998). Caddy, J. F., and R. Mahon. Reference points for fisheries management. FAO Fisheries Technical Paper No. 347, Rome: FAO (1995). Caddy, J. F., and P. G. Rodhouse. Cephalopod and groundfish landings: evidence for ecological change in global fisheries? Rev. Fish Biol. Fisher., 8: 431–444 (1998). Cadrin, S. X., and E. M. C. Hatfield. Stock assessment of longfin inshore squid, Loligo pealeii. NEFSC Reference Document, 99– 12. 72 pp. (1999). Camarillo-Coop, S., R. De Silva-Davila, M. E. Hernandez-Rivas, and R. Durazo-Arvizu. Distribution of Dosidicus gigas paralarvae off the west coast of the Baja California peninsula, Mexico. In: Report of a GLOBEC-CLIOTOP/PFRP workshop, 16–17 November 2006, Honolulu (R. J. Olson and J. W. Young, Eds.). Hawaii, USA. GLOBEC Report 24 (2006). Carpenter, K. E., and V. H. Niem. FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific, 2, Cephalopods, crustacean, holothurians and sharks. Rome: FAO (1998). Dawe, E. G., and P. C. Beck. Population structure, growth and sexual maturation of short-finned squid at Newfoundland, Canada, based on statolith analysis. Can. J. Fish. Aquat. Sci., 54: 137– 146 (1997). Dawe, E. G., P. C. Beck, H. J. Drew, and G. H. Winters. Long distance migration of a short- finned squid, Illex illecebrosus. J. Northwest Atl. Fish. Sci., 2: 75–76 (1981). Dawe, E. G., E. B. Colbourne, and K. F. Drinkwater. Environmental effects on recruitment of short-finned squid (Illex illecebrosus). ICES J. Mar. Sci. 57: 1002–1013 (2000). Dawe, E. G., and L. C. Hendrickson. A review of the biology, population dynamics, and exploitation of short-finned squid in the northwest Atlantic Ocean, in relation to assessment and management of the resource. NAFO SCR Doc. 98/59, Ser. No. N3051, 33 p. (1998). Dawe, E. G., L. C. Hendrickson, E. B. Colburne, K. F. Drinkwater, and M. A. Showell. Ocean climate effects on the relative abundance of short-finned (Illex illecebrosus) and long-finned (Loligo pealeii) squid in the Northwest Atlantic Ocean. Fish. Oceanogr. 16 (4): 303–316 (2007). Dawe, E. G., and Y. Natsukari. Light microscopy. In: Squid Age Determination Using Statoliths, pp. 83–95 (P. Jereb, S. Ragonese and S. v. Boletzky, Eds.). Palermo, Italy: NTR-ITPP Spec Pub No. 1 (1991). Escanez Perez, A., R. Riera Elena, A. F. Gonzalez Gonzalez, and A. Guerra Sierra. On the occurrence of egg masses of the diamondshaped squid Thysanoteuthis rhombus Troschel, 1857 in the subtropical eastern Atlantic (Canary Islands). A potential commercial species? ZooKeys, 222: 69–76 (2012). Evans, K. Arrow squid behaviour and vulnerability to netting techniques. Department of Sea Fisheries Tasmania. 0817–3680 (1986). Falkland Islands Government. Fishery Statistics 16. Fisheries Department, Stanley, Falkland Islands (2012). FAO Yearbook. Fishery and Aquaculture statistics. Rome, FAO. (2010). FAO. FAO Fisheries and Aquaculture Department, Statistics and Information Service. FishStatJ: Universal software for fishery statistical time series. Rome: FAO (2011). FAO. FAO Fisheries and Aquaculture Department, Statistics and Information Service. FishStatJ: Universal software for fishery statistical time series. Rome: FAO (2014). FAO. Fisheries and aquaculture software. FishStatJ (2.0.0) - Software for fishery statistical time series. FAO Fisheries and Aquaculture Department [online]. Rome. (2011–2013). http://www.fao.org/fish ery/statistics/software/fishstatj/en. Karnicki Z. S., T. Pintowski, and J. Latanowicz. Polish squid industry present state and future. In: The first world cephalopod conference (March 13–15 1989, Lisbon, Portugal) p. 80–84. London: AGRA Europe Ltd (1989). Karpov, K. A., and G. M. Cailliet. Prey composition of the market squid, Loligo opalescens Berry, in relation to depth and location of capture, size of squid, and sex of spawning squid. Calif. Coop. Ocean. Fish. Inv. Rep., 20: 51–57 (1979). Kasahara, S. Descriptions of offshore squid angling in the Sea of Japan, with special reference to the distribution of common squid (Todarodes pacificus Steenstrup); and on the techniques for forecasting fishing conditions. Bull. Jap. Sea Reg. Fish. Res. Lab., 29: 179–199 (1978). Nabhitabhata J. Life cycle of three cultured generations of spineless cuttlefish, Sepiella inermis (Fe ´russac and D´Orbigny, 1848). Phuket Marine Biological Center Special Publication. 1997; 17(1):289– 98. Zheng XD, Xiangzhi L, Zhaokai W, Ruihai Y, Chuanyuan T, Qi L. Studies on the life cycle of cultured spineless cuttlefish Sepiella japonica. Transactions of Oceanology and Limnology. 2010; 3:24–8. Boletzky SV, Boletzky MV, Fro ¨sch D, Ga ¨tzi V. Laboratory rearing of Sepiolinae (Mollusca, Cephalopoda). Mar Biol. 1971; 8:82–7. Mauris E. Colour patterns and body postures related to prey capture in Sepiola affinis (Mollusca: Cephalopoda). Marine Behaviour and Physiology. 1989; 14:189–200. Jones NJE, Richardson CA. Laboratory culture, growth, and the life cycle of the little cuttlefish Sepiola atlantica (Cephalopoda: Sepiolidae). Journal of Shellfish Research. 2010; 29(1):241–6. PMID: CCC:000276267900031. Rodrigues M, Garci ME, Troncoso JS, Guerra A. Spawning strategy in Atlantic bobtail squid Sepiola atlantica (Cephalopoda: Sepiolidae). Helgol Mar Res. 2011; 65(1):43–9. PMID: ISI:000287329300005. Boletzky SV. Sepiola robusta. In: Boyle PR, editor. Cephalopod life cycles Volume 1 Species accounts: Academic Press London; 1983. p. 53–67. Guerra A, Rocha F, Gonzalez AF, Buckle LF. Embryonic stages of the Patagonian squid Loligo gahi (Mollusca: Cephalopoda). Veliger. 2001; 44(2):109–15. PMID: ISI:000167997400001. Arkhipkin AI, Laptihovsky VV, Middleton DAJ. Adaptations for cold water spawning in loliginid squid: Loligo gahi in Falkland waters. Journal of Molluscan Studies. 2000; 65:551–64. McConathy DA, Hanlon RT, Hixon RF. Chromatophore arrangements of hatchling loliginid squids (Cephalopoda, Myopsida). Malacologia. 1980; 19(2):279–. PMID: ISI:A1980JP39900005. Yang WT, Hixon RF, Turk PE, Krejci ME, Hulet WH, Hanlon RT. Growth, behavior, and sexual maturation of the market squid, Loligo opalescens, cultured through the life cycle. Fishery Bulletin. 1986; 84(4):771– PMID: ZOOR:ZOOR12400026273. 91. Vidal EAG, DiMarco FP, Wormuth JH, Lee PG. Influence of temperature and food availability on survival, growth and yolk utilization in hatchling squid. Bull Mar Sci. 2002; 71(2):915–31. PMID: ISI:000182787600025. Hanlon RT, Turk PE, Lee PG, Yang WT. Laboratory rearing of the squid Loligo pealei to the juvenile stage: growth comparisons with fishery data. Fish Bull. 1987; 85:163–7. . Baeg GH, Sakurai Y, Shimazaki K. Embryonic stages of Loligo bleekeri Keferstein (Mollusca: Cephalopoda). Veliger. 1992; 35(3):234–41. Ikeda YS I; Ito K; Sakurai Y; Matsumoto G. Rearing of squid hatchlings, Heterololigo bleekeri (Keferstein 1866) up to 2 months in a closed seawater system. Aquac Res. 2005; 36:409–12. Segawa S, Yang WT, Marthy HJ, Hanlon RT. Illustrated embryonic stages of the Eastern Atlantic squid Loligo forbesi. Veliger. 1988; 30(3):230–43. PMID: ISI:A1988Q265400003. Hanlon RT, Yang WT, Turk PE, Lee PG, Hixon RF. Laboratory culture and estimated life span of the Eastern Atlantic squid, Loligo forbesi Steenstrup, 1856 (Mollusca: Cephalopoda). Aquaculture and Fisheries Management. 1989; 20:15–34. . Vecchione M, Lipinski MR. Descriptions of the paralarvae of two loliginid squids in southern African waters. South African Journal of Marine Science. 1995; 15:1–7. Blackburn S, Sauer WH, Lipinski MR. The embryonic development of the chokka squid Loligo vulgaris reynaudii d’Orbigny, 1845. The Veliger. 1998; 4(3):249–58. Vidal EAG, Roberts MJ, Martins RS. Yolk utilization, metabolism and growth in reared Loligo vulgaris reynaudii paralarvae. Aquatic and Living Resources. 2005; 18:386–93. Martins RS, Roberts MJ, Vidal E ´AG, Moloney CL. Effects of temperature on yolk utilization by chokka squid (Loligo reynaudii d’Orbigny, 1839) paralarvae. Journal of Experimental Marine Biology and Ecology. 2010; 386(1–2):19–26. Villanueva R, Sanchez P. Cephalopods of the Benguela Current off Namibia—new additions and considerations on the genus Lycoteuthis. Journal of Natural History. 1993; 27(1):15–46. PMID: ISI: A1993KQ57500002. Turk PE, Hanlon RT, Bradford LA, Yang WT. Aspects of feeding, growth and survival of the European squid Loligo vulgaris Lamarck, 1799, reared through the early growth stages. Vie et Milieu. 1986; 36:9–13.