Development 124, 4481-4491 (1997) 4481 Printed in Great Britain © The Company of Biologists Limited 1997 DEV0134

ETTIN patterns the Arabidopsis floral meristem and reproductive organs

Allen Sessions1,†, Jennifer L. Nemhauser1, Andy McCall 1,‡, Judith L. Roe1, Ken A. Feldmann2 and Patricia C. Zambryski1,* 1Department of Plant and Microbiology, 111 Koshland Hall, University of California at Berkeley, Berkeley, CA 94720, USA 2Department of Plant Sciences, University of Arizona, Tucson, AZ 85721, USA †Present address: Department of Biology and Center for Molecular Genetics, University of California at San Diego, La Jolla, CA 92093-0116, USA ‡Present address: Department of Biology, Carleton College, Northfield, MN 55057-4000, USA *Author for correspondence

SUMMARY ettin (ett) mutations have pleiotropic effects on Arabidopsis involved in prepatterning apical and basal boundaries in flower development, causing increases in perianth organ the gynoecium primordium. Double mutant analyses and number, decreases in stamen number and anther expression studies show that although ETT transcriptional formation, and apical-basal patterning defects in the activation occurs independently of the meristem and organ gynoecium. The ETTIN gene was cloned and encodes a identity genes LEAFY, APETELA1, APETELA2 and protein with homology to DNA binding proteins which bind AGAMOUS, the functioning of these genes is necessary for to auxin response elements. ETT transcript is expressed ETT activity. Double mutant analyses also demonstrate throughout stage 1 floral meristems and subsequently that ETT functions independently of the ‘b’ class genes resolves to a complex pattern within petal, stamen and APETELA3 and PISTILLATA. Lastly, double mutant carpel primordia. The data suggest that ETT functions to analyses suggest that ETT control of floral organ number impart regional identity in floral meristems that affects acts independently of CLAVATA loci and redundantly with perianth organ number spacing, stamen formation, and PERIANTHIA. regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of Key words: Arabidopsis, flower development, ETTIN, positional the gynoecium, consistent with the proposal that ETT is information

INTRODUCTION and 1997; Running and Meyerowitz, 1996; Sessions and Zambryski, 1995; Sessions, 1997). These genes likely act to In higher plants, proper flo ral development re q u i res the coor- pattern growth, cell division and regional differentiation during d i n ated activity of a number of genes that control the pat t e rn- the acquisition of identity within the developing flower. CLV1 ing of organ type, organ number and organ fo rm (We i ge l , functions partially redundantly with meristem identity genes, 1995; Ya n o f s ky, 1995). In A rab i d o p s i s, these genes have been whereas PAN and TSL function independently of the meristem cl a s s i fied into those functioning early in the establishment of and organ identity genes (Clark et al., 1993; Roe et al, 1997; flo ral meristem identity such as L E A F Y (L F Y), A P E T E L A 1 Running and Meyerowitz, 1996). (A P 1), and APETELA2 (A P 2), and those acting later duri n g H e re we describe the isolation of the E T T gene and its the pat t e rning of organ identity such as A P E T E L A 3 (A P 3) , ex p ression pat t e rn during early flo ral development. E T T P I S T I L L ATA (P I) and AG A M O U S (AG) (We i gel and encodes a protein that is predicted to be nu clear localized and M eye rowitz, 1994). Mutations in these genes affect the flora l is homologous to DNA binding proteins wh i ch bind to auxin ve rsus inflo resence identity of flo ral shoots and/or the identity response elements (AREs). E T T m R NA is detected in a of the individual flo ral organs. Most of these genes are thought c o m p l ex pat t e rn throughout early flower development and is to encode tra n s c ription fa c t o rs (We i gel, 1995; Ya n o f s ky, consistent with the proposed role for E T T in pat t e rning: (i) 1995). p e rianth organ nu m b e r, and (ii) stamen and carpel fo rm. Early There are a number of other mutations which affect organ E T T ex p ression in the gynoecium suggests that the pro t e i n number, organ shape and regional differentiation within floral p a rt i c i p ates in the pat t e rning of abaxial tissues and the estab- organs without changes in the identity of either the floral shoot lishment of apical and basal boundaries in the pri m o rd i u m . or its component organs. For example, mutations in CLAVATA1 I n t e re s t i n g ly, the tra n s c riptional activation of E T T is inde- (CLV1), CLAVATA3 (CLV3), ETTIN (ETT), and PERIANTHIA pendent of known meristem and organ identity functions. (PAN) increase organ number within the flower, whereas L a s t ly, genetic analyses indicate that E T T functions indep e n- mutations in TOUSLED (TSL) decrease organ number and d e n t ly of C LV and re d u n d a n t ly with PA N to control flo ra l organ size (Clark et al., 1993, 1995, and 1997; Roe et al, 1993 o rgan nu m b e r. 4482 A. Sessions and others

MATERIALS AND METHODS WsO ecotype. With the exception of lfy-1 and ag-5 which are in the Columbia (ColO) ecotype, the remaining mutant alleles (ap1-1, ap2- Plant material 2, pi-1, ap3-1, ag-1, clv1-1, clv3-1) are in LaO. Control outcrosses of ett alleles and plant growth conditions were similar to those described ett-1 identified ecotype specific suppressors of ett-1 in ColO and LaO, by Sessions and Zambryski (1995). ag-5 was isolated and provided which segregate as single recessive loci in F2 outcross populations: by Eva Huala (Roe et al., 1997). All other mutant alleles were 25% of F2 ett-1 plants have a suppressed gynoecium phenotype, obtained from the laboratory of Elliot Meyerowitz (California allowing more valve formation and some seed set. The loci imparting Institute of Technology). suppression of ett-1 in LaO and ColO have not been mapped. In F2 Scanning electron microscopy (SEM) double mutant populations these suppressor loci segregated indepen- dently of ett-1 and all other mutations with the exception of lfy-1 and Fixation, drying and viewing are the same as Sessions (1997). pi-1, which both reside on chromosome 5. Suppressed phenotypes in Identification and isolation of the ETT gene double mutant populations were distinct and additive, and were not Plasmids, strains and cloning details, as well as data not shown are scored in the phenotypic analyses presented. available upon request. ETT was isolated using the ett-1 allele. ett-1 was ett-1 was crossed as a male onto the different homozygous identified in a large screen of T-DNA mutagenized seed (#7581; mutants. Individuals doubly homozygous for ett-1 and the other Feldmann, 1991; Azpiroz-Leehan and Feldmann, 1997) and shown by mutation of interest were identified in five different ways: (i) as a Southern analysis with T-DNA border-specific probes to contain a single new/additive phenotype segregating 1/16 in F2 populations (ap2-2 T-DNA insert encoding kanamyacin resistance. The ett mutant ett-1, ap3-1 ett-1, ett-1 pi-1, ett-1 pan-1); (ii) by Southern analysis phenotype was completely linked to the T-DNA and kanamyacin resis- of individual F2 mutants to detect ett-1 specific T-DNA induced RFLPs (ett-1 lfy-1, ag-1 ett-1, ag-5 ett-1); (iii) in F3 populations from tance (0 recombinants in 50 homozygous ett-1/ett-1 plants) in F2 backcross populations. Left border plasmid rescue of the ett-1 T-DNA F2 suppressed ett-1 individuals that were heterozygous for the other border generated a plant specific 0.4 kb StyI/EcoRI fragment that was mutation of interest (ett-1 lfy-1, ag-1 ett-1); (iv) in F3 populations used to screen a Wassilewskija (WsO) lambda genomic library (Roe et from F2 mutants that were heterozygous for ett-1 (ap1-1 ett-1, clv1- al., 1993). Five clones spanning 25 kb were isolated. Southern analysis 1 ett-1, clv3-1 ett-1, ett-1 pan-1); and (v) by testcrosses (ett-1 pan- mapped the 0.4 kb StyI/EcoRI border fragment to the center of the 12 1). The ap1-1 enhancing cauliflower-1 (cal-1) mutation resident in kb clone ASL2. Clone ASL2 was inserted into transformation vector WsO (Bowman, 1993) was not present in the families segregating for pSLJ6991 (Jones et al., 1992) as a SacI fragment and introduced directly ap1-1 ett-1 used here. into a suppressed ett-1 line (see below) by vacuum mediated transfor- mation. ASL2 rescued the ett-1 phenotype and subsequently rescued ett- 2 and ett-3 in crosses, demonstrating that ETT resides within ASL2. Two RESULTS overlapping fragments from ASL2, one spanning the predicted insertion site in ett-1, were used to screen a Landsberg erecta (LaO) floral and infloresence specific lambda ZAP cDNA library (Weigel et al., 1992). ett phenotypes The longest (2.1 kb) of three similar clones, designated number 5, was Wild-type Arabidopsis flowers are composed of four sepals, purified as a pBluescript plasmid (pAS13), and sequenced in full four petals, six stamens and a bicarpelate gynoecium (Fig. 1A). (GenBank accession no. AF007788). cDNA 5 was used in northern ett mutations only affect the flower, and are pleiotropic: sepal analysis to show the presence of a 2.3 kb transcript in wild-type, ett-2, and petal number are increased (Fig. 1B), stamen number and and ett-3 infloresence tips which was absent in ett-1. Sequencing primers anther form are decreased (Fig. 1D,E), and the proper differ- derived from the cDNA 5 sequence were used to initiate sequencing of entiation of gynoecial tissues is significantly altered (Fig. 1G- the complete 4.5 kb coding region of ETT genomic DNA from ASL2, corresponding to 300 nucleotides upstream of the predicted transcription K; Sessions and Zambryski, 1995; Sessions, 1997). ett associ- start to 100 bp after the predicted translation stop. Alignment of the ated decreases in stamen number are correlated with aberrant cDNA 5 sequence with ASL2 sequence suggests that the translation start or failed initation of medial stamen primordia (Sessions, 1997), site lies 77 bp downstream of the 5′ end of cDNA 5. The transcription whereas the anther defects include a failure in the formation of start site is predicted to lie 341 bp upstream of the predicted translation the interthecal furrow which is often partially formed or start site based on RACE and primer extension analysis. The insertion missing on the anthers of ett medial stamen (Fig. 1C-E). The sight of the left border of the T-DNA in ett-1 was determined by sequenc- anatomy of tissues and vascular bundles is normal in ett sepals, ing the left border rescue plasmid. 4.0 kb of ett-2, ett-3 and ett-4 covering petals and stamens (not shown). the complete genomic region was amplified in two fragments by PCR ett gynoecium phenotypes are allele-strength dependent and (Hi Fidelity PCR Kit, Boehringer Mannheim), sequenced in full, and involve the aberrant development of tissues in place of the lesions found in fragments cloned from two independent PCR reactions listed in Fig. 2. ett-2 was recovered from T-DNA mutagenized WsO seed ovary. Phenotypes for each allele vary. Wild-type gynoecia (#1537); ett-3 and ett-4 were isolated from ethylmethane sulfonate consist of a stigma-and-style-capped bilocular ovary on an un- (EMS)-treated LaO seed and kindly provided by David Smyth and John elongated internode. The ovary is the largest region of the wild- Alvarez (Monash University). type gynoecium and is composed abaxially of 2 valves laterally and 2 furrows medially. The phenotypes of ett-2, ett-3 and ett- In situ hybridization 1 gynoecia form a continuum of decreasing ETT function in In situ hybridization using digoxigenin-labeled probes and alkaline which valve tissue is removed basally (Fig. 1G-K). Lost valve phosphatase detection was performed according to the method of is replaced basally by structures intermediate between abaxial Drews (1995) and according to the manufacturer’s (Boehringer style and internode, and medially (between the valves) by Mannheim) directions. ett-1 plants were used as negative controls. 5′ and 3′ probes were transcribed from pBluescript subclones of pAS13 adaxial style tissue (Fig. 1F-K; Sessions and Zambryski, 1995; (1.6 kb EcoRI (5′), and 0.8 kb BamHI/XbaI (3′). Sessions 1997). These phenotypes have been interpreted as resulting from the basalizing of a hypothetical distal abaxial- Generation and identification of double mutants adaxial boundary, and the raising of a hypothetical proximal Double mutants were made using the null ett-1 allele which is in the valve forming boundary on the gynoecium primordium, in an ETTIN patterning during flower development 4483 allele-strength dependent manner (Sessions, 1997). Unlike the Expression of ETT in infloresence and floral sepals, petals and stamen, vascular patterning and anatomy are meristems altered in ett gynoecia (Sessions and Zambryski, 1995). To determine when and where ETT is expressed during flower development, in situ hybridization was performed on floral Isolation of the ETT gene tissues spanning the 13 developmental stages (Smyth et al., An ETT genomic DNA clone was isolated using the T-DNA 1990). ETT RNA is first detected before stage 1 in the inflo- tagged ett-1 allele, and shown to complement ett-1, ett-2 and resence meristem (IM) in groups of cells which are developing ett-3 (see Materials and Methods). The 2.3 kb ETT transcript as new FMs (floral meristems; Fig. 3A-C). The base of the has the potential to encode a 608 amino acid protein with a expression domain tapers and joins the infloresence axis pro- predicted molecular mass of 66.5 kDa (Fig. 2). The protein cambium (Fig. 3A-C). During stage 2, expression resolves to contains two serine rich regions and a putative bipartite nuclear procambial tissues in the pedicel, and a domain in the future localization signal (NLS; Robbins et al., 1991). Furthermore, receptacle (Fig. 3A-C). This expression appears to mark the the N-terminal half of ETT shows homology with the DNA- sites of vascular differentiation within the floral pedicel and binding domains of the transcription factor ARF1 and the receptacle (Fig. 3C). In addition, a second patch of expression related protein IAA24 (Ulmasov et al., 1997; Kim et al. 1997). is detected towards the apex of stage 2 FMs (‘ii’ in Fig. 3C) and These two proteins have been implicated in mediating this patch ultimately expands to form a thick ring in the terminal responses at auxin-regulated promoters. Moreover, using the meristem (presumptive gynoecium) during stage 5 (Fig. 3D-F). ARF1 sequence, a BAC containing the ETT locus was identi- During stage 3 and 4, expression in the pedicel remains fied in GenBank (U78721); a cDNA isolated with this BAC restricted to the pedicel vasculature in cells that lie between dif- sequence was called ARF3 (Ulmasov et al., 1997). The ferentiating phloem and xylem elements (not shown), and sequence of ETT and ARF3 are identical with the exception of appears to be high in presumptive petal and stamen primordia 5 nucleotides. In addition, an 84 amino acid region beginning (Fig. 3D,E). The expression in the infloresence procambium at position 155 of the ETT protein and containing the NLS is also resolves to cells that lie between differentiating phloem and highly similar to an EST from rice (D40316, 93% identity). The C-terminal half of ETT is unique and of unknown function. Four ett alleles were sequenced and found to contain lesions consistent with the phenotypic severity of each allele (Fig. 2). The strong ett-1 allele has a T-DNA inserted into exon 2 and lacks the wild-type 2.3 kb transcript as determined by northern blot and in situ hybridization analyses (not shown). The weak ett-2 allele has a single bp change that leads to a conservative Arg to Lys substitution at Fig. 1. Wild-type and ett flowers and floral organs. (A) Wild-type flower showing 4 petals (p), six stamens (s) and a bicarpellate gynoecium (g). The four sepals are not seen in this view. (B) ett-1 flower with 5 petals, and amino acid 247, and also a decrease in the number of stamens (stamens not visible). (C-K) SEM images. (C) Adaxial surface of a wild- affects splicing in some type anther showing two pairs of locules separated by the interthecal furrow (arrows); dehiscence occurs ett-2 transcripts (J. N. and between the locules on each thecus. (D,E) Adaxial sides of ett-1 anthers showing a reduction in the P. Z., unpublished). The intrathecal furrow. (F) Abaxial surface of a wild-type gynoecium showing apical stigma (sg), style (st), and improperly spliced tran- basal ovary (o) composed of valves laterally, and placentae medially (not shown), atop a reduced internode script introduces the stop (in). Notice the medial furrow (mf) on the abaxial side of the placenta, between the valves; apical and basal codon contained in intron valve limits are indicated by arrows. (G) Gynoecium of a weak ett-2 homozygote showing basal reduction in 5 resulting in a truncated valve formation (between arrows) and pronounced outgrowth of the medial ovary in stylar tissues (mo). (H) Gynoecium of an intermediate strength ett-3 homozygote showing a mild ett-3 phenotype of valve polypeptide. The interme- ′ diate strength ett-3 and reduction (between arrows) and pronounced medial outgrowths (mo); (in ) internode intermediate between true internode and abaxial style. (I) Gynoecium of an intermediate strength ett-3 homozygote expressing a ett-4 alleles contain strong ett-3 phenotype of more severe valve reduction (between arrows) and more proliferation (*) of adaxial nonsense mutations in style tissue below and between valves; (in′) internode covered primarily in abaxial style tissue. (J) Rare exons 8 and 9, respec- gynoecium of a strong ett-1 individual with a patch of valve tissue (between arrows) bounded apically by tively, downstream of the abaxial style tissue; other abaxial cells as in K. (K) Typical gynoecium from a strong ett-1 homozygote which putative DNA binding lacks valves and is covered apically in adaxial style tissue (*) and basally in abaxial style-like tissue (in′). domain. Scale bar: C,D,E, 80 µm; E,F,G,I,K, 400 µm; H,J, 360 µm. 4484 A. Sessions and others

1 aaaaggtctaaaagccacaccacacacatcagtcaccagacgtagcagagagcctcactgttgcagagagc 72 actcagtactgttctgtttctctgatacctctctctctcctctctcttttaacattgtccaaattaaaaatctaaactttttttctagtt 162 tttttttttctttaatagaaaagtttttttctccacggcttaaagactcactcatcactgtgctactactctctcttcttttggctgaga 252 gggtaaaagtcatgaagaaactcctctgagttttttttctttctttcttataataaagctcttatctttatctctgtttctctctcctta M G G L I D L N V M E T E E D E T Q T Q T P S S A S G S V S 30 342 ATGGGTGGTTTAATCGATCTGAACGTGATGGAGACGGAGGAAGACGAAACGCAAACGCAAACACCGTCTTCAGCTTCTGGGTCTGTCTCT P T S S S S A S V S V V S S N S A G G G V C L E L W H A C A 60 432 CCTACTTCGTCTTCTTCAGCTTCTGTGTCTGTGGTGTCTTCGAATTCTGCTGGTGGAGGGGTTTGTTTGGAGCTGTGGCATGCTTGTGCT G P L I S L P K R G S L V L Y F P Q G H L E Q A P D F S A A 90 522 GGACCCCTTATCTCTCTACCAAAAAGAGGAAGCCTTGTGTTGTATTTCCCTCAGGGACATTTGGAACAAGCCCCCGATTTCTCCGCCGCG I Y G L P P H V F C R I L D V K L H A E T T T D E V Y A Q V 120 612 ATTTACGGGCTCCCTCCTCACGTGTTCTGTCGTATTCTCGATGTTAAGCTTCACGCAGAGACGACTACAGATGAAGTTTATGCTCAAGTC ett-1 S L L P E S E D I E R K V R E G I I D V D G G E E D Y E V L 150 702 TCTCTTCTTCCTGAGTCAGAGGACATTGAGAGGAAGGTGCGTGAAGGAATTATAGATGTTGATGGTGGAGAGGAAGATTATGAAGTGCTT Fig. 2. Nucleotide and predicted K R S N T P H M F C K T L T A S D T S T H G G F S V P R R A 180 amino acid sequence of ETT 792 AAGAGGTCTAATACTCCTCACATGTTTTGCAAAACCCTTACTGCTTCTGATACAAGCACCCATGGTGGTTTCTCTGTTCCTCGCCGAGCT transcript. A composite sequence A E D C F P P L D Y S Q P R P S Q E L L A R D L H G L E W R 210 representing the LaO ETT protein and 882 GCTGAGGATTGCTTCCCTCCTCTGGACTATAGCCAGCCCCGGCCTTCTCAGGAGCTTCTTGCTAGGGATCTTCATGGCCTGGAGTGGCGA transcript derived from genomic and F R H I Y R G Q P R R H L L T T G W S A F V N K K K L V S G 240 cDNA sequence information. The dark 972 TTTCGCCACATTTATCGAGGGCAACCTAGGAGGCATTTGCTCACTACCGGGTGGAGTGCGTTTGTGAACAAGAAGAAGCTTGTCTCTGGT grey boxes indicate serine-rich D A V L F L R G D D G K L R L G V R R A S Q I E G T A A L S 270 1062 GATGCTGTGCTTTTCCTTAGAGGAGATGATGGCAAACTGCGACTGGGAGTTAGAAGAGCTTCTCAAATCGAAGGCACCGCTGCTCTCTCG regions; the light grey box indicates, A ett-2 A Q Y N Q N M N H N N F S E V A H A I S T H S V F S I S Y N 300 the putative bipartite nuclear 1152 GCTCAATATAATCAGAATATGAACCACAACAATTTCTCTGAAGTAGCTCATGCCATATCGACCCATAGCGTTTTCAGCATTTCCTACAAC localization signa. Closed triangles P K A S W S N F I I P A P K F L K V V D Y P F C I G M R F K 330 represent the positions of introns, and 1242 CCCAAGGCAAGCTGGTCAAACTTCATAATCCCTGCACCAAAGTTCTTGAAGGTTGTTGACTATCCCTTTTGCATTGGGATGAGATTTAAA the open triangle represents the A R V E S E D A S E R R S P G I I S G I S D L D P I R W P G 360 position of the T-DNA insert in exon 2 1332 GCGAGGGTTGAATCTGAAGATGCATCTGAGAGAAGATCCCCTGGGATTATAAGTGGTATCAGCGACTTGGATCCAATCAGGTGGCCTGGT of the ett-1 allele. The mutations S K W R C L L V R W D D I V A N G H Q Q R V S P W E I E P S 390 found in the ett-2, ett-3 and ett-4 1422 TCAAAATGGAGATGCCTTTTGGTAAGGTGGGACGACATTGTGGCAAATGGGCATCAACAGCGTGTCTCGCCATGGGAGATCGAACCATCT A ett-3 A ett-4 alleles are indicated below the wild- G S I S N S G S F V T T G P K R S R I G F S S G K P D I P V 420 type sequence. ett-3 and ett-4 are from 1512 GGTTCCATCTCCAATTCAGGCAGCTTCGTAACAACTGGTCCCAAGAGAAGCAGGATTGGCTTTTCCTCAGGAAAGCCTGATATCCCTGTC EMS mutagenized lines and contain S E G I C A T D F E E S L R F Q R V L Q G Q E I F P G F I N 450 nonsense mutations from guanine to 1602 TCTGAGGGGATTTGCGCCACAGACTTTGAGGAATCATTGAGATTCCAGAGGGTCTTGCAAGGTCAAGAAATTTTTCCGGGTTTTATCAAC T C S D G G A G A R R G R F K G T E F G D S Y G F H K V L Q 480 adenine changes. The domain shared 1692 ACTTGTTCGGATGGTGGAGCCGGTGCCAGGAGAGGCCGCTTCAAAGGAACAGAATTTGGTGACTCTTATGGTTTCCATAAGGTCTTGCAA by ETT with ARE-binding proteins G Q E T V P A Y S I T D H R Q Q H G L S Q R N I W C G P F Q 510 ARF1 and IAA24 includes amino 1782 GGTCAAGAAACAGTTCCCGCCTACTCAATAACCGATCATCGGCAGCAGCACGGGTTGAGCCAGAGGAACATTTGGTGTGGGCCGTTCCAG acids 52 through 391 (Ulmasov et al., N F S T R I L P P S V S S S P S S V L L T N S N S P N G R L 540 1997; Kim et al., in press). The 1872 AACTTTAGTACACGTATCCTCCCCCCATCTGTATCATCATCACCCTCTTCCGTCTTGCTTACCAACTCGAACAGTCCTAACGGACGTCTG longest cDNA clone begins at nt 265. E D H H G G S G R C R L F G F P L T D E T T A V A S A T A V 570 The first nucleotide represents the 1962 GAAGACCATCACGGAGGTTCAGGTAGATGCAGGCTGTTTGGTTTCCCATTAACCGACGAAACCACAGCAGTTGCATCTGCGACGGCTGTC presumed start of transcription P C V E G N S M K G A S A V Q S N H H H S Q G R D I Y A M R 600 deduced from primer extension and 2052 CCCTGCGTTGAAGGGAATTCCATGAAAGGTGCGTCAGCTGTTCAAAGCAATCATCATCATTCGCAAGGAAGGGACATCTATGCAATGAGA RACE analyses. Numbers on left are D M L L D I A L 608 2142 GACATGTTGCTAGACATTGCTCTCtagaagggttctttggtttctgtgttttatttgcttgtggcttaagtaaagttcttattttagttg nucleotides, and amino acids on the 2232 atgatgacttgctgctaacttttggaatgtcacaagttgtgacttatgagagacttgtaaacttggttcaagaatgttctgtgttaggtt right. 2322 caatttaaaaagtgtttgcatcaattccggtt xylem elements (Fig. 3L). These results demonstrate that ETT marks the abaxial-adaxial boundary of the gynoecium pri- is expressed in a complex pattern throughout early floral mordium before it emerges from the FM (Fig. 3F,G). Expression meristem formation and floral organ initiation. from stages 5-8 is strictly in the abaxial cells of the gynoecium primordium (Fig. 3F-I). This expression is refined during stage Expression of ETT in floral organs 9 to cells within the four differentiating vascular strands that lie ETT RNA is not detected in sepal primordia (Figs. 3D-H). ETT between phloem and xylem elements (Fig. 3J,K; not shown). transcript is detected throughout petal primordia during stages This vasculature expression persists until stage 12 (not shown). 4-6, and becomes restricted to procambial cells during stages 7 and 8, and ceases by stage 9 (Fig. 3F,K). During stage 5, Relationship of ETT to meristem identity functions stamen primordia arise between the receptacle and gynoecium In wild-type plants the IM initiates lateral shoot meristems rings of expression, and show abaxial expression of ETT tran- which normally develop as FMs. In meristem identity mutants script from inception until stage 7 (Fig. 3F,G,H). During stages lateral shoots assume a mixture of floral and infloresence 7-9, ETT transcript is detected in the stamen vasculature and meristem characters. To determine if any of these genes in four bands of cells within each anther: two adaxial stripes functions as an upstream regulator of ETT expression, double near the interthecal furrow and two abaxial stripes between the mutant analyses and expression studies were performed. locules and the vasculature (Fig. 3H,J,K). Stamen vascular expression ceases during stage 9, before morphological differ- LFY entiation of cell types within the bundles is visible. LFY is thought to be one of the earliest acting genes in the floral Similar to stamen primordia, the gynoecium shows abaxial meristem identity program because of loss-of-function pheno- expression of ETT at inception (Fig. 3F,G). The inner (adaxial) types which convert lateral floral shoots toward an infloresence edge of the ring of ETT expression in the terminal meristem identity (Huala and Sussex, 1992; Weigel et al., 1992). Usually ETTIN patterning during flower development 4485 only the late initiated, most apical lateral shoots on strong lfy and ap1 infloresence characteristics by ap2 alleles (Irish and mutants resemble normal flowers, and even these lack petals Sussex, 1990; Huala and Sussex, 1992; Bowman et al., 1993; and stamens (Fig. 4A; Huala and Sussex, 1992; Weigel and Okamuro et al., 1997). Strong mutations in AP2 such as ap2- Meyerowitz, 1992). ett-1 lfy-1 plants differ from lfy-1 plants 2, result in the development of medial w1 carpels in place of only in the terminal gynoecia of late initiated lateral shoots, sepals, the absence of w2 petals, loss of w3 stamens, and occa- which express the ett phenotype (Fig. 4B). Thus, lfy-1 is largely sionally unfused w4 carpels (Fig. 4G; Bowman et al., 1991). epistatic to ett-1 except in the most floral like shoots, suggest- ap2-2 is largely epistatic to ett-1 in w1-w3 of ap2-2 ett-1 ing that ETT is not active early in the development of lfy-1 flowers (Fig. 4H). ett-1 does not affect organ number in w1 of infloresences and lateral shoots. ETT expression however, is ap2-2 flowers, but does affect development of w1 carpel largely normal in a lfy-1 mutant indicating that LFY is not margins (Fig. 4I-J). ap2-2 w1 medial carpels generally have required for the early transcriptional activation of ETT in the central valve tissue bounded laterally by a marginal flap of IM and in lateral meristems (Fig. 4C). Thus some aspect of the medial ovary and stigmatic tissue, and a transmitting tract- post-transcriptional function of ETT is dependent on LFY. covered submarginal placenta (Fig. 4I). ap2-2 ett-1 w1 medial carpels lack the marginal flaps, and valve tissue abuts the trans- AP1 mitting tract-covered submarginal placenta (Fig. 4J). AP1 appears to function in concert with LFY in the control of ap2-2 ett-1 double mutants suggest that although ETT is not FM identity (Bowman et al., 1993; Mandel and Yanofsky, 1995; active in determining organ number in ap2-2, it is required in Weigel and Nilsson, 1995). ap1 mutations cause the basal nodes patterning differentiation within the margins of w1 ap2-2 of lateral shoots to have infloresence-like identity, leading to the carpels (Table 1; Fig. 4J). The normal valve development in formation of bracts and secondary floral shoots where sepals and ap2-2 ett-1 w1 medial carpels suggests ETT is not needed for petals would normally develop (Fig. 4D). ap1-1 ett-1 lateral the development of valve tissue per se, and that its role in shoots have w1 and w2 phenotypes that are identical to those of normal w4 gynoecium development is probably to position ap1-1, and w3 and w4 phenotypes which are identical to those where valve cell types will form. AP2 does not appear to be of ett-1 (Fig. 4E). ap1-1 is epistatic to ett-1 in that no more than involved in the early transcriptional activation of ETT, since four w1 organs are initiated in ap1-1 ett-1 lateral shoots (not expression is normal in ap2-2 meristems (Fig. 4K). While ETT shown). Although it sometimes may appear that five w1 green is not normally expressed in w1 sepals, in ap2-2 ETT RNA bract-like organs are present in mature ap1-1 and ap1-1 ett-1 appears in the abaxial layers of w1 carpel primordia, suggest- flowers (Figs. 4D, E), the extra organ develops from the positions ing that AP2 is somehow involved in repression of ETT of w2 petal primordia (Bowman et al., 1993). ETT thus appears expression in w1 (Fig. 4L). It is unclear why ETT is transcribed to not be functioning in w1/w2 of ap1-1 lateral shoots. Similar in the abaxial layers of the valve regions of w1 ap2-2 carpels to the case with lfy-1, ETT expression appears largely normal in when it only seems to be functioning in the margins. ap1-1 IMs and FMs (Fig. 4F), suggesting that AP1 is required at the posttranscriptional level for ETT activity. Relationship of ETT to organ identity gene function Since LFY, AP1 and CAL, have been shown to be partially Organ identity genes have been typed into a, b and c classes redundant coregulators of meristem identity, expression of ETT (Bowman et al., 1991). We examined the potential interaction was assayed in ap1-1 lfy-1 and ap1-1 cal-1 double mutants. of ETT with members of each class genetically and by in situ ETT expression in lateral meristems occurs in both double hybridization. mutants, supporting the conclusion that ETT transcriptional activation occurs independently of meristem identity genes ‘a’ class (Fig. 4M; not shown). AP1 and AP2, in addition to being classified as meristem identity genes, are also considered ‘a’ class organ identity genes. As AP2 described above, the organ identity functions of AP1 and AP2 AP2 is defined as a meristem identity gene due to secondary appear to act independently of ETT, since ett-1 does not affect flower production in ap2-1 flowers, and the enhancement of lfy organ identity in ap1 and ap2 mutants (Fig. 4E,H; Table 1).

Table 1. Flower organ number in single and double mutants Mutant w1 w2 w3 (w4)* flowers/plants ap2-2 2.0 (0.0)/1.6 (0.6)1 − 1.0(0.9)2 45/3 ap2-2 ett-1 2.0 (0.2)/1.4 (0.7)1 − 1.3 (1.1)2 75/5 ap3-1 4.0 (0.0) 4.0 (0.1) 5.6 (0.6) 0.0 (0.0)3 124/7 ap3-1 ett-1 4.8 (0.7) 4.4 (0.6) 3.8 (1.5) 1.2 (1.2)3 177/10 ag-1 4.0 (0.0) 10.1 (0.4)4 − 3.8 (0.4)5 52/4 ag-1 ett-1 4.1 (4.1) 11.0 (1.4)4 − 3.9 (0.5)5 88/6 clv3-1 4.5 (0.6) 4.5 (0.6) 6.2 (1.1) 0.6 (0.9)6 75/3 clv3-1 ett-1 5.7 (0.6) 5.3 (0.7) 3.4 (2.2) 4.4 (2.1)6 75/3 pan-1 5.6 (0.6) 5.1 (0.7) 5.4 (0.4) 80/8 pan-1 ett-1 4.1 (1.3) 7.6 (1.6) 3.0 (1.3) 80/8

Standard deviations are given in parentheses. Superscripts indicate organ type as follows: 1medial organs/lateral organs; 2w2 versus w3 distinctions between stamens was not possible; 3w3 white club- shaped organs; 4w2 and w3 petals not distinguished; 5w4 sepal/petal mosaic organs; 6w3 staminodes. *w3 or w4 organ type as indicated by superscript. 4486 A. Sessions and others

‘b’ class (Fig. 5E,F; Hill and Lord, 1989). pi-1 w3 organs can be either ‘b’ class genes are represented by AP3 and PI, mutations in free from or fused to the central w4 carpels (Fig. 5E,F; Hill which lead to the replacement of petals by sepals and stamens and Lord, 1989). ett-1 pi-1 flowers have an additive by carpels. Flowers from plants homozygous for the weak ap3- phenotype of 5-6 sepals in each of w1 and w2 and ett-like 1 allele have sepals in w2 and carpeloid stamens in w3 (Fig. carpels which lack valve tissues in w3 and w4 (Fig. 5G,H). 5A,B; Bowman et al., 1989). Carpeloid stamens in ap3-1 The additive phenotypes of ett-1 -’b’ class double mutants flowers have a variable phenotype but are generally mosaics in suggest that ETT functions independently of ‘b’ functions which individual anther locules develop with carpeloid during normal petal and stamen development. Additionally, features, most noticeably placentae (Bowman et al., 1989; Fig. we have found that ett-1 shows additive interactions with 5B). ap3-1 ett-1 flowers have a largely additive phenotype of mutations in genes whose wild-type products regulate ‘b’ 5 to 6 sepals in each of w1 and w2, w3 organs showing reduced function activities, including unusual floral organs (ufo)-2, locule formation and generally lacking all placental features, and superman (sup)-1, further suggesting independence of and a w4 ett gynoecium (Table 1; Fig. 5C,D). Most notable of ETT and ‘b’ function activity (not shown; Bowman et al., ap3-1 ett-1 flowers is the development in w3 of anther locule- 1992; Levin and Meyerowitz, 1995). lacking club shaped organs covered in anther-like tissue (Table 1; Fig. 5C,D). This phenotype can also be interpreted as ‘c’ class additive since both ap3-1 and ett-1 diminish locule formation. AG is the only identified ‘c’ class gene in Arabidopsis. ag Flowers from plants homozygous for the strong pi-1 allele mutations cause the development of petals and sepals in place have sepals in w1 and w2 and carpeloid organs in w3 and w4 of w3 stamens and w4 carpels (Fig. 5I; Bowman et al., 1989).

Fig. 3. In situ hybridization detection of ETT expression in WsO IMs, FMs, and floral organs. Signal is indicated by blue color. Numbers indicate developmental stage (Smyth et al., 1990). (A) Cross section through top of IM (I) and young FMs. Expression is detected in clusters of cells that will grow out as FMs. (B) Serial section 28 µm below that in A showing the tapered bases of ETT expression that join the procambium of the infloresence axis. Notice pedicel expression in the procambium of the late stage 2 FM at top (arrows), and expression throughout stage 1 and early stage FMs. Notice early stage 2 FM in lower left showing broader expression at the apical regions of the FM (receptacle region). Line indicates plane of section shown in C. (C) Longitudinal section through the flank of the IM, indicated by a line in B, showing cone-like expression in stage 1 and 2 FMs, and pedicel procambial (arrows) and receptacle expression in stage 2 FMs. The second patch of expression that gives rise to the gynoecium is indicated (ii). (D) Oblique longitudinal section through a stage 4 FM showing reticulate expression in traces leading to the presumptive incipient petals (p) and medial stamens (s), but not the sepals (arrows). Expression in the second domain (ii) has expanded. (E) Medial longitudinal section through a stage 4 FM, showing absence of expression in the sepals (arrows), abaxial expression in the incipient medial stamen primordia (s), and in the gynoecium primordium (g). (F) Oblique section through a stage 6 FM showing expression in petal (p), stamen (s) and the gynoecium (g) primordium. Notice abaxial expression in the stamens and gynoecium. (G) Cross section through a stage 6 FM showing abaxial expression of ETT in medial stamen primordia and the gynoecium primordium. Notice absence of expression in sepals. (H) Cross section through a stage 8 bud showing expression in the stamens in the procambial strand (v) and in 4 patches of cells (arrows) bordering each locule. Expression in the gynoecium (g) primordium is abaxial. (I) Medial longitudinal section through a stage 8 gynoecium showing abaxial expression of ETT transcript. (J) Cross section through late stage 8 bud showing reduction in expression in stamens and the gynoecium except for in the procambial strands (arrows). (K) Cross section through the base of a bud similar to that in J, showing expression in procambial strands of petals (p), stamens (ls and ms), and the gynoecium (g). (L) Cross section through the infloresence axis 300 µm below the top of the IM showing expression in vascular strands between differentiating phloem (ph) and xylem (x) elements. Scale bar: A,B, 35 µm; C, 25 µm; D, 16 µm; E, 18 µm; F, 30 µm; G, 30 µm; H, 36 µm; I, 30 µm; J, 36 µm; K, 40 µm; L, 10 µm. ETTIN patterning during flower development 4487

Additionally ag flowers are indeterminate and continue initiat- carpels and pan mutants have increases in carpel number ing organs inside the w4 sepals in the whorl-type pattern (petals, (Running and Meyerowitz, 1996). pan-1 mutant FMs develop petals, sepals)n (Fig. 5I). Strong mutations in AG, such as ag-1, similarly to ett-1 mutants in the increase in adaxial sepal and are epistatic to ett-1 in w3 and w4 (Table 1; Fig. 5J). Weaker petal number and loss of stamen primordia (Fig. 6E,F,H,I,K,L). alleles of ag, such as ag-5, lead to less severe organ identity pan gynoecium development is similar to wild-type with the transformations (Roe et al., 1997) and are enhanced by ett-1 exception of early trumpet-like as opposed to cylindrical (Fig. 5K, L). Whereas ag-1 ett-1 flowers suggest that ETT is not growth of the gynoecium primordium (Running and active in ag-1, ag-5 ett-1 flowers indicate that ETT is necessary Meyerowitz, 1996). for full AG activity. In situ hybridization suggests that AG plays no role in the transcriptional regu- lation of ETT (Fig. 5M-O). Surprisingly, ETT shows normal abaxial expression in ag-1 w3 and w4 organs from inception, as well as abaxial expression in subsequently initiated organs (Fig. 5M-O). The abaxial expression of ETT in ag-1 w3-w6 primordia supports the view that ag-1 affects organ identity after initiation of normal primordia (Crone and Lord, 1994). In particular, ag-1 w4 primordia which will develop as sepals, express ETT abaxially, similar to carpel primordia, and not sepal primordia, which normally lack ETT expression at inception. Relationship of ETT function to the organ number control genes CLV and PAN

CLV CLV1 and CLV3 are proposed to function together to promote differentiation of cells in shoot meristems (Clark et al., 1993, 1995, 1997). Mutations in either gene lead to increases in meristem size, and to increases in organ number in all floral whorls (Fig. 6A; Table 1). clv1-1 and clv3-1 each act additively in double mutant com- bination with ett-1 (Fig. 6B; Table 1; not shown for clv1-1 ett-1). clv3-1 ett-1 flowers had slight increases in organ number in each whorl compared to single mutants (Table 1). Stamens and carpels in both double mutants show ett-1- like alterations in regional differentiation of cell types. Notably, clv3-1 ett-1 flowers show a syner- gistic increase in the number of w3 staminodes (reduced stamen), suggesting an interactive role for CLV and ETT in the promotion of stamen Fig. 4. Relationship of ETT to meristem identity gene function. (A,B,G-J) SEM development (Table 1; Fig. 6B). The indetermi- images. (C,F,K,L,M) In situ hybridization detection of ETT transcript, signal is blue. (A) lfy-1 mutant flower showing carpel-sepal mosaic organs in place of petals and nacy caused by clv mutations (Clark et al., 1993, stamens, and an almost normal gynoecium. (B) ett-1 lfy-1 flower showing sepal-carpel 1995) which is normally contained within the w4 mosaic organs surrounding an ett gynoecium (*). (C) ETT transcript is detected in the gynoecium is exposed in clv3-1 ett-1 flowers due infloresence shoot axis and lateral meristems of lfy-1 plants (arrows). (D) ap1-1 flower to the splitting of the style and stigma caused by showing w1 bracts (b) and secondary flowers (sf). (E) ap1-1 ett-1 flower similar to that ett-1 (Fig. 6B). in D except that it has an ett gynoecium. (F) ETT transcript is detected in the infloresence shoot axis (i) and lateral meristems (lm) of ap1-1 plants. (G) ap2-2 flower PAN showing w1 carpels (arrows), an absence of petals, and a reduced number of stamen. PAN is thought to function to promote bilateral (H) ap2-2 ett-1 flower showing w1 carpels (arrows) and an ett gynoecium (*). The w1 symmetry within the floral meristem (Running carpels in this image are fused to neighboring stamens (common in ap2-2 single and Meyerowitz, 1996). pan mutations change mutants). (I) Close up of ap2-2 w1 carpel margin showing the marginal flap (m) and the submarginal placenta (sm). (J) Close up of ap2-2 ett-1 w1 carpel showing the fused FM symmetry from bilateral to radial, which, like marginal structure (arrow). (K) ETT transcript is detected in the infloresence shoot axis ett mutations, increase sepal and petal number, (i) and lateral meristems (lm) of ap2-2 plants, and in the abaxial layers (arrows) of w1 and decreases stamen number (Fig. 6C). ett and primordia in ap2-2 stage 3 FMs (L). (M) ETT transcript is detected in the lateral pan mutants differ in gynoecium defects: ett meristems of ap1-1 lfy-1 infloresence shoots. Scale bar: A, 420 µm; B, 450 µm; C, 70 mutants have tissue patterning defects within µm; F, 50 µm; G,H, 1 mm; I, 330 µm; J, 330 µm; K, 45 µm; L, 46 µm; M, 60 µm. 4488 A. Sessions and others

Fig. 5. Relationship of ETT to organ identity gene function. (B,D,E-H) SEM images; (M-O) In situ hybridization detection of ETT transcript, signal is blue. (A) ap3-1 flower showing w1 sepals (se), w2 sepals (se′), and w3 carpeloid stamens (s′). (B) Adaxial surface of a typical ap3-1 w3 carpeloid stamen showing split anther (a) and carpel (c) identity. (C) ap3-1 ett-1 flower showing w1 and w2 sepals, w3 club shaped organs (arrow) and an ett gynoecium (*). (D) Abaxial surfaces of ap3-1 ett-1 club-shaped organs and reduced anthers. (E) pi-1 flower with w1 and w2 organs removed. w3 organs (3) are filamentous and carpeloid and not fused to the central gynoecium. (F) Dissected pi-1 flower showing the congenital fusion of w3 carpeloid organs (3) to the central gynoecium. (G) Dissected ett-1 pi-1 flower showing three-lobed central gynoecium lacking valves, but covered in stigmatic and internode tissue. The organ at left (2) is sepaloid and from w2. (H) Dissected ett-1 pi-1 flower showing a three lobed central gynoecium lacking valves and covered in transmitting tract tissue. Notice w3 organ (3) covered in the same cell-types. (I) ag-1 flower showing petals and sepals in place of stamens and carpels, and an indeterminate reiterating phenotype. (J) ag-1 ett-1 flower identical to that in I except bearing 5 organs in each of w1 and w2. (K) ag-5 flower showing w3 stamenoid petals and w4 carpeloid sepals. (L) ag-5 ett-1 flower showing enhanced ag phenotype similar to the strong ag-1 allele. (M) Expression of ETT transcript in a stage 5 ag-1 FM is similar to normal. (N) Expression of ETT transcript in stage 6 FMs is also normal. Numbers indicate whorls. (O) Expression of ETT in primordia initiated above w3 and w4 also show abaxial expression. Scale bar: B, 180 µm; D, 150 µm; E, 400 µm; F, 300 µm; G,H, 360 µm; M,N, 33 µm; O, 45 µm.

ett-1 pan-1 double mutants show synergistic phenotypes, the function redundantly in the within-a-whorl spacing of sepal most dramatic of which is a loss in the proper spacing and an and petal primordia, the initiation of stamen primordia, as well increase in the number of petal primordia within w2 (Fig. 6D; as placental development within the gynoecium. ETT tran- Table 1). Flower development in ett-1 pan -1 double mutants scription in pan FMs and IMs is normal (not shown). diverges from that of ett-1 and pan-1 single mutants at stage 3 when the sepal primordia initiate (Fig. 6G). Fewer sepal primordia initiate in ett-1 pan-1 FMs. These sepals are variably DISCUSSION clustered on one side of the FM (Fig. 6G). Aberrant sepal initiation is followed by dramatic proliferation of the remaining Based on ett mutant phenotypes and the expression pattern of FM (Fig. 6G). This proliferation is followed by the initiation ETT transcripts we propose that ETT has a dynamic role in pat- of multiple petal primordia, a diminished number of stamen terning development in groups of cells within floral meristems primordia and a trumpet-shaped gynoecium primordium (Fig. and reproductive organs. In early patterning, ETT functions in 6J, M). Development of sepals, stamens and the gynoecium is determining the number of organ primordia, whereas later it is also synergistically impaired in ett-1 pan-1 double mutants: involved in the outgrowth of and patterning of tissues within sepal and stamen primordia often grow into narrow reduced organ primordia. Mechanistically, how the ETT gene product organs, and the gynoecium usually lacks ovules and appears achieves this is unclear, though it is likely to function as a tran- like a reduced ett-1 gynoecium (not shown). scription factor. The homology of ETT with the ARE-binding The enhancement of ett-1 and pan phenotypes in double proteins ARF1 and IAA24 suggests that ETT may mediate mutant combination, and the similar w1-w3 phenotypes of auxin responses at the promoters of auxin regulated genes individual ett and pan mutants suggest that ETT and PAN (Ulmasov et al., 1997; Kim et al., 1997). ETTIN patterning during flower development 4489

The pleiotropic nature of ett mutants could result either from expression of ETT in w3 must function in part to organize indi- a requirement for ETT at an early stage of development which vidual primordia, since these primordia often fail to initiate in secondarily affects later stages, or from multiple requirements ett mutants (Sessions, 1997). This early expression appears to for ETT functioning throughout flower development. perform a function that requires CLV1 and CLV3, and that can Expression patterns and the dissection of individual whorl functions in double mutant combination indicate that ETT functions at multiple times during flower development and that its activity within each whorl occurs independently of its functioning in other whorls. For example w1/w2 and w3/w4 ETT functions can be separated (ap1-1 ett-1, ag-1 ett-1), and w1/w2/w3 and w4 ETT functions can be separated (ap2-2 ett-1). ETT’s role in patterning The early patterning role of ETT affects the number of sepal and petal primordia. ETT expression in the IM occurs before morphological appearance of the FM and resolves to a pattern by stage 3 which marks the presumptive sites of vascular development and future organ initiation. Expression in the future pedicel and receptacle regions of the FM appears last in cells between differentiating phloem and xylem elements. Defects in the anatomy of ett-1 pedicel vascular bundles, however, have not been detected. The early reticulate expression somehow affects the positioning of the sites of sepal and petal initiation within the FM, and the sites of their vascular bundles within the pedicel and the recep- tacle, without affecting the size of the FM, or the differentiation of cell types within vascular bundles, sepals or petals. It is curious that sepal primordia do not express ETT transcript whereas petal primordia do, since both sepal and petal number are increased in ett mutants. This suggests that ETT functions within the Fig. 6. Relationship of ETT function to the organ number control genes CLV and PAN. All stage 2 FM before sepal and petal panels are SEM images except C and D. (A) Dissected clv3-1 flower showing multicarpelate primordia emergence to repress organ gynoecium, and regular stamens. (B) clv3-1 ett-1 flower showing staminodes (arrows), and the indeterminate meristem (*) emerging through the split style and stigma. (C) pan-1 flower formation, perhaps by a mechanism showing 5 petals and stamens. (D) ett-1 pan-1 flower showing 10 petals and 3 stamens. The related to lateral inhibition. ETT appears reduced gynoecium is not visible. (E) pan-1 IM (i) and young FMs showing extra abaxial to perform this function redundantly with sepal primordia above the normal number of four (arrows). (F) ett-1 IM and young FMs PAN (see below), but independently of the nearly identical to that in E. (G) ett-1 pan-1 IM and young FMs showing absence of sepal action of CLV genes, which act more primordia (arrows) and proliferation of stage 3 FMs (*). (H) Dissected stage 6 pan-1 bud. globally in shoot meristems to promote Sepals have been removed to expose the small petal (arrows), stamen (s) and gynoecium the differentiation of cells. ETT also primordia. (I) Dissected stage 6 ett-1 bud. 4 of 5 sepals have been removed to expose the appears to control primordia number small petal (arrows), stamen (s) and gynoecium (g) primordia; one medial stamen ′ independently of the TSL protein kinase primordium is irregular (s ). (J) ett-1 pan-1 bud similar in age to H and I showing 2 sepal (Roe et al., 1997). primordia, over double the number of petal primordia (arrows), 3 stamen primordia (s) and a gynoecium primordium (g). (K) Dissected stage 8 pan-1 bud. The sepals have been removed The later role of ETT affects the to expose the internal organ primordia. (L) Dissected stage 8 ett-1 bud. Three sepals have initiation of and patterning of tissues been removed to show the inner organ primordia, revealing the small and irregular medial within stamen and carpel primordia. stamen primordia (*). (M) Undissected ett-1 pan-1 bud similar in age to those in K and L, Stamen and carpel primordia express ETT showing numerous petal primordia, no sepal primordia, and a reduced stamen primordium abaxially from inception, and later within (*). Scale bar: A, 1500 µm; B, 800 µm; E,F, 65 µm; G, 33 µm; H, 60 µm; I, 50 µm; J, 60 the developing vascular bundles. Early µm; K, 70 µm; L, 76 µm; M, 80 µm. 4490 A. Sessions and others be compensated for by PAN, to promote the outgrowth of pendently of meristem and organ identity genes. Recent studies normal primordia. CLV1 encodes a putative receptor kinase indicate that LFY and AP1 are necessary and sufficient for which is absent from stamen primordia but is expressed in the flower formation within shoot primordia (Mandel and Yanofsky, center of stage 4 FMs, perhaps overlapping with ETT 1995; Weigel and Nilsson, 1995), and that AG is necessary and expression (Clark et al., 1997). sufficient for the formation of carpels (Mizukami and Ma, Stage 7 stamen primordia additionally express ETT in four 1992), yet ETT transcriptional activation occurs in the absence subepidermal vertical streaks in the anther. This anther of each of these functions. Additionally, loss of pairs of partially expression apparently is essential to position where locule redundant meristem identity functions in ap1-1 lfy-1 and ap1- outgrowth and the interthecal groove will form as these 1 cal-1 plants does not appear to alter the early activation of functions are lost in ett-1. The stamen procambial cells express ETT transcription in incipient and developing lateral meristems. ETT transcript until stage 9, before visible differentiation of This argues that other unidentified factors besides the known vascular cell types, although similar to the petals, stamen vas- meristem and organ identity genes are involved in the tran- culature appears unaffected in ett mutants. That petal and scriptional regulation governing flower development. stamen vasculature is normal in ett mutants suggests that ETT While expression studies demonstrate that ETT is expressed is not functioning in differentiation in these places, or that its in the meristem and organ identity mutants lfy-1, ap1-1, ap2- function is covered by redundant factors in ett mutants. 2 and ag-1, double mutants suggest that ETT is not active in all whorls in these mutant backgrounds. Thus, meristem and ETT’s role during gynoecium development organ identity genes although unnecessary for ETT transcrip- The ett allelic series suggests that ETT patterns the gynoecium tional activation, are indeed necessary for ETT function. Addi- primordium in a dose-dependent manner. Abaxial expression tionally, ETT appears to be necessary for full AG function, of ETT in the gynoecium primordium from inception until since the partial function of the ag-5 allele requires ETT stage 8 supports its predicted role in prepatterning the proper activity. differentiation of tissues within the developing organ (Sessions and Zambryski, 1995). The expression data suggest that ETT Partial redundancy of ETT and PAN acts in the abaxial walls of the primordium to perform three Several results suggest that ETT and PAN function redundantly essential functions: (i) to promote formation of valve and ovary to control radial patterning within w1-w3. First, the w1-w3 cell types, (ii) to repress formation of stylar and internode cell phenotype of both single mutants, including the early stage 1- types and (iii) to pattern the sites of vascular differentiation and 4 floral ontogeny, is very similar. The developmental basis for anatomy. One way ETT accomplishes this is by restricting the stamen loss during stage 5 differs between the two mutants in activity of the TSL protein kinase to the distal gynoecium pri- that ett fails to initiate one of the four medial stamens while mordium (Roe et al., 1997). pan mutants initiate 5 equally spaced stamen primordia We have proposed a model in which the proper differentiation (Running and Meyerowitz, 1996; Sessions, 1997). Second, ett of tissues within the developing gynoecium occurs from two and pan mutations have similar genetic interactions in CLV and ringed boundaries established in the stage 6 gynoecium pri- meristem and organ identity genes (this study; Running and mordium (Sessions, 1997). Based on this model, ett mutations Meyerowitz, 1996). Third, ett-1 pan-1 double mutants show cause an apical (abaxial-adaxial) boundary to be lowered and a different synergistic phenotypes in each whorl. This is best basal (valve forming) boundary to be raised on the stage 5/6 pri- exemplified in w2 of ett-1 pan-1 flowers in the formation of mordium (Sessions, 1997). This model is in part supported by petal primordia in all available positions in the whorl. ETT and ETT expression in the gynoecium primordium. For example, the PAN seem to function independently of each other, since each inner edge of the ring of ETT-expressing cells in the stage 5 is active in a mutant of the other. Since ett and pan single gynoecium primordium appears to mark the abaxial-adaxial mutants do show clear differences, the extent of the redundancy boundary and the hypothetical apical boundary, arguing that is unclear. Future experiments expressing ETT in a pan back- ETT acts early to directly position this boundary. Similarly, the ground under constitutive and spatially refined promoters lower edge of ETT expression on the stage 5 gynoecium pri- should help to clarify this relationship. mordium appears to mark the proposed basal boundary. Thus, ETT could act to position these hypothetical developmental boundaries at the edges of it expression domain. Alternatively CONCLUSION ETT could act throughout the gynoecium primordium (i.e. not entirely at the edges) to provide positional information. ETT provides a critical function in patterning groups of cells ett-1 pi-1 flowers suggest that ETT functions similarly in w3 within the FM and reproductive organs. Understanding the carpel primordia. However, the two boundary model is at odds nature of this patterning function will be aided in the future by with the phenotype of ap2-2 ett-1 w1 carpels, since ETT appears gain of function ETT alleles, and experiments which establish to be functioning only in the margins of these organs as opposed whether ETT acts as a transcription factor and/or mediates to throughout the primordium. Perhaps redundant factors are auxin-based signals. Transcriptional activation of ETT occurs present in ap2-2 w1 carpel primordia which can promote the independently of meristem and organ identity genes, suggest- formation of valve tissue in the absence of ETT, or there is a ing that other unidentified factors are necessary for flower different developmental basis for carpel development in w1. development. ETT expression also implies that primordium initiation and vascular patterning are coincident events, and Independence of meristem and organ identity that the differentiation of tissues in mature organs is partially functions from ETT transcriptional activation patterned in the meristem before primordia become morpho- Expression studies demonstrate that ETT is transcribed inde- logically distinct from the meristem. ETTIN patterning during flower development 4491

We thank John Alvarez and David Smyth for ett-3 and ett-4, Eva Jones, J. D. G., Shlumukov, L., Carland, F., English, J., Scoefield, S. R., Huala for ag-5, Elliot Meyerowitz for clv1-1, clv3-1, and other single Bishop, G. J. and Harrison, K. (1992). Effective vectors for transformation, meristem and organ identity mutants, Ove Nilsson and Detlef Weigel expression of heterologous genes, and assaying transposon excision in for ap1-1 (lfy-6/+), James Keddie for pSLJ6991, the Berkeley transgenic plants. Transgenic Research 1, 285-297. Electron Microscope Lab, Steve Ruzin and the NSF center for Plant Kim, J., Harter, K. and Theologis, A. (1997). Protein-Protein Interactions Among the Aux/IAA Proteins. Proc. Natl. Acad. Sci. (in press). Developmental Biology, and Tim Durfee and Fred Hempel for dis- Levin, J. and Meyerowitz, E. M. (1995). UFO: An Arabidopsis gene involved cussions and critical reading of the manuscript. This work was in both floral meristem and floral organ development. Plant Cell 7, 529-548. supported by Department of Energy grant 88ER13882 to P. C. Z. Mandel, M. A. and Yanofsky, M. F. (1995). A gene triggering flower formation in Arabidopsis. Nature 377, 522-24. Mizukami, Y. and Ma, H. (1992). Ectopic expression of the floral homeotic REFERENCES gene AGAMOUS in transgenic Arabidopsis plants alters floral organ identity. Cell 71, 119-131. Okamuro, J., Szetzo, W., Lotys-Prass, C. and Jofuku, D. (1997) Photo and Azpiroz-Leehan, R. and Feldmann, K. A. (1997). T-DNA insertion hormonal control of meristem identity in the Arabidopsis flower mutants mutagenesis in Arabidopsis: going back and forth. Trends Genet. 13, 152- apetela2 and apetela1. Plant Cell 9, 37-47. 156. Robbins, J., Dilworth, S. M., Laskey, R. A. and Dingwall, C. (1991). Two Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1989). Genes directing independent basic domains in nucleoplasmin nuclear targeting sequence: flower development in Arabidopsis. Plant Cell 1, 37-52. identification of a class of bipartite nuclear targeting sequence. Cell 64, 615- Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1991) Genetic 623. interactions among floral homeotic genes in Arabidopsis. . Development 112, Roe, J. L., Rivin, C. J., Sessions, R. A., Feldmann, K. A. and Zambryski, P. 1-20. C. (1993). The Tousled gene in A. thaliana encodes a protein kinase homolog Bowman, J. L., Sakai, H., Jack, T., Weigel, D., Mayer, U. and Meyerowitz, that is required for leaf and flower development. Cell 75, 939-950. E. M. (1992). SUPERMAN, a regulator of floral homeotic genes in Roe, J. L., Nemhauser, J. L. and Zambryski, P. C. (1997). TOUSLED Arabidopsis. Development 114, 599-615. participates in apical tissue formation during gynoecium development in Bowman, J. L., Alvarez, J., Weigel, D., Meyerowitz, E. M. and Smyth, D. R. Arabidopsis. Plant Cell 9, 33-353. 1993. Control of flower development in Arabidopsis thaliana by APETELA1 Running, M. P. and Meyerowitz, E. M. (1996). Mutations in the and interacting genes. Development 119, 721-43. PERIANTHIA gene of Arabidopsis specifically alter floral organ number and Clark, S. E., Running, M. P. and Meyerowitz, E. M. (1993). CLAVATA1, a initiation pattern. Development 122, 1261-1269. regulator of meristem and flower development in Arabidopsis. Development Sessions, R. A. and Zambryski, P. C. (1995). Arabidopsis gynoecium 119, 397-418. structure in the wild type and in ettin mutants. Development 121, 1519-1532. Clark, S. E., Running, M. P. and Meyerowitz, E. M. (1995). CLAVATA3 is a Sessions, R. A. (1997). Arabidopsis flower development and gynoecium specific regulator of shoot and floral meristem development affecting the patterning in wild-type and ettin mutants. Am. J. Bot. 84, 1179-1191. same processes as CLAVATA1. Development 121, 2057-2067. Smyth, D. R., Bowman, J. L. and Meyerowitz, E. M. (1990). Early flower Clark, S. E., Williams, R. W. and Meyerowitz, E. M. (1997). The CLAVATA1 development in Arabidopsis. Plant Cell 2, 755-767. gene encodes a putative receptor kinase that controls shoot and floral Ulmasov, T., Hagen, G., Guilfoyle, T. (1997). ARF1, a transcription factor that meristem size in Arabidopsis. Cell 89, 575-585. binds to auxin response elements. Science 276, 1865-8. Crone, W. and Lord, E. M. (1994). Floral organ initiation and development in Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and Meyerowitz, E. wild-type Arabidopsis thaliana and in the organ identity mutants apetela2-1 M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69, and agamous-1. Can. J. Bot. 72,384-401. 843-859. Drews, G. N. (1995). In situ hybridization with nonradioactive probes. Weigel, D. and Meyerowitz, E. M. (1994). The ABCs of floral homeotic genes. Arabidopsis Molecular Genetics Course Manual. Cold Spring Harbor Cell 78, 203-209. Laboratory. Weigel, D. and Nilsson, O. (1995). A developmental switch sufficient for Feldmann, K. (1991). T-DNA insertion mutagenesis in Arabidopsis: flower initiation in diverse plants. Nature 377, 495-500. mutational spectrum. Plant J. 1, 71-82. Weigel, D. (1995). The genetics of flower development: from floral induction to Hill, J. P. and Lord, E. M. (1989). Floral development in Arabidopsis thaliana: ovule morphogenesis. Annu. Rev. Genetics 29, 19-39. a comparison of the wild type and the homeotic pistillata mutant. Can. J. Bot. Yanofsky, M. F. (1995). Floral meristems to floral organs: genes controlling 67, 2922-2936. early events in Arabidopsis flower development. Annu. Rev. Plant Physiol. Huala, E. and Sussex, I. (1992). LEAFY interacts with floral homeotic genes to Mol. Biol. 46, 167-88. regulate Arabidopsis floral development. Plant Cell 4, 901-913. Irish, V. F. and Sussex, I. M. (1990). Function of the apetela-1 gene during Arabidopsis floral development. Plant Cell 2, 741-753. (Accepted 4 September 1997)