DOCSLIB.ORG

Expression and Localization of Homeodomain Proteins DLX4, HB9 and HB24 in Malignant and Benign Human Colorectal Tissues

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression and Localization of Homeodomain Proteins DLX4, HB9 and HB24 in Malignant and Benign Human Colorectal Tissues ANTICANCER RESEARCH 24: 955-962 (2004) Expression and Localization of Homeodomain Proteins DLX4, HB9 and HB24 in Malignant and Benign Human Colorectal Tissues PAUL HOLLINGTON1*, PETRA NEUFING2*, BILL KALIONIS3, PAUL WARING4, JACKY BENTEL5, DAVID WATTCHOW6 and WAYNE D. TILLEY1 1Dame Roma Mitchell Cancer Research Laboratories, University of Adelaide, Hanson Institute, IMVS, Adelaide; 2Department of Immunology, Flinders Medical Centre, Bedford Park, South Australia; 3Perinatal Research Centre, Department of Perinatal Medicine, Royal Women’s Hospital, Carlton, Victoria; 4Department of Pathology, Peter Mac Callum Cancer Institute, Melbourne, Victoria; 5Department of Anatomical Pathology, Royal Perth Hospital, Perth; 6Department of General and Gastrointestinal Surgery, Flinders Medical Centre, Bedford Park, South Australia, Australia Abstract. Background: The purpose of this study was to identify accounting for 70% of these cancers (1). Fearon & homeobox genes expressed in the human colon and to determine Vogelstein (2) have described the molecular basis for whether their expression levels were altered between matched non- sporadic colon cancer as a multistep model of carcinogenesis. malignant and malignant colon tissues. Materials and Methods: These genetic events ultimately result in uninhibited cell Homeobox genes expressed in colon tissue were identified by growth, proliferation and clonal tumor development. Known reverse transcription polymerase chain reaction (RT-PCR). genetic mutations account for approximately 80% of sporadic Antibodies were raised to the homeodomain proteins DLX4, HB9 colon cancers (1) and, therefore, additional events which take and HB24 and immunohistochemistry was performed on 3 place during colon carcinogenesis or progression of the moderately-differentiated tumors and their corresponding non- disease remain to be elucidated. malignant colon tissue samples. Results: The RT-PCR screen Homeodomain (hdm) proteins comprise a large family of identified expression of DLX4, HB9, HB24 and MSX2 in the transcription factors that contain a highly conserved DNA normal colon. Immunoaffinity purified polyclonal antisera raised binding motif (the homeobox) (3,4) and have been shown to against DLX4, HB9 and HB24 detect specific immunoreactivity regulate cellular commitment and differentiation in a wide in glandular epithelial cells, stromal cells of the lamina propria but variety of species (4). Precise spatial and temporal expression not in the submucosa. Nuclear epithelial immunoreactivity of all of homeobox (hbx) genes is essential for correct axis formation three antibodies decreased in moderately-differentiated tumors and spatial patterning during embryonic development (3,5). An compared to the corresponding matched non-malignant mucosa. example which underpins the importance of hbx gene These data suggest that differential expression of HB9, HB24 and expression levels during gut development is provided by the DLX4 may be associated with colorectal carcinogenesis. overexpression of Hoxa-4 in mice which results in a megacolon phenotype (6). Altered hbx gene expression levels in adult Colon cancer is a common disease with an incidence of 1 in colon tissues can also lead to aberrant cellular differentiation 20 in the western population, with sporadic disease and is often associated with a transformed phenotype (7). Reduction of hbx gene CDX2 expression for example has been reported in a number of human colon cancers (8,9) and also in rat and mouse models of the disease (10,11). Evidence that *P. Hollington and P. Neufing contributed equally to this work and loss of hbx gene expression can result in hyperplastic or are listed in alphabetical order. dysplastic phenotypes has been provided more directly by targeted gene disruption experiments (12-14). For example, Correspondence to: Petra Neufing, Room 2E119 Department of heterozygous loss of hbx gene CDX2 results in multiple Immunology, Flinders Medical Centre, Bedford Park SA 5042, South Australia, Australia. Tel: (618) 8204 5276, Fax: (618) 8204 intestinal polyp-like lesions (12). Reduction of CDX2 4158, e-mail: [email protected] expression also results in concomittant down-regulation of molecules involved in cell-cell and cell-substratum interactions Key Words: Homeodomain, colorectal cancer, immunohistochemistry. such as ICAM-1 (15), E-cadherin, integrin-beta4, laminin- 0250-7005/2004 $2.00+.40 955 ANTICANCER RESEARCH 24: 955-962 (2004) Table I. Sequence, PCR cycling conditions and expected product size of primer sets used to amplify hbx genes of the Engrailed class, the diverged hbx genes DLX4, HB9, HB24, MSX2 and loading controls ‚-actin and cytokeratin 20. Gene Sense and antisense primers Cycling conditions Product Ref Size Eng TAGAATTCAGXCCXAGXACXGCXTT 40x(94ÆC 30'', 55ÆC 45'', 72ÆC 90'') 132 29 TAGAATTCCGXCGATTTTGAAACCA DLX4 CCGCCCGTGGTGAACTCCGACC 40x(94ÆC 30'', 72ÆC 30'', 72ÆC 60'') 160 30 CCCCCACGTTCACCGCGCCAGGTG HB9 GCGGATCCGGCACTCCAAGGAGGC 40x(94ÆC 45'', 58ÆC 60'', 72ÆC 90'') 480 31 GCGAATTCTATAAGCAGCCAAGCG HB24 CTGCCTAAGATGCCCGACTTC 33x(94ÆC 30'', 64ÆC 45'', 72ÆC 90'') 420 32 GTCCTCGTCCTCGTCCTCCTC MSX2 CAGACACAGTGCACACAGAA 40x(94ÆC 30'', 62ÆC 45'', 72ÆC 60'') 390 30 CCTTTGCAACTGTGAGGATG ‚-actin CAGATCATGTTTGAGACCTT 30x(94ÆC 1', 55ÆC 1', 72 ÆC 1') 148 33 CTGGTGGTGAAGCTGTAGCC Cyt20 CAGACACACGGTGAACTATGG 40X(94ÆC 30'', 55ÆC 45'', 72ÆC 90'') 370 34 GATCAGCTTCCACTGTTAGACG gamma2 chain, hemidesmosomal protein and alpha-actinin diagnostic requirements, as well as samples of normal mucosa from the (16). This suggests that loss of CDX2 expression may not only end of the resection specimen remote from the tumor, were harvested play a role in the initiation of colorectal carcinogenesis, but by a histopathologist and immediately stored in liquid nitrogen in the Flinders Cancer Centre tissue bank. The research protocol was could also favour metastasis of tumor cells. approved by the Flinders Medical Centre Clinical Investigations In contrast to CDX2, the expression of other hbx genes, such Committee and conforms to the statements on human experimentation as HOXB6, HOXB8, HOXC8 and HOXC9 increases at different by the NHMRC. Informed consent was given by the patients for the stages of colon tumor development (17,18). Furthermore, other use of tissue in experimental work, prior to surgery. studies have shown that HOXB8 interacts with a number of tumor suppressor genes such as N-CAM (19). N-CAM is RT-PCR screen with degenerate primers. Frozen specimens of matched structurally related to the DCC tumor suppressor gene and, like normal mucosa and colonic tumors were homogenised in 4M guanidium isothiocyanate. RNA was isolated by ultracentrifugation DCC, has been shown to act as a tumor suppressor gene in through a caesium chloride gradient (27). Two hundred ng of total colorectal cancer (20). Similarly, the Drosophila homologue of RNA was reverse transcribed with Superscript II reverse transcriptase HOXB8 (called abd-A) regulates a gene of the TGF-‚ class (Gibco BRL) using oligo (dT)17–adaptor primers according to the called the ‘decapentaplegic’ gene (21,22). In Drosophila, abd-A manufacturer's protocol. One tenth of this cDNA was amplified with also regulates a gene of the Wnt class called ‘wingless’ (23,24). antisense degenerate engrailed class primers (Table I). PCR reactions The APC gene is a component of the Wnt cell signalling were carried out in a final volume of 20 Ìl containing 1x Taq reaction pathway and both it and TGF-‚ are important in sporadic and buffer (Pharmacia Biotech, Sweden) 200 ÌM dNTPs, 1.5mM MgCl2, 200ng of sense and antisense primers, 4 Ìl template cDNA and 0.5U familial colorectal carcinogenesis (25,26). Taq DNA polymerase. PCR cycling conditions are listed in Table π. In light of the critical regulatory role of hbx genes, their DNA fragments were gel-purified, cloned into pBluescript and oncogenic potential in mouse models and evidence of their sequenced using the fmol® DNA Cycle Sequencing System (Promega, aberrant expression in solid tumors, it is likely that misexpression USA). Comparison of cloned DNA sequences to known hbx genes was of hbx genes may be a crucial event in oncogenesis and/or performed using the GenBank Sequence database and the ANGIS progression of colon tumors. In this work we report the isolation suite of analysis programs. of hbx genes DLX4, HB9, HB24 and MSX2, from adult human PCR screening using specific primers. All PCR reactions were carried out colorectal tissue and show, by immunohistochemistry, that the in 1x Taq reaction buffer (Pharmacia Biotech, Sweden), 200 ÌM expression of hdm proteins DLX4, HB9 and HB24 is reduced in dNTPs, 1.5 mM MgCl2 with 100 ng of each primer, 2 Ìl of cDNA colorectal tumors when compared to the corresponding non- reaction and 0.5 U of Taq polymerase in a final volume of 20 Ìl with the malignant tissue from the same patients. following exceptions: ‚-actin PCR reactions were performed in 2 mM MgCl2 on 4 Ìl of cDNA and in a final volume of 25 Ìl, DLX4 and HB9 Materials and Methods PCR reactions in addition contained 1M betaine and MSX2 reactions were performed using 4 Ìl of cDNA. Details of primers and PCR Tissue samples. Tissue samples were collected from patients undergoing cycling conditions are listed in Table π. PCR products were separated bowel resection for colon or rectal carcinoma at Flinders Medical on 1.5% agarose gels, stained with ethidium bromide and visualized Centre, South Australia. Samples of non-necrotic tumor surplus to with a FluorImager scanner (Molecular
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Onc2010217.Pdf
    Oncogene (2010) 29, 4671–4681 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc ORIGINAL ARTICLE DEK oncoprotein regulates transcriptional modifiers and sustains tumor initiation activity in high-grade neuroendocrine carcinoma of the lung T Shibata1,2, A Kokubu1, M Miyamoto1, F Hosoda1, M Gotoh2, K Tsuta3, H Asamura4, Y Matsuno5, T Kondo6, I Imoto7,8, J Inazawa7,8 and S Hirohashi1,2 1Cancer Genomics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 2Pathology Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 3Clinical Laboratory Division, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 4Division of Thoracic Surgery, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 5Department of Surgical Pathology, Hokkaido University Hospital, Sapporo, Hokkaido, Japan; 6Proteome Bioinfomatics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 7Department of Molecular Cytogenetics, Medical Research Institute and Graduate School of Biomedical Science, Tokyo Medical and Dental University, Tokyo, Japan and 8Center of Excellence Program for Frontier Research on Molecular Destruction and Reconstitution of Tooth and Bone, Tokyo Medical and Dental University, Tokyo, Japan Lung cancer shows diverse histological subtypes. Large- Introduction cell neuroendocrine cell carcinoma and small-cell lung carcinoma show similar histological features and clinical Lung cancer is one of the most prevalent cancers behaviors, and can be classified as high-grade neuro- worldwide, and shows diverse histological subtypes, endocrine carcinoma (HGNEC) of the lung. Here we including adenocarcinoma, squamous cell carcinoma, elucidated the molecular classification of pulmonary large-cell carcinoma, large-cell neuroendocrine carcino- endocrine tumors by copy-number profiling. We compared ma (LCNEC) and small-cell lung carcinoma (SCLC; alterations of copy number with the clinical outcome of Travis and Brambilla, 2004).
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • DLX Genes: Roles in Development and Cancer
    cancers Review DLX Genes: Roles in Development and Cancer Yinfei Tan 1,* and Joseph R. Testa 1,2,* 1 Genomics Facility, Fox Chase Cancer Center, Philadelphia, PA 19111, USA 2 Cancer Signaling and Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA 19111, USA * Correspondence: [email protected] (Y.T.); [email protected] (J.R.T.) Simple Summary: DLX homeobox family genes encode transcription factors that have indispensable roles in embryonic and postnatal development. These genes are critically linked to the morphogene- sis of craniofacial structures, branchial arches, forebrain, and sensory organs. DLX genes are also involved in postnatal homeostasis, particularly hematopoiesis and, when dysregulated, oncogen- esis. DLX1/2, DLX3/4, and DLX5/6 exist as bigenes on different chromosomes, sharing intergenic enhancers between gene pairs, which allows orchestrated spatiotemporal expression. Genomic alterations of human DLX gene enhancers or coding sequences result in congenital disorders such as split-hand/foot malformation. Aberrant postnatal expression of DLX genes is associated with hematological malignancies, including leukemias and lymphomas. In several mouse models of T-cell lymphoma, Dlx5 has been shown to act as an oncogene by cooperating with activated Akt, Notch1/3, and/or Wnt to drive tumor formation. In humans, DLX5 is aberrantly expressed in lung and ovarian carcinomas and holds promise as a therapeutic target. Abstract: Homeobox genes control body patterning and cell-fate decisions during development. The homeobox genes consist of many families, only some of which have been investigated regarding a possible role in tumorigenesis. Dysregulation of HOX family genes have been widely implicated in cancer etiology.
    [Show full text]
  • Upregulation of DLX5 Promotes Ovarian Cancer Cell Proliferation by Enhancing IRS-2-AKT Signaling
    Published OnlineFirst November 2, 2010; DOI: 10.1158/0008-5472.CAN-10-1568 Published OnlineFirst on November 2, 2010 as 10.1158/0008-5472.CAN-10-1568 Molecular and Cellular Pathobiology Cancer Research Upregulation of DLX5 Promotes Ovarian Cancer Cell Proliferation by Enhancing IRS-2-AKT Signaling Yinfei Tan1, Mitchell Cheung1, Jianming Pei1, Craig W. Menges1, Andrew K. Godwin2, and Joseph R. Testa1 Abstract The distal-less homeobox gene (dlx) 5 encodes a transcription factor that controls jaw formation and appendage differentiation during embryonic development. We had previously found that Dlx5 is overexpressed in an Akt2 transgenic model of T-cell lymphoma. To investigate if DLX5 is involved in human cancer, we screened its expression in the NCI 60 cancer cell line panel. DLX5 was frequently upregulated in cell lines derived from several tumor types, including ovarian cancer. We next validated its upregulation in primary ovarian cancer specimens. Stable knockdown of DLX5 by lentivirus-mediated transduction of short hairpin RNA (shRNA) resulted in reduced proliferation of ovarian cancer cells due to inhibition of cell cycle progres- sion in connection with the downregulation of cyclins A, B1, D1, D2, and E, and decreased phosphorylation of AKT. Cell proliferation resumed following introduction of a DLX5 cDNA harboring wobbled mutations at the shRNA-targeting sites. Cell proliferation was also rescued by transduction of a constitutively active form of AKT. Intriguingly, downregulation of IRS-2 and MET contributed to the suppression of AKT signaling. More- over, DLX5 was found to directly bind to the IRS-2 promoter and augmented its transcription. Knockdown of DLX5 in xenografts of human ovarian cancer cells resulted in markedly diminished tumor size.
    [Show full text]
  • Expression and Function of Dlx Genes in the Osteoblast Lineage Haitao Li University of Connecticut School of Medicine and Dentistry
    University of Connecticut OpenCommons@UConn UCHC Articles - Research University of Connecticut Health Center Research 4-2008 Expression and Function of Dlx Genes in the Osteoblast Lineage Haitao Li University of Connecticut School of Medicine and Dentistry Inga Marijanovic University of Connecticut School of Medicine and Dentistry Mark S. Kronenberg University of Connecticut School of Medicine and Dentistry Ivana Erceg University of Connecticut School of Medicine and Dentistry Mary Louise Stover University of Connecticut School of Medicine and Dentistry See next page for additional authors Follow this and additional works at: https://opencommons.uconn.edu/uchcres_articles Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Recommended Citation Li, Haitao; Marijanovic, Inga; Kronenberg, Mark S.; Erceg, Ivana; Stover, Mary Louise; Velonis, Dimitrios; Mina, Mina; Upholt, William B.; Kalajzic, Ivo; and Lichtler, Alexander C., "Expression and Function of Dlx Genes in the Osteoblast Lineage" (2008). UCHC Articles - Research. 49. https://opencommons.uconn.edu/uchcres_articles/49 Authors Haitao Li, Inga Marijanovic, Mark S. Kronenberg, Ivana Erceg, Mary Louise Stover, Dimitrios Velonis, Mina Mina, William B. Upholt, Ivo Kalajzic, and Alexander C. Lichtler This article is available at OpenCommons@UConn: https://opencommons.uconn.edu/uchcres_articles/49 NIH Public Access Author Manuscript Dev Biol. Author manuscript; available in PMC 2009 May 9. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Dev Biol. 2008 April 15; 316(2): 458±470. doi:10.1016/j.ydbio.2008.01.001. Expression and Function of Dlx Genes in the Osteoblast Lineage Haitao Li1, Inga Marijanovic1, Mark S.
    [Show full text]
  • Dual Functions of the Homeoprotein DLX4 in Modulating Responsiveness of Tumor Cells to Topoisomerase II-Targeting Drugs
    Published OnlineFirst December 7, 2012; DOI: 10.1158/0008-5472.CAN-12-3538 Cancer Tumor and Stem Cell Biology Research Dual Functions of the Homeoprotein DLX4 in Modulating Responsiveness of Tumor Cells to Topoisomerase II-Targeting Drugs Bon Q. Trinh, Song Yi Ko, Nicolas Barengo, Shiaw-Yih Lin, and Honami Naora Abstract Topoisomerase II (TOP2)-targeting poisons such as anthracyclines and etoposide are commonly used for cancer chemotherapy and kill tumor cells by causing accumulation of DNA double-strand breaks (DSB). Several lines of evidence indicate that overexpression of TOP2A, the gene encoding topoisomerase IIa, increases sensitivity of tumor cells to TOP2 poisons, but it is not clear why some TOP2A-overexpressing (TOP2A-High) tumors respond poorly to these drugs. In this study, we identified that TOP2A expression is induced by DLX4, a homeoprotein that is overexpressed in breast and ovarian cancers. Analysis of breast cancer datasets revealed that TOP2A-high cases that also highly expressed DLX4 responded more poorly to anthracycline-based chemotherapy than TOP2A-high cases that expressed DLX4 at low levels. Overexpression of TOP2A alone in tumor cells increased the level of DSBs induced by TOP2 poisons. In contrast, DLX4 reduced the level of TOP2 poison-induced DSBs irrespective of its induction of TOP2A. DLX4 did not stimulate homologous recombination– mediated repair of DSBs. However, DLX4 interacted with Ku proteins, stimulated DNA-dependent protein kinase activity, and increased erroneous end-joining repair of DSBs. Whereas DLX4 did not reduce levels of TOP2 poison-induced DSBs in Ku-deficient cells, DLX4 stimulated DSB repair and reduced the level of TOP2 poison– induced DSBs when Ku was reconstituted in these cells.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]
  • Developmental Biology Catalog
    ptglab.com 1 ANTIBODIES FOR DEVELOPMENTAL BIOLOGY www.ptglab.com 2 Antibodies For Developmental Biology Front Cover: IF result (trunk or trunck-associated region; nucleus stain; RED) of NKX2-2 antibody (13013-1-AP) with E16.5 mouse pancreas by Dr. Nicholas George, Sarvetnick Lab – UNMC. (Green, E-Cadherin; RED, NKX2-2; Blue, DAPI). ptglab.com 3 WELCOME Foreword Developmental biology covers a broad spectrum of scientific research relating to the growth and development of living things. Not only does it concern the embryogenic events immediately following fertilization, it also encompasses the genetic control of cell growth, differentiation and morphogenesis – key components of regeneration and aging in the adult organism. In this development-focused catalog This catalog is essentially a shortlist you will find antibodies to those targets of around one quarter of the antibodies involved in pattern formation, such as Proteintech has for developmental biology HOX gene products and proteins involved protein targets. If you can’t find an antibody in Notch and Hedgehog signaling; neural to your target of choice here, we’re confident tube formation, such as sonic hedgehog that with over 2,000 primary antibodies protein; and organogenesis such as Wnt, relating to development in the complete FGF, BMP and EYA proteins. At the center Proteintech inventory you’ll find what you’re of the catalog, you will also find a primer looking for online at www.ptglab.com. on the primary cilium, with details on Proteintech®* antibodies recognizing the proteins involved in the generation and maintenance of this vital developmental structure. What’s Inside 6–7 Focus Article Antibodies For Cilia Development 8 Focus Article Investigating Kidney Development With Proteintech’s SIX2 Antibody 9–11 Antibodies: ABLIM1 GSK3B 12–13 Antibodies For Cilia Development 14–17 Antibodies: GSK3B ZHX2 18 Contact Us Please Note: All products featured in this catalog are for research use only.
    [Show full text]
  • Transforming Growth Factor ß1-Mediated Functional Inhibition Of
    Myelodysplastic Syndromes SUPPLEMENTARY APPENDIX Transforming growth factor 1- mediated functional inhibition of mesenchymal stromal celβls in myelodysplastic syndromes and acute myeloid leukemia Stefanie Geyh, 1* Manuel Rodríguez-Paredes, 1,2 * Paul Jäger, 1 Annemarie Koch, 1 Felix Bormann, 2 Julian Gutekunst, 2 Christoph Zilkens, 3 Ulrich Germing, 1 Guido Kobbe, 1 Frank Lyko, 2 Rainer Haas 1 and Thomas Schroeder 1 1Department of Hematology, Oncology and Clinical Immunology, University of Duesseldorf, Medical Faculty; 2Division of Epigenetics, DKFZ- ZMBH Alliance, German Cancer Research Center, Heidelberg and 3Department of Orthopedic Surgery, University of Duesseldorf, Medical Faculty, Germany *SG and MR-P contributed equally to this work. ©2018 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2017.186734 Received: December 19, 2017. Accepted: May 14, 2018. Pre-published: May 17, 2018. Correspondence: [email protected] Figure S1 Downregulated genes Downregulated genes Upregulated Figure S1. Heatmaps showing the 50 most upregulated and downregulated genes between the 3 healthy MSC controls and the 9 RCMD-, RAEB- and AML-derived MSC samples. Color scale depicts the rlog-transformed FPKM values for each gene and every sample. Figure S2 Downregulated genes Downregulated genes Upregulated Figure S2. Heatmaps showing the 50 most upregulated and downregulated genes between the 3 healthy MSC controls and the 3 RCMD, RAEB and AML MSC samples, respectively. Color scales depict the rlog-transformed FPKM values for each gene and every sample. Figure S3 A. B. 0.0015 *** ** <-3 -2 0.0010 RCMD RAEB AML -1 0 1 0.0005 Log2FC LTF 2 CCL26/GAPDH INHBB >3 0.0000 TGFB2 y S h D ML M A ealt ll LTF H a EGF 0.003 *** ** INHBB TGFB2 0.002 INHBB IGFBP7 0.001 GDF11 LIF/GAPDH BMP1 0.000 y L th M TNFSF12 l A FGF13 ea ll MDS H a FGF13 0.0015 * TNFSF10 TNFSF10 0.0010 0.0005 SPP1/GAPDH 0.0000 y th l AML ea H all MDS Figure S3.
    [Show full text]
  • Supplementary File Table S1
    Supplementary file Table S1 Grouping of Homeobox genes according to their main known function. Anatomical Structure Morphogenesis EN1, HOXC10, HOXC13, HOXD3, LBX1, SIX2, SIX4 Organ Morphogenesis CDX1, CDX2, HOXA11, HOXA13, ISL1, LHX1, PAX3, PDHX, PITX2, PITX3, PROX1, SIX6 Body Pattern Formation ALX3, EMX2, HHEX, HOXA11, HOXA2, HOXA4, HOXA5, HOXA6, HOXB1, HOXB5, HOXB6, HOXC5, HOXD10, HOXD8, LMX1B, PITX2 Ectoderm Development PROX1, VAX2 Endoderm Development HOXC11 Brain & Nervous System Development Brain Development ALX1, DLX2, EMX2 Nervous System Development: ARX, DLX5, DLX6, HOXD10, LBX1, LHX1, OTP, PAX3, PHOX2A, PHOX2B Skeletal Development: ALX3, ALX4, DLX3, DLX5, DLX6, EN1, HOXA11, HOXA13, HOXA2, HOXB6, HOXD10, HOXD13, MSX2 Muscle Development: BARX2, MKX, SIRT1, SIRT2, SIX1 Other Homeobox Genes Involved In BARX1, CDX4, CUX1, DLX1, EMX1, EN2, Multicellular Organismal HOXA1, HOXA7, HOXA9, HOXB13, HOXB2, Development: HOXB3, HOXB4, HOXB7, HOXB8, HOXB9, HOXC12, HOXC8, HOXC9, HOXD1, HOXD11, HOXD12, HOXD9, ISL2, LBX2, LMX1A, MEIS1, NKX3-1, OTX1, TLX1, VAX1, VSX1, VSX2 Homeobox Genes Involved In Cell ARX, EMX2, HHEX, HLX, HOPX, LBX1, LHX1, Differentiation: LMX1B, MIXL1, OTP, PHOX2A, SIRT1, VSX2 Other Genes: PHTF1, SIRT3, SIRT6, SIRT7, ZHX1, ZHX2 Homeobox genes include two subsets of genes coding for transcription factors involved in multiple functions. The clustered HOX genes are indicated in bold. Supplementary file Figure S2 5’ Spatial collinearity 3’ HOXA Chr. 7p15.3 HOXB Chr. 17q21.3 HOXC Chr. 12q13.3 HOXD Chr. 2q31 13 12 11 10 9 8 7 6 5 4 3 2 1 Paralogous HOX groups Distribution of the 39 human HOX genes in four clusters located in different chromosomal regions*. Blue indicates anterior HOX genes. Yellow, paralogy group 3 Hox genes, green and purple indicatete central HOX genes and Red the posterior HOX genes.
    [Show full text]