DOCSLIB.ORG

Upregulation of DLX5 Promotes Ovarian Cancer Cell Proliferation by Enhancing IRS-2-AKT Signaling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Upregulation of DLX5 Promotes Ovarian Cancer Cell Proliferation by Enhancing IRS-2-AKT Signaling Published OnlineFirst November 2, 2010; DOI: 10.1158/0008-5472.CAN-10-1568 Published OnlineFirst on November 2, 2010 as 10.1158/0008-5472.CAN-10-1568 Molecular and Cellular Pathobiology Cancer Research Upregulation of DLX5 Promotes Ovarian Cancer Cell Proliferation by Enhancing IRS-2-AKT Signaling Yinfei Tan1, Mitchell Cheung1, Jianming Pei1, Craig W. Menges1, Andrew K. Godwin2, and Joseph R. Testa1 Abstract The distal-less homeobox gene (dlx) 5 encodes a transcription factor that controls jaw formation and appendage differentiation during embryonic development. We had previously found that Dlx5 is overexpressed in an Akt2 transgenic model of T-cell lymphoma. To investigate if DLX5 is involved in human cancer, we screened its expression in the NCI 60 cancer cell line panel. DLX5 was frequently upregulated in cell lines derived from several tumor types, including ovarian cancer. We next validated its upregulation in primary ovarian cancer specimens. Stable knockdown of DLX5 by lentivirus-mediated transduction of short hairpin RNA (shRNA) resulted in reduced proliferation of ovarian cancer cells due to inhibition of cell cycle progres- sion in connection with the downregulation of cyclins A, B1, D1, D2, and E, and decreased phosphorylation of AKT. Cell proliferation resumed following introduction of a DLX5 cDNA harboring wobbled mutations at the shRNA-targeting sites. Cell proliferation was also rescued by transduction of a constitutively active form of AKT. Intriguingly, downregulation of IRS-2 and MET contributed to the suppression of AKT signaling. More- over, DLX5 was found to directly bind to the IRS-2 promoter and augmented its transcription. Knockdown of DLX5 in xenografts of human ovarian cancer cells resulted in markedly diminished tumor size. In addition, DLX5 was found to cooperate with HRAS in the transformation of human ovarian surface epithelial cells. Together, these data suggest that DLX5 plays a significant role in the pathogenesis of some ovarian cancers. Cancer Res; 70(22); OF1–10. ©2010 AACR. Introduction the prostatic epithelium, whereas its loss of function initiates prostate carcinogenesis (4). In breast cancer, HOXA5 expres- Cancer is often regarded as the consequence of develop- sion is frequently lost due to gene deletion or promoter mental dysregulation underlaid by aberrant expression of methylation (5). transcription factors that are normally involved in embryonic We had previously identified a chromosomal abnormality development (1). The homeobox gene superfamily encodes in thymic tumor cells from a transgenic mouse model driven transcription factors that act as master controllers of devel- by a myristoylated (myr), constitutively active form of Akt2. opment by regulating a diverse range of target genes. For Tumor cells from these mice often harbor an inversion example, TAL1 and HOX11 are essential transcription factors of chromosome 6 that juxtaposes an evolutionally con- involved in early hematopoiesis, but their misexpression in served homeobox bi-gene, Dlx5/6, to the enhancer of the thymocytes causes T-cell acute lymphoblastic leukemia Tcrb gene (6). Moreover, clonogenic assays revealed onco- (T-ALL) by blocking thymocyte differentiation (2). In addi- genic cooperativity when both Dlx5 and activated Akt2 tion to HOX11, homeobox genes are widely implicated in var- were coexpressed in mammalian cells. The Dlx gene family ious human cancers, by acting either as oncogenes or as is related to the Drosophila distal-less (dll)geneandis tumor suppressors. For example, in rhabdomyosarcoma, an mainly expressed in the developing forebrain and craniofa- oncogenic chromosomal translocation results in the fusion of cial structures. More recently, Dlx genes have also been the DNA binding domain of the PAX3 homeobox gene with found to play broader roles ranging from neurogenesis to the FKHR transcription factor gene (3). The homeobox gene hematopoiesis (7). Sonic hedgehog, BMP4, fibroblast growth NKX3-1 plays an important role in normal differentiation of factor (FGF), and Wnt, among others, can induce Dlx expres- sion in a tissue-specific manner (8). Dlx5 is expressed in adult bone marrow cells and fetal liver Authors' Affiliations: 1Cancer Biology Program and 2Women's Cancer Program, Fox Chase Cancer Center, Philadelphia, Pennsylvania cells, but its expression is suppressed in Thy1-positive T cells (9). Note: Supplementary data for this article are available at Cancer In thymic lymphoma cells observed in myr-Akt2 transgenic Research Online (http://cancerres.aacrjournals.org/). mice, Dlx5 protein levels are highly elevated, which may facili- Corresponding Author: Joseph R. Testa, Fox Chase Cancer Center, 333 tate tumor development by interfering with T-cell differentia- Cottman Avenue, Philadelphia, Pennsylvania 19111. Phone: 215-728- tion (6). Another DLX family member, DLX7 (now known as 2610; Fax: 215-214-1623; E-mail: [email protected]. DLX4) has also been implicated in human hematopoietic neo- doi: 10.1158/0008-5472.CAN-10-1568 plasms. DLX4 is expressed in normal hematopoietic cells and ©2010 American Association for Cancer Research. leukemia cell lines with erythroid characteristics, and its www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2010 American Association for Cancer Research. Published OnlineFirst November 2, 2010; DOI: 10.1158/0008-5472.CAN-10-1568 Tan et al. knockdown induces apoptosis via downregulation of MYC ples were processed by using FACScan (BD), and data were and GATA1 (10). DLX4 was also found to be frequently over- analyzed by using FlowJo software (Tree Star). expressed in acute myeloid leukemia and T-ALL (11), and ex- pression of DLX4 has been implicated in breast cancer Gene knockdown by lentivirus-mediated progression and choriocarcinoma cell survival (12). The role short-hairpin RNAi of DLX5 in tumor development, however, is only beginning Sequences used for DLX5 knockdown were selected by us- to emerge. Kato and colleagues reported that overexpression ing siRNA Design Tools (Ambion). The short-hairpin oligos of DLX5 in non–small cell lung cancer is linked to tumor size were synthesized, annealed, and inserted into pLVTHM (a and is predictive of a poor prognosis (13). They also showed gift of D. Trono, University of Geneva, Geneva, Switzerland). that knockdown of DLX5 suppresses lung cancer cell viability Of 11 lentiviral constructs tested, two with the best knock- and colony formation. Here, we report that DLX5 is frequently down efficiency were used for the experiments presented overexpressed in human ovarian cancer cells, and that deple- here. The human DLX5 sequence used for construct sh2 tion of DLX5 by RNA interference (RNAi) inhibits cell prolifer- was TGG TGA ATG GCA AAC CAA A, and the sequence ation, in part by attenuating AKT signaling. for construct sh3 was AGC TTA TGC CGA CTA TAG C. Con- trol sequence against the LacZ gene was GGA TCA GTC GCT GAT TAA A. Short hairpin sequences against human DLX6 Materials and Methods were AAA GGG AAT GCT GCA TGT TTT (sh4) and AAG AAT CTG CAC AAA CTT GGC (sh10). Viruses were produced Cell lines, tumor specimens, and reagents as previously reported (14). In brief, 293T cells were cotrans- Ovarian cancer cell lines IGROV1, OVCAR3, OVCAR4, fected with the lentiviral vector, packaging plasmid, and en- OVCAR5, OVCAR8, OVCAR10, SKOV3, and A2780 were from velope plasmid. Virus supernatant was collected 24 hours Fox Chase Cancer Center and were maintained in RPMI 1640 after transfection. Ovarian cancer cells were then infected medium supplemented with 10% fetal bovine serum, 100 U/mL with virus at a multiplicity of infection (MOI) of 1.5 for 6 hours. penicillin, and 100 μg/mL streptomycin. Primary and SV40- Cell proliferation rates and relevant signaling pathways were immortalized nontumorigenic human ovarian surface epithe- measured 3 to 5 days after transduction of the short hairpin lial (HOSE) cells were maintained in 1:1 M199 and MCBD-105 RNA (shRNA). media, respectively, supplemented with 5% fetal bovine serum and 0.2 IU/mL insulin, 100 μg/mL penicillin and streptomycin, Retroviral transduction of a DLX5 cDNA with and 2 mmol/L L-glutamine. Primary ovarian tumor specimens wobble mutations were obtained from patients who underwent surgery at Fox A Flag-tagged full-length human DLX5 cDNA was ampli- Chase Cancer Center. Antibodies against DLX5, DLX6, cyclin fied from human reference cDNA (Clontech) by using Pfx po- A, cyclin B1/2, cyclin D1/2/3, cyclin E1/2, insulin-like growth lymerase (Invitrogen) and then cloned into pMSCV vector factor I receptor β (IGFIRβ), MET, IRS-1/2, phosphoinositide (Clontech). The sequence targeted by lentiviral DLX5-sh2 3-kinase (PI3K) p110β, β-actin, and GAPDH were purchased was altered from TGG TGA ATG GCA AAC CAA A to TGG from Santa Cruz Biotechnology. Antibodies against phosphor- TCA ACG GGA AAC CAA A by using a site-directed mutagen- ylated (p)-PDK1, total PDK1, p-AKT/AKT, p-GSK3β/GSK3β, esis kit (Stratagene). Retrovirus containing the wobbled p-p70S6K/p70S6K, extracellular signal-regulated kinase DLX5 was pseudotyped with pVSV-G by cotransfecting pack- (ERK)/p-ERK, human epidermal growth factor receptor 2 aging cells. Supernatant was collected after 24 hours, and (HER2), epidermal growth factor (EGF), and p-MET were from cells were infected for 5 hours at a MOI of 2. Puromycin at Cell Signaling Technology. 2 μg/mL was used 48 hours posttransduction to select cells. Cell proliferation assay Cell proliferation was measured by WST-1 assay (Clontech). Results In brief, cells were seeded at 3 × 103 cells/well in a 96-well plate 5 days after initiating knockdown of DLX5. Optical density DLX5 is frequently upregulated in cell lines derived (OD) values at 450 nm were measured 2 hours after incubation from human cancers of various origins, including with WST-1, using a 96-well microplate reader (BioRad). More- ovarian cancer over, cell growth curves were measured over a 5-day period. To test whether DLX5 expression is deregulated in human Cells were seeded in 24-well plates at 3 × 104 cells/well and cancers, we initially screened the NCI 60 cancer cell line were collected at days 0, 3, and 5.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Comparative Analysis of a Teleost Skeleton Transcriptome Provides Insight Into Its Regulation
    Accepted Manuscript Comparative analysis of a teleost skeleton transcriptome provides insight into its regulation Florbela A. Vieira, M.A.S. Thorne, K. Stueber, M. Darias, R. Reinhardt, M.S. Clark, E. Gisbert, D.M. Power PII: S0016-6480(13)00264-5 DOI: http://dx.doi.org/10.1016/j.ygcen.2013.05.025 Reference: YGCEN 11541 To appear in: General and Comparative Endocrinology Please cite this article as: Vieira, F.A., Thorne, M.A.S., Stueber, K., Darias, M., Reinhardt, R., Clark, M.S., Gisbert, E., Power, D.M., Comparative analysis of a teleost skeleton transcriptome provides insight into its regulation, General and Comparative Endocrinology (2013), doi: http://dx.doi.org/10.1016/j.ygcen.2013.05.025 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. 1 Comparative analysis of a teleost skeleton transcriptome 2 provides insight into its regulation 3 4 Florbela A. Vieira1§, M. A. S. Thorne2, K. Stueber3, M. Darias4,5, R. Reinhardt3, M. 5 S. Clark2, E. Gisbert4 and D. M. Power1 6 7 1Center of Marine Sciences, Universidade do Algarve, Faro, Portugal. 8 2British Antarctic Survey – Natural Environment Research Council, High Cross, 9 Madingley Road, Cambridge, CB3 0ET, UK.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Molecular Mechanisms Regulating Mammalian Forebrain Development
    Molecular Mechanisms Regulating Mammalian Forebrain Development By David Chun Cheong Tsui A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by David Chun Cheong Tsui (2013) Title: Molecular Mechanisms Regulating Mammalian Forebrain Development Name: David Chun Cheong Tsui Degree: Doctor of Philosophy, 2013 Department: Institute of Medical Sciences, University of Toronto ABSTRACT While the extrinsic factors regulating neurogenesis in the developing forebrain have been widely studied, the mechanisms downstream of the various signaling pathways are relatively ill-defined. In particular, we focused on proteins that have been implicated in cognitive dysfunction. Here, we ask what role two cell intrinsic factors play in the development of two different neurogenic compartments in the forebrain. In the first part of the thesis, the transcription factor FoxP2, which is mutated in individuals who have specific language deficits, was identified to regulate neurogenesis in the developing cortex, in part by regulating the transition from the radial precursors to the transit amplifying intermediate progenitors. Moreover, we found that ectopic expression of the human homologue of the protein promotes neurogenesis in the murine cortex, thereby acting as a gain-of-function isoform. In the second part of the thesis, the histone acetyltransferase CREB-binding protein (CBP) was identified as regulating the generation of neurons from medial ganglionic eminence precursors, similar to its role in the developing cortex. But CBP also plays a more substantial role in the expression of late interneuron markers, suggesting that it is continuously required for the various stages of neurogenesis at least in the ventral neurogenic niche.
    [Show full text]
  • Onc2010217.Pdf
    Oncogene (2010) 29, 4671–4681 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc ORIGINAL ARTICLE DEK oncoprotein regulates transcriptional modifiers and sustains tumor initiation activity in high-grade neuroendocrine carcinoma of the lung T Shibata1,2, A Kokubu1, M Miyamoto1, F Hosoda1, M Gotoh2, K Tsuta3, H Asamura4, Y Matsuno5, T Kondo6, I Imoto7,8, J Inazawa7,8 and S Hirohashi1,2 1Cancer Genomics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 2Pathology Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 3Clinical Laboratory Division, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 4Division of Thoracic Surgery, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 5Department of Surgical Pathology, Hokkaido University Hospital, Sapporo, Hokkaido, Japan; 6Proteome Bioinfomatics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 7Department of Molecular Cytogenetics, Medical Research Institute and Graduate School of Biomedical Science, Tokyo Medical and Dental University, Tokyo, Japan and 8Center of Excellence Program for Frontier Research on Molecular Destruction and Reconstitution of Tooth and Bone, Tokyo Medical and Dental University, Tokyo, Japan Lung cancer shows diverse histological subtypes. Large- Introduction cell neuroendocrine cell carcinoma and small-cell lung carcinoma show similar histological features and clinical Lung cancer is one of the most prevalent cancers behaviors, and can be classified as high-grade neuro- worldwide, and shows diverse histological subtypes, endocrine carcinoma (HGNEC) of the lung. Here we including adenocarcinoma, squamous cell carcinoma, elucidated the molecular classification of pulmonary large-cell carcinoma, large-cell neuroendocrine carcino- endocrine tumors by copy-number profiling. We compared ma (LCNEC) and small-cell lung carcinoma (SCLC; alterations of copy number with the clinical outcome of Travis and Brambilla, 2004).
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • The Roles of RNA Polymerase I and III Subunits Polr1a, Polr1c, and Polr1d in Craniofacial Development BY
    The roles of RNA Polymerase I and III subunits Polr1a, Polr1c, and Polr1d in craniofacial development BY © 2016 Kristin Emily Noack Watt Submitted to the graduate degree program in Anatomy and Cell Biology and to the Graduate Faculty of The University of Kansas Medical Center in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Paul Trainor, Co-Chairperson Brenda Rongish, Co-Chairperson Brian Andrews Jennifer Gerton Tatjana Piotrowski Russell Swerdlow Date Defended: January 26, 2016 The Dissertation Committee for Kristin Watt certifies that this is the approved version of the following dissertation: The roles of RNA Polymerase I and III subunits Polr1a, Polr1c, and Polr1d in craniofacial development Paul Trainor, Co-Chairperson Brenda Rongish, Co-Chairperson Date approved: February 2, 2016 ii Abstract Craniofacial anomalies account for approximately one-third of all birth defects. Two examples of syndromes associated with craniofacial malformations are Treacher Collins syndrome and Acrofacial Dysostosis, Cincinnati type which have phenotypic overlap including deformities of the eyes, ears, and facial bones. Mutations in TCOF1, POLR1C or POLR1D may cause Treacher Collins syndrome while mutations in POLR1A may cause Acrofacial Dysostosis, Cincinnati type. TCOF1 encodes the nucleolar phosphoprotein Treacle, which functions in rRNA transcription and modification. Previous studies demonstrated that Tcof1 mutations in mice result in reduced ribosome biogenesis and increased neuroepithelial apoptosis. This diminishes the neural crest cell (NCC) progenitor population which contribute to the development of the cranial skeleton. In contrast, apart from being subunits of RNA Polymerases (RNAP) I and/or III, nothing is known about the function of POLR1A, POLR1C, and POLR1D during embryonic and craniofacial development.
    [Show full text]
  • Regulation of Cell Fate Decisions in the Developing Forebrain by DLX
    Regulation of cell fate decisions in the developing forebrain by DLX transcription factors by Mikaela Nevin A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science Medical Sciences- Medical Genetics University of Alberta © Mikaela Nevin, 2020 Abstract Introduction The Dlx1/Dlx2 double knockout (DKO) mouse exhibits major defects in forebrain development including a block in differentiation and migration of GABAergic interneurons from the subpallium to the cortex. In addition, the Dlx1/Dlx2 DKO mouse generates more oligodendrocyte progenitor cells (OPC) during forebrain development, and this occurs at the expense of interneuron generation. This phenotype suggests a role for DLX genes in mediating the neuronal-glial cell fate switch in the developing forebrain. Furthermore, expression of many oligodendroglial lineage genes is increased and occurs earlier in the DKO forebrain. As such, we hypothesized that DLX2 actively represses acquisition of oligodendroglial cell fate in a subset of forebrain neural progenitor cells by direct transcriptional repression of multiple genes required for oligodendroglial development. Here, I aimed to determine whether DLX2 represses expression of the oligodendroglial lineage genes Myt1 and Plp1 during forebrain development. In order to further characterise this gene regulatory network, I also investigated regulation of Plp1 by MYT1. I also investigated whether DLX2 may play a role in regulating progenitor cell fate in the pediatric brain tumour Diffuse Intrinsic Pontine Glioma (DIPG). Methods Chromatin immunoprecipitation with a polyclonal DLX2 antibody was performed on E13.5 mouse forebrain chromatin to determine whether DLX2 occupied candidate promoter regulatory regions of the Myt1 and Plp1 promoters, and with an MYT1 antibody on E14.5 and E18.5 forebrain to determine if MYT1 occupied candidate regulatory regions of the Plp1 promoter.
    [Show full text]
  • DLX Genes: Roles in Development and Cancer
    cancers Review DLX Genes: Roles in Development and Cancer Yinfei Tan 1,* and Joseph R. Testa 1,2,* 1 Genomics Facility, Fox Chase Cancer Center, Philadelphia, PA 19111, USA 2 Cancer Signaling and Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA 19111, USA * Correspondence: [email protected] (Y.T.); [email protected] (J.R.T.) Simple Summary: DLX homeobox family genes encode transcription factors that have indispensable roles in embryonic and postnatal development. These genes are critically linked to the morphogene- sis of craniofacial structures, branchial arches, forebrain, and sensory organs. DLX genes are also involved in postnatal homeostasis, particularly hematopoiesis and, when dysregulated, oncogen- esis. DLX1/2, DLX3/4, and DLX5/6 exist as bigenes on different chromosomes, sharing intergenic enhancers between gene pairs, which allows orchestrated spatiotemporal expression. Genomic alterations of human DLX gene enhancers or coding sequences result in congenital disorders such as split-hand/foot malformation. Aberrant postnatal expression of DLX genes is associated with hematological malignancies, including leukemias and lymphomas. In several mouse models of T-cell lymphoma, Dlx5 has been shown to act as an oncogene by cooperating with activated Akt, Notch1/3, and/or Wnt to drive tumor formation. In humans, DLX5 is aberrantly expressed in lung and ovarian carcinomas and holds promise as a therapeutic target. Abstract: Homeobox genes control body patterning and cell-fate decisions during development. The homeobox genes consist of many families, only some of which have been investigated regarding a possible role in tumorigenesis. Dysregulation of HOX family genes have been widely implicated in cancer etiology.
    [Show full text]
  • Expression and Function of Dlx Genes in the Osteoblast Lineage Haitao Li University of Connecticut School of Medicine and Dentistry
    University of Connecticut OpenCommons@UConn UCHC Articles - Research University of Connecticut Health Center Research 4-2008 Expression and Function of Dlx Genes in the Osteoblast Lineage Haitao Li University of Connecticut School of Medicine and Dentistry Inga Marijanovic University of Connecticut School of Medicine and Dentistry Mark S. Kronenberg University of Connecticut School of Medicine and Dentistry Ivana Erceg University of Connecticut School of Medicine and Dentistry Mary Louise Stover University of Connecticut School of Medicine and Dentistry See next page for additional authors Follow this and additional works at: https://opencommons.uconn.edu/uchcres_articles Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Recommended Citation Li, Haitao; Marijanovic, Inga; Kronenberg, Mark S.; Erceg, Ivana; Stover, Mary Louise; Velonis, Dimitrios; Mina, Mina; Upholt, William B.; Kalajzic, Ivo; and Lichtler, Alexander C., "Expression and Function of Dlx Genes in the Osteoblast Lineage" (2008). UCHC Articles - Research. 49. https://opencommons.uconn.edu/uchcres_articles/49 Authors Haitao Li, Inga Marijanovic, Mark S. Kronenberg, Ivana Erceg, Mary Louise Stover, Dimitrios Velonis, Mina Mina, William B. Upholt, Ivo Kalajzic, and Alexander C. Lichtler This article is available at OpenCommons@UConn: https://opencommons.uconn.edu/uchcres_articles/49 NIH Public Access Author Manuscript Dev Biol. Author manuscript; available in PMC 2009 May 9. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Dev Biol. 2008 April 15; 316(2): 458±470. doi:10.1016/j.ydbio.2008.01.001. Expression and Function of Dlx Genes in the Osteoblast Lineage Haitao Li1, Inga Marijanovic1, Mark S.
    [Show full text]
  • Expression and Localization of Homeodomain Proteins DLX4, HB9 and HB24 in Malignant and Benign Human Colorectal Tissues
    ANTICANCER RESEARCH 24: 955-962 (2004) Expression and Localization of Homeodomain Proteins DLX4, HB9 and HB24 in Malignant and Benign Human Colorectal Tissues PAUL HOLLINGTON1*, PETRA NEUFING2*, BILL KALIONIS3, PAUL WARING4, JACKY BENTEL5, DAVID WATTCHOW6 and WAYNE D. TILLEY1 1Dame Roma Mitchell Cancer Research Laboratories, University of Adelaide, Hanson Institute, IMVS, Adelaide; 2Department of Immunology, Flinders Medical Centre, Bedford Park, South Australia; 3Perinatal Research Centre, Department of Perinatal Medicine, Royal Women’s Hospital, Carlton, Victoria; 4Department of Pathology, Peter Mac Callum Cancer Institute, Melbourne, Victoria; 5Department of Anatomical Pathology, Royal Perth Hospital, Perth; 6Department of General and Gastrointestinal Surgery, Flinders Medical Centre, Bedford Park, South Australia, Australia Abstract. Background: The purpose of this study was to identify accounting for 70% of these cancers (1). Fearon & homeobox genes expressed in the human colon and to determine Vogelstein (2) have described the molecular basis for whether their expression levels were altered between matched non- sporadic colon cancer as a multistep model of carcinogenesis. malignant and malignant colon tissues. Materials and Methods: These genetic events ultimately result in uninhibited cell Homeobox genes expressed in colon tissue were identified by growth, proliferation and clonal tumor development. Known reverse transcription polymerase chain reaction (RT-PCR). genetic mutations account for approximately 80% of sporadic Antibodies
    [Show full text]
  • Dlx1 and Dlx2 Function Is Necessary for Terminal Differentiation And
    Research article 311 Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina Jimmy de Melo1, Guoyan Du2,3, Mario Fonseca2,3, Leigh-Anne Gillespie3, William J. Turk3, John L. R. Rubenstein4 and David D. Eisenstat1,2,3,5,* 1Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, Manitoba, R3E 3J7, Canada 2Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Manitoba, R3A 1S1, Canada 3Manitoba Institute of Cell Biology, Cancer Care Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada 4Department of Psychiatry, University of California, San Francisco, CA 94143, USA 5Department of Ophthalmology, University of Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada *Author for correspondence (e-mail: [email protected]) Accepted 3 November 2004 Development 132, 311-322 Published by The Company of Biologists 2005 doi:10.1242/dev.01560 Summary Dlx homeobox genes, the vertebrate homologs of Distal- Ectopic expression of Crx, the cone and rod photoreceptor less, play important roles in the development of the homeobox gene, in the GCL and neuroblastic layers of the vertebrate forebrain, craniofacial structures and limbs. mutants may signify altered cell fate of uncommitted RGC Members of the Dlx gene family are also expressed in progenitors. However, amacrine and horizontal cell retinal ganglion cells (RGC), amacrine and horizontal cells differentiation is relatively unaffected in the Dlx1/2 null of the developing and postnatal retina. Expression begins retina. Herein, we propose a model whereby early-born at embryonic day 12.5 and is maintained until late RGCs are Dlx1 and Dlx2 independent, but Dlx function is embryogenesis for Dlx1, while Dlx2 expression extends to necessary for terminal differentiation of late-born RGC adulthood.
    [Show full text]