Molecular Basis for Intellectual Disability and Epilepsy: Role of the Human Homeobox Gene ARX

I , I l¡ \-lN I ìo

Molecular Basis for Intellectual Disability and Epilepsy: Role of the Human Homeobox Gene ARX

A thesis submitted for the degree of Doctor of Philosophy to the University of Adelaide

by

Desiree Cloosterman

BSc (Hons)

school of Medicine, Department of Paediatrics, university of Adelaide

November 2005 ll

,rlf the human brain were so simple that we coultl understønd it, we woukl be so simple thøt we couldn't"

Emerson M. Pugh lll

CONTENTS

Summary IV

Statement and Declaration v

vl Acknowledgements..------

List of Abbreviations vlll

CHAPTER I Introduction------.-- 1

CHAPTER 2 Materials and Methods- 43

CHAPTER 3 Conservation of ARX. _.__-_._.1 10

CHAPTER 4 Yeast Two-Hybrid Screening __-_--_ I 33

CHAPTER 5 Confirmation of Y2H Interactions 176

CHAPTER 6 ZebrafishKnockdown Model------.- 203

CHAPTER 7 Conclusions 237

References lv

SUMMARY

Mental retardation (MR) is estimated to affect 2-3Yo of the population and is caused by both environmental and genetic factors. Mutations in Ihe Aristaless-related homeobox gene (AR$ have been found in numerous families with X-linked MR with and without other clinical features including infantile spasms, dystonia, lissencephaly, autism and dysarthria. The aim of this study was to investigate the normal function of the ARX protein within a cellular environment and in development. Discernment of ARX function will improve our understanding about the molecular pathology of intellectual disability and epilepsy, as well as improve our knowledge of the genes and mechanisms required for normal brain development.

The first part of the thesis addressed the conservation of ARX domains and polyalanine regions by the identification and analysis of characterized and novel ARX orthologs. It was found that the ARX homeodomain and aristaless are highly conserved, but the octapeptide domain, exon 2 NLS, fourth polyalanine tract and to a lesser extent the acidic domain are only conserved in vertebrates and the first three polyalanine tracts are only conserved in mammals. The second part of this thesis involved the identification of IPO13, PICKl, PKM2 and AlUp as interacting with ARX by yeast two-hybrid screening and speculated on their functional roles with respect to ARX. The interactions between ARX and the proteins IPOl3 and PICKI were confirmed by coimmunoprecipitation and colocalization studies. Furthermore, it was found that expansion of the first polyalanine tract in ARX, as seen in human patients, resulted in a marked increase of cytoplasmic aggregation, where IPO13 colocalized to these ARX aggregates. This suggests that nuclear import of ARX may be hindered due to expansion of the first polyalanine tract. Finally, a zebrafish knockdown model was generated by the microinjection of antisense arx morpholinos. Microinjection of arx morpholinos resulted in reduced forebrain expression of emx3, dlx2a and dlx5a indicating that arx plays a significant role in forebrain and GABAergic interneuron development.

VI

ACKNOWLEDGMENTS

I would like to take this opportunity to thank the Cytogenetics unit of the Department of Genetics, Women's and Children's Hospital for their financial and moral support and for use of equipment during my PhD. In particular I would like to thank my supervisors Associate professor Jozef Gecz and Professor Grant Sutherland for giving me the opportunity to work in

such an exciting field and for providing guidance and helpful advice when needed- I would also like to acknowledge the MS Mcleod Research Foundation who provided financial support in the form of the MS Mcleod Research Fund Postgraduate Study Award.

I would like to thank my colleagues within the Neurogenetics and Molecular Genetics laboratories that have made this experience an enjoyable one. Thank you to Marie Shaw' Dr Cheryl Shoubridge, Shirley Richardson, Joanna Crawford, Merran Finnis, Tod Fullston, Olivia McKenzie, Dr Mark Corbett, Rachael Bennett, Linda Burrows, Lynne Hobson, Dr Marie Mangelsdorf, Dr Kathie Friend and last but not least Lucianne Vandeleur.

I would also like to thank those that contributed to the work presented within this thesis. Thank you goes to Joanna Crawford, Dr Karen Lower, Michaella Richards and Dr Anne Davy for their help in setting up the yeast two-hybrid systems. I gratefully thank Dr Michael Lardelli and members of his lab (Ben Tucker, Simon Wells, Svanhild Nornes) who collaborated on the zebrafish work including the maintenance, microinjection and fixation of zebrafish embryos. I would like to say thank you to Dr Marie Mangelsdorf for sequence the start of the zebrafish arx gene. A sincere thank you also goes to Dr Igor Dawid and Dr Marc Ekker for the kind provision of plasmids used in zebrafish whole mount in situ hybridization analysis (detailed in materials and methods). Thank you also to Professor Dirk Görlich for the kind provision of the anti-IPO13 antibody. A special thank you goes to Dr Cheryl Shoubridge and to Olivia McKenzie for their contributions towards my work on ARX. Dr Shoubridge kindly collaborated on the work involving the colocalization of ARX with IPOI3 and PICKI and provided yet to be published results regarding aggregate formation of ARX in mammalian cells. I wish to thank Olivia McKenzie for the information and figures regarding the unpublished work of ARX transcriptional repression studies and the yeast two-hybrid work involving ARX polyalanine tracts and AlUp. I would also like to thank Cathy Derwas for cell establishment and maintenance of cell lines. vil

I would like to thank my family for their support during my studies. To my parents Robert and Christine, who lead by example in both working hard and achieving what I aim for. To Nana who shows me every day what courage is and who I am very proud of. To my brother

Shannon who provided unconditional encouragement and who shares a love of a good cup of coffee. To my sister Serenity who showed me that persistence pays off and who understands exactly what I mean whether it be work or life. To Dion, my future brother in law, thank you for making my sister happy and welcome to the family. Finally to Rascal (AKA Evil Kitty dam cute' rd ), you are expensive to keep and I may loose a limb one day, but you are so vlll

LIST OF ABBREVIATIONS

3AT 3 -Amino- 1, 2,4 -T riazole aa amino acid AC acidic domain ACC agenesis ofthe corpus callosum AD activation domain ADP adenosine diphosphate al aristaless gene

ARX Ar is t ale s s -related homeobox gene ATP adenosine triphosphate

bp base pair CNS central nervous sYstem DBD DNA binding domain ECL enhanced chemiluminescent detection EST expressed sequence tag GAP GTPase activating Protein GDI guanine nucleotide disassociation inhibitor GEF nucleotide exchange factor

GFP green fluorescent protein HD homeodomain hpf hours post fertilization HRP horseradish peroxidase HYD/AG hydranencephaly with ambiguous genitalia IPOl3 Importin l3 IQ intelligence quotient ISSX X-linked Infantile Spasms/)(-linked West syndrome ORF open reading frame kb kilo base pairs

KD kilo Daltons MR mental retardation NE nuclear envelope NJ Neighbour Joining NLS nuclear localization sequence IX

NPC nuclear pore complex NS-XLMR non-syndromic X-linked mental retardation OAR aristaless domain OMIM Online Mendelian Inheritance in Man

OP octapeptide domain

PBS phosphate buffer solution PICKl Protein Interacting with C Kinase I PK pyruvate kinase PKM2 Pyruvate Kinase M2 polyA polyalanine

PRTS Partington syndrome SBH subcortical band heterotopia

SC synthetic complete medium

SD standard deviation SHH sonic hedgehog S-XLMR syndromic X-linked mental retardation TCS tonic-clonic seizures UPGMA unweighted pair group method using arithmetic averages UTR untranslated region XLAG X-linked lissencephaly with abnormal genitalia XLMR X-linked mental retardation XMESID X-linked myoclonic epilepsy with genetalized spasticity and intellectual disability Y2H Yeast two-hybrid YPD yeast extract peptone dextrose medium CHAPTER 1

Introduction

1.1.1 AErloI-ocy oF MENTAL RETARDATION ...... '...." """""""'4

I3 l. 2. I . I Neur ons, Cytoskeleton Remodelling and Dendrite s

1.2. 1.2 Synapse Signalling... 17

I .2. l. 3 Trans cription Re gulation......

1.3.1 PAIRED-CLASS HOMEODOMAIN PROTEINS AND ARX ...... ''..20 1.3.2 GENOMIc CrnRactsruzArIoN AND EXPRESSION oF ARX '...... '.'... """"""'22 1.3.3 DEVELOPMENTAL ROLE oF ARX """"""""""25

1.3.4 ARX MurRtIoNS: PHENOTYPE-GENOTYPE CORRELATIoN .."""""""""""'26

l. 3.4. I XJinked West syndrome.. -...... 28 ].3.4.2 XMESID

l. 3.4. 3 Partington Syndrome ...... 30 L3 4.4 Proud Syndrome....-...... 3I ..31 l. 3. 4. 5 Lissencephaly and XL4G......

1.3.5 INren,cND INTRAFAMTLTAL PHENorypE VARIATIoN lN PATIENTS wtrs ARX 428-45lour(24nr)

1.3.6 PoLyALAnmr TRacr EXPANSION DISORDERS...... ".""""""'37

1.4 AIMS CHAPTER 1 - 2

1.1 MENTAL RETARDATION

A person's success in society is often determined or influenced by their level of intelligence'

Though there is no consensus on the dehnition of intelligence, most people have a general impression of the extreme limits to intelligence such as higher than average intelligence or a lower than averuge intelligence. Intelligence is most commonly determined through an individual's performance in standardized IQ (intelligence quotient) tests. Observations have shown that the distribution of IQ score in the general population follows a bell curve (Figure

1.1), with the major proportion of the general population (95%) within 2 standard deviations

(SD) above or below the mean score of 100 (Dingman and Tarjan, 1960; Moser and Wolf, teTr).

-t +3rd 400

0 o ôa E 22

55 t¡13 IO ¡cofr¡

Figure 1.1: Distribution of intelligence across the general population (modihed from

Mackintosh, 1998).

The proportion of the population who possess an IQ of less than 70 (2 SD below the mean

where 1 SD is 15 IQ points) are classified as being mentally retarded (World Health

Organization (WHO), 1993). Though not perfect, a recent definition of mental retardation CHAPTER I - 3

(MR) provided by the American Association on Mental Retardation (AAMR, 2002)

characterizes MR by 1) IQ score; 2) limitations in adaptive behaviour in conceptual, social and practical skills; and 3) the conditions manifesting before 18 years of age. Based upon the

assumption that IQ is a normally distributed continuous variable, MR is estimated to be

present in approximately l-3Yo of the population (Mclaren and Bryson, 1987 Leonard and

Wen,2002; Ropers and Hamel, 2005). Severity of MR is further subdivided into the general

categories of mild, moderate, severe and profound (Table 1.1). It should be noted that the

AAMR initially classified borderline MR as an IQ of 68 - 84 (Herber, 1961), but as the

definition of adaptive behaviour changed, the upper limit of MR became an IQ of 70 or mild

MR (Grossman, 1973; Grossman, 1983). Interestingly a simplified categorization of MR

severity has also been used (Glass, 1991; Crow and Tolmie, 1998; Leonard and Wen, 2002).

In the simplified system an IQ between 50 and 70 is considered mild MR and an IQ below 50

is considered severe MR. Therefore care must be taken when comparing the prevalence of

MR severity across different studies.

Table 1.1: Degree of MR categoriza|ion and prevalence

b I)esree of MR IQ, Simplification Prevalenceb Mild 50-70 Mild 2-3Yo Moderate 35-50 Severe 20-35 S evere 0.3-0.4% Profound <20 Quotients according to (WHO, 1993) and \ilen (2002), Crow and Tolmie (1998) and Glass (1991) CHAPTER 1 - 4

1.1.1 Aetiology of Mental Retardation

MR comprises a large group of highly heterogeneous disorders at the phenotypic and genetic

level. It is generally accepted that both environmental factors and improperly functioning

genes play a role in the aetiology of MR. Environmental factors which cause MR either act

during pregnancy or during infancy. Examples include maternal alcohol consumption, fetal

malnutrition, premature birth, hypotoxia, viral and other infections, lead poisoning and trauma

(American Psychiatric Association, 1994). Unfortunately the cause of MR is unexplained in

approximately 25-40Yo of severe MR cases and most mild MR cases (Chelly and Mandel,

2o0l).

Improperly functioning genes may act separately, in combination with other genes, or in

combination with the environment to cause MR. Genetic causes may be heritable or

spontaneous either through gene mutations or chromosome abnormalities. In the Online

Mendelian Inheritance in Man (OMIM), 1286 entries with MR are found (July 2005).

Chromosome abnormalities including unbalanced translocations, deletions, duplications,

subtelomere rearrangements, account from 4-34.1% of individuals with MR (Xu and Chen,

2003). Of the chromosome abnormalities, trisomy 2l causing Down syndrome, is the most

well known, and is the most common genetic cause of MR (Patterson and Costa,2005).

An increasing number of monogenetic causes of MR have been identified over the last few

years. To date proportionally many more genes on the X chromosome have been found to

cause MR in comparison to any segment of the autosomes. The bias towards genes on the X

chromosome contributing to MR is possibly due to some genes having allelic heterogeneity

such as MECP2 and to the preferential screening for gene mutations on the X chromosome in CHAPTER I - 5

possible bias towards the X hemizygous males (Zechner et al., 2001)' Dispite the the importance of genes chromosome, the number of genes discovered to date demonstrates on the X chromosome contributing to MR'

1.2 X-LINKED MENTAL RETARDATION

with MR has long been An excess of males compared to females among individuals

cases of institutionalised MR there recognised. In 1938 Penrose determined that from 1280

the absence of an excess of male was a 200lo excess of males (Penrose, 1938). However, in

was due to genes on the siblings with MR he dismissed the possibility that the sex difference succeptibility to environmental X chromosome and instead attributed the excess to a male MR were twice as likely to effects. This was f-ollowed by the observation that females with

(Reed and Reed, 1965)' Later the produce retarded offspring compared to males with MR

was in part attributed to mutations 30%o excess of males affected by MR compared to females

Turner,1974; Herbst and Miller' in X-linked genes (Lehrke,1972;Lehrke, 1974; Turner and

1980).

(XLMR) affected 1'83/1000 In 1980, Herbst and Miller estimated X-linked mental retardation where MR was not the males, but did not include neurological or syndromal conditions

frequency of mild MR are primary diagnosis (Herbst and Miller, 19s0). Estimations on the sufficiently in society but if variable due to problems identifling patients who may function estimating the frequency of mild tested would be classed as mildly retarded. Variability in As such it is difficult to MR can also occur due to differences in types of IQ tests used' studies show that an estimate the prevalence of mild XLMR. However, epidemiological

(Leonard and Wen, 2002), which is excess of males with mild MR has an average ratio of 1.9 CHAPTER 1 - 6 about equal to that estimated by Herbst and Miller (1930). If it is assumed that the excess of males in the mild MR category is entirely due to X-linked genes and that no females are affected, then this suggests that nearly 50Y, of mild MR is X-linked. Fishburn et al. (1983) estimated the prevalence of moderate to severe MR (IQ <50) due to XLMR to be 5/10000

(0.05%) (Fishburn et a\.,1983). Ropers and Hamel (2005) also estimated a similar frequency of severe XLMR in males to be 0.08%, or 10-16%o of all severely retarded patients, based upon the incidence of Fragile X syndrome (Ropers and Hamel, 2005). Of course it must be

noted that social, economic (e.g. education), cultural, raciallethnic and other environmental

factors can influence the estimates of MR prevalence (reviewed in Leonard and Wen, 2002).

XLMR can be roughly categorized into the two groups of syndromic XLMR (S-XLMR) and

non-syndromic XLMR (NS-XLMR). S-XLMR cases have a consistent distinguishing clinical,

radiological or biological feature aside from mental retardation. Whereas in NS-XLMR cases

the only distinguishing phenotype is MR or affected members of the same family do not

display consistent clinical features which would allow classification into a syndrome (Mulley

et al., lgg2). The most common form of inherited MR discovered is Fragile X mental

retardation syndrome. Fragile X syndrome, estimated to affect 1/4000 males and 1/7000

females (Turner et a\.,1996 Crawford et a\.,2001), is typically caused by trinucleotide repeat

expansion in the 5' untranslated region of the FMRI gene preventing expression of the

encoded protein (Oberle et al.,l99l; Verkerk et al',l99l;Yu et al',1991)'

Approximately 140 forms of S-XLMR have been described to date. In 66 of these the

causative mutations in genes have been identified (Figure 1.2), including some of which were

allelic, and about a further 50 have been mapped to a region of the X chromosome. In

contrast, less than 50% of the estimated genes have been discovered for NS-XLMR (lod score CHAPTER 1 - 7

82 NS-XLMR families (MRX) > 2; Figure 1.2), which coffesponds w\th24 of the reported

estimated that there are more (reviewed in Kleefstra and Hamel, 2005). A recent review has XLMR (Kleefstra and Hamel' than a 100 genes in total that are responsible for monogenic of genes involved in XLMR 2005). However, this may be an overestimation of the number

recently as causing XLMR and are considering that some of these genes were only identifred every family with overlapping therefore unlikely to have been screened for mutations in linkage intervals'

positional cloning using pooled Monogenic causes of s-XLMR are generally mapped by However, discovering families that share similar clinical phenotypes for linkage analysis' the extreme heterogeneity that monogenic causes of NS-XLMR is more difficult due to pooled families for linkage studies occurs in NS-XLMR families which excludes using are identified by (Chelly and Mandel, 2001). Instead monogenic causes of NS-XLMR

genes affected by X positional cloning in individual large NS-XLMR families, identiffing protocols for large-scale chromosome reafrangements and semi-automated mutation-detection

and Hamel,2005)' mutation screening of candidate genes (Lower et a\.,2001; Ropers

found to cause S-XLMR Significantly, genes identified to cause NS-XLMR have also been

the genetic cause of XLMR based upon demonstrating that it is not always easy to distinguish

mutations in a gene may initially be phenotype alone (Figure 1.2).Furthermore, even though

can be reclassified as s-XLMR' For described as NS-XLMR, reanalysis has shown that they identified by cloning the example, oligophrenin-l encoded by the 7PHNI gene \Ùas where a frameshift mutation in breakpoint t(x; 12) in a female with mental retardation, (Billuart et aI'' 1998)' However' OPHNI was subsequently identified in the family MRX60

reanalysis of the translocation after detection of mutations in three additional families and CHAPTER 1 - 8

OPit/BBB MIDI NLGN4 I OFDI Oro-facio-digital Xp22 -t RSK2 Coffi Rettlike, Infantile sPasms CDKL5 ARX W"" AG, Partington* Nance-Horan NHS Spermine sYnthase defi ciencY SMS _ Pyruvate decarboxylase dehciency PDHAI ILIRAPLI GK GlYcerol kinase deficiencY Xp21 Duchenne muscular dYstroPhY DMD Omithine transcarbamylase defi ciency OTC TM4SF2 ZNFSI BCOR OFCD, Lenz microPhthalmia ZNF4l EPilePsY ATP6AP2 Xp11 FTSJI Monoamineoxidase-Adeficiency MAOA JARIDI NDP Norrie PQBPI EPilePsY, macrocePhalY SYN| KlAAl202 Stocco dos Santos FGDI Cleft lip/Cleft Plate PHFS Xql OPHNI Cerebellar hYPoPlasia - 13 transporter deficiency tT+iîí Xqf f DLG3 þ XNP ATR-X, Caçenter-Waziri, Holmes-Gang, -l Chudley-L mith-Fineman-MYers' Juberg-Ma

Phosphoglycerate kinase defrciency PGKl Pelizaeus-Merzbacher PLP Xq21 Mohr-Tranebjaerg TIMMSA F

PRPP synthetase hYPeractivitY PRPSI Xq22 ACSL4 LissencePhalY DCX -1 PAK3 Danon LAMP2 Xq23 Lowe OCRL GPC3 XqZ4 AGTR2 SimPson-Golabi-Behmel - Börjeson-Forssman-Lehmann PHF6 Lesch-NYhan HPRT Xq25 Growth hormone defi ciencY sox3 X FMRI Fragiìe Xq26 _ ARHGEF6 Hunter IDS AdrenoleukodYstroPhY ABCDI MASA LlCAM Xq21 MECP2 n"tt BPNH, OPD FLNA FMR2 GDII Incontinentia Pigmenti IKBKG Xq28 DYskeratosis congenìta DKCI SLC6AST

the X chromosome. Genes Figure 1.2: Schematic drawing of the genes causmg XLMR on the left and genes causmg causing s-xLMR and their associated syndromes are listed on

have been shown NS-XLMR and s-xLMR are shown on the right. A red star signifies genes

to cause both syndromic and non-syndromic XLMR'

reclassified as a S-XLMR gene female and the affected males from MRX60, oPHNl was the merging boundaries (des Portes et a1.,2004; Kleefstra and Hamel, 2005). Although

basis for distinguishing between S-XLMR and NS-XLMR indicate that there is no molecular CHAPTER I - 9 between the two groups, it is still presently useful for the identification of genes causing

XLMR. As we discover more about the molecular function of genes causing S-XLMR and

NS-XLMR it is possible that they will be subcatagorized into groups based upon the genes themselves or their molecular functions.

1.2.1 Gene Function and the Brain

The development and maintenance of the human brain is a complicated process and as such it

is expected that there would be vast differences observed in cellular functions of the genes

discovered to be involved with XLMR (Tables 1.2 and 1.3). Not all genes discovered causing

XLMR are just involved in brain development. Some XLMR genes play important roles in

cellular processes such as cell survival and energy metabolism and therefore additionally

affect developmental process other than those involved in brain development. Though the

understanding of the molecular mechanisms of genes involved in XLMR is far from

complete, improvement in the understanding of processes involved in brain development is

rapidly building. Indeed, as discussed below, some XLMR genes play key roles in regulating

developmental processes such as dendrite morphology and neurite outgrowth, synapse

signalling and transcription regulation. CHAPTER 1 - IO

Tabte 1.2: Genes involved in syndromic forms of XLMR

References Gene bol Protein Function M]D] Microtubule-associated ubiquitin ligase; role in protein (Quaderi et a1.,7997) degradation (Ltu et a1.,2001) (Trockenbach et et al., 2001) (Ferrante et aL.,2001) OFDl Possible role in regulation of microtubule dynamics (Emes and Ponting, 2001) (Kalscheuer et al., 2003b) CDKL5 Serine-threonine kinase; phosphorylates MECP2

6rKe) (Trivier et al.,1996) RSK2 Growth factor regu Protein kinase, phosphorylates CR s a role in learning (Xing er aL.,1996) (Harum et dL.,2001) ànd memôry, role i ation and function (Yanget aL.,2004) and (Burdon et a|.,2003) NÉlS Proposed key roles in the regulation of eye, tooth, brain,

(Stromme et aL.,2002) ARX (Bienvenu et aL.,2002) (Kitamura et aL.,2002) (Collombat et al., 2003) (Cason et a|.,2003) SMS Spermine synthase PDHAl Role in energy metabolism (Endo e/ a1.,1989) (Brown et aL.,1994) in (Guo et al.,1993) GK Glycerol kinase enzyme in glycerol metabolism, involved (Ropers and Hamel, 2005) nuclear translocation of the glucocorticoid-receptor complex (Koenig et al.,1987) DMD Component of the dystrophin-glycoprotein complex, possible a1.,2004) role in neurite outgrowth (Acosta et (Tuchman et aL.,2002) OTC Key enzyme in urea cYcle (Nget aI.,2004) BCOR Tránscrþtional co-repressor possibly mediated through histone acetylation and chromatin remodelling (Ramser et aI.,2005) ATP6AP2 Renin receptor; activates ERKI/2 (Brunner et a|.,1993) MAOA MAO; serotonin metabolism (Berger et a|.,1992) NDP Secreted protein, ligand offrizzledteceplot, key role in vascular development in the eye and ear (Xu et aL.,2004) (Jensen et aL.,2005) JARID]C Transcription factor; role in chromatin remodelling (SMCÐ (Garciaet a\.,2004) SYNl Synaptic vesicle-associated protein involved in regulation of et aL.,2004a) synaptogenesis and neurotransmitter release (Giovedi (Giovedi et aL.,2004b) (Kalscheuer et al., 2003a) PQBPl Polyglutamine-binding; role in pre-mRNA processing (Ropers and Hamel, 2005) KIAAI2O2 PDZiomain-containing protein; possible role in actin

(Ropers and Hamel, 2005) PHFS (Pasteris et aL.,1994) FGD] (Hou e/ aL.,2003) (Billuart et al.,1998) OPHN] dendritic spine length (Govek etaL.,2004) (Dumitrescu et al., 2004) SLC]642 Transports thyroid hormone into the cell (Chelly et aL.,1993) ATPTA Copper-transporting P-type ATPase (Petris and Mercer, 1999) (Gibbons et a\.,1995) XNP DNA helicase; chromatin remodelling, regulator of gene et a1.,2005) (ATRÐ expression; regulator of cortical size (Berube (Michelson et al., 1983) PGKl Phosphoglycerate kinase is a major enzyme in glycolysis (lkemoto et aL.,2003) (Cremers et aL.,1987) PLP Encodes two membrane-bound proteins that are components (Saugier-Veber et al., 1994) of the myelin sheath ool et al. CHAPTER 1 - 11

Table 1.2: Genes involved in syndromic forms of XLMR continued

Gene Symbol Protein Function References T]MMgA Mitochondrial inner membrane transport protein (Iin et al., 1996) (Roesch et a1.,2002) PRPS/ Catafytic enzyme necessary for de novo and salvage pathway (Roessler et a\.,7990) biosynthesis of purine, pyrimidine and pyridine (Becker et al.,1995) DCX Microtubule-associated protein that is thought to play a role in (Gleeson et al.,1998) the growth ofleading neuronal processes (des Portes et al., 1998) (Friocourt et al,, 2003) LAMP2 Acts as a receptor in the lysosomal membrane, critical for (Nishino et aL.,2000) chaperone-medi ated autophagy (Cuervo and Dice,2000) OCRL] Phosphatidylinositol 4,5-bisphosphate 5-phosphatase with (Attree et a|.,1992) PIP2 as preferred substrate, associates with Rac (Fauchene et a1.,2003) GPCJ Cell-surface proteoglycan glypican 3, negative regulator of (Pllia et al., 1996) proliferation, regulator of cell survival, possibly modulator of (Filmus,2002) IGF2 signalling PHF6 Nucleolar PHD zinc-finger protein; possible role in (Lower et a1.,2002) transcription HPRT Key enzyme in the regulation of purine metabolism (Wilson and Kelley, 1983) SOX3 Transcription factor, role in morphogenesis of Rathke's pouch (Laumonnier et al., 2002) and correct function of hypothalamic-pituitary axis (Rizzoti et aL.,2004) FMR] mRNA binding protein; regulation of mRNA transport and (Verkerk et al.,l99l) translation (Iin et a1.,2004) IDS Role in lysosomal mucopolysaccharide degradation (Wilson et aL.,1990) ABCD] Peroxisomal ATP binding cassette (ABC) transporter protein, (Mosser et aL.,1993) role in verylong-chain fatty acid metabolism (McGuinness et al., 2003) MECP2 Mediates transcriptional repression of neuronal genes (Amir el aL.,1999) (Chen et aL.,2003) LlCAM Axonal glycoprotein, role in axonal guidance and growth, (Rosenthaf er al., 1992) migration, axon bundling, synaptogenesis, myelination and (Jouet er al., 1994) neuronal cell survival (Kenwrick et a|.,2000) FLNA Actin-binding protein; role in neuronal migration and neurite (Fox et a1.,1998) outgrowth (Robertson et al., 2003) IKBKG Essential modulator of NF-rB (Smahi et aL.,2000) (NEMO) (Bruckner,2004) SLC6A8 Creatine transporter (Salomons et a\.,2001) (Salomons et aL.,2003) DKC] Associates with small nucleolar RNA, role in ribosomal RNA (Heiss el aL.,1998) and telomerase function et al. CHAPTER 1 - 12

Table 1.3: Genes involved in non-syndromic forms of XLMR

References Gene bol Protein Function et al., 2004) NLGN4 Postsynaptic membrane Protein, involved in formation of (Laumonnier presynaptic terminals, linked to NMDA receptors (Cblh et a\.,2004) (Trivier et a\.,1996) RSK2 Growth factor regulated serine-threonine protein kinase, phosphorylates CREB and therefore plays a role in learning (Xinget a1.,1996) and memory, role in osteoblast differentiation and function (Harum et aL.,2001) (Yanget a|.,2004) ARX Transcription factor; possible role in axonal guidance in the (Stromme et a1.,2002) (Bienvenu et aL.,2002) fl oor pl ate ; ro le in neuronal prol i feration/d ifferenti ation/ migration of GABAergic interneurons in the forebrain; role (Kitamura et aL.,2002) in differentiation of endocrine pancreas cells (Collombat et al., 2003) IL] RAPL Regulator of dense-core-granule exocytosis, possible (Carrie et aL.,1999) regulator of neurotransmitter release (Bahi et a1.,2003) et al., 1996) TM4SF2 Membrane protein that interacts with integrins, possible role (Kopczynski in synapse formation (Zemniet aL.,2000) ZNFS] Zinc finger protein (Kf eefstra e/ al.,2004) ZNF4l Zinc frnger protein; proposed transcriptional regulator (Shoichet et aL.,2003) involved in chromatin remodelling FTSJl RNA methyltransferase, possible role in posttranscriptional (Freude et aL.,2004) modification of tRNA and in translation (Ramser et aL.,2004) JAND]C Transcription factor; role in chromatin remodelling (Jensen et aL.,2005) (sMCX) PQBPl Polyglutamine-binding; role in pre-mRNA processing (Kalscheuer et al., 2003a) FGD] RhoGEF; important role in regulating actin cytoskeleton (Pasteris et al., 1994) organisation and subsequently cell shape and mobility (Hou e/ aL.,2003) DLG3 Membrane-associated guanylate kinase protein, interacts (Tarpey et aL.,2004) directly with NR2 subunits of the NMDA glutamate receptor XNP DNA helicase; chromatin remodelling, regulator of gene (Gibbons et a|.,1995) (Berube aL.,2005) ØrRX) expression; regulator of cortical size el ACSL4 Long-chain Acyl-CoA synthase, suggested role in (Meloni et a|.,2002) (FALC4) membrane synthesis and/or recycling processes (Renieri et aL.,2005) PAK3 Regulation of actin cytoskeleton, stimulation of neurite (Allen et al.,1998) outgrowth and regulation of dendritic spine morphogenesis (Ramakers,2002) and synapse formation (Zhanget a\.,2005) AGTR2 Angiotensin recePtor 2 (Vervoort et aL.,2002) ARHGEF6 Integrin-mediated activation of Rac and cdc42, regulation of (Kutsche et a1.,2000) dendritic spine morphogenesis and synapse formation (Rosenberger et al., 2003) (Zhanget a\.,2005) MECP2 Mediates transcriptional repression of neuronal genes (Amir et a\.,1999) (Chen et a1.,2003) FMR2 Transcriptional co-activator, possibly role in long-term (Gecz et a1.,1996) memory and long-term potentiation in the hippocampus (Gu et aL.,1996) (Hillman and Gecz, 2001) (Gu et a1.,2002) GDI] RabGDI protein, plays a role in synaptic vesicle recycling (D'Adamo et a1.,1998) (D'Adamo et aL.,2002) SLC6A8 Creatine transporter (Salomons et a\.,2001) Salomons s/ a/ 200 CHAPTER 1 .13 l.2.l.l Neurons, Cytoskeleton Remodellin g and Dendrites

of a single main axon and Neurons are highly polarized cells which are typically composed cell body' In general' the axon relays several highly branched dendrites projecting from the

receive signals from the axons of signals away from the neuronal cell body, and the dendrites the shafts of dendrites on some other neurons and relay them to the cell body. Coating Most excitatory synapses in spiny neurons are micro-long extensions called dendritic spines. inhibitory synapses are typically neurons are located on the dendritic spines, whereas most excitatory and inhibitory synapses located on the dendrite shafts. For non-spiny neurons both

(forreview see Lee and Sheng' 2000; are located along the lengths of the dendrite branches

Nimchinsky et al',2002;Van Aelst and Cline, 2004)'

affect the formation of neural Abnormalities in dendrites and dendritic spines would likely resulting in assorted psychiatric networks and the processing of neural transmission, therefore

been noted that MR is associated with diseases and neurologic disorders. Indeed, it has long 1972; Huttenlocher' 1974; abnormalities in dendrites and dendritic spines (Marin-Padilla, be involved in dendrite and Purpura, lg74). A number of XLMR genes are proposed to

the FMRI gene has been shown dendritic spine formation (Table 1.2 and l'3)' For example, When FMRI is mutated in to be important for dendrite development and synapse function'

are longer and more immature in humans and Fmrl knock-out mice, dendritic spines that (Comery et al', 7997; lrwin et al'' appearance have an increased density in the visual cortex

analysis of the Fmrl knock- 2001;Nimchinsky et a:.,2007; Irwin et a1.,2002). Furthermore,

gene, is involved in synaptic plasticity out mice suggests that FMRP, encoded by the Fmrl at synapses (Huber et al'' through regulation of mRNA transport and local protein synthesis

2002). CHAPTER I - 14

and dendritic spine XLMR genes are also known to play key roles in dendritic outgrowth and cytoskeletal architecture' formation and dynamics through regulating the Rho GTPases

which are GTP-binding proteins that Rho GTPases belong to a superfamily of small GTPases the cytoskeleton' They act as molecular switches in linking cell surface receptors to

state and an inactive GDP-bound accomplish this by cycling bet,veen an active GTP-bound

Among the small GTPases, Rho GTPases state (Figure 1.3) (reviewed in Takai et a\.,2001). for the regulation of a number of mediate organisation of the cytoskeleton, which is essential outgrowth and migration' processes including morphologic differentiation, neurite

and remodelling' synapse formation, establishment of cell polarity, dendritic spine formation 2002)' and synaptic plasticity (Hall, 1998;Takai et al',2001;Ramakers'

is regulated by both positive and Cycling of Rho GTPases between active and inactive states 1997;Takai et al''2007)' negative mechanisms (reviewed in Van Aelst and D'Souza-Schorey' nucleotide exchange factors (GEFs) in Exchange of GDP for GTP is regulated by guanine conversely GTPase activating response to upstream signals such as integrin signalling' small GTPases by stimulating proteins (GAPs) increase the intrinsic GTPase activity of

GTPases are regulated by guanine GTPase hydrolysis of GTP to GDP. Additionally, small the GDP-bound conformation of nucleotide disassociation inhibitors (GDIs), which stabilize Finally there are the downstream small GTPases, thus keeping them in the inactive state' to the active GTP-bound form of effector proteins of small GTPase signalling, which bind

small GTPases. CHAPTER 1 - 15

Inactive form GDP

GTP Pi

Upstream (aPlX, FGDl) <- Signal (oPHNl) GDP ((xGDI)

Rho/Rab Active form GTP Effectors (PAK3 Synapsin r) + Downstream Signal

inactive GDP Figure 1.3: Cycling of small GTPases (including Rho and Rab) between an by positive and bound state and an active GTP bound state. Small GTPases are regulated (GEFs)' GTPase negative factors (blue) such as guanine nucleotide exchange factors

(GDIs)' Genes activating proteins (GAps) and guanine nucleotide disassociation inhibitors or act as direct known to cause XLMR and play a role in regulation of small GTPases

downstream effectors are indicated in brackets'

cr,PIX (or cool-2) of the genes involved in XLMR, ARHGEFî encodes a Rho-GEF known as kinase (PAK) (Kutsche et a;.,2000), which also stimulates p21-activating serine/threonine

to regulate activity (Bagrodia et al., 1998; Daniels et at., 1999). cr,PIX has been shown

Rac (a Rho GTPase) dendritic spine morphogenesis and synapse formation along with PAK3, (Zhang et al', 2005)' and G-protein-coupled receptor kinase-interacting protein 1 (GITI) the Rho GTPase pAK3 is another XLMR gene which is a critical effector protein that links (Allen et al., 1998)' Another signalling to the actin cytoskeleton and MAP kinase cascades CHAPTER 1 - 16

which plays an important role in Rho-GEF involved in XLMR is FGD\ (Lebel et al',2002), OPHNl encodes a Rho-GAP (Billuart e/ regulating cell mobility and shape (Hou e/ a\.,2003)' to play a role in the maintenance of al., 799l;Fauchereau et al',2003), which is proposed the encoded protein oligophrenin-l dendritic spine length (Govek et a:.,2004). Furthermore, in dendritic spine morphogenesis was found to bind to Homer proteins, which are involved

glutamate receptors (mGluRs) to multiple and synaptic transmission by linking metabotropic

intracellular targets (X\ao et al',2000; Govek et al''2004)'

in cytoskeleton remodelling' For example' A number of other XLMR genes are also involved

in neuronal migration and outgrowth (Fox FLNAis an actin binding protein which is involved

contains an EVH1 DOMAIN that indicates it et a1.,199S). KIAAI202 encodes a protein that remodelling (Ropers and Hamel, 2005)' The also binds to actin and has a role in cytoskeletal actin f,rlaments and with a complex of DMDgene encodes dystrophin, which associates with

proteins known collectively as the dystrophin- transmembrane glycoproteins and cytoplasmic and Campbell' 1991; associated protein complex (DAPC) (Yoshida andOzawa,l990;Ervasti

and was found to be required suzuki et al., lgg2).Dp71 is the major isoform of dystrophin

and DCX genes encode proteins for neural outgrowth (Acosta et a1.,2004). Both the MIDI

a microtubule-associated ubiquitin ligase that bind to the microtubule cytoskeleton. MIDI is (Trockenbacher et al'' 2001)' that targets protein phosphatase 2A (PP2A) for degradation

whereastheDCXencodedproteindoublecortin,stabilizesandcausesbundlingof of leading neuronal processes (Horesh ef microtubules suggesting it plays a role in the growth

al., 1999 ;Friocourt et al'' 2003)' CHAPTER 1 - 17

1.2.1.2 Synapse Signallin g

in synapse induction' structure and Some XLMR genes are also proposed play important roles primarily to the postsynaptic function. For exampl e, NLGN4 (encoding neuroligin 4) localizes the formation of presynaptic membranes of glutamatergic synapses where they stimulate

synapse-associated protein 102 terminals of adjacent axons (Chih et at.,2004). DLG3 encodes guanylate kinase (sAP102), which is a member of the postsynaptic membrane-associated

(MAGUK)proteinfamily.SAP1O2interactswithN-methyl-D-aspartate(NMDA)-type

receptor localization' glutamatergic receptors and with other proteins responsible for NMDA involved in the regulation of immobilization, and signalling. This suggests that DLG3 may be

changes within the synapse and neurotransmitter receptor clustering, resulting in structural

regulation of synaptic plasticity (Tarpey et al',2004)'

IL1RAPL1 was found to other XLMR genes are also involved in synapse vesicle transport-

plays a role in the regulation interact with neuronal calcium sensor-1 (NCS-1) protein, which ILIRAPLI was found to play a of dense-core granule exocytosis (Bahi et at.,2003)'Since be involved in the modulation negative role in exocytosis, this suggests that ILIRAPLI may which regulates Rab protein of neurotransmitter release. GDII encodes the protein c¿GDI, and fusion of vesicles recycling fiom membranes. Rab GTPases regulate the targeting endocytic pathways (reviewed transporting cargo between compartments in the exocytic and Rab GTPases was in Takai et a1.,2001). ln Gdi|-deficient mice, concentration of several available pool of synaptic reduced, which likely caused a reduction in the immediately synaptic plasticity in vesicles. Reduced concentration of Rab GTPases resulted in reduced short-term memory CA3-CA1 hippocampal neurons and impaired hippocampus-dependent

is an important effector of (D'Adamo et a1.,2002). The sy]vrl gene encodes synapsin 1 which CHAPTER 1 - 18

Rab3A GTPase (Giovedi et a1.,2004a; Giovedi et a1.,2004b). 'SIll1 plays a developmental role in axon elongation, branching, synaptogenesis, and neurotransmitter release by regulating the release of synapse vesicles from a reserve pool of vesicles attached to the actin cytoskeleton (Greengard et a\.,1993;Li et al.,1995 Takei et aL.,1995; Ferreira et al.,1998)-

I.2.1.3 Transcription Regulation

Regulation of gene transcription and chromatin remodelling is becoming one of the main themes of XLMR gene action . ARX and SOX3 are homeodomain transcription factors which when mutated have been shown to cause XLMR (Figure 1.2). ARX was found to act as a transcriptional activator and repressor (Seufert et a\.,2005), and to regulate the proliferation, migration and differentiation of GABAergic interneurons in forebrain development (Kitamura et aI., 2002). SOX3 was recently found to be required in the ventral diencephalon for the correct morphogenesis and differentiation of the infundibulum and hypothalamus, correct morphogenesis of Rathke's pouch, and corect formation of the hypothalamic-pituitary axis

(Rizzoti et a\.,2004). Both PHF6 and PHFB are PHD zinc-finger proteins that are thought to

play arole in transcription, but their exact role remains to be elucidated (Lower et a1.,2002;

Ropers and Hamel, 2005).

The XLMR genes FMR2, JANDIC and MECP2 are all transcriptional regulators. FMR2 is a

transcriptional co-activator that likely plays a role in synaptic plasticity to regulate long-term

memory and long-term potentiation in the hippocampus (Gecz et a\.,1997; Hillman andGecz,

2001; Gu et at.,2002). Though the function of JARIDIC is presently unknown, it belongs to

the JARID1 subfamily of ARID DNA-binding proteins that potentially involves it in

transcription regulation and chromatin remodelling processes (Jensen et a|.,2005). MECP2 CHAPTER I - 19 selectively binds to 5-methyl cytosine residues in symmetrically positioned CpG dinucleotides (Lewis et at.,1992) where it recruits histone deacetylases and the transcriptional corepressor SIN3A to silence transcription of neuronal genes (Jones et a1.,1998; Nan et al.,

1998; Caballero and Hendrich, 2005). In the brain MECP2 was found to be important for the maturation and maintenance rather than the proliferation and cell fate decisions of neurons

(K i shi and Mackl i s, 20 0 4 ; Matar azzo and Ronnett, 200 4) .

CDKL5 (also known as SZrKg) is a member of the serine-threonine family of kinases (Montini et a1.,7998). It was recently found that CDKL5 is capable of phosphorylating MECP2 (Mari et a1.,2005), which supports the finding that mutations in either MECP2 ot CDKL5 cause

Rett syndrome or a variant of Rett syndrome respectively (Amir et al., 1999; Scala et al',

2005). Another serine-threonine kinase gene RSK2 is also involved XLMR (Trivier et al.,

1996). RSK2 rvas shown to phosphorylate the transcription factor cyclic adenosine monophosphate response element binding protein (CREB) (Trivier et a1.,1996; Xing et al',

1996). phosphorylation of CREB was subsequently shown to be reduced in patients with

Coffin-Lowry syndrome, suggesting that RSK2 phosphorylation of CREB plays an important role in learning and memory (Harum et al., 2001). RSK2 has also been shown to

phosphorylate ATF4, a transcription factor important for osteoblast differentiation and

function (Yang et aL.,2004).

Mutations in BCOR causes Oculofaciocardiodental andLenz microphthalmia syndromes (Ng

et al., 2004). BCOR encodes a transcription co-repressor, which interacts with histone

deacetylases, suggesting that it is involved in transcriptional repression mediated through

chromatin remodelling (Huynh et a1.,2000). The XLMR gene XNP (also known as ATRX)

encodes a protein that contains an ATPase/helicases domain homologous to that found in CHAPTER I - 20

xNP has been members of the SNF2 family of chromatin-remodelling proteins. Moreover, is able to shown to have ATPase activity (Gibbons et al., 1995 Tang et a1.,2004). -17/P protein (Daxx) which suppress transcription and interacts with death domain-associated thatå?/P localizes to modulates transcription and apoptosis (Tang et al',2004)' Studies show

(HPlo), an pericentromeric heterochromatin and associates with heterochromatin protein 1cr

(McDowell et al', adaptor molecule involved in the propagation of heterochromatic domains

as contains a plant 1999; Berube et a1.,2000). xNP is also suggested to methylate DNA it 3 family of homeodomain (pHD) zinc finger domain similar to the DNA metþltransferase in ATR-X proteins, and abnormal methylation patterns at several genomic loci was noticed

survival patients (Gibbons et a1.,2000). Furthermore,XNP was shown to be critical for cell

cortical size during early neuronal differentiation, and as such may be involved in regulating

(Berube et aL.,2005).

1.3,4,RXGENE

1.3.1 Paired-Class Homeodomain Proteins and ARX

Paired-class Aristaless-related homeobox gene (AR$ belongs to a subset of Aristaless-related

factors that play (prd-class) homeodomain proteins. Homeodomain proteins are transcription

the critical roles in developmental patterning and differentiation. They do this by modulating manner (for expression patterns of target genes in a temporal, spatial and tissue specific

defìned by a review see (Banerjee-Basu and Baxevanis, 2001). Homeodomain proteins are binds to lggbp helix-loop-helix DNA binding domain termed the homeodomain, which CHAPTER 1 - 21

is A/G, and N is any palindromic DNA sequences TAATYNRATTA, where Y is cÆ, R nucleotide (Wilson et al',1995)

homeodomain related to the Prd-class homeodomain proteins are defined as having a

gene- Proteins belonging to the Prd- homeodomain encoded by the Drosophila paired Qtrd)

Pro-26, Asp-27, Glu-32, Arg-44' class contain at least 5 of the 6 diagnostic invariant residues Within the Prd-class of Gln-46 and Ala-54 in their homeodomain (Galliot et al., lg99)' for confening different homeodomain proteins, position 50 of the homeodomain is critical Galliot et al'' 1999)' DNA binding specificities onto homeodomains (Wilson et aI', 1995;

are divided into three According to the residue at position 50, genes belonging to the Prd-class

genes contain a serine residue at subclasses (Galliot et al., 1999). The Pax- or Prd-type called the paired position 50 of the homeodomain and have a second DNA-binding-domain

the paired domain' The second domain. The other two subclasses afe Prd-like as they lack

a lysine residue at position 50 and subclass is related to Ofthodenticle where the proteins have

to the third subclass of Prd-like genes are thus named Kso Paired-like (Prd-like). ARXbelongs Prd-like' that contain a glutamine residue at position 50 and are known as Qso

distinct gene families, of which aristaless (al) is within the Q5e Prd-like subclass are twelve proteins contain a conserved one (Meijli nk et al., lggg). The Aristal¿ss-related family of C-peptide or Paired-tail domain) domain at their c-terminus (known as the aristaless, oAR, Also conserved in that is structurally related to the Drosophila melanogaster gene aristaless' including ARX' is the various members of Prd-class proteins, especially the Q56 subclass

the aristaless and octapeptide octapeptide domain. While not much is presently known about (Hollenbach et al'' 1999; domains, they have been shown to play a role in transcription A more in- depth Eberhard et a1.,2000; Dasen et a1.,2001; Hollenbach et al',2002)' CHAPTER 1 - 22

to discussion about the potential roles of the octapeptide and aristaless domains in regard

ARX function is included in Chapter 3.

of which is In addition, the ARX protein also contains two nucle ar localization sequences one part of the homeodomain, an acidic domain and four polyalanine tracts (Figure 1.4). Acidic

activation domains are common to transcription factors and often act as transcriptional

remains largely domains (Roberts, 2000). The function of polyalanine rich regions however, 2003; unknown. polyalanine regions are enriched within transcription factors (Lavoie et al''

as to Brown and Brown,2004), which suggests that they play a role in transcription such

regions directly repress transcription (Han and Manley, lgg3). Alternatively polyalanine rich

orientation of other are thought to act as a spacer or hinge regions to help maintain the proper

domains within the protein (Karlin et a\.,2002;Brown and Brown, 2004).

1.3.2 Genomic Characterization and Expression of ARX

Arx wasfirst isolated in the mouse (Mus musculus) and zebrafish (Danio rerio) (Miura et al',

et al',2002)' 1997) andwas subsequently isolated in humans (Bienvenu et al',2002; Stromme arx More recently frog (Xenopus laevis) and worm (Caenorhabditis elegans) orthologs of

located were isolated (El-Hodiri et a1.,2003; Melkman and sengupta,2005). Human ARXis kb from on the X chromosome (Xp21 .3-22.1) in atail-to-tail orientation approximately 6.7

The ARX gene the POLA (DNA polymerase alpha) gene (Figure 1.5) (Stromme et aL.,2002)'

ARXhas an open consists of 5 coding exons over a genomic region of approximately l2-5 kb'

Ohira reading frame of 1686 bp encoding a protein of 562 amino acids (Bienvenu e/ a\.,2002;

et a1.,2002; Stromme et a1.,2002)- CHAPTER 1 - 23

E4 E5 E1 E2 E3 4 STOP ATG t2 3

1074 tt20 t448 1449 1686 oRF (bp) 1 t96 197 1073 lttg 373 374 483 483 562 Protein (aa) 166 66 358 358

NLS aa 82-89 Polyalanine Repeat I aa 100-115 aa 328-387 Aristaless a;t527-562 Octapeptide ar27-34 Polyalanine RePeat 2 aa144-155 Homeodomain Acidic Domain at 224-255 Polyalanine repeat 4 m 432440 Polyalanine Repeat 3 aa275-281

above as are the polyalanine tracts (1-4)' Figure 1.4: Schematic of the human ARX gene (not drawn to scale). Exons (E) are indicated

sequence (NLs; dark grey), polyalanine tracts (red)' acidic \ /ithin the ARX protein of the octapeptide domain (green), nuclear localization

the exons' domain (pink), homeodomain (purple) and aristaless domain (blue) are indicated below CHAPTER 1 - 24

Northern blot and expressed sequence tag (EST) analysis of ARX shows that it is expressed

predominantly in the human fetal and adult brain (cerebral cortex, amygdala, thalamus,

corpus callosum, caudate nucleus, substantia nigra and hippocampus), skeletal muscle and

pancreas (Bienvenu et a1.,2002; Ohira et a1.,2002; Stromme et a1.,2002). Interestingly in the

human brain only a single pRNA transcript of approximalely 2.8 kb was detected, while in

skeletal muscle two additional smaller isoforms were detected (approximately 2.5 and 2.1 kb)

(Stromme et a1.,2002), and in the heart a larger isoform was detected (approximately 4'4 kb)

(Bienvenu et al., 2002). The highly conserved mouse and zebraÏtsh orthologs of ARX arc

similarly expressed in the developing brain (ganglionic eminences, hippocampus, cerebral

cortex ventral thalamus, and hypothalamus), floor plate, somites and pancreas (Miura et al',

1997; Bienventt et a\.,2002; collombat et a\.,2003; Mavropoulos et a\.,2005).

\o f\ ôJ r.l hr Ê\ o\ ô¡ lr G. r,¡ ¡h ss È Ê,¡ Êen tel |:\o\ ú¡-i ti <|.- h14 .Èn ?t Ð )1t il frn l{ d dd dcl dd

ILlRAPLI sli" ZFX - .E/FJ.SJ

+ {- PCI'TIB POLÁ ilRX

Figure 1.5: Genomic location of the human ARX gene' Known genes and sequence-tagged

sites from the region are indicated by red lines. The position and orientation of ARX with

respect to the gene POLA is indicated by arrows, as is the centromere-to-telomere orientation

of the region between POLA andlRX(Stromme et a1.,2002)' CHAPTER I - 25

1.3.3 Developmental Role of ARX

Due to its expression pattern, ARX was proposed to be important for the proliferation, differentiation and maintenance of neural subtypes in the cerebral cortex and axonal guidance in the floor plate (Miura et al., 1997; Bienvenu e/ al., 2002; Stromme et al., 2002).

Subsequent analysis in the mouse has shown that expression of ARX is important for the proliferation, differentiation and migration of GABAergic interneurons in the forebrain and olfactory bulb and plays a role in the differentiation of the testes (Kitamlra et al., 2002;

Colombo et al., 2004; Yosh\hara et al., 2005). Disruption of GABAergic interneuron proliferation, differentiation and migration likely impedes the proper formation of local inhibitory neural circuits leading to altered behaviour. For example, altered GABAergic interneuron migration due to inactivation of the urokinase plasminogen activator receptor

(uPAR) gene can cause spontaneous myoclonic seizures (Powell et aL.,2003). Therefore, as expected by the role of ARX in GABAergic interneuron development, loss or mutation of ARX in humans causes altered behaviour such as mental retardation and epilepsy. Clinical phenotypes caused by ARX mutations are discussed below in the next section.

In the worïn (Caenorhabditis elegans) the ARX ortholog alr-l regulates AWA and ASG

chemosensory neurons and VD GABAergic motor neuron development (Melkman and

Sengupta, 2005). Expression of alr-l is also important for maintaining the functional and

structural integrity of amphid sensory organs during larval development (Tucker et a\.,2005).

Maintenance of the amphid sensory organs requires alr-L expression in the glial-like socket

cells to maintain their specific cell shape and cell-cell contacts. The socket cells are support

cells that create a pore through which the exposed sensory cilia of six amphid neurons contact

the environment and are thus essential for amphid neuron function. Furthermore, expression CHAPTER 1 - 26 of alr-l was found to be important for proper morphogenesis of the anterior hypodermis and positioning of the mouth opening in worms (Tucker et aL.,2005).

ARX expression was also found to be essential for the differentiation of endocrine pancreas o(- cells (Collombat et a1.,2003).It was recently shown That ARX is antagonistic towards the differentiation of endocrine pancreas p- and õ-cells by repressing PAX4 expression

(Collombat et a\.,2005). PAX4 is essential for the differentiation of B-precursor cells, and was found to repress ARX expression in a mutually inhibitory cross-regulatory circuit. Hence, expression of ARX along with PAX4 is required for the proper differentiation of pancreatic endocrine cells. Furthermore, expression of the sox4b in zebrafish was found to be required for arx expression in the process of endocrine pancreas u-cell differentiation and may therefore be one of the genes involved in the regulation of drr expression in the pancreas

(Mavropoul os et al., 2005)

1.3.4 ARX Mutations: Phen otype-Genotype Correlation

The prevalence of mutations inARX was recently estimated to affect 9.5o/o of families with

XLMR (Poirier et a\.,2005b). Analysis of the spectrum of phenotypes observed dueto ARX

mutations shows that ARX plays a very important role during development. Mutations in ARX

were found to cause mental retardation (syndromic and non-syndromic), epilepsy and X-

linked lissencephaly with abnormal genitalia (Table 1.4) (Bienven:u et al., 2002; Kitamura e/

a1.,2002; Stromme et a\.,2002). Though causing a variety of phenotypes the common feature

of all patients with mutations in ARX is that they all present with some form of mental

retardation. Furthermore, though patients with mutations in ARX may be diagnosed with a CHAPTER 1 - 27

Table 1.4: Phenotypes caused by ARXmutations

No. Fam/ References Mutation Predicted Type of Associated DNA Protein Mutation Cases I (Kato et aL.,2004) ]VSI+2T>C Skipping ofexonl Splice XLAG (Kato et aL.,2004) IV53+lG>c Skipping ofexon3 Splice XLAG 1 I (Poirier et a1.,2005b) lt2c>T P38S Missense NS-XLMR 2 (KaIo el aL.,2004) 232G>T E78X Nonsense XLAG I (Kato e/ a|.,2004) I l05G>T F'369X Nonsense HYD/AG XLAG I (Kitamura et aL.,2002) I I l7C>T Q373X Nonsense I (Bienvenu et a\.,2002) 98ÞC L33P Missense NS-XLMR I (Bienvenu et a1.,2002) 488A>G Ql63R Missense NS-XLMR I (Bienvenu et a|.,2002) 856G>A G286S Missense NS-XLMR 1 (Uyanik et aL.,2003) 994C>T R332C Missense XLAG I (Kato et a1.,2004) 995G>C R332P Missense XLAG (Kitamura et aL.,2002) R332H Missense XLAG I 995G>A I (BhaIet a1.,2005) 996-l004del T333 F335del Deletion XLAG 1 (Kato et a1.,2004) 998C>A T333N Missense Proud/ACC 1 (Kitamura et a1.,2002) 1028T>A L343Q Missense XLAG XLAG 1 (Kato et a1.,2004) 1058C>G P353R Missense I (Stromme et aL.,2002) 1058C>T P353L Missense XMESID I (Kato el aL.,2004) l56lG>A A52IT Missense XLAG/LCH I (Kitamura et a\.,2002) EXI 2del No expression Deletion XLAG I (Kato et a1.,2004) EX2 5del G66 C562del Deletion XLAG I (Bienvenu et a\.,2002) 304ins(GCG)2 l6A-+184 Insertion NS-XLMR 2 (Stromme et aL.,2002) 304ins(GCG)7 16A-->234. Insertion ISSX I (Kato el aL.,2004) 335-368del A112 Gl23del&fs Deletion XLAG I (KaTo et a1.,2004) 392-452del Pl3l Al5ldel&fs Deletion XLAG I (Kitamura et aL.,2002) 420-45ldel Dl40fs Deletion XLAG I (Kato e/ a1.,2004) 617delG G206fs Deletion XLAG/FIYD I (Kato et a1.,2004) 619-647del Y207 A2l6del&fs Deletion XLAG 3 (Kitamura et a\.,2002) 790delC R264fs Deletion XLAG (Uyanik et a1.,2003) (Hahn et a1.,2004) 2 (Kitamura et a\.,2002) l372delG A458fs Deletion XLAG (Kato et aL.,2004) I (Kitamura et aL.,2002) I 187-1 188insC P396fs Insertion XLAG 1 (Stromme et al ,2002) IV54. R483fs Deletion ISSX 816 EX570ldel I (Hartmann el al-,2004) 1419- T474fs Duplication XLAG 1420insAC l8 (Bienvenu et al.'2002) 428-45 ldup Duplication NS-XLMR (Stromme et aL.,2002) (StePP el a1.,2005) (Partington et al., 2004) (Gronskov et a1.,2004) (Poirier et a|.,2005b) S-XLMR 2 (Stromme et al',2002) (Van Esch et a|.,2004) ISSX 2 (Stromme et a1.,2002) (Kato et a|.,2003) PRTS 3 (Stromme et al',2002) et al. 2005b HydranencePhalY with Ambiguous XLAG: X-linked LissencePhalY with Abnormal Genitalia; HYD/AG: S-XLMR: Syndromic X-linked Mental Genitalia; NS-XLMR: Non-sYndromic X-linked Mental Retardation; with cerebellar hypoplasia; ISSX: X- Retardation; ACC: Agenesis of the Corpus Callosum; LCH: lissencephaly syndrome; XMESID: X-linked my oclonic linked Infantile SPasms/XJ inked West sYndrome; PRTS; Partington epilepsy with generalized spasticity and intellectual disabilitY CHAPTER I - 28

that are in common particular syndrome, they may also present with some clinical features dby ARX mutations)' with another syndrome (see below for discussion on syndromes cause

the less severe In-frame expansion mutations of the first two polyalanine tracts cause X-linked Infantile phenotypes of NS-XLMR, X-linked 'west syndrome (also known as

is also caused by missense Spasms or ISSX) and Partington syndrome (PRTS). NS-XLMR mutation that causes mutations in ARX outside the homeodomain, and the only truncation within the ARX ISSX deletes the aristaless domain. conserved missense mutations myoclonic epilepsy with homeodomain cause proud syndrome and X-linked recessive non-conserved generalized spasticity and intellectual disability (xMESID). However

aristaless domain, frame shift missense mutations within the homeodomain and near the ARX exons' and exon mutations (nonsense, deletions, insertions) affecting the first fot'r

lissencephaly with abnormal skipping mutations cause the more severe phenotype of X-linked to XLAG genitalia (XLAG). These mutations can also cause phenotypes closely associated lissencephaly with such as hydranencephaly with ambiguous genitalia (HYD/AG) or

cerebellar hyPoPlasia.

1.3.4.1 X-linked West sYndrome

found to be X-linked west syndrome (MIM 303350) was one of the first epileptic syndromes

syndrome has an incidence rate caused by mutations within,4,RX(Stromme et al',2002). West

90olo of cases of 2 to 5 per 10,000 live births in various populations of the world, where Classical presentation of manifest within the first year of life (Wong and Trevathan, 2001)'

pattern known as west syndrome includes: 1) infantile spasms; 2) chaotic EEG to occur in clusters of brief hypsarrhythmia; and 3) mental defìciency. Infantile spasms tend CHAPTER I - 29 involuntary symmetric bilateral flexions or extensions of muscles along the trunk, neck or limbs, followed by abrief period of atonia (Bruyere et a1.,1999). Moderate to severe mental retardation occurs in 60-70%" of children with infantile spasms (Bruyere et al',1999).

or West syndrome is heterogeneous in origin and is often categorized as either symptomatic 70- cryptogenic and rarely idiopathic. Symptomatic infantile spasms, affecting approximately

g0% of patients, occurs in the presence of a pre-existing brain lesions caused by prenatal

postnatal events events (e.g. congenital infection or malformation, perinatal birth injury) and

such as sepsis (ILAE 1989; Wong and Trevathan,2001). In approximately 75-20olo of cases'

west syndrome is cryptogenic, where the patients are symptomatic but with no known

aetiology (ILAE 1989; Cowan and Hudson, 1991). Approximately half of cryptogenic cases

were assumed to have a genetic predisposition and a more favourable prognosis than

(Dulac symptomatic cases. They were therefore redefined as idiopathic West syndrome cases

et a\.,1993; Vigevano et aI.,1993)-

An X-linked form of West syndrome was observed (Feinberg and Leahy, 1977) and was

mapped to Xpl1.4-Xper in two families (Claes et al.,1997). Mapping to the X chromosome

is the was further refined to Xp2l .3-Xp22.l (Bruyere et aI., 1999). Located within this region

ARX gene,which was discovered to cause of X-linked West syndrome (Stromme et aL.,2002).

Lying distal to the ARX gene at Xp22.3 is the CDKL5 gene. Interestingly CDKLS was

recently discovered to cause X-linked West syndrome when disrupted by a balanced

in X;autosome translocation (Kalscheuer et a\.,2003b). As noted in section 1.2.1.3 mutations

CDKL5 have also been shown to cause an early seizure variant of Rett Syndrome and it is

al., also known to phosphorylate MECP2 (Tanaka et al., 2004b; Mañ et al., 2005; scala et

2005). The phenotypic overlap between ARX and CDKL| as well as CDKLS and MECP2 CHAPTER 1 - 30 therefore suggests the genes ARX, CDKLS and MECP2 may be acting in a common molecular pathway.

1.3.4.2 XMESTD

The new syndrome X-linked Myoclonic Epilepsy with Generalized Spasticity and Intellectual

Disability (XMESID; MIM 300432) was found to have a mutation within the homeodomain

et of the ARX gene(Stromme et a\.,2002). Within the single family described so far (Scheffet

at.,2002) affected boys suffered refractory generalized epilepsy with the major seizure types

of myoclonic seizures (sudden brief contractions of the face, trunk and sometimes limbs) and

tonic-clonic seizures (TCS). TCS are classified as being a loss of consciousness with sharp

tonic muscular contractions, which if affecting respiratory muscles will cause the patient to

cry out or moan. This is followed by clonic convulsive movements lasting for variable periods

of time (ILAE 1931). XMESID affected boys also presented with generalized spasticity, early

death in two of the boys, developmental delay from birth and moderate to profound mental

retardation (Scheffer et al., 2002).

1.3.4.3 Partington SYndrome

Stromme et al. (2002) discovered that in two families with Partington syndrome (MIM

309510) the disease was caused by mutations in the second polyalanine ttact of ARX (428-

45ldup(24bp)). The affected male members of these families typically presented with mild to

moderate mental retardation, facial muscle weakness, dysarthria (difficulty in articulation)

and episodic dystonic movement of hands and in some cases the feet (Partington et al',1988; CHAPTER 1 - 31

included slow flexion Frints et a1.,2002a; Frints et a1.,2002b). Dystonic spasms of the hands

30 seconds or more at the wrist, \Nith extension and flexion of the joints that could last for

(Frints et aI.,2002b).

1.3.4.4 Proud Syndrome

(MIM A mutation within the ARX homeodomain was found to cause Proud syndrome to have affected males 300004) (Karo ü a1.,2004). The four generation family was repofted mental retardation, and females (Proud et al., lgg2). Affected males presented with severe

seizures' severe spasticity, agenesis of the corpus callosum (ACC), micrencephaly, myoclonic

as well as limb contractures, scoliosis, tapered digits and coarse face. Affected females one obligate obligate female carriers showed variable expression of the phenotype. while affected' with mild to carrier was unaffected, other female members were more severely

impaired compared to the severe mental retardation. Two affected females were less severely

contractures' males, but still presented with epileptic seizures, spastic quadriplegia, limb

chromosome inactivation coarse face and in one case had tapered digits. Though skewed X

seen in the females may in has not been suggested, the variability and severity of phenotypes

part be explained by skewed X chromosome inactivation'

1.3.4.5 LissencePhalY and XLAG

in ARX The creation of an ,4rx knockout mouse model lead to the discovery that mutations

300215) (Kitamura ef cause X-linked Lissencephaly with Abnormal Genitalia (XLAG; MIM of the a|.,2002;Uyanik et a1.,2003). Lissencephaly (smooth brain) is a severe malformation CHAPTER I - 32

gyri cerebral cortex where the smoothness of the brain varies from complete absence of (sBH) (Kato (agyria) to broad gyri (pachygyria) and merges with subcortical band heterotopia

has several and Dobyns,2003). Gyri are the convolution crests of the cerebral cortex which

cortex is characteristic deep infoldings (Kandel et al', 2000). The mammalian cerebral from the composed of six layers. During development proliferating neurons, originating germinal zoîe of the dorsal telencephalon and the ventricular zone of the ventral

pathways to populate telencephalon, migrate tangentially and radially along various migration by the cortical layers (Kriegstein and Noctor, 2004). Lissencephaly disorders are caused (reviewed Kato and abnormal or reduced migration of neurons in the cerebral cortex in

Dobyns,2003).

The first X-linked family with lissencephaly, agenesis of the corpus callosum and (Berry-Kravis microphallus (congenital underdevelopment of the penis) was reported in 1994

other families lead and Israel, lgg4).Further characterlzation of this family along with three

patients with to the classification of this disorder as XLAG (Dobyns et al.,1999)- Affected

(p>a gradient) with XLAG have lissencephaly that is more severe in posterior than anterior

ambiguous intermediate increase in cortical thickness, agenesis of the corpus callosum and

genitalia in males. The patients usually died in the first year of life, had profound mental

as retardation, temperature instability (hypothalamic dysfunction principally manifesting XLAG hypothermia), and chronic diarrhea. Interestingly, similar to XMESID patients,

seizures patients had epileptic seizures that mainly consisted of myoclonic and tonic-clonic

patients also (intractable epilepsy). Furthermore, like Proud syndrome patients, some XLAG

either complete or had tapered fingers. Significantly, obligate female cariers of XLAG had

is partial ACC, normal or impaired intelligence with associated tonic-clonic seizures' which

reminiscent of Proud syndrome female carriers (Dobyns et a1.,1999; Bonneau et al',2002)' CHAPTER I - 33

The sharing of some phenotypes demonstrates that though various syndromes may result from different mutations of ARX,they can share common clinical features due to affecting the same gene.

present More recently a patient with XLAG and an identified mutation in ARX was found to

Hahn with renal phosphate wasting and exocrine pancreatic insufficiency (Hahn et al',2004). et al. (2004) suggested that the reason why renal phosphate wasting may not have been early in observed in other XLAG patients with mutations in ARX is that most patients died so in clinical life (less than 5 months) that renal phosphate wasting was not observed. Diversity

al., phenotypes due to ARX mulations is also seen in another XLAG family (Hartmann et

2004). While one affected male family member had features consistent with XLAG as with described above, another affected family member presented with a variant of XLAG

hypoglycaemia and no evidence of lissencephaly. A second family identified with an ARX

frame shift mutation also showed intrafamilial variability (Kato et a1.,2004)' Both affected

males presented with XLAG but one affected male also had hydranencephaly.

phenotype Hydranencephaly with ambiguous genitalia (HYD/AG) seems to be an overlapping

with XLAG, as an unrelated male with a nonsense mutation in ARX presented with severe

et al' macrocephaly, ambiguous genitalia, and hydranencephaly (Kato et al',2004)'Hartmann

be due (2004) suggests that the intrafamilial variation in patients with mutations in ARX may

to environmental and genetic modif ing factors'

Aside fromARX several other genes have been recognised to cause lissencephaly including

z/s1 (also known as PAFAHIBI), DCX (encoding doublecortin) and RELN (Kato and

Dobyns, 2([3).Approximat ely 76Yo of sporadic lissencephaly patients show mutations in thick either LISI or DCX (pilz et al.,lggg). Patients with zLs1 mutations have an abnormally CHAPTER 1 - 34

layers in the cofiex instead of cortex, gyral malformations more severe posteriorly and four syndrome (MDS)' six (Kato and Dobyns, 2003). LISI mutaTions can cause Miller-Dieker SBH' MDS is due to deletions on isolated lissencephaly sequence (ILS) and rarely isolated

genes at this chromosomal locus' the chromosome 17p13.3, which involves LISI and' other involved in cell migration and division' 21,51 plays an important role in cytoplasmic dynamics (sapir et al', 1997; Faulkner et al'' by regulating dynein, microtubule and actin dynamics

et a1.,2004a). 2000; Smith et a1.,2}}};Kholmanskikh et a1.,2003;Tanaka

abnormally thick cortex, gytal Lissencephaly patients with DCX mutations have an

heterozygous females rather than malformations that are more severe anteriorly and SBH in

that express the mutated DCX gene lissencephaly (Kato and Dobyns, 2003). Cortical neurons they form a band of neurons in the migrate approximately only halfivay to the cortex, where (sBH) is a term given to carrier subcortical white matter. Subcortical band heterotopia present with a milder form of females with mutations in DCX. Female SBH patients

population of neurons that express lissencephaly as due to random X inactivation they have a Located in chromosome normal DCX andtherefore migrate normally (Guerrini et al',2003)' associates and stabilizes Xq22.3-g23 DCX encodes the protein doublecortin, which events required for nuclear microtubules and enhances microtubule polymerization de Rouvroit and Gofftnet' translocation in neuronal migration (Horesh et al',7999;Lambert dynamics in nuclear migration 2001). Doublecortin is also involved in regulating dynein

(Tanaka et a1.,2004a). CHAPTER 1 - 35

1.3.5Inter and Intrafamilial Phenotype variation in Patients with ARX 428-

451dup(24bp) Mutation

The most frequent mutation identified in the ARX gene is the 428-451dup(24bp) mutation which results in the elongation of the second polyalanine tract from 12 to 20 alanine residues'

(Table To date the 42g-451dup(24bp) mutarion has been identified in 25 published families

a to 1.5). Typically patients with the 428-45ldtpQabfi mutation in ARX suffer from mild

moderate form of mental retardation. However, additional features such as epilepsy and

dystonia caused by the 42g-45\dupeabfi mutation differs between families (interfamilial) as mtÍation well as between family members (intrafamilial). How the 428-45ldup(24bp) ARX

at causes the phenotypic variability seen between and within families is not well understood

present time, but likely the effect of the mutated ARX protein is modified by other

environmental and genetic factors' CHAPTER 1 - 36

Table I.5:42g-451dup(2abp) ARXmutation causes interfamilial and intrafamilial phenotypic variability

to moderate et 1 (MRX36) (Fr\nts et al . , 2002b) (Bienvenu øt al, 2002) Epilepsyb Moderate to profound 2 (MRx43) NS-XLMR (Hamel et a1.,1999) Moderate (Bienvenu et al ,2002) 3 (MRX76) NS-XLMR (Bienvenu eta1.,2002) Dystonia Moderate 4 (P49) NS-XLMR Moderate (Bienvenu et al ,2002) 5 (P73) NS-XLMR (Bienvenu et a|.,2002) Epilepsyb Moderate ó (sc) NS.XLMR Severe (Stepp ¿¡ a/., 2005) 7 (MRX29) NS.XLMR (Hane et aL.,1996) Mild to severe (Stepp el a/., 2005) 8 (MRX32) NS-XLMR (Hure et aL.,1999) (Stepp et d1.,2005) Drabetes mellitus Ope II Severe 9 (MRX33) NS-XLMR (Holinski-Feder et al., 1996) (Stepp et al, 2005) Epitepsyb Mild to moderate l0 (MRX38) NS-XLM& macrocePhalY (Schrtz et a1.,1996) (Stromme et al ISSX, PRTS, autism, TCS Mild to severe ,2002) 11(MRX-M) NS-XLMR (Tumer et a|.,2002) (stromrne et a|.,2002) NS-XLMR, epilepsy (IS and TCS), autism, Mild to moderate 12 (MRXS-B) S-)OMR (Turner et a1.,2002) dystonia, diabetes (Stromme et a1.,2002) Cerebeìlar atrophy, corpus callosum hpoplasia, Mild to profound l3 (Norwegiar) ISSX (Stromme et a\.,1999) cerebral and cerebella¡ Iesions, spinocerebellar àI¿xta Mild to moderate (Stromme et a1.,2002) (Australian) PRTS l4 (Partington e t a l., 1988) Mild to moderate (Slromme et a|.,2002) l5 (Belgian) PRTS (FrinTs et a1.,2002a) (VanEsch eta1.,2004) PRTS, macrocephalY Moderate 16 transsphenoidal encephalocele, ACC, hypopituitarism, Not provided (P aftingfon e t a 1., 200 4) MR, epilepsy (TCS and CPS), t7 Not provided (Partington et al., 2004) MR, dystonia CPS l8 Not provided (Pafürlgfon et al ,2004) MR Diabetes mellitus, dystoni4 TCS l9 Not provided (Kato et al ,2003) ISSX TCS, hypotonia 20 Not provìded (Gronskov et a\.,2004) 21 MR, slight clinodactyly offifth fingers, hypotonia, dystonia, lateral ventricles asymmeûical Mtld (Poirier et ø/., 2005b) dysphasia 22 (P106) NS-)OMR, (Poirier et al ,2005a) Not provided (Poirier er a/., 2005b) 23 (P104) NS-XLMR (Poirier er a/., 2005b) Facial dysmorphism, strabismus, hypotonia, Severe 24 (T37) NS.)OMR walking diflìculties Severe et 25 severe syndrome; ACC: agenesis of the corpus callosum; IS: infantile features not seen in every affected family member; of epilepsy unpublished; PRTS: Partington seizures spasm; ISSX: X-linked West syndrome; CPS: complex partial seizures; TCS: tonic-clonic CHAPTER 1 - 37

1.3.6 Polyalanine Tract Expansion Disorders

gene are expansion of the The most commonly identified mutations in the human ARX

tract expansions have been polyalanine tracts (Table 1.4). To date nine genes with polyalanine polyalanine tracts remains shown to cause human disorders (Table 1.6). The function of and they have been largely unknown although they are common in transcription factors 2003)' consequences of shown to be capable of repressing transcription (Lavoie et al.,

discussed in Chapter 3' polyalanine expansion mutations on the structure of the proteins are

with disease Except for PHOX2B and zIC2, expansion of polyalanine tracts associated and/or cytoplasmic phenotypes were shown to induce the formation of intranuclear

pathogenesis' Expansion of the aggregates, theref-ore suggesting a common mechanism of

resulted in the formation of polyalanine tract in FoxL2 and the first polyalanine tract in ARX However, cytoplasmic nuclear aggregates (Caburet et al., 2004; Nasrallah et al., 2004)' tract expansion in FOXL2' aggregates were predominantly formed as a result of polyalanine

SOX3 and RUNX2 (Albrecht as well as polyalanine tract expansions in HOXD13' HOXAl3,

may not have been seen with et a:.,2004;caburet et a1.,2004). while cytoplasmic aggregates

noted that the study used the expansion of the first polyalanine tract in ARX it should be

in the first polyalanine tract and 3 mouse Arx ortholog which normally contains I less alanine human ARX ortholog (see less alanines in the second polyalanine tract compared to the

Chapter 3). CHAPTER 1 - 38

Table 1.6: Polyalanine expansion disorders Gene References Gene factor (Stromme el ,2002) of MR, vanous forms of 16,4'-+184,234 Transcription ARX MR, ISSX, Partington Broad spectrum (Bienvenu et aL.,2002) syndrome epilepsy dystonia, dysarthri4 lissencephaly 12Ã-+204. abnormal genitaiia factor (Crisponi et a|.,2001) ptosis, epicanthus inversus, l4A-+22A,,24A, Transcription FOXL2 blepharophimosis/Ptosis/ Blepharophimosis, (De Baere et a\.,2003) epicanthus inversus ovarian failure (BPES) syndrome Transcription factor (Brown et al.,1998) and alobar HPE (malformation of l5A-+254 ZIC2 HoloprosencephalY Semilobar (Brown et a|.,2001) structures) (HPES) forebrain midline (Amiel et a|.,2003) to hypercarbia 20A-+25A-331^ Transcription factor PHOX2B Congenital central Abnormal ventilatory response (Materaet a|.,2004) hypoventilation, Haddad and hypoxemia and other autonomic abnormalities syndrome factor (Laumonnier et al., 2002) and growth hormone \5A-+261^ Transcription SOX3 MR with growth MR, short stature deñciency hormone deficiencY factor (Mundlos et al.,1997) including t7 A-27 A. Transcription RUNX2 Cleidocranial dy sPlasia Skeletal abnormalities (cBFAI) hypoplasia/aplasia of clavicles, patent fontanelles, supemumerary teeth, short stature Transcription factor (Utsch el aL.,2002) malformations including small 14Ã-+244. HOXA]3 Hand-foot-genital Hand/foot (Goodman et aI.,2000) great toes, genitourinary tract l2A-+l8A syndrome thumbs, short (Innis et a\.,2004) 18A-+244-304 abnormalities (Frisen et aI.,2003) (Debeer et a1.,2002) factor (Muragaki et a1.,7996) showing as syndactyly 15Ã-+22A-25L,294' Transcription HOXDI3 SYnPolYdactYlY Limb malformation (Goodman et aL.,1997) (webbeÜtused digits) and polydactyly (excess digits) (Brais e/ a1.,1998) progressive ptosis, dysphagia and 10A-+11A-l7A Polyadenylate-binding PABPN] Oculopharyngeal Aãult onset, et al., 2002) inclusions protein Q.{akamoto muscular dystroPhY proximal limb weakness, intranuclear

uDisorders caused bY exPansion of the polyalanine tracts CHAPTER 1 - 39

Caburet et at. (2004) postulate that nuclear aggregates may form initially, but over time the protein degradation machinery is overwhelmed and so cytoplasmic aggregates form. It is possible that aggregation of transcription factors with polyalanine expansion mutations in the cytoplasm will prevent nuclear import of the proteins. Interference with nuclear import is

supported by the observation that HOXDI3 with expansion of polyalanine tracts is able to

spontaneously form aggregates in a frlter precipitation assay (Albrecht et aL.,2004). Therefore

expansion of the polyalanine tracts themselves are the likely cause of aggregation.

Significantly, there seems to be a threshold affect on protein aggregation (Albrecht et al',

2004).In all transcription factors the normal tract length is 14-20 alanines, whereas expansion

the cytoplasm oftract lengths over 1 8-22 alanines in transcription factors cause aggregation in

and disease. Moreover, tract lengths greater Than 20 alanines were not observed in proteins in

the Swiss-prot and Trembl databases (Albrecht et a\.,2004), suggesting that there is a limit to

the number of alanines in a polyalanine tract that is tolerated in a transcription factor or any

other protein. This is supported by several observations. Firstly, expansion of the first

polyalanine tract in ll?X causes an increase of cell death (Nasrallah et a1.,2004)- Secondly,

both HOXDI3 and ARX transcription factors with polyalanine expansion mutations are

misfolded (colocalize with chaperone proteins) and are degraded (Albrecht et al., 2004;

Nasrallah et al., 2004). Therefore, by the mislocalization and formation of aggregates,

polyalanine tract expansion mutations in transcription factors are potentially toxic to the cell

or hinder the normal folding and degradation of other cellular proteins. CHAPTER 1 - 40

(also known as PABP2) is unique' of the polyalanine expansion disorder genes, PABPN| that play important developmental Whereas the eight other genes are transcription factors

the length of poly(A) tails after pre- roles, pABPNI is a poly(A)-binding protein that regulates closely linked to transcription' mRNA processing, which is a process that is likely to be polyalanine expansion mutations consequently, clinical symptoms from transcription factor of PABPNI results in adult onset of are congenital malf'ormation syndromes, while mutation

progressive (Brais et al'' 1998)' In the oculopharyngeal muscular dystrophy (OPMD) that is

contain filamentous nuclear inclusions affected areas of OPMD patients, skeletal muscle cells (Uyama et a1.,2000; Fan et al', that contain mutated pABpNl,which leads to cell death in PABPNl inclusions also contain 2001). Unlike HOXDl3,polyalanine expansion mutation (Calado et al., 2000). ubiquitin, proteasomes, heat shock proteins, and poly(A)-mRNA

seen in OPMD patients are normally Furthermore, intranuclear inclusions similar to those This indicates that PABPNL present in oxytocin-producing neurons of the hypothalamus' of PABPN1 into polyalanine expansion mutations are not essential to cause aggregation

The differences in onset, gene function frlamentous nuclear inclusions (Berciano et a\.,2004).

polyalanine expansion mutations are and clinical presentation therefore suggest that PABNPI polyglutamine tract expansion diseases more similar to other neurological and neuromuscular

(Brown and Brown, 2004; Albrecht and Mundlos' 2005)' CHAPTER 1 - 41

I.4 AIMS

understanding of the The general aim of the research presented in this thesis is to improve brain develops' In particular, genes involved in mental retardation and knowledge of how the to a family of the aim was to improve understanding of the XLMR gene ARX- ARXbelongs over the last few years the highly conserved homeobox genes that are transcription factors. and migration has importance of ARX in regards to GABAergic interneuron development

it was unknown what proteins begun to be elucidated. However, at the beginning of this study

regulates' Therefore the ARX interacts with and what molecular pathways and genes ARX protein by identiffing aim of this study was to investigate the molecular function of the ARX

effect of knocking out ARX proteins that interact directly with ARX and by charactet\zing the

protein expression in development.

1.4.1 Specific Aims

1) Identification of proteins interacting directly with ARX'

evolution, with the Hvpotheses: The ARX protein is highly conserved throughout

in sequence. Potentially homeodomain and aristaless domain likely being the most conserved

libraries as interacting with more than one protein will be identified from human brain cDNA

are most likely to be individual domains of ARX. Proteins identified as interacting with ARX

part of the transcriptional machinery' CHAPTER 1 - 42

and I. To analyse the conserv ation of ARX orthologs with the use of NCBI (EST, nr, htgs)

Ensembl databases.

il. To identifli proteins that interact with ARX from a human adult and fetal brain cDNA

library by yeast two-hybrid screening.

il. Confirm proteins interacting with ARX by coimmunoprecipitation and colocalization.

2) Characterizingthe effect of knocking out ARX protein expression in development.

will Hypothesis: Microinjection of antisense arx morpholinos into zebrafish embryos knockdown expression of ARX protein which may result in abnormal zebrafish embryo

development and will affect expression of other developmentally important genes'

I. To design antisense morpholino oligonucleotides and microinject into zebrafish

embryos for the creation of azebraftsh arx knockdown model.

il. To characterize zebraftsh embryos for expression of other developmentally important

genes in response to microiniection of arx-morpholinos'

ilI. Confirm that expression of arx protein is knocked down in zebrafish embryos

microinjected with arx-morpholinos. CHAPTER 2

Materials and Methods

2.l NUCLEIC ACID EXTRACTION """"""""""""46

46 2.I .I GENOMIC DNA EXTRACTION FROM CULTURED CELLS 46 2.Ll.I Cell Lysis by Proteinase K Treatmenl 2.1.1.2 Phenol Chloroform Extraction...-- " " "46

2. l. l. 3 Ethanol Precipilatíon -... ..

2.1.2.1 QIAprep Spin Miniprep Kit Protocol .- 2.1.2.2 QIAGEN Plasmid Midi Kit Protocol...... 2.1.2.3 Plasmíd cDNA Library Exlractíon -....

2. l. 3. I QlAquick PCR Purification 2.1.3.2 QlAquickGel Extraction.'.-.'.....- """""""54

5Õ 2.2 DNA AND RNA QUANTITATION...... -....

57 2.3 FIRST STRAND CDNA SYNTHESIS

2.4.I OLIGONUCLEOTIDEPRIMERS..'...... """""""58

2.5.1 PuRtFIcATIoNoF SEQUENCINGExrENSloNPRODUCTS """"61

62 2.6 RESTRICTION ENDONUCLEASE DIGESTION

63 2.7 GATEWAY@ CLONING

2.7.2PR)DU)ING ATTB-PCR PRoDUcrs. """"""""64

2.T.3BPRECOMBTNATION REACTION """""""""""64

2.7.4 LR RECOMBINATION REACTION...'. """"""""'66

2.8 ESC HERI C H IA CO¿I TRAN SFORMATION

2.8.1 PREPARATION oF CovlprtrNt Cslls ...... ' """"""""""""'67 CHAPTER 2 - 44

69 2.9 GLYCEROL STOCKS

2.10 SDS-POLYACRYLAMIDE GEL ANALYSIS """"""""'""'69

...... 69 2.10.1 GENERALLYSISMETHODFORCULTUREDCELLS..... 70 2.10.2 BRADFORD PROTEIN AssAY....".'.'...' """"""

2.10.3 PREPARATTON oF PROTETN LYSATES FoR GEL LOADING (ReouctNc CoNltrlons)..'...... '..."""""""'70

2.10.4 RLTNNINc rHB GsI- (Rnoucruc CoNDlrloNS) ' """"""""""'71

2.10.5 WESTERN BLor TRANSFER ...'...... """"""""72

2.10.8 ENHANCED CHEMILUMINESCENT (ECL) DrrrcrloN """"""" """""""""'74

75

75 2. I l. I YEASr MEDIA...... 75 2.1 1 . t . 1 Yeast Extract Peptone Dextrose (YPD) Medium' 76 2.1 1.1.2 Synthetic Complete (SC) Medium. 77 2.I I,2 YEAST GLYCEROL STOCKS 77 2. 1 1.3 YEASr CoLoNY PCR...... '.

2.11.3.1 Lysis of Yeast Cells

2.1 L3.2 Yeast Colony PCR Primers..' 78 2.1 L3.3 Yeast Colony PCR Controls'.

2.1 1.3.4 Yeast Colony PCR Condítiont'...... 8I 2,1I.4 YEAST CRUDE PROTEIN EXTRACTION. 82 2.ll.5YEASTTwo-HYBRlDRpponrn'nGgNEAUTOACTIVATIONTESTING 82 2.11.5.I Small Scale Yeast Transformation..'...- . .""' 83 2.11.5 2 Autoactivation Reporter Gene Analysis """"""" " "" 85 2.1 1.5.3 þGalactosidase Filter Assay 86 2.11.6 YEASr Two-HvsRIo LIBRARY SCREENING..' """"""""""" 2.I1.6.1 Large Scale Yeast Transformation...... " 88 2.11.6.2 Library Screeníng Reporler Gene AnalysÌs ...... 90 2.I I.7 YEAST PLASMD DNA EXTRACTION

9I 2.1L8.1 Digestion of pPC86 Vector.... 92 2.1 1.8.2 Gap Repair Yeast Transþrmation....'..'.

94 2.12 COIMMUNOPRECIPITATION....

94 2. I2. I TRANSIENT TRANSFECTION ....'.'..... 96

97 2.12.3 P(orP,LNA-SEPHAROSE BEADS'...... 98 2.72.4 PRECLEARING CELL LYSATE'...... '.. CHAPTER 2 - 45

2.12.5 Cnt-rLysArE AND ANTIBODY COUPLING...... '...... '99

2.I4ZF,BR.AFISH WHOLE MOUNT IN SITT]HYBRIDIZATION...... "...... "...102

2.14.1 MICROINJECTIoN oF ANTISENSE MoRpTToI-TNO OLIGONUCLEOTIDES INTO ZEBRAFISH EMBRYOS ,.,..,. IO2 2.l4.2DrGoxIGENIN-LABELtso RlsopnoeE PREPARATION ...... 103

2.14.3 PREPARATION oF EMBRYOS ...... '-.'... 106 2,I4.4HYBRIDIZATIONANDPOST-HYBRIDIZATIONWASHES...... '..'...... '. ..''...''IO7 2.14.5 ANTIBO¡YAppLIcetloN, WASHINGRNo SranrNc .....'.... 108 CHAPTER 2 - 46

2.1 NUCLEIC ACID EXTRACTION

2.1.1 Genomic DNA Extraction from Cultured Cells

DNA was extracted from 5-10 ml of cultured cells.

2.l.l.l Cell Lysis by Proteinase K Treatment

I. Collection of cultured cells from a T25 (25 ml) flask was performed by spinning the

cells in a l0 ml tube at 5100 rpm (Sigma 4K15 Laboratory Centrifuge) for 10 minutes.

il. The culture media was removed and the pellet was resuspended in 500 pl of proteinase

K buffer (10 M Tris-HCl (pH 7.5), 10 MNaCl, 10 M EDTA (pH 8'0))' pl of l0% ¡¡. The suspended cells were transferred to a 1.5 ml microcentrifuge tube and 50

SDS and 50 ¡rl of proteinase K was added.

1y. The 1.5 ml microcentrifuge tube lid was sealed with parafrlm to prevent leakage, and

rotated on a wheel overnight at37"C.

2.1.1.2 Phenol Chloroform Extraction

L To the cell lysate 500 pl of 70Vo Phenol:Water:Chloroform mix (Applied Biosystems)

was added. The sample was then mixed by rotating on a wheel for 30 minutes'

top layer il. Samples were centrifuged at maximum speed (13000 rpm) for 5 minutes' The

was transferred to a clean 1.5 ml microcentrifuge tube' CHAPTER 2 - 47

alcohol was ru. Steps I and II was repeated and then 500 ¡tl of 24l chloroform:isoamyl

added and mixed gently for I minute.

and the top IV. Samples were centrifuged at maximum speed (13000 rpm) for 5 minutes

layer was transferred to a clean 1.5 ml microcentrifuge tube.

2.1.1.3 Ethanol PreciPitation

added' Samples L To each sample I ml of cold ethanol (4"C) and 50 pl of 3 M NaAc was

aT -20'C were inverted gently a number of times to precipitate DNA and then incubated

for 30 minutes.

and the il. samples were centrifuged at maximum speed (13000 rpm) for l0 minutes

supernatant was removed.

il. The DNA precipitate was washed in I ml 70%o ethanol' Ethanol IV. The samples \ilere centrifuged at maximum speed (13000 rpm) for 5 minutes'

was removed and the DNA pellet was dried for 10 minutes under vacuum'

stored at V. The dried DNA pellet was resuspended in 50 pl of sterile deionised water and -20c CHAPTER 2 - 48

2.1.2 Plasmid DNA Isolation

Except for human brain plasmid oDNA libraries, all plasmid DNA was isolated using the

instructions as eIAGEN plasmid purification kits and QlAfilters according to manufacturer's

follows.

2.1.2.1QIAprep Spin Miniprep Kit Protocol

I. Single colonies of bacteria (Escherichia coli) were used to inoculate 3-10 ml of LB

(Luria-Bertani) medium supplemented with the appropriate antibiotic in a 50 ml tube.

Bacterial cultures were gro\ /n overnight at37"C with vigorous shaking (300 rpm).

il. Bacterial cells were harvested by centrifugation for 10 minutes at 51000 rpm at 4oC.

Supernatant was discarded.

m. Bacterial pellets were resuspended \n250 pl of kit supplied Buffer Pl and transferred to

a sterile 1.5 ml microcentrifuge tube.

ry. 250 ¡i of kit supplied Buffer P2 was added and the microcentrifuge tubes were mixed

by gently inverting 4-6 times and incubated at room temperature for a maximum of 5

minutes.

V. 350 pl of kit supplied Buffer N3 was added and the microcentrifuge tubes were mixed

by gently inverting 4-6 times.

VI. Cell lysates were centrifuged at maximum speed (13000 rpm) for 10 minutes, and the

supernatant was transferred to a kit supplied QIAprep column'

(13000 rpm) for I minute, and VII. QIAprep columns were centrifuged at maximum speed

the flow-through was discarded. CHAPTER 2 - 49

Vn. The elAprep column was washed by adding 750 pl of kit supplied Buffer PE and

centrifuging at maximum speed (13000 rpm) for 1 minute'

¡¡. Flow-through was discarded and the QIAprep columns were centrifuged at maximum

speed (13000 rpm) for another minute.

(QIAGEN) and X. elAprep columns were transfened to a clean 2 ml collection tube

30-50 pl of sterile distilled water was added to the centre of each QIAprep column. The

elAprep column was incubated at room temperature for 1 minute and then centrifuged

at maximum speed (13000 rpm) for 1 minute to elute purified plasmid DNA ready for

quantitation and further use.

2.1.2.2 QIAGEN Plasmid Midi Kit Protocol

I. Single colonies of bacteria (Escherichia coli) were used to inoculate a 5 ml starter

culture in a 50 ml tube containing antibiotic supplemented LB (Luria-Bertani) medium.

Starter cultures were gro\iln approximately 8 hours during the day at37"C with vigorous

shaking (300 rpm).

il. The starter culture was diluted 1/500 into 50-250 ml of selective LB medium in a

conical flask. Bacterial cultures were gro\rr'n overnight at 37'C with vigorous shaking

(300 rpm).

n. Bacterial cells were harvested by centrifugation for l0 minutes at 6000 rpm (in a

Beckman JA-10 rotor) at4C. Supernatant was discarded'

1y. Bacterial pellets were resuspended in 4 ml of kit supplied Buffer Pl and transferred to a

50 ml tube. CI{APTER 2 - 50

gently inverting V. 4 ml of kit supplied Buffer P2 was added, the samples were mixed by

4-6 times and were incubated at room temperature for a maximum of 5 minutes'

vI. 4 ml of kit supplied Buffer P3 was added and the samples were mixed by gently

inverting 4-6 times.

incubated at VII. Lysates were transferred to the barrel of a QlAfrlter Midi cartridge and

room temPerature for 10 minutes.

by loading 4 ml of kit- VIII. A QIAGEN-tip 100 column was equilibrated for each sample gravity flow. The flow-through supplied buffer QBT onto the column, which emptied by

was discarded

into 1¡. A plunger was inserted into the QlAfilter cartridge and the cell lysate was filtered

the prepared column where it entered the resin by gravity flow. The flow-through was

discarded.

Buffer X. The eIAGEN-tip 100 column was washed with 2X 1Oml kit supplied QC.

XI. plasmid DNA was eluted from the column with 5 ml of kit supplied Buffer QF. isopropanol xII. Plasmid DNA was precipitated by the adding 3.5 ml of room temperature

(analytical grade) and mixing gently. Samples were transferred to sterile 1.5 ml

30 minutes' microcentrifuge tubes and centrifuged at maximum speed (13000 rpm) for

The supernatant was discarded.

XIII. The plasmid DNA pellets were washed by the addition of I ml of 70Yo ethanol

(analytical grade) and centrifuged at maximum speed (13000 rpm) for l0 minutes'

pellets dried under vacuum. The XIV. The 70o/o ethanol was removed and the plasmid DNA dHzO' plasmid DNA from each microcentrifuge tube was resuspended in 20 pl of sterile

All DNA fiom the same clone were combined in one tube ready for quantitation and

further use. CHAPTER 2 - 51

2.1.2.3 Plasmid cDNA Library Extraction

proeuestrM pre-made human brain oDNA libraries (Invitrogen) were amplified according to

manufacturer's instructions and extracted using the QIAGEN Maxi plasmid purification kit as

follows.

I. 100 ml of Terrific Broth medium containing 100 pglml ampicillin was inoculated with

2.5 x l¡e cells from a human brain cDNA library (lX 500 pl aliquot) in a 500 ml conical

flask. Terrific broth was produced in the following manner'

Amount

BactorM Tryptone (BD Biosciences) 12g

BactorM Yeast Extract (BD Bioscienes) 24e

Glycerol 4ml

Distilled water to 900 ml

In a separate bottle the following reagents were dissolved in 100 ml of distilled water.

Amount 100 ml Final Concentration

KHzPO+ (monobasic) 2.3 g (169 mM) 16.9 mM

KzHPO¿ (dibasic) 12.5 g (718 mM) 71.8 mM

The medium and solution were autoclaved on liquid cycle for 20 minutes. After cooling to

approximately 55oC, the two solutions were mixed together, ready for use. CHAPTER 2 - 52

il. The bacterial culture was incubated in Tenific broth for 16 hours at 30"C with shaking

at275 rym.

m. The bacterial culture was diluted I in 100 and the culture's absorbance was read at Asqo.

Approximately 500 ODsso units were processed.

1y. Bacterial cells were harvested by centrifugation for 10 minutes at 6000 rpm (in a

Beckman JA-l0 rotor) at 4oC. Supernatant was discarded.

V. Bacterial pellets \l/ere resuspended in 10 ml of kit supplied Buffer P1 and transferred to

a clean 50 ml tube.

y1. l0 ml of kit supplied Buffer P2 was added, the samples were mixed by gently inverting

4-6 times and were incubated at room temperature for a maximum of 5 minutes.

VII. l0 ml of kit supplied Buffer P3 was added and the samples were mixed by gently

inverting 4-6 times.

XV. Lysates were transferred equally to the barrel of 4X QlAfilter Maxi cartridges and

incubated at room temperature for 10 minutes.

XVI. Four QIAGEN-tip 500 columns were equilibrated for each sample by loading 10 ml of

kit-supplied buffer QBT onto the column, which emptied by gravity flow. The flow-

through was discarded

XVII. A plunger was inserted into the QlAfilter cartridge and the cell lysate was filtered into

the prepared columns where it entered the resin by gravity flow. The flow-through was

discarded.

VIII. The QIAGEN-tip 500 columns were washed with 2X 30ml kit supplied Buffer QC.

IX. Plasmid DNA was eluted from the columns with 15 ml of kit supplied Buffer QF in

each column.

X. Plasmid DNA was precipitated by the adding 5 ml of room temperature isopropanol

(analytical grade) and mixing gently. Samples were transferred to sterile I '5 ml CHAPTER 2 - 53

microcentrifuge tubes and centrifuged at maximum speed (13000 rpm) for 30 minutes'

The supernatant was discarded.

;ç1. The plasmid DNA pellets were washed by the addition of 1 ml of 70o/o ethanol

(analytical grade) and centrifuged at maximum speed (13000 rpm) for 10 minutes'

room XII. The 70%o ethanol was removed and the plasmid DNA pellets were dried at

temperature.

XIII. The human brain plasmid cDNA library pellets were each resuspended in 300 pl of

sterile distilled water, and were kept in separate aliquots at -20"C ready for quantitation

and further use.

2.1.3 PCR Purification

Removal of free nucleotides and oligonucleotide primers to extract purified PCR products

was either carried out using the QIAGEN QlAquick PCR purification kit or the QIAGEN

elAquick Gel Cleanup kit according to manufacturer's instructions as follows.

2.1.3.1 QlAquick PCR Purification

I. For each pCR sample, 5 volumes (usually 200 pl) of kit supplied Buffer PB to 1 volume

of PCR sample was added and mixed'

il. The PCR sample was transferred to a kit supplied QlAquick spin column in a 2 ml

collection tube and centrifuged for 1 minute at maximum speed (13000 rpm). The flow-

through was discarded CHAPTER 2 - 54 ilI. The elAquick column was washed by adding 750 pl of kit supplied Buffer PE and

centrifuging at maximum speed (13000 rpm) for 1 minute. The flow-through was

discarded.

¡y. The QlAquick column was centrifuged at maximum speed (13000 rpm) for an

additional minute before transferring the QlAquick column to a clean 2 ml collection

tube (QIAGEN).

V. pCR samples were eluted by adding 30-50 pl of sterile distilled water to the centre of

the column, letting the column stand for I minute and then centrifuging for I minute at

maximum speed (13000 rpm). The PCR samples were then ready for quantitation and

further analysis.

2.1.3.2 QlAquick Gel Extraction

I. pCR samples were excised from an agarose gel under UV transillumination using a

clean sharp scalpel.

il. The gel slice was weighed in a sterile 1.5 ml microcentrifuge tube and 3 volume of kit

mg of gel supplied Buffer QG to 1 volume of gel was added. For example, for each 100

slice 300 pl of Buffer QG was added (up to a maximum of 400 mg of gel).

m. Gel samples v/ere dissolved in Buffer QG by incubating at 50"C for l0 minutes with

vortexing every 2'3 minutes during the incubation'

IV. 1 gel volume of isopropanol was added to the sample and mixed.

V. The sample was then transferred to a kit supplied QlAquick spin column in a 2 ml

collection tube and centrifuges for I minute at maximum speed (13000 rpm). The flow-

through was discarded. CHAPTER 2 - 55

VI. The sample was washed with the addition of 750 pl of kit supplied Buffer PE and

centrifuged at maximum speed (13000 rpm). The flow-through was discarded.

VII. The QlAquick column was centrifuged an additional minute at maximum speed (13000

rpm) before transferring the QlAquick column to a new 2 ml collection tube (QIAGEN).

Vm. The PCR sample was eluted by adding 30-50 pl of sterile distilled water to the centre of

the QlAquick column, letting stand for I minute and centrifuging at maximum speed

(13000 rpm) for I minute. The DNA was then ready for quantitation and further

analysis.

2.1.4 RNA Extraction

RNA was extracted from 5-10 ml of cultured cells using the QIAGEN RNeasy Mini kit as

follows.

I. Collection of cultured cells from a T25 (25 ml) flask was performed by spinning the

cells in a 10 ml tube at 5100 rpm (Sigma 4Kl5 Laboratory Centrifuge) for 10 minutes.

il. The culture media \'r'as removed and the pellet was resuspended in 600 pl of kit supplied

Buffer RLT with 140 mM B-Mercaptoethanol.

il. Cells were homogenized by transfening the cell suspension into a QlAshredder spin

column that was placed into a 2 ml collection tube (QIAGEN) and centrifuging at

maximum speed (13000 rpm) for 2 minutes.

1y. 600 ¡rl of |To/oethanol was added to the homogenized lysate and mixed well. CHAPTER 2 - 56

placed V. The sample was transferred to a kit supplied RNeasy mini column, which was in

at a kit supplied 2 ml collection tube. The sample was then centrifuged for 15 seconds

10000 rpm and the flow-through was discarded'

VI. To wash the column 700 ¡rl of kit supplied Buffer RWl was added and the RNeasy

column was centrifuged for 15 seconds at 10000 rpm. The flow-through was discarded.

VII. The RNeasy column was transferred to a new kit supplied 2 ml collection tube.

VIII. 500 pl of Buffer RPE was added to the column, which was centrifuged for 15 seconds at

10000 rpm. This step was repeated with a 2 minute centrifugation.

IX. The RNeasy column was transferred to a new 2 ml collection tube (QIAGEN) and

centrifuged for 1 minute at maximum speed (13000 rpm)' pl kit X. The RNeasy column was again transferred to a new 2 ml collection tube and 30 of

supplied RNase-free water was placed directly onto the column membrane' The RNA

was eluted by centrifuging for 1 minute at 10000 rpm, ready for quantitation and further

analysis.

2.2 DNA AND RNA QUA|ITTTATTON

DNA and RNA concentrations were determined by measuring the optical density on a

One OD spectrophotometer (Pharmacia Biotech UltraSpec 3000) at a wavelength of 260 nm-

unit is equal to 50 pglml of double stranded DNA and 40 pglml of single stranded RNA.

nm. DNA and RNA were diluted 1 in 200 and their optical densities \Nere measured at 260

Using Beer's law and the known molar extinction coefficients above, DNA and RNA

concentrations were calculated using the following formulas' CHAPTER 2.57

DNA pglpl: absorbance at ODzoo x dilution factor (200) x molar extinction coefficient (50)

I 000

RNA pglpl : absorbance at ODzoo x dilution factor (200) x molar extinction coefhcient (40)

1000

2.3 FIRST STRA|ID cDNA SYNTHESIS

For cloning of ARX domains in yeast two-hybrid screening or testing for the expression of a

gene in a cell line, RNA was made into oDNA for use as a PCR template' To convert the

RNA into gDNA, first strand cDNA synthesis was performed using SUPERSCRIPTTM RNase

H- Reverse Transcriptase (GIBCOBRL@) according to manufacturer's instructions as

follows.

I. To a sterile 0.5 ml pCR tube 1 pg of total RNA was mixed with 1 pl (20 ng) of random

hexamer primer and l0 pl of sterile distilled waster (ll pl of sterile distilled water for

the negative reaction that would not contain reverse transcriptase).

il. The reaction mixture was heated to 70'C for 10 minutes and then placed on ice for a

further 2 minutes.

il. After a brief centrifugation 4 pl of kit supplied First Strand Buffer,2 pl of kit supplied

0.1 M DTT and I pl of l0 mM dNTP mix (Invitrogen) was added. The sample was

given a briefgentle vortex and a briefcentrifugation'

ry. The samples were placed at 42"C for 2 minutes to equilibrate the temperature before

adding I pl (200 U) of SUPERSCRIPTTM RT (excluding negative controls) and mixed. CHAPTER 2.58

V. Reactions were subsequently incubated at42C for I hour. y1. Following first strand cDNA synthesis, 1 pl of the resulting product was used as a

template for PCR. Every reaction was tested with a control PCR using oligonucleotides

designed to amplif, a proportion of the Esterase D (¿SD) gene. The ESD primers are

shown below in a 5'-+3' orientation.

X'orward Reverse Size GGAGCTTCCCCAACTCATAAAT GCATGATG TCTGATGTGGTCAG 453 GCC TAA

2.4 POLYMERASE CHAIN REACTION

2.4.1 Oligonucleotide Prim ers

Oligonucleotides for PCR were designed such that they contained close to 50Yo GC content

and a melting temperature around 60'C. Oligonucleotides were usually l8-25 base pairs in

length. Primer sequences are given throughout the text in the sections for which they are

relevant.

2.4.2PCR Conditions

Except for amplification of the ARX gene, all PCRs were amplified in 20 ¡rl and 50 pl reaction

volumes using the 10X buffer supplied (100 mM Tris-HCl, 15 mM MgCl2, 500 mM KCI CHAPTER 2 - 59

(pHg.3 [20.C]) with Taq DNA Polymerase (Roche) as per the manufacturers instructions.

Each PCR reaction contained the following'

Per 50 pl Vol Final Concentration

DNA (10 nglpl) 1pl 0.2 nglp,l

10X reaction buffer 5pl IX

10 mM dNTP mix lpl 200 pM

pmol/pl Forward primer (50 Pmol/Pl) lpl I

pmol/pl Reverse primer(50 Pmol/Pl) lpl l

Taq polymerase (5 U/ul) 0.5 pl 0.05 U/¡rl

Sterile distilled water to 50 pl

as shown All standard pCR reactions were carried out using the same cycling conditions

30 below. This was altered if expected PCR product sizes were greater than 500 bp by adding

seconds to the extension time per 500 bp.

94C 30 sec

60'c 30 sec x 35 cycles

72C 30 sec

All pCRs where amplificatio n of ARX was involved were amplified in 50 ¡rl using FailsaferM

from the PCR 2X PreMix J buffer (Epicentre Technologies) and the DNA polymerase mix Tris-HCl Expand Long Template PCR System (Roche). The 2X J buffer contains 100 mM CHAPTER 2 - 60

PCR Enhancer (pH 8.3), 100 mM KCl, 400 ¡rM of each dNTP, 3 mM MgClz and 8X Failsafe

Each 50 pl reaction contained the following:

Per 50 pl Vol Final Concentration

DNA (10 ng/pl) 1pl 0.2ngl¡tJ

1X 2X J buffer 25 ¡i l pmol/pl Forward Primer (50 Pmol/Pl) 1pl I pmol/pl Reverse Primer (50 Pmol/Pl) 1pl

Expand polymerase mix (3-5 U/¡rl) 0.5 0.035 U/pl

Sterile distilled water to 50 pl

All pcR reactions amplifliing ARX were carried out using the same cycling conditions as 500 bp by shown below. This was altered if expected PCR product sizes were greater than

adding 30 seconds to the extension time per 500 bp'

94"C 30 sec

60'c 30 sec x 35 cycles

68'C 30 sec

All pCRs were cleaned up using the QIAGEN QlAquick PCR purihcation kit (section 2.1.3).

(89 mM Tris PCR purification was confirmed by gel electrophoresis on a l%" (wlv) lX TBE ethidium base, 89 mM Boric acid,2 mM EDTA (pH 8.0)) agarose gel containing 5 pglml of

bromide and visualizing under UV transillumination' CHAPTER 2 - 61

2.s SEQUENCTNG

Sequencing samples were either electrophoresed by the ABI automated DNA sequencers at the IMVS Molecular Pathology Unit (Adelaide, Australia) as part of a paid service or by the

ABI automated in house DNA sequencer at the Women's and Children's Hospital Department

of Genetic Medicine (Adelaide, Australia). Standard conditions were used for all sequencing

reactions with the use of the Big Dye@ terminator cycle sequencing kit as per the instructions

of the supplier (Applied Biosystems). Each 20 ¡;Jreaction was setup in a sterile 0.5 ¡rl PCR

tube and contained 250 ng of plasmid DNA or 100 ng of PCR product, 3.2 pmol of primer,

2 pl ABI Big Dye@ sequencing mix version 3.7,2 ¡i of Big Dye@ Terminator Buffer version

3.1 and l0% DMSO (v/v).

The Sequencing cycling conditions are as follows

96C 10 seconds

50'c 5 seconds x 25 cycles

60"c 4 minutes

2.5.1 Purification of Sequencing Extension Products

I. Sequencing reactions were transferred to a sterile 1.5 ml microcentrifuge tube, where

after adding 60 prl of 100% isopropanol and 20 ¡rl of sterile distilled water, they were

briefly vortexed and left to stand at room temperature for 20 minutes. CHAPTER 2 - 62

II. The extension products were centrifuged at maximum speed (13000 rpm) for 20

minutes.

prepared m. The supernatant was removed and the pellets were washed with I ml of freshly (13000 rpm) 75%o isopropanol, mixed by vortexing and centrifuged at maximum speed

for l0 minutes

IV The isopropanol was immediately removed and the pellets were dried for 10 minutes

under vacuum

2.6 RESTRICTION ENDONUCLEASE DIGESTION

Restriction endonuclease digestion was employed to 1) conf,trm the identity of vectors, 2) confirm the presence of an insert in a vector after cloning and 3) l\nearize vector DNA for the generation of in vitro transcribed riboprobes. Restriction enzymes were supplied from New

restriction England Biolabs and MBI Fermentas and were used with the recommended 10X

cleaned buffers at the recommended temperature. Digested DNA used for further analysis was up using the eIAGEN QlAquick PCR purifrcation kit as described in section 2.1.3.

Furthermore, digestion and DNA purification was confirmed by gel electrophoresis on a 1olo

(w/v) agarose gel containing lX TBE (S9 mM Tris base, 89 mM Boric acid, 2 mM EDTA

(pH S.0)) and 5 pglml of ethidium bromide. DNA was visualised under UV transillumination. CHAPTER 2 - 63

2.7 GATEWAY@ CLONING

2.7.1Gateway@ Primers

To facilitate Gateway@ cloning (Invitrogen) of PCR products into a Gateway@ competent

donor vector by a BP recombination reaction, primers were generated with a//B sites at the 5'

ends. As all proteins encoded by the PCR products were fused to an N-terminaltag, no Kozak

consensus sequence was included in the forward primer and a translation termination codon

was included in the reverse primer. Primer sequences are given throughout the text in the

sections for which they are relevant. The attB sequences that are generated as part of the

primers are shown below.

Forward primer:

5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTNN-(18-25 gene-specific nucleotides) - 3'

attBT

In the design of the forward primer the gene specific nucleotides were designed to be in frame

with the 6 alanine residues of the attB site and the NN residues were designed so that they

were not AA, AG, or GA, to avoid creation of a translation termination codon.

Reverse primer:

5' - ccccAcCACTTTGTACAAGAAAGCTGGGTCCTA-(18-25 gene-specific nucleotides) - 3'

attB2

The gene specific nucleotides of the reverse primer were designed to be in frame with the 3

nucleotides written in bold (stop codon)' CHAPTER 2 - 64

2.7 .2 P rodtcin g attB-PCR Products

Standard PCR conditions as set out in section 2.4 were used to generate a//B-PCR products'

PCR products were then purified using the PEG purification protocol provided by Invitrogen

except when the PCR product size was below or very close to 300 bp where the QIAGEN

QlAquick PCR purification kit was then used. The PEG purification protocol was performed

as follows.

I. To the 50 pl PCR reaction 150 pl of lX TE (10 mM Tris-HCl, I mM EDTA, pH 8'0)

was added and mixed.

il. 100 pl of 30o/o PEG 8000/30 mM MgCl2 was added to each reaction and vortexed.

ilI. Reactions were spun at maximum speed (13000 rpm) for 15 minutes and the supernatant

was discarded

1y. The DNA pellet was dissolved in 50 ¡rl of 1X TE (pH 8.0) ready for quantitation and

further use.

2.7.3 BP Recombination Reaction

The Gateway@ BP ClonaserM Enzyme Mix kit (Invitrogen) was used to transfer the ¿//B-PCR

product into an attP-contatning vector (pDONRrM2O1) thereby generating an entry clone. The

BP recombination reaction was performed as follows.

I. The following components were added to a sterile 1.5 microcentrifuge tube and mixed

at room temperature CHAPTER 2.65

Per 20 pl Vol Final Concentration a//B-PCR product (40-100 fmol) xpl 2-50 fmol pDONRrM2Ol vector (150 nglPl) 1pl 7.5 nglpl

5X BP ClonaserM Reaction Buffer 4vl 1X

1X TE (pH 8.0) to l8 pl

il. The Bp ClonaserM enzyme mix was removed from -70"C and thawed on ice for

approximately 2 minutes after which it was briefly vortexed twice.

ilI. To each Bp reaction , 2 þ|of BP ClonaserM enzyme mix was added, and the reaction

was vortexed brieflY twice.

IV. The BP reactions were incubated at25"C overnight'

V. 2 ¡i ofkit provided proteinase K solution was added to each reaction and incubated at

37'C for 10 minutes.

VI. Of the Bp reactions, I ¡rl was transformed (section 2.8) into DH5crrM (Invitrogen)

chemically competent cells and the rest was stored at -20C for a maximum of 7 days.

VII. Bp recombination success was confirmed by restriction digestion (section 2.6). BP

clones were also sequenced with either pDONRrM2Ol specifrc primers (shown below in

a 5'-)3' orientation) or with sequence specific primers such as the attB-PCR primers

(see section 2.7.1) to confirm that the clone was in frame with the forward primer and

that no mutations had occurred.

01 Forward Primer 01 Reverse Primer TCGCGTTAACGCTAGCATGGATCT C GTAACAT CAGAGATTT T GAGACAC CHAPTER 2 - 66

2.7 .4 LRRecom bination Reaction

The Gateway@ LR ClonaserM Enzyme Mix kit (Invitrogen) was used to transfer lhe attl-- pDONRrM2gl entry clone into an a/tR-containing vector (for example pDESTrM32) thereby

generating an expression clone. The LR recombination reaction was performed as follows.

I The following components were added to a sterile 1.5 microcentrifuge tube and mixed

at room temPerature.

Per 20 pl Vol Final Concentration

attl--Entry clone (150 ng/Pl) lpl 7.5 ngl¡lJ

Destination vector (150 ngl¡rl) 1pl 7.5 ngl¡tl

5X LR ClonaserM Reaction Buffer 4pl 1X

lX TE (pH 8.0) to 18 pl

III. The LR ClonaserM enzyme mix was removed from -70'C and thawed on ice for

approximately 2 minutes after which it was briefly vortexed twice.

m. To each LR reaction , 2 pl of LR ClonaserM enzyme mix was added, and the reaction

was vortexed brieflY twice.

IV. The LR reactions were incubated at25"C overnight'

V. 2 pl of kit provided proteinase K solution was added to each reaction and incubated at

37"C for 10 minutes.

y¡. Of the LR reactions, 1 pl was transformed (section 2.8) into DH5arM (Invitrogen)

chemically competent cells and the rest was stored at -20"C for a maximum of 7 days. CHAPTER 2.67

VII. LR recombination success was confirmed by restriction digestion (section 2.6). LR

clones \Ä/ere re-sequenced to confirm that the clone was in frame and that no mutations

had occurred.

2.8 Escherichia coli TRANSFORMATION

2.8.1 Preparation of Competent Cells

Vectors were either transformed into SURE@ 2 E. coli cells (Stratagene) or into DH5ctrM

(Invitrogen) E. coli cells that were made chemically competent as described below.

I. E. coli cells were grolrun on LB agar plates containing the appropriate antibiotic

(15 pglml tetracycline for SURE@ 2 cells and25 pglml streptomycin for DH5c¿ru cells)

at37"C.

n. A single col<-rny was used to inoculate 10 ml of LB medium and grown at37"C shaking

(250 rpm) overnight.

m. E. coli cellswerediluted 1/50 (400 pl into 20mlLB) and grown at37"C with shaking

to an approximate ODeoo of 0.3.

1y. The cells were harvested by centrifugation at 2500 rpm for 15 minutes at4C and the

supernatant discarded.

V. The cells were resuspended in 1/10 culture volume (2 ml) of ice cold PEG/DMSO

solution (10% (w/v) PEG¡¡so, 5% (vlv) DMSO, 50 mM MgClz in LB medium).

y1. Competent cells were aliquoted into 300 pl aliquots, incubated on ice for 30 minutes and

then frozen in liquid nitrogen before storing at -70"C- CHAPTER 2 - 68

2.8.2 Transformation

I. For each transformation, 50 pl of chemically competent E. coli cells was aliquoted into

a sterile 1.5 ml microcentrifuge tube.

il. Up to 25 ng of vector DNA was transformed per 50 ¡rl of chemically compehent E. coli

cells.

ilI. E. coli cells were incubated on ice for 30 minutes.

W. Transformations were heat-shocked at 42C for 30 seconds without shaking.

V. To each transformation 800 pl of SOC medium was added. SOC medium was prepared

by the following method.

Amount

BactorM Tryptone 2og

BactorM Yeast Extract 5o

NaCl 0.58 g (100 mM)

KCI 1.86 g (250 mM)

MgC12 2.02 g (100 mM)

MgSO¿ 2.46 s (100 mM)

Glucose 3.6 g (182 mM)

Distilled water to 1 litre

The medium was autoclaved on liquid cycle for 20 minutes.

\/I. Transformations were incubated at37"C with shaking (200 rpm) for I hour CHAPTER 2 - 69

VII. Up to 200 pl of transform ed E. coli cells were plated on a 9 cm LB agat plate containing

the correct selection antibiotic.

VIII. LB agar plates were incubated at37"C overnight.

2.9 GLYCEROL STOCKS

All E. coli glycerol stocks were produced by the same method as follows

(IWAKI). I. 500 pl of a I day old culture was transferred into a sterile 2 ml cryogenic tube

in the cryogenic tube and mixed. il. 500 ¡rl of sterile 80% glycerol was added to the culture

ilI. Glycerol stocks were stored at -70C.

2.10 SDS-POLYACRYLAMIDE GEL ANALYSIS

2.10.1General Lysis Method for Cultured Cells

I. Collection of cultured cells from a T25 (25 ml) flask was performed by spinning the

cells in a l0 ml tube at 5100 rpm (Sigma 4K15 Laboratory Centrifuge) for 10 minutes.

il. The culture media was removed and the pellet was resuspended in 50-100 pl of RIPA+

buffer (50 mM Tris-HCl (pH 7.4), l% (vlv)Nonidet P-40, 150 mM NaCl, I mM EDTA,

0.25% (v/v) sodium deoxycholate, lX Protease Inhibitor Cocktail (SIGMA), 1 mM

NaVO+, I mM NaF, 1 mM PMSF). CHAPTER 2 - 70 n. Resuspended cells were incubated on ice shaking for 15 minutes and were then passed

through a 2l-gatge needle I 0X.

IV. Lysed cells were centrifuged at 10000 x g for 15 minutes at 4C.

V. Cell lysates (supernatant) were transferred to a clean 1.5 ml screw-capped tube and

stored aT -70C.

2.10.2 Bradford Protein AssaY

I. In a96 well plate, BSA was used to create a protein standard curve at concentrations of

0 ¡rg, 10 pg, 20 pg, 40 pg, 60 pg, 80 pg and 100 pg' where each standard was

represented four times on the 96 well plate.

il. 200 pl of Protein Assay reagent (BIO-RAD) that had been diluted 1 in 4 was added to

each well making sure that no bubbles formed.

il. Each sample,ù,zas diluted l/10 and 1/50 in the diluted Protein Assay reagent and was

represented four times at each concentration on the 96 well plate.

1y. Concentration of protein in each well of the 96 well plate \ilas measured and calculated

at )'570

2.10.3 Preparation of Protein Lysates for Gel Loading (Reducing Conditions)

Protein lysates were mixed with lOX NuPAGE@ Reducing Agent (Invitogen) and 4X

NupAGE@ LDS sample buffer (Invitrogen) before gel loading. Protein lysate samples were

prepared in either 10 ¡rl or 15 pl volumes depending on the cell lysis method and protein CHAPTER 2 - 7I concentration. For example, each 10 pl reaction contained l-6.5 pl of protein lysate, lX

NuPAGE@ LDS and 1X NuPAGE@ Reducing Agent'

2.I0.4 Running the Gel (Reducing Conditions)

gels protein lysates were run on precast 12 well NuPAGE@ Novex 4-12% Bis-Tris gradient

(Invitrogen) using the XCell SureLocl{M Mini-Cell (Invitrogen) according to manufactures

instructions.

I. The precast 12 well NuPAGE@ Novex 4-12% Bis-Tris gradient gel cassettes were

removed from their sealed pouches and rinsed in distilled water.

il. The tape covering the slot on the back of the gel cassette \ilas removed as was the comb

separating the 72 wells.

ilI. The gel wells were rinsed 3X with lX MES running buffer (50 mM 2-(N-morpholino)

ethane sulfonic acid (MES), 50 mM Tris Base, 3.47 mM SDS, 1.03 mM EDTA,pHT'3)

(Invitrogen).

ry. After assembling the XCell SureLocl{M Mini-Cell, the upper buffer chamber was filled

with 200 ml of lX MES buffer containing 500 ¡rl of NuPAGE@ Antioxidant

(Invitrogen).

V. The lower buffer chamber was filled half way with lX MES buffer.

VI. After loading the protein lysate samples, the gels were run at 140 volts for 80 minutes to

2 hours.

VII. The XCell SureLocl{M Mini-Cell was then dismantled and the gels removed by cracking

apart the plates with a bevelled Gel Knife (Invitrogen)'

Vm. Both the wells and the foot of the gel were cut off with the Gel Knife and discarded- CHAPTER 2 -72

2.f0.5 Western Blot Transfer

gradient gels I. To transfer the separated proteins in the NuPAGE@ Novex 4-12% Bis-Tris

to a nitrocellulose membrane (PALL Life Sciences) the XCell IIrM Blot Module

(Invitrogen) was used with the XCell SureLocl{M Mini-Cell. Both the blotting pads and

Whatman #5 paper were prewet in lX transfer buffer (Invitrogen). The nitrocellulose

transfer membranes were first prewet in distilled water before being prewet in lX

buffer. The lX transfer buffer (25 mM Bicine,25 mM Bis-Tris, 1.03 mM EDTA,50

pM chlorobutanol, pH 7.2) contained 10% (v/v) methanol (analytical grade) when

transfeffing 1 gel or 20% (vlv) methanol when transferring 2 gels'

The XCell IIrM Blot Module was assembled as shown below

top of apparatus (+) blotting pad blotting pad prewet Whatman prewet nitrocellulose membrane Second gel prewet Whatman blotting pad prewet rühatman prewet nitrocellulose membrane first gel prewet Whatman blotting pad blotting pad bottom of apparatus (-)

II. The XCell IIrM Blot Module chamber was filled with lX transfer buffer and the outer

buffer chamber was filled with ice-cold distilled water' CHAPTER 2 - 73 m. The separated proteins in the gels were then transfened to the nitrocellulose membrane

by running by running the XCell IIrM Blot Module at 30 volts for 90 minutes.

2.10.6 Ponceau Staining

Nitrocellulose membranes \Mere stained with ponceau stain to determine if protein transfer was successful.

I. Nitrocellulose membranes were washed in distilled water 3X (total 5 minutes).

il. Nitrocellulose membranes were then covered by Ponceau S solution (SIGMA) for I

minute.

ilI. Distilled water was then used to wash the nitrocellulose membranes until a protein

banding pattern became clear.

1y. Once confirmed that protein transfer did occur, the nitrocellulose membranes were then

washed with shaking in lX Tris buffered saline solution plus Tween 20 (lX TBST;

20 mM Tris Base, 137 mM NaCl, 0.05% Tween 20 (v/v)) until no stain remained.

2.10.7 Immunoblot

I. Nitrocellulose membranes were blocked overnight in a lX TBST plus 5% milk (w/v)

solution at 4"C.

il. Primary antibodies were diluted in lX TBST plus l% milk (w/v) and incubated with the

nitrocellulose membrane for t hour at room temperature. CHAPTER 2 - 74 il. Nitrocellulose membranes were then washed 4X 10 minutes with agitation in lX TBST

at room temperature.

1y. Secondary antibodies conjugated to horseradish peroxidase were diluted in lX TBST

plus l% milk (w/v) and incubated with the nitrocellulose membrane for I hour at room

temperature.

V. Nitrocellulose membranes \^/ere then washed 4X 10 minutes with agitation in lX TBST

at room temperature.

2.10.8 Enhanced Chemiluminescent (ECL) Detection

The ECL detection kit (Amersham Biosciences) was used to detect proteins on the nitrocellulose membrane labelled with horseradish peroxidase conjugated to the secondary antibody.

I. Excess lX TBST was removed from the nitrocellulose membranes by blotting the edges

of the membrane on paper towels.

il. Equal amounts of detection reagent 1 and detection reagent 2 was mixed together and

placed on the nitrocellulose membrane forming a meniscus for 1 minute at room

temperature.

m. ECL detection reagents \rr'ere removed and the excess drained off by blotting the edges

of the membrane on paper towels.

1y. Nitrocellulose membranes were placed in a clear plastic sleeve located in a film cassette.

The nitrocellulose membranes were then exposed to autoradiography film (AGFA) for 2

minutes and 5 minutes. CHAPTER 2-75

V. The autoradiography films lilere assessed and if necessary a new sheet of

autoradiography film was exposed to the nitrocellulose membrane for a suitable length

of time.

2.I1 YEAST TWO.HYBRID

2.ll.l Yeast Media

2.ll.l.l Yeast Extract Peptone Dextrose (YPD) Medium

ypD is rich medium that was used for the routine growth of yeast. YPD media was prepared according to proQuestrM yeast two-hybrid system manual specifications as follows.

Component Amount

BactorM Yeast Extract (BD Biosciences) 1og

BactorM Peptone (BD Biosciences) 2oe

Dextrose 2og

Adenine Hemisulfate salt (SIGMA) 100 mg

Distilled water to I litre

The medium was adjusted to pH 6.0 with concentrated HCI and autoclaved at 121"C for 25

per minutes. For YPD agar plates 20 grams of bacteriological-grad e agar (SIGMA) was added

litre before autoclaving. YPD agar \Mas allowed to cool to approximately 55'c before CHAPTER 2 - 76 dispensing into sterile 9 and l5 cm petri dishes. When solidified the YPD plates were stored upside down at 4oC.

2.11.1.2 Synthetic Complete (SC) Medium

SC medium was used to select and test for specific growth of yeast strains, where certain

amino acids were omitted (dropped out) from the medium. It consisted of a nitrogen base, a

carbon source and a "dropout" powder mix containing essential amino acids, nucleic acids,

trace elements and vitamins.

I. The dropout powder mix was prepared by mixing, with a mortar and pestle, 2 grams

each of the following: adenine hemisulfate salt, alanine, arginine, aspartic acid,

asparagine, cysteine, glutamic acid, glutamine, glycine, isoleucine, lysine, methionine,

phenylalanine, proline, serine, threonine, tyrosine and valine. All of the powders used to

prepare the dropout powder mix was obtained from SIGMA'

il. SC medium was prepared by adding 6.7 grams of yeast nitrogen base without amino

acids (BD Biosciences) and 1.35 grams of dropout powder mix into a I litre bottle.

Distilled water to I litre was then added and the pH was adjusted to 5'9 with 5 M

NaOH. For SC agar 20 grams of bacteriological-grade agar (SIGMA) was added-

m. SC agar was autoclav ed at l2l"C for 20 minutes with a magnetic stir bar.

IV. After the SC agar had cooled to approximately 50"C, 50 ml of 40%o sterile glucose was

added.

V. Depending onthe selection requirements of the SC agar 8 ml of following amino acid

solutions were added per 1 litre of SC agar: 20 mM uracil, 100 mM histidine-Hcl, 100

mM leucine and 40 mM trYPtoPhan. CHAPTER 2 -77 vI. For SC agar additionally containing 3-Amino-1,2,4-Triazole (3AT) (SIGMA) the

reagent was added as a Powder.

into sterile 9 and 15 VII. SC agar was mixed with the magnetic stir bar and then dispensed

down at 4oC' cm sterile petri dishes. When solidified the SC plates were stored upside

2.11.2 Yeast GlYcerol Stocks

the appropriate media Yeast glycerol stocks \ /ere prepared by spreading the yeast strains on

cells plates (YPD or SC) and incubating24hours at 30'c. A I cm2 patch of confluentyeast

80% sterile glucose was scraped and resuspended in 500 pl of distilled water and 500 ¡rl of

before storing at -70"C.

2.11.3 Yeast ColonY PCR

vector and for Yeast colony PCR was used to both confirm the presence of a yeast two-hybrid

the analysis of yeast two-hybrid positive clones'

2.11.3.1Lysis of Yeast Cells

tube I A yellow pipette tip was used to transfer a small amount of yeast into a 0'5 ml PCR

containing 20 Pl of 0.02 M NaOH.

seconds' il. Yeast cells were then lysed by heating them in a microwave on high for 30

m. 3 pl of lysed yeast was then used as a template for each PCR' CHAPTER 2 - 78

2.11.3.2 Yeast ColonY PCR Primers

oligonucleotide primers were designed to amplify the GAL4 DNA binding domain

(GAL4rs¡) and the GAL4 activation domain (GAL4no) from the pDESTrul/ (Invitrogen)

and pEXp-AD5O2 (Invitrogen) yeast two-hybrid vectors respectively. These primers were

also designed to amplify inserts contained within these vectors encoding either one of the (pEXP- ARX domains (pDESTrM32 vector) or a protein from a human brain cDNA library

4D502 vector). All sequences are listed in a5'-)3'orientation'

Vector X'orward Primer Reverse Primer TGATTGGAGAC pDESTrM32 AACCGAAGTGCGCCAAGT GT CTG AGCCGACAACCT -AD502 CGGT CCGAACCTCATAACAACTC GT AAATTTCTGGCAAGGTAGAC

2.11.3.3 Yeast Colony PCR Controls

A number of PCR controls were performed concurrently with each yeast colony PCR. When

the purpose of the yeast colony PCR was to confirm the presence of the vectors transformed

into yeast, then both a negative and a positive control was performed. The negative control

involved performing a no template (water control) PCR. The positive control for confirming

vector presence involved performing a PCR from purified vector or yeast transformed with

the same vector where the presence of the vector had been previously confirmed'

the pEXP- When the purpose of the PCR was to ampliff the human brain library inserts from

AD502 vector (Invitrogen) for further analysis (such as sequencing), a number of different

controls were performed. One positive control involved performing a PCR on Yeast Control CHAPTER 2 - 79

Strains D and E (Invitrogen; see Chapter 4 section 4.1.1), as the pEXP-4D502 vector primers also recognised the pPC86 vector. Another positive control was to amplify the ARX domain

insert in the pDESTrM32 vector from at least 3 positive clones. This last positive control was to confirm that the ARX domain was still present and therefore the likely reason why the

reporter genes were activated during yeast two-hybrid screening. Finally the negative PCR

control performed concurrently with the PCR to amplifu the human brain cDNA library insert

was to use no template (water control) in the PCR.

2.11.3.4 Yeast Colony PCR Conditions

All yeast colony PCRs where amplification of the pEXP-4D502 vector was involved were

amplified in 50 pl using lOX High Fidelity PCR Buffer (Invitrogen), 50 mM MgSOa

(Invitrogen), l0 mM dNTP mix (Invitrogen) and Platinum@ Zaq DNA Polymerase High

Fidelity (Invitrogen). The l0X High Fidelity PCR Buffer contains 600 mM Tris-SO+ (pH 8.9)

and 180 mM ammonium sulfate. Each 50 ¡rl reaction contained the following:

Per 50 pl Vol Final Concentration

Lysed yeast template 3 ¡rl 6% (v/v)

10X High Fidelity PCR Buffer 5 Pl lX

50 mM MgSO+ 2 Pl 2 mM

10 mM dNTP mix 1.0 200 PM

Forward Primer (150 ng/pl) I pl 3 ngl¡rJ

Reverse Primer (150 ng/pl) 1 pl 3 ngl¡i

Expand polymerase mix (5 U/¡rl) 0.2 0'02U1¡tJ

Sterile distilled water to 50 ¡rl CHAPTER 2 -80

All yeast colony pCRs where amplification of an ARX domain was involved were amplified

Technologies) and the DNA in 50 ¡rl using FailsaferM PCR 2X PreMix J buffer (Epicentre polymerase mix from the Expand Long Template PCR System (Roche)' The 2X J buffer

MgCl2 and contains 100 mM Tris-HCl (pH 8.3), 100 mM KCl, 400 pM of each dNTP, 3 mM

8X Failsafe PCR Enhancer. Each 50 pl reaction contained the following:

Per 50 pl Vol Final Concentration

Lysed yeast template 3 prl 6% (vlv)

2X J buffer 25 ¡Å IX l pmol/pl Forward Primer (50 Pmol/Pl) lpl

Reverse Primer (50 pmol/Pl) lpl l pmol/pl

Expand polymerase mix (3.5 U/Prl) 0.5 0.035 U/pl

Sterile distilled water to 50 ¡rl

All yeast colony PCRs were canied out using the same cycling conditions as follows:

94C 2minutes xlcYcle

94C 1 minute

56'C I minute x 35 cycles

68"C 3 minutes CHAPTER 2 - 8I

2.11.4 Yeast Crude Protein Extraction

Crude protein extraction from yeast protocol was obtained from the Dual Bait Hybrid

HunterrM yeast two-hybrid manual and was used to confirm expression in yeast of the

GAL4oso-ARX fusion proteins expressed from the pDESTru32 yeast two-hybrid vector.

I. In a 50 ml tube, 10 ml of YPD medium was inoculated with a single yeast colony and

grown overnight with shaking at 30'C.

¡. yeast cells were pelleted at 2500 rpm for 5 minutes at room temperature, and the

medium was discarded.

il. Cell pellets were frozen aI -70C for 10 minutes'

1y. Cell pellets were then thawed in 100 pl of pre-warmed (60'C) cracking buffer (8 M

urea, 5%o SDS, 40 mM Tris-HCl, 0.1 mM EDTA,0.4 mglml bromophenol blue).

V. Resuspended yeast cells were transferred to a 1.5 ml microcentrifuge tube containing

100 pl of acid washed 425-600 micron glass beads (SIGMA)'

VI. Yeast samples were incubated at 70'C for 10 minutes and then vortexed for I minute'

VIL Lysed yeast cells were then centrifuged at maximum speed (13000 rpm) for 5 minutes at

room temPerature.

VIII. The supernatant was transferred to a sterile 1.5 ml microcentrifuge screw-capped tube

and stored aI -70C.

¡¡. For each crude yeast protein lysate, 9.75 ¡tl was run in 1 well of a72\ane 4-72%oBis-

Tris NupAGE@ gel (Invitrogen) and detected with the GAL4 (DBD) (RK5CI): sc-510

horseradish peroxidase conjugated antibody (Santa cruz Biotechnology)' CHAPTER 2 - 82

2.11.5 Yeast Two-Hybrid Reporter Gene Autoactivation Testing

2.ll.S.l Small Scale Yeast Transformation

The small scale yeast transformation protocol was used as a quick method of transforming yeast two-hybrid vectors into MaV203 yeast for autoactivation testing and transformation of

ARX domains in the pDESTrM32 expression vector to be used for human brain cDNA library

screening. The transformation method was modified from the Clontech Yeast Protocols

Handbook.

I. MaV203 yeast (Invitrogen) was patched onto a YPD plate and grown overnight.

il. Thawed 10 pgl¡rl salmon sperm carrier DNA (Invitrogen) was boiled for 10 minutes at

94C andplaced on ice for at least 2 minutes before use.

ru. A flamed metal loop was used to scrape approximately a matchsticks head worth of

MaV203 yeast cells from a YPD plate. MaV203 yeast cells were resuspended in sterile I ml of lX TE buffer/lX (100 mM) LiAc solution (Clontech) in a sterile 1.5 ml

microcentrifuge tube. lX TE buffer consists of l0 mM Tris-HCl and I mM EDTA

(pH 7.5).

1y. Resuspended yeast cells were centrifuged at maximum speed (13000 rpm) for 10

seconds and the supernatant was removed.

V. yeast cell pellets were resuspended in250 pl of sterile lX TE buffer/lX LiAc solution

gently. and25 ¡rl of boiled salmon sperm carrier DNA was added and mixed

VI. Yeast cells were transferred in 50 ¡rl aliquots into sterile 1.5 ml microcentrifuge tubes. CHAPTER 2.83

VU. To each aliquot of resuspended yeast, 100 ng of yeast two-hybrid vector to be

transformed was added. LiAc VIII. To each transformation sample, 300 pl of sterile 40/ó PEG:.-l¡;o/lX TE buffer/lX

solution (Clontech) was added and mixed gently'

1¡. Transformation samples were incubated at 30'C for 30 minutes and then heat-shocked

for 15 minutes at 42C.

X. Transformed samples were centrifuged at maximum speed (13000 rpm) for 10 seconds

and the suPernatant was removed.

water and XI. Transformed sample pellets were then resuspended in 50 pl of sterile distilled

plated onto aPProPriate SC Plate.

XII. Yeast transformations were grown at 30"C for 2 days'

2.11.5.2 Autoactivation Reporter Gene An alysis

analysed ProQuestrM (Invitrogen) yeast two-hybrid reporter genes (HIS3, lacZ, URA3) were

for activation according to ProQuestrM yeast two-hybrid manual instructions as follows.

I. Four different colonies from each transformation were patched onto a single 15 cm

of the Yeast Control Strains A-E SC -Leu -Trp plate, as \ilere two colonies from each

(Invitrogen). Yeast patches were grown at 30'C for 18 hours to create a master plate.

il. To eliminate excessive moisture, SC plates used for testing the reporter genes \ilere

dried next to a flame for 2 hours before use. Plates used for testing reporter gene

autoactivation are listed below.

o ypD with a nitrocellulose membrane placed on top (lacZrcpor|er gene) CHAPTER 2 - 84

. SC -Leu -Trp -IJra (URA3 reporter gene) mM, 20 mM, 25 mM, . SC -Leu -Trp -His containing 3AT at concentrations of l0

30 mM or 40 mM (IIIS3 rePorter gene)

m. The master plate was gently pressed with even pressure onto a sterile tautly held velvet

square (100% cotton) to transfer patched yeast colonies to the velvet. Reporter gene

plates were then pressed to the inoculated velvet square to replicate the colonies onto the

plates. Only 5 plates were replicated from 1 inoculated square before a new sterile

velvet square was freshly inoculated.

1y. Immediately following replica plating, the yeast cells on the reporter gene plates were

replica cleaned to remove excess yeast cell material. 'Replica cleaning' involved

pressing the reporter gene plates firmly onto a new sterile velvet square until there was

an absence of visible yeast cell material. This often required the use of 2 or more sterile

velvet squares per reporter gene plate.

V. Reporter gene plates were incubated at 30'C fot 24 hours'

y1. After incubation all reporter gene plates, except the YPD + nitrocellulose membrane

plate, were replica cleaned again and incubated for a further 2 days at 30"C'

which grew only 24 VII. A B-galactosidase filter assay was performed on yeast colonies

hours (steps II-V) on the nitrocellulose membrane located on the YPD plate. This assay

is described in section 2.11.5.3.

VIII. SC reporter gene plates \¡/ere assessed for reporter gene expression and thus

autoactivation. Yeast colonies turning blue in the p-galactosidase colony-lift filter assay

or growing on the SC -Leu -Trp -Ura plate were considered to autoactivate The lacZ

plates and URA3 reporter genes respectively. Growth on all SC -Leu -Trp -His + 3AT

was considered to autoactivate The HIS3 reporter gene. However, when no growth

occurred, the lowest concentration of 3AT that inhibited yeast cell growth was CHAPTER 2 - 85

consequently the amount of 3AT added to all plates lacking histidine during yeast two-

hybrid library screening.

2.11.5.3 p-Galactosidase Filter Assay

L For each l5 cm nitrocellulose membrane 10 ml of Z buffer (60 mM NazHPO¿'7H2O,40

mM NaHzpO+.HzO, 10 mM KCI and 1 mM MgSO+¡7HzO pH 7.0) was mixed with the

following to make the Z bufferlX-gal solution:

Per Membrane Final Concentration

14 M p-Mercaptoethanol 27 ¡i 37.8 mM

20 mglml X-Gal solution 167 ¡il 334 ¡:,glml

The 20 mg/ml X-Gal stock solution \üas made by dissolving 200 mg of 5-bromo-4chloro-3-

indolyl-B-D-galactopyranoside (Progen) in 10 ml of N,N-dimethylformamide (DMF). X-gal

(20 mg/ml) stock solution was then stored at -20c in I ml aliquots.

il. Two pieces of Whatman paper #5 were stacked in an empty 15 cm petri dish and

presoaked in 8 ml of zbufferlX-gal solution. Air bubbles were removed.

m. Using forceps, the nitrocellulose membrane containing gro\Nn yeast colonies on the

surface, was removed from the YPD plate and completely immersed in liquid nitrogen

for 20-30 seconds.

1y. The frozen membrane was then placed on top of the soaked Whatman paper colony side

up. Air bubbles were removed and the petri dish containing the nitrocellulose membrane CHAPTER 2 - 86

vvas placed in the dark at 37oC on a slight tilt so excess ZbufferlX-gal solution did not

accumulate on the membrane.

activation of the V. B-galactosidase filter assay results were analysed at t hour for strong

lacZ reporter gene and at 24 hours.

2.11.6 Yeast Two-Ilybrid Library Screening

2.11.6.1 Large Scale Yeast Transformation

The large scale yeast transformation protocol was obtained and modified from the Clontech

Yeast Protocols Handbook. It was used to transform human brain cDNA library into MaV203 yeast cells already transformed with one of the ARX domains in the pDESTrM32 expression vector

I. MaV203 yeast previously transformed with an ARX domain in the pDESTrM32

expression vector were patched onto SC deficient in leucine plates (SC -Leu) and grown

at 30"C for 2 days.

il. Approximately 2-3 mm2 of confluent yeast was scraped from the SC -Leu plate and

resuspended in 10 ml of YPD medium in a sterile 50 ml tube. Yeast cultures'\¡/ere grown

at 30'C overnight.

il. Yeast overnight culture was diluted into 200 ml of pre-warmed (30"C) YPD medium to

a fìnal ODooo of 0.15.

1y. Diluted yeast culture \ryas then grown in a shaking incubator at 30'C until the yeast

culture reached an ODooo of 0.7 (approximately 2 x 107 cells/ml)' CHAPTER 2 - 87

V. Thawed 10 ¡rglpl salmon sperm carrier DNA (Invitrogen) was boiled for l0 minutes at

94C andplaced on ice for at least 2 minutes before use.

y1. Yeast culture transferred to 4X 50 ml tubes and centrifuged at 2000 x g for 5 minutes at

room temperature.

VII. The supernatant was removed and each yeast pellet was gently resuspended in 12'5 ml

of sterile distilled water. Two of the resuspended yeast pellets were combined with the

other two resuspended yeast pellets to obtain two 50 ml tubes each containing25 ml of

resuspended yeast.

VIII. Yeast cells were centrifuged at 2000 x g for 5 minutes at room temperature. Supematant

was removed and each yeast pellet was gently resuspended in 5 ml of sterile lX TE

buffer/l X LiAc solution (Clontech).

1¡. Yeast cells were centrifuged at 2000 x g for 5 minutes at room temperature. After

removal of the supernatant, each yeast pellet was gently resuspended in I ml of sterile

lX TE buffer/lX LiAc solution to obtain approximately 2 x 10e cells/ml. Both yeast

samples were combined at this time.

X. 1.7 ml of the yeast competent yeast cells was gently mixed with 170 pl of boiled salmon

sperm DNA. At this time 55 pl of the master mix was transfered into a sterile 1.5 ml

microcentrifuge tube to use as a no DNA negative control.

¡1. Yeast competent cells were then gently mixed with 3l pg of extracted DNA from a

human brain oDNA library and 56.5 pl aliquots were transferred into 31 sterile 1.5 ml

microcentrifuge tubes.

XII. To each 1.5 ml microcentrifuge tube (including the no DNA control) 300 ¡rl of sterile

40o/oPqGttso/lX TE buffer/lX LiAc solution (Clontech) was added and mixed gently.

XIII. Transformation samples were incubated at 30"C for 30 minutes and then heat-shocked

for20 minutes at42"C. CHAPTER 2 - 88

XIV. Transformed samples were centrifuged at 10000 rpm for l0 seconds and the supernatant

was removed.

XV. Transformed samples were resuspended in 500 ¡rl of sterile distilled water'

XVI. From one 1.5 ml microcentrifuge tube of transformed yeast cells 50 pl was transferred

to another sterile 1.5 ml microcentrifuge tube containing 450 pl of sterile distilled water

to create a I in 10 dilution. The yeast sample was then serially diluted a further two

to times to create I in 100 and I in 1000 dilutions. These three dilutions were then used

determine yeast transformation effi ciency.

XVII. Approximately l5 acid washed 3 mm glass beads (SIGMA) was used to gently disperse + 3AT I yeast transformation aliquot (500 pl) evenly over a 15 cm SC -Leu -Trp -His

plate. The glass beads were reused for the entire 30 yeast transformation aliquots' but

clean glass beads were used for the no DNA control and the dilution controls.

XVIII Transformed yeast cells were grown at 30"C for 3-5 days'

2.11.6.2 Library Screening Reporter Gene Analysis

After the large scale yeast two-hybrid transformation, ProQuestrM (Invitrogen) yeast two-

hybrid reporter genes (I11S3, lacZ, URA3) were analysed for activation according to

ProQuestrM yeast two-hybrid manual instructions as follows'

I. Clones that activated the Ë11,53 reporter gene within five days of incubating the

grown transformations at 30oC were patched on a SC -Leu -Trp -His + 3AT plate and

for 24 hours to create a master plate. CHAPTER 2 - 89

il. To eliminate excessive moisture, SC plates used for testing the reporter genes (listed

below) were dried next to a flame for 2 hours before use'

. YPD with a nitrocellulose membrane placed on top (lacZ teporter gene)

. SC -Leu -Trp -rJra (URA3 reporter gene)

o SC -Leu -Trp -His containing 3AT (HIS3 reporter gene)

ilI. The master plate was gently pressed with even pressure onto a sterile tautly held velvet

square (100% cotton) to transfer patched yeast colonies to the velvet. Reporter gene

plates were then pressed to the inoculated velvet square to replicate the colonies onto the

plates.

1y. Immediately following replica plating, the yeast cells on the reporter gene plates were

replica cleaned to remove excess yeast cell material.

V. Reporter gene plates were incubated at 30'C for 24 hours'

y1. After incubation all reporter gene plates, except the YPD * nitrocellulose membrane

plate, were replica cleaned again and incubated for a further 2 days at 30"C.

grew only 24 VII. A B-galactosidase filter assay was performed on yeast colonies which

hours (steps II-V) on the nitrocellulose membrane located on the YPD plate.

Vm. SC reporter gene plates were assessed for reporter gene expression due to an interaction

between a GAL4nsu-ARX fusion protein and a human brain cDNA library encoded

protein. A summary is included below of the potential phenotypes observed and their

interpretation.

HIS3 lacZ URA3 retation No growth False positive/background Growth Blue Growth Interactor Growth White No growth Non-interactor Growth Blue No growth Interactor, probably weak Growth White Growth Probable interactor (check lacZ expression CPRG CHAPTER 2 -90

2.1t,.7 Yeast Plasmid DNA Extraction

A yeast plasmid DNA extraction protocol was used to extract pDESTrM32 vectors encoding the ARX domains and pEXP-4D502 vectors encoding the human brain library proteins. Once extracted, the yeast plasmid DNA was used for PCR to confirm the presence of an ARX domain and to amplif, the human brain library inserts. The yeast plasmid DNA extraction

protocol was modified from the clontech Yeast Protocols Handbook.

I. The yeast colonies were spread on a SC -Leu -Trp -His + 3AT plate in a2 cm2 patch.

The yeast colonies were grown at 30"C for 3-4 days.

il. From each confluent patch of yeast cells, approximately I cm2 was scraped using a

sterile metal loop and resuspended in 50 pl of water in a sterile 1.5 ml microcentrifuge

tube.

ru. To each 1.5 ml microcentrifuge tube, l0 pl of lyticase solution (5 U/pl lyticase

(SIGMA), 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA pH S.0) was added. Yeast cells

were thoroughly resuspended by vortexing.

ry. Yeast cell samples were incubat ed at 37"C for 60 minutes with shakin g at 200-250 rpm.

V. 10 pl of 20% SDS was added to each 1.5 ml microcentrifuge tube and vortexed for I

minute.

VI. Yeast cell samples \¡r'ere frozen at -20C and then vortexed again to ensure complete

lysis of yeast cells.

VII. The volume of each 1.5 ml tube was brought up to 200 pl with lX TE (10 mM Tris-HCl

(pH 7.5)and I mM EDTA PH 7.0). CHAPTER 2 - 9I

VIII. To each 1.5 ml microcentrifuge tube,200 ¡rl of 70%o Phenol:Water:Chloroform mix

(Applied Biosystems) was added. The yeast lysates were mixed by rotating on a wheel

for 30 minutes.

IX. The yeast lysates were centrifuged at maximum speed (13000 rpm) for 10 minutes and

the top layer was transferred to a sterile 1.5 ml microcentrifuge tube.

alcohol was X. Steps VIII-IX were repeated and then 200 pl of 241 chloroform:isoamyl

added and mixed gently for I minute.

XI. The samples were centrifuged at maximum speed (13000 rptn) for 10 minutes, and the

top layer was transferred to a sterile 1.5 ml microcentrifuge tube.

X1¡. To each 1.5 ml microcentrifuge tube 8 pl of 10M ammonium acetate and 500 ptl of 95-

100% ethanol was added and the microcentrifuge tubes were placed at -70C for t hour.

XIIL The samples were centrifuged at maximum speed (13000 rpm) for l0 minutes.

10 minutes XIV. Supematant was discarded and the yeast plasmid DNA pellets \üere dried for

under vacuum.

XV Dried yeast plasmid DNA pellets were resuspended in 20 pl of sterile distilled water for

I hour at room temPerature.

2.11.8 Yeast Gap RePair

2.11.8.1 Digestion of pPC86 Vector

For yeast gap repair, 5 pg of the pPC86 vector (Invitrogen) was linearized overnightat25"C

with 20 Il of Smal restriction enzyme (New England Biolabs). Restriction digestion of

ppC86 was performed in NEB Buffer 4 (New England Biolabs). At the end of the CHAPTER 2 - 92

20 linearization period the smal enzyme was heat inactivated by incubating at 65'C for

gel minutes. 100 ng of digested DNA was analysed for digestion on a 0'8% (w/v) agarose

and 5 containing lX TBE (89 mM Tris base, 89 mM Boric acid, 2 mM EDTA (pH 8'0)) pglml ethidium bromide and was visualized by uV transillumination.

2.11.8.2 Gap Repair Yeast Transformation

the pDBLeu DNA was transformed into MaV203 (Invitrogen) yeast already transformed with

vector vector (Invitrogen) and into Mav203 yeast already transformed with the pDESTrM32

(Invitrogen) containing one of the ARX domains. All transformations were performed in

strain (pDBLeu duplicate. The protocol below describes the transformation of one yeast bait

or pDESTrM32-ARX domain)

I. MaV203 bait strain was patched onto a SC -Leu plate and was grown at 30'C for 2

days.

plate and il. Approximat ely 2-3 mm2 of confluent yeast was scraped from the SC -Leu grown resuspended in 10 ml of YPD medium in a sterile 50 ml tube. Yeast cultures were

at 30'C overnight.

to il. Yeast overnight culture was diluted into 100 ml of pre-warmed (30'C) YPD medium

a final ODeoo of 0.15.

the yeast W. Diluted yeast culture \ryas then grown in a shaking incubator at 30"C until

culture reached an ODooo of 0.7 (approximately 2x 107 cells/ml).

for 10 minutes at V. Thawed l0 ¡rglpl salmon sperm carrier DNA (Invitrogen) was boiled

94"C andplaced on ice for at least 2 minutes before use' CHAPTER 2 -93

14. Yeast culture transferred to 2X 50 ml tubes and centrifuged at2000 x g for 5 minutes at

room temperature.

y1I. The supematant was removed and each yeast pellet was gently resuspended in 12.5 ml

of sterile distilled water.

VIII. Yeast cells were centrifuged at 2000 x g for 5 minutes at room temperature. Supernatant

\ryas removed and each yeast pellet was gently resuspended in 5 ml of sterile lX TE

buffer/1 X LiAc solution (Clontech).

1¡. Yeast cells were centrifuged at 2000 x g for 5 minutes at room temperature. After

removal of the supernatant, each yeast pellet was gently resuspended in 0.5 ml of sterile

lX TE buffer/lX LiAc solution to obtain approximately 2 x lOe cells/ml. Both

resuspended yeast pellets were combined at this time'

X. For each transformation 20 pl of competent yeast cells and 2 ¡i of 10 ¡rgl¡rl salmon

sperm carrier DNA were mixed in a sterile 1.5 ml microcentriftrge tube. In addition to

the PCR containing the human brain library inserts from the pEXP-4D502 vector,

several different controls were also transformed as listed below.

DNA Transformed Reason No DNA Negative transformation control pPC86 undigested Positiv e transformation control Smal digested pPC86 Negative gap repair control SnaI digested pPC86 * Yeast Control Strain D PCR Positive gap repair control SmaI 86+ insert PCR les to be tested for interaction

100 ng of undigestedlsmal digested pPC86 and 200 ng of purified PCR product (Yeast

Control Strain D or library insert) were used in the transformations accordingly.

XI. To each 1.5 ml microcentrifuge tube (including the no DNA control) 120 pl of sterile

40o/oPgGttso/lX TE buffer/lX LiAc solution (Clontech) was added and mixed gently. CHAPTER 2 -94

xII. Transformation samples were incubated at 30'c for 45 minutes and then heat-shocked

for 20 minutes at 42C.

the supernatant XIII. Transformed samples were centrifuged at 3000 rpm for 1 minute and

was removed.

XIV Transformed samples were resuspended in 150 ¡rl of sterile distilled water. Samples

were centrifuged at 3000 rpm for 1 minute and the supernatant was removed'

XV. Transformed samples were resuspended in 20 pl of sterile distilled water'

plate. XVI. I pl of each transformation was spotted onto a 15 cm SC -Leu -Trp

XVII. Transformed yeast cells were grown at 30"C for 24 hours'

and grown XVIII. Transformed yeast cells on the SC -Leu -Trp plate were then replica cleaned

for 48 hours at 30"C

in section 2'll'6'2) XIX Yeast reporter genes (f11^S3 , laZ, IJRA3) were tested (as described

for all transformed yeast cells that grew

2.I2 COIMMUNOPRECIPITATION

2.12.1 Transien t Tran sfection

10% fetal ]HEK 2g3T cells were grown in DMEM (JRH BiosciencesrM) growth media with

calf serum (FCS; GIBCOTM), 4 mM L-Glutamine (MulticelrM) and 166 pglml

transfection, the Benzylpenicillin (cSL Limited) in 5%o coz at37"C. The day before transient

well of a 6 well cells were trypsinized, counted and I x 106 cells were plated out in a single

plate as follows. CHAPTER 2 -95

L HEK 293T cells were washed once with ice-cold PBS (10 mM NazHPOa, 2 mM

KHzPO¿, 23 mMKCl, 137 mM NaCl pH7.4). For T75 (75 ml) culture flasks I ml of

trypsin (MultiCelrM) was added to the flask. HEK 293T cells were incubated in the

trypsin for 5 minutes at room temperature at which point they detached from the flask.

il. g ml of DMEM media (10% FCS, 4 mM L-Glutamine) was added to the trypsinized

cells and the cells were mixed by pipetting to obtain a single cell suspension'

1¡. For cell counting 10 pl of cells was taken and added to 90 pl of PBS to create alll0

dilution. 10 pl of cells was loaded onto either side of ahaemocytometer, the cells were

counted and the concentration of the cell suspension was determined.

containing 2.5 ml ry. 1 x 106 cells was added per 10 cm2 well of a 6 well plate (COSTAR@)

of DMEM media (10% FCS,4 mM L-Glutamine)'

V. The cells were grown overnight at37"C with 5% COz and the following day they were

observed to ensure they were at90-95Vo confluency'

y1. Before transient transfection HEK 293T cell media was replaced with 2 ml of DMEM

(4 mM L-Glutamine).

VII. For cach transiently transfected well, 4 pg of each plasmid (1 plasmid if single

transfection, 2 plasmids if cotransfection), was diluted in 250 pl of DMEM (4 mM L-

Glutamine). Likewise for each transiently transfected well l0 ¡rl of LipofectaminerM

2000 (Invitrogen) was diluted in250 ¡rl of DMEM (4 mM L-Glutamine).

VIII. The DNA solution and the LipofectaminerM 2000 solution was immediately mixed and

incubated at room temperature for 20 minutes'

1¡. The DNA/LipofectaminerM 2000 mixture was added to the HEK 293T cells which were

at 90-95o/o confluencY.

X. HEK 293T cells were incubated at37"C with 5%o COz for 24 hours before harvesting. CHAPTER 2 - 96

K. To harvest HEK 293T cells for protein lysate, cells were scraped using a rubber cell

scraper (TPP@) and transfeffed into a sterile 1.5 ml scre\À/-capped tube.

XII. Harvested cells were centrifuged at 3000 rpm for 2 minutes and the supernatant was

discarded.

XIII. Cells were washed twice with I ml of ice-cold PBS and centrifuged again at 3000 rpm

for 2 minutes.

Xry. The supernatant was discarded and the cell pellet was stored at -70C ready for lysis.

4.12.2 Cell Lysis

I. Cell pellets were thawed on ice'

¡1. Each cell pellet was resuspended in 400 pl of lysis buffer that contained the following.

Per 10 mt Vot Final Concentration

5M NaCl 240 pJ 120 mM

2M Tris-HCl (pH 8.0) 250 ¡i 50 mM

Nonidet P-40 50 ¡rl 0.5% (vlv)

25X Protease Inhibitor Cocktail (SIGMA) 400 pl 1X

200 mM NaVO+ 50 pl lmM

200 mM NaF 50 pl lmM

200 mM PMSF 50 pl 1mM

Sterile distilled water 8.91 ml CHAPTER 2 - 97

then passed III. Resuspended cells were incubated on ice shaking for 15 minutes and were

through a2l-gauge needle 10X.

IV. Lysed cells were centrifuged at 10000 x g for 15 minutes at 4c.

V. Cell lysates (supernatant) were transferred to a clean 1.5 ml screw-capped tube and

stored at-70C.

2.12.3 ProteinA-SePharose Beads

ProteinA-Sepharose CL-48 beads (Pharmacia Biotech) was used for all coimmunoprecipitations. ProteinA-Sepharose beads were prepared by the following

(modified from Elion, 1999).

gently I. 500 mg of ProteinA-sepharose powder was resuspended in 10 ml of PBS by

mixing at room temperature for 5 minutes

g for 5 minutes and il. Resuspended proteinA-sepharose beads were centrifuged at 700 x

the PBS was discarded.

n. ProteinA-Sepharose pellet was washed 3X in l0 ml of PBS' in PBS, in a IV. ProteinA-Sepharose pellet was resuspended in 2-2.5 ml of 0.1% Na Azide

ratio of 50% settled gel to 50% buffer, to give a final volume of 4-5ml of 50% ProteinA-

Sepharose bead slurry. ProteinA-Sepharose bead slurry was stored at 4C'

V. Before use the required volume of ProteinA-Sepharose bead slurry was centrifuged at

700 x g and the supernatant was discarded. The ProteinA-Sepharose pellet was washed

2X with lysis buffer (minus protease and phosphatase inhibitors) where the pellet was

g resuspended inZXthe volume of the ProteinA-Sepharose pellet, centrifuged at 700 x

for 5 minutes and the supernatant was discarded. The ProteinA-Sepharose pellets were CHAPTER 2.98

resuspended in an equal volume of lysis buffer (minus protease and phosphatase

inhibitors) to obtain a 50Yo ProteinA-sepharose slurry in lysis buffer.

2.12.4 Preclearing Cell Lysate

Cell lysates were precleared with 50% ProteinA-Sepharose slurry in lysis buffer to reduce

non-specific binding of proteins to the ProteinA-Sepharose beads (modified from Adams and

ohh,2o01).

I. To each cell lysate,20 pl of ice-cold 50%ProteinA-Sepharose slurry in lysisbufferwas

added and incubated for t hour on a rotating wheel at 4"C.

il. Cell lysates were centrifuged (13000 rpm) for l0 minutes at4C-

il. Cell lysate was transferred to a clean 1.5 ml screw-capped tube and the ProteinA-

Sepharose pellet was resuspended in 60 ¡rl of lysis buffer (minus protease and

phosphatase inhibitors).

1y. Resuspended ProteinA-Sepharose beads were centrifuged (13000 rpm) for 10 minutes at

4oC and the cell lysate was pooled with the first cell lysate collected in step III.

V. l5 pl of the cell lysate was transferred to a clean I .5 ml screv/-capped tube for use as an

'input' control in SDS PAGE analysis. CHAPTER 2.99

2.12.5 Celt Lysate and Antibody Coupling

Where possible all subsequent steps were performed on ice (modified from Brymora et al.,

2001).

I. precleared lysate (approximately 450 pl) was transferred to a plugged MicroSpin G-50

column (Amersham Biosciences) that fitted into a clean 1.5 ml screw-capped tube.

il. 0.5 pg of immunoprecipitating antibody was added to the column. The lid of thel.5 ml

screw-capped was attached to the G-50 column. The G-50 column \ryas then sealed to

the 1.5 ml screw-capped tube with parafilm.

ilI. Cell lysate and antibody was incubated overnight at 4C on a rotating wheel.

2.12.6 Immu n oprecipitation

I. 40 pl of 50% ProteinA-Sepharose slurry in lysis buffer (minus protease and phosphatase

inhibitors) was added to the cell lysate/antibody mix in the G-50 micrcolumn and

incubated at 4C for t hour on a rotating wheel.

il. The 1.5 ml screw-cap lid was loosened from the G-50 column before the plug was

removed.

m. The G-50 column (still in the 1.5 ml screw-capped tube) was microcentrifuged for 10

seconds.

IV. To each G-50 column 400 ¡rl wash buffer was added and with a loose 1.5 ml screw-cap

lid, the samples were microcentrifuged for 10 seconds. This was repeated 2 more times.

The wash buffer (as specified in Adams and Ohh, 2001) contained the following' CHAPTER 2.IOO

Per 10 ml Vol Final Concentration

5M NaCl* 240 ¡i 120 mM

2M Tris-HCl (pH 8.0) 100 Pl 20 mM

500 mM EDTA(pH S.0) 10 ¡rl 1 mM

Nonidet P-40 50 Pl 0.5% (vlv)

Sterile distilled water 9.6 ml

*When optimising coimmunoprecipitation conditions between fivo proteins, the fìnal concentration of NaCl was often altered in the wash buffer.

v. lx sDS load buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 5o/o

B-Mercaptoethanol, 0.001% bromophenol blue) (Laemmli, 1970) was heated to 94'C.

y1. The plug was placed back into the G-50 column and 60 pl of hot lX SDS load buffer

was added directly to the column. y1I. The G-50 column was incubated at 60"C for 3 minutes before the plug was removed, the

lid was loosened and the G-50 column was microcentrifuged for 10 seconds to elute the

antibody and bound proteins.

VIII. 3-10 pl of sample was analysed by sDS-polyacrylamide gel analysis.

2.13 COLOCALIZATION

HEK 2g3T cells \ryere transiently transfected the same way as they were for

coimmunoprecipitation (section 2.12.1). However instead of harvesting the transiently

transfected cells, the cells were placed on coverslips as follows. CHAPTER 2. IOI

I. HEK 293T transiently transfected cells were trypsinized by the addition of I ml of

trypsin to I well in a 6 well plate. Transiently transfected HEK 293T cells were

incubated in the trypsin for 5 minutes at room temperature at which point they detached

from the plate.

il. 1.5 ml of DMEM media (10% FCS, 4 mM L-Glutamine,166 pglml Benzylpenicillin)

was added to the trypsinized cells and the cells were mixed by pipetting to obtain a

single cell suspension.

ilI. 50 pl of the trypsinized cells was transferred to another well that contained a sterilized

coverslip in a new 6 well plate. To each well containing a coverslip, 2.5 ml of DMEM

media (10% FCS, 4 mM L-Glutamine, 166 pglml Benzylpenicillin) was added, and the

cells were grown overnight at37"C 'with 5% CO2.

W. Media was removed from the coverslips located in the 6 well plate and the cells were

washed 2X 5 minutes (no agitation) with PBS (10 mM NazHPO¿, 2 mM KHzPO+,

2.7 ml|r4Kcl,137 mM NaCl PH7 '\.

V. Coverslips were treated with 3.7% (vlv) formaldehyde in PBS for I hour at room

temperature.

y1. Following three further washes in PBS, transiently transfected HEK 293T cells were

permeablizedin0.2Yo triton (v/v) in PBS for 5 minutes at room temperature.

VII. Permeablized cells were washed 3X 5 minutes (no agitation) at room temperature, and

were blocked t hour at room temperature with lX TBST (20 mM Tris Base, 137 mM

NaCl, 0.05%Tween 20 (vlv)) plus 5% goat sera (v/v) and 1% BSA (w/v).

VIII. The primary antibody was diluted in lX TBST plus 1% BSA (w/v) and incubated with

the coverslip overnight at 4C.

1¡. The primary antibody was removed, and the coverslips were washed 3X l0 minutes

with lX TBST (no agitation) at room temperature. CHAPTER 2 - IO2

X. Coverslips were then incubated with the secondary antibody diluted in lX TBST plus

l% BSA (w/v) at room temperature for I hour.

XI. The secondary antibody was removed and the coverslips were washed 3X l0 minutes

vvith lX TBST (no agitation) at room temperature.

XII. The coverslips were placed onto slides containing 40 pl of DAPI antifade and sealed to

the slides with clear nail polish. DAPI antifade was made by adding 500 pl of 10 pglml

DApI (SIGMA) into 10 ml of antifade solution (20 mM Tris base, 90o/o glycerol, 1.8%

DABCO (SIGMA).

XIII. Coverslips were viewed on an Olympus BX40 microscope under appropriate filters.

Images of cells were captured by a cooled CCD camera using the CytoVision Ultra

image collection and enhancement system (Applied Imaging Int Ltd).

2.I4 Zß,BIR.AFISII WHOLE MOUNT IN SITUHYBRIDIZATION

Z.l4.l Microinjection of Antisense Morpholino Oligonucleotides into Zebrafish Embryos

Antisense morpholino oligonucleotides (morpholinos) were designed by and obtained from

Gene Tools , LLC. Microinjection of the morpholinos was carried out by Ben Tucker and

Simon Wells (University of Adelaide, Australia). Zebrafish embryos at the 2- to 4-cell stage

were microinjected with 0.5 mM of either arx-| or arx-3 morpholinos. Siblings from the same

pool of embryos were either microinjected with 0.5 mM of control non-functional morpholino

or remained uninjected to serve as the internal controls for these experiments. Both

microinjected and uninjected zebrafish embryos were allowed to develop for 12 hours post

fertilization (hpf) or 24 hpf at 28.5"C before fixing the embryos in a 4%o formaldehyde CHAPTER 2 - IO3 solution (4% (vlv) formaldehyde, 10 mM NazHPO+,2 mM KHzPO+, 2.7 mM KCl, 137 mM

NaCl pH 7.4) at 4"C overnight.

2.14.2 Digoxigenin-Labelled Riboprobe Preparation

The DNA templates used to produce antisense digoxigenin-labelled riboprobes were obtained from various sources. The cloned zebrafish genes used within this thesis were kindly provided by the following sources. Michael Lardelli (University of Adelaide, Australia) kindly provided clones of the genes emx3, shh and myoD. Dr Igor Dawid (NIH, NICHD, LMG,

Bethesda, Maryland) kindly provided the emxl clone and Dr Marc Ekker (Ottawa Health

Research Institute, Canada) kindly provided the dlxl a, dlx2a and dlx5a genes.

These DNA templates were cloned into different vectors which provided a T3 or T7 promoter site that drove in vitro transcription of the clone in the antisense direction. To enable production of the in vitro transcribed digoxigenin-labelled riboprobes, the DNA templates were linearized. Linear DNA template from the cloned genes was produced either by standard

PCR (as detailed in section 2.4.2) or by restriction endonuclease digestion (as detailed in section 2.6). When a linear template was produced by restriction digestion, 5 pg of vector

DNA was digested with 20 U of restriction endonuclease. Restriction digest occurred overnight in the recommended buffer at the appropriate temperature. The restriction site chosen was located in the multiple cloning site at the 3' end of the antisense clone orientation.

The table below lists the method by which each cDNA was linearized and the RNA polymerase used in The in vitro transcription reaction. CHAPTER 2 - IO4

Clone Vector Restriction Enzvme/Ml3 PCR Primers Polvmerase emxl PCS2+ BamHl T7 emx3 pBluescript SK+ M13F: M13R: T3 GTAAAACGACGGCCAG CAGGAAACAGCTATGAC dlxl pBluescript KS+ BamHI T3 dlx2 pBluescript SK- BamHl T7 dlx3 oBluescript SK- BamHI T7 shh pBuescript SK- HindIlI T7 myoD pBluescript SK- MI3F: M13R: T7 GTAAAACGACGGCCAG CAGGAAACAGCTATGAC M13 primers are listed in a 5'-)3' direction.

Each in vitro transcribed digoxigenin-labelled riboprobe \'/as transcribed as follows

L l pg of linearized DNA vector or 200 ng of PCR product was used in a 20 ¡tl

transcription reaction with a T3 or T7 RNA polymerase (MBI Fermentus) and the

recommended 5X transcription buffer. Transcription occurred in the presence of the

superase inhibitor Superase.Intt lAmbion) and a 10X DIG mixture containing l0 mM

each of ATP, CTP and GTP,6.5 mM of UTP (Roche) and 3.5 mM of Digoxigenin-ll-

UTP (Roche). The in vitro transcription reactions were incubated at 37"C for 2 hours

where each transcription reaction contained the following.

Per 20 pl Vol Final Concentration

DNA (1 pglpl or 200 ngl¡il) lpl 50 nglpl or l0 nglpl

10X DIG mixture lpl IX

5 X transcription buffer 4pl IX

T3n7 RNA polymerase (20 U/pl) 2 ttl 2Ul¡il

Superaserlntt 1zo u/pt¡ lpl I U/pl

Sterile distilled deionized water to 20 pl CHAPTER 2 - IO5

In vitro transcribed digoxigenin-labelled riboprobes were purified using 30K Nanosep centrifugal devices (PALL Life Sciences) according to the manufacturer's instruction as follows.

I. The transcription reaction was diluted to 500 pl with sterile distilled deionized water.

II. Diluted transcription reaction was transferred into a 30K Nanosep device and

centrifuged at 7000 rpm for l2 minutes. The supernatant was discarded.

III. Retained DNA template and in vitro transcribed digoxigenin-labelled riboprobe were

washed with 200 pl of sterile distilled deionized water, and the centrifugation was

repeated.

1y. The in vitro transcribed digoxigenin-labelled riboprobe was recovered from the 30K

Nanosep device by rinsing the membrane surface '\Nith 2X 20 ¡i of sterile distilled

deionized water with a pipette tip, where the rinse was transferred to a new 1.5 ml

microcentrifuge tube.

V. Concentration of the in vitro transcribed digoxigenin-labelled riboprobe \ryas estimated

by running 4 pl of riboprobe besides the RNA standard Bioline Hyperladder (Bioline),

on a l%o (w/v) agarose gel containing lX TAE (40 mM Tris-acetate, I mM EDTA

(pH8.0)) and 5 pglml of ethidium bromide. RNA \ryas visualised under UV

transillumination.

\/I. In vitro transcribed digoxigenin-labelled riboprobes were stored at -70C' CHAPTER 2 - 106

2.14.3 Preparation of Embryos

I. Using a set of 2l-guage needles, zebrafish embryo chorions were removed.

il. 30-50 embryos of a single treatment (such as arx-| microinjected 24 hpf embryos) were

transferred to a clean 1.5 ml microcentrifuge tube.

m. Embryos were rinsed lX and washed lX 5 minutes in 100% methanol and were then

kept at -20"C for t hour to overnight in 100% methanol.

IV. Embryos were then put through a series of 5 minute washes as follows.

lX I ml of 75Yo (v/v) methanol in PBS then

lX I ml of 50%o (v/v) methanol in PBS then

lX I ml of 25Yo (v/v) methanol in PBS then

4X 1 ml of PBT (PBS plus 0.1% (v/v) Tween 20)

V. Embryos were transferred to a 1.5 ml microcentrifuge tube with a locking cap ("Safe-

Lock" tubes, Eppendorf). Embryos were rinsed with I ml of prehybridization solution.

The prehybridization solution contained the following.

507o Formaldehyde (deionised)

5X SSC

2%o Blocking reagent (Boehringer Mannheim)

0J% (vlv) Tween 20

0.s% CHAPS (Sigma)

50 pglml yeast RNA (SIGMA)

50 mM EDTA

50 ¡rglml heparin (SIGMA) CHAPTER 2 - IO7 yI. Embryos in I ml of prehybridization solution were incubated at 70'C for t hour while

slowly and gently being rocked in a horizontal position

2.14.4 Hybridization and Post-Hybridization Washes

I. 200-300ng of in vitro transcribed digoxigenin-labelled riboprobe was added per 1.5 ml

microcentrifuge tube of embryos. The riboprobe was added to the top of the solution and

then mixed by rapidly inverting the tube a couple of times.

il. Riboprobe hybridization occuffed overnight at70"c with gentle rocking.

m. Embryos were rinsed 3X and then washed 2X l5 minutes at 70C with 1 ml of

prehybridization solution prewarmed to 70'C.

ry. Embryos were then washed lX 30 minute in I ml of 50o/o prehybridization solutìon plus

50%2X SSC at 70'C with gentle rocking.

V. Embryos were rinsed lX and washed lX 15 minutes in 1 ml of 2X SSC plus 0.1% (vlv)

Tween aL70"C with gentle rocking'

14. Embryos were rinsed lX and washed 2X 30 minutes in I ml of 0.2X SSC plus 0.1%

(v/v) Tween at70C with gentle rocking

VII. Embryos were rinsed lX and washed 2X l0 minutes, then lX 5 minutes in I ml of PBT

at room temperature with gentle rocking-

VIII. Finally embryos were rinsed lX and washed 2-3 hours in I ml of PBT plus l% (w/v)

BSA at 4"C with gentle rocking. CHAPTER 2 - IO8

2.14.5 Antibody Application, Washing and Staining

L Anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche) was diluted 1:4000

in PBT plus l% (w/v) BSA, mixed gently by inversion and placed aT 4C for at least

t hour.

il. The PBT plus l% (w/v) BSA solution was removed from embryos and replaced with

1 ml of the diluted antibody. Antibody and embryos were rocked slowly and gently

overnight at 4C.

m. Embryos were rinsed 3X and washed 5X I hour in 1 ml of PBT plus 0.1% (w/v) BSA at

room temperature with gentle rocking.

1y. Embryos were then rinsed lX and washed 3X 5 minutes in I ml of freshly made NTMT

buffer at room temperature. NTMT buffer contains the following.

Per 50 ml Vol Final Concentration

0.5 M MgClz 5ml 50 mM

I M NaCl 5ml 100 mM

I M Tris HCI (pH9.5) 5ml 100 mM

Tween-20 50 ¡rl 0)% (vlv)

Sterile distilled water 35.95 ml

V. NTMT buffer was replaced with I ml of staining solution. The 1.5 ml microcentrifuge

tube was covered with aluminium foil to protect from light and rocked gently at room

temperature for 30 minutes. The staining solution was made up of 1 ml NTMT buffer,

340 mg/ml NBT (Roche) and 175 mglml BCIP (Roche). CHAPTER 2 - IO9

2.14.6 Post-Stain Fixation

I. When strong staining was evident, embryos were rinsed lX and washed lX in I ml of

NTMT for l0 minutes.

il. Embryos were then rinsed lX and washed lX in I ml of PBT for 10 minutes.

ilI. Embryos were fixed in I ml of 4Yo formaldehyde in PBT overnight al4C.

IV. The fixation solution \ùas removed and replaced with I ml of 80% glycerol. The 1.5 ml

microcentrifuge tubes were placed upright at 4C to allow the embryos sink to the

bottom of the tube when they had equilibrated with the glycerol.

V. Embryos were stored at -20C or -80oC until examination. Embryos were examined

using the Zeiss Axiophot microscope from West Germany. Images were obtained using

a Fujix HC-1000 3CCD digital camera attached to the microscope and Adobe@

Photoshop@ 5.0 LE was used to view the images. CHAPTER3

Conservation of ARX

3.1 INTRODUCTION...... 111

3.2.2.1 Rat Arx Ortholog Contains the First Two Polyalanine Tracts 127 CHAPTER 3 . III

3.1 INTRODUCTION

As discussed in Chapter 7 ARX belongs to the subset of Aristaless-related Paired-like

homeodomain proteins. Homeodomain proteins are structurally and functionally conserved

transcription factors that play key roles in development. Aristaless-related homeodomain

proteins in particular play significant roles in embryogenesis (for review see Meijlink eI al.,

1999). Mutations within ARX and the resulting phenotypes observed signiff how important

ARXis to normal human development. Therefore one of the major aims of this study wasto

characterize the molecular function of the ARX protein and thus elucidate how mutations in

ARX alter the normal function of ARX.

Naturally occurring mutations can be frequently valuable in molecular studies of normal

protein function. For example, deletion of a domain or mutation of an important conserved

amino acid residue can pinpoint what is necessary for an enzymic reaction, interaction

between two proteins or the conformation of the protein itself. Such is the case with ARX

where there are deletions, duplication, expansion and missense mutations which affect the

first two polyalanine tracts, octapeptide domain, homeodomain and aristaless domain. These

ARX mutations result in the various mental retardation and epilepsy phenotypes seen in

humans (Chapter I Table 1.4), which suggest that these domains and regions are important for

the normal function of ARX.

Among other methods, analysis of gene and protein conservation can provide invaluable

insight into protein domain function. The purpose of the work presented within this chapter

was to assemble bioinformatical knowledge about ARX and its orthologs. The GenBank

database was used to identiff and analyse characterised or novel ARX orthologs. Alignment of CHAPTER 3 - 112

ARX orthologs verified which domains and regions of the ARX protein are highly conserved.

Determination of the domains or regions conserved in ARX was also important for ascertaining what species would be an appropriate model organism for future experimental studies.

3.2 RESULTS AND DISCUSSION

3.2.1 Conserved Domains within ARX Orthologs

Previous studies have shown that ARX is highly conserved in amino acid sequence between

human, mouse, zebrafish and Xenopus with the greatest similarity between human and mouse

(Stromme et al., 2002; El-Hodiri et aI., 2003). Furthermore, previous phylogenetic studies

have shown that the purple sea urchin alx and C. elegans alr-I genes are orthologs of the

Drosophila aristaless gene (Galliot et a\.,1999; Melkman and Sengupta, 2005). Phylogenetic

studies have also suggested that the two Hydra genes (prdl-a and prdl-b) are derivatives of

the ancestral genes, and are therefore most likely true homologs of the aristaless family of

homeobox genes (Galliot et a1.,1999). Full length amino acid sequence of human ARX was

used in blastp searches of GenBank (nr, EST and htgs) databases and the Ensembl database

for related orthologs from other species. The result of these searches are presented in Table

3 .l below where additional orthologs of human ARX were identified in the green sea urchin,

cricket, honey bee and rat. It must be noted that although the sea urchin genes are named alx,

they are not orthologs of the Aristaless-homeobox-3 and 4 (ALX3 and ALX4) genes which

belong to the Cartl gene family of Aristaless-related Q50 Paired-like homeobox genes

(Galliot et a|.,1999). CHAPTER 3 - 113

Species Ortholog Gene Accession Number Bovine (Bos taurus) - partial sequence ARX xM 67652 Human (Homo sapiens) ARX NM 139058 Mouse (Mus musculus) Arx 8C052033

R:at (Ra t tu s no rv eg i cu s) Arx xM 228590 Xenopus (Xenopus laevis) arx-A AY130460 qrx Zebr aftsh (D a n i o r er i o) NM 131384 Honey bee (Apis mellifera) similar to CG6860-PA xM 392557 Cricket (Gry I lus b imacu I atus) Gbal Dr o s phol il a (Dro s ophil a me I ano gast er) aristaless NM^B,07tt47 164382 C. elegans (Caenorhabditis elegans) alr-I NM 0774s9 Purple sea urchin (Strongylocentrotus purpuratus) alx AY277399 Green sea urchin (Lytechinus variegates) alx Hydra (Hydra vulgaris) prdl-a ^Y277400Y15515 Hvdra (Hvdra vulsaris\ - partial sequence prdl-b Y15516

Table 3.1: Identified orthologs of human,4RX

Phylogenetic relationships between the identified ARX orthologs were examined using either

all available ARX ortholog sequence data (not shown) or just the sequences encoding the

homeodomain (Figure 3.1). Similar results were obtained for both the entire ARX open

reading frame and the homeodomain sequences using the Neighbour Joining (NJ) method

(Saitou and Nei, 1987) and the unweighted pair group method using arithmetic averages

(UPGMA) method (Michener and Sokal, 1957). As expected human ARX is more similar to

other the vertebrate ARX orthologs than it is to the invertebrate arx orthologs. The bovine

ARX ortholog did not group with the other vertebrate ARX orthologs, which was likely due

to the fact that only partial bovine sequence was available for analysis' CHAPTER 3 - II4

Zebrafish arx Human ARX Mouse Arx Rat Arx Mouse 94% Xenopus ax-A Rat 95% ARX Bovine 81% Puçle Se¿ Urchin alx Xenopus 650lo Green Sea Urchin alx Zebraftsh 57Yo C elegans alr-1 prdl-a32%o Cricket Gbal Cricket 31% Honey Bee CG686&PA prdl-b 27%, Droeophila al Drosophila2To/o C elegats25Yo prdl-b Honey bee23%o Drosophila oþ Green seawchin23o/o otp Purple seaurchin22o/o OTP otp 0.0605 units Rat Otp

Figure 3.1: Phylogenetic relationship between ARX orthologs with representatives from the Chordata (Vertebrata), Echinodermata, Arthropoda

Nematoda and Cnidaria phyla. ARX homeodomain sequences (60 residues) were aligned and the NJ tree inferred usng CLC Free Workbench

1.01 (www.clcbio.com). The homeodomains of OTP proteins were used as outliers in this analysis. Percentages of 100 bootstrap replicates supporring rhe topology shown are indicated by hatchmarks: (/) - <50%o;00 - 51-80%; (lll) - 81-100%. Listed to the right is the percentage similarity between human ARX and the ARX orthologs using entire ARX protein sequences. CHAPTER 3. I15

Amino acid sequences of the various ARX orthologs were further analysed by alignment using ClustalW (Megalign module of the DNASTAR program). The alignment was then manually edited utilising GeneDoc version 2.6.002 (multiple sequence alignment editor and shading utility program) to obtain optimal alignment between all species. The human ARX protein is highly conserved among vertebrates (from 57%o to 95o/o) and less well conserved in the invertebrates (from 22Yo to 32%) (see Figure 3.1). Invertebrate arx orthologs differ extensively to veftebrate ARX orthologs in the amino acid sequences preceding the homeodomain (not shown). Due to the divergence or incomplete sequence availability of some ARX orthologs individual ARX domains were analysed separately (Figure 3.2). Within

ARX, both the octapeptide domain and the nuclear localization sequence (NLS) are l00Yo conserved in vertebrates, but interestingly are absent in invertebrates. The acidic domain is conserved in mammals (100%), but less well conserved in other veftebrates (39% in

Xenopus) and is absent in invertebrates. As expected the ARX homeodomain is the most highly conserved domain across all species (fromgl%o to 100%). While the aristaless domain is present in all species, it is less well conserved in C. elegans (21%) and Hydra (21%). This indicates how important each domain might be to the normal function of ARX and how they may contribute to disease phenotypes when mutated. Furthermore, unpublished work generated within our laboratory demonstrated that both the entire ARX protein and various individual ARX domains/regions (octapeptide, acidic, homeodomain and polyalanine tracts) are capable of repressing transcription (Figure 3.3). Conversely the ARX aristaless domain was shown to activate transcription. CHAPTER 3 - 116

YCIDSfLG PPKLRR],Y E rr ssiaal-rlka eh A. B. SI.Lù^],RL 100% Human ïrlI tr!1f LG 100% Human E,F}ILF,P,LÏ r00% Bovine Human ËIÁÀIRL t00% Mouse ïi'Itr::ILG 100Y" Mouse FE,HLRRLÏ r00% Mouse ÈI¡-4LRLKÀJIE 100% Rat îf]IDiTÏLÜ l00o/o Rat F FFiLP.RLY l00Yo Rat S I¡J.],F.LI{¡";¡E 100% Xenopus ï'lI t' ll I LG Xenopus E,F}iLFIF.LÏ 7O0o/o t00% Xenopus SI.Lù.IP.LEÀ.58 t00% ïËI t,Fi ILË Zebrafish FE,FiLRFILY t00% Zebrafish 100% Zebrafish gI r00% Bee I 79% e deeE IeDEEDE EEEEI]Edd eelledd Cricket LlT r00% c ST t00% Human E TEET, EEELLED ELLEDD t00% Drosophila cd 2t% ÞIouSê EE I,E E t' EE E LLE ELLEDD t00% C. elegans purpuratus IA¡.LR 86% Rat EE t'EEtE EEELLE ELLEDD l00o/r S. L. I¡¡.LR 86% Xènopus QSP EEt,E EEE SVKQHNSSN 39% variegates prdl-a T LI zl%o D RRyRTTFT OL ElE F THYPDVf REEIA. LTEÂR e Bovine F tllFl 100% F,*lJFlFl¡^litl Fi 100% Human FIYF].T T F T LE HÏ E DVE ,- I Fl Fl.!-Filtl F: 100% Mouse FIYFIT T F 1 LE Hï E t,',,¡E I Rat YFiTTFT L HÏ Ft VF ,:l'l Fl Fi¡,Flfìl F. tiiE 100% F ,-lJF:Fl¡-¡iUF: FiFE 100% Xenopus 1t.rfE L HÏ E L,VE E'-rl I Fl F:¡-llll'I F: Fiá-ì E t00% Zebrafish F.f.IT.II HÏEt!'F 100% Bee F],ÏFiT T F Hï E 100% Cricket FYFITTE na E 100% Drosophila FIT FiT T F HÏ E ,1ir 96% C. elegans FlYFIT T F HÏ S. purpuratus TTE E HÏ 9t% L. variegates Itt TTFT ü; HÏ E :II FI 9t% É'r-rlIF E' ù l:fiìT 100% prdl-a F:YFiT T F LE Hï FT ,rlJ prdl-b r-at.aact LE HÏ E Fl Fl¡-lift-I Fl 93% Acidic; D. Homeodomain; Figure 3.2: Orthologous protein sequence alignments of various ARX domains.,4. Octapeptide; -8. exon 2 NLS; C.

grey,80%: darkgrey and 100%o: aîdE.Aristaless. Amino acids identicalro consensus sequences (above alignments) are shaded (60%: light indicated to the right of each black). Non-conserved amino acids are unshaded. Percentage of similarity each domain has to the consensus is alignment. CHAPTER 3 - TI7

B. GAL4 A. NKlO 63 WT

1-281 l-495 OP 75 pAl & A2 AC & pA3 HD pA4 OAR 012346064 Relative Reporter Gene Expression

Figure 3.3: ARX represses transcription from CAT reporter gene in a transient transfection assay. ,4. Schematic diagram of ARX deletion constructs showing the position of their indicated amino acid position within ARX. .8. HEK 293T cells were transfected with 1 ug

GAL4-TK-CAT reporter vector, 0.3 ug B-gal internal control vector and 1.5 ug of the indicated GAL4-ARX deletion constructs (OP: octapeptide, pA: polyalanine, AC: acidic domain, HD: homeodomain and OAR: aristaless domain). Cells were harvested 24 hours post-transfection and CAT concentration was determined by ELISA and normalised to B-gal activity. Relative CAT expression is given as the means +SD from triplicate samples representative of at least three independent experiments. Full length GAL4-ARX fusion protein reduced expression of the CAT reporter gene by 7 fold, compared to GAL4 alone. The fourth polyalanine tract (pA4 amino acids 400-495) is largely responsible for this repression.

The aristaless domain increases the expression of the reporter gene suggesting it functions as a transcriptional activation domain. CHAPTER3 - 1I8

3.2.1.1 Octapeptide Domain

The precise function of the octapeptide domain is presently unknown. However, previous studies have shown that the octapeptide domain in Paired-class proteins is capable of mediating interactions with proteins involved in transcriptional repression (Table 3.2) The octapeptide domain is similar to the Engrailed homology repressor domain (eh-1) sequence.

In the Goosecoid Paired-class homeodomain protein and the Engrailed Antennapedia-class homeodomain protein the eh-1 domain mediates transcriptional repression (Smith and Jaynes,

1996; Mailhos ¿r al., 1998). Additionally, the human ARX octapeptide domain has been shown in our laboratory to have some repression capability (Figure 3.3). Therefore, this suggests that the function of the octapeptide domain is to mediate transcriptional repression through interactions with other proteins. Thus a mutation in the human ARX octapeptide domain, such as 98ÞC which causes NS-XLMR (Bienvenu et a1.,2002), potentially disrupts these protein interactions causing abhonent regulation of ARX mediated transcription. In

Chapter 4 the human ARX octapeptide domain was used in yeast two-hybrid screening to screen human brain cDNA libraries to determine whether the octapeptide domain directly binds to other proteins. Unfortunately, the yeast two-hybrid screening performed did not identiff any proteins as interacting with the human ARX octapeptide domain. CHAPTER3 - 119

Protein Domain Interacting Function of Interacting Reference Protein Protein Pax3 OP hDaxx Transcriptional co-repressor (Hollenbach et al., 1999) Pax5 OP Gr94 Transcriptional co-repressor (Eberhard et aL.,2000) Pax3 OP Calmyrin EF-hand calcium binding (Hollenbach et al., 2002) protein Hesxl OP Transducin Transcriptional co-repressor (Dasen et a|.,2001) -like enhancer of split- I Phoxl HD SRF Serum response factor (Grueneberg et al., 1992) Phoxl HD TFII-I Initiator binding protein (Grueneberg et al., 1997) (transcriptional activator), part ofthe basal transcriptional machinery Pax3 PaxT HD HIRA Transcriptional co-repressor (Magnaghi et aL.,1998) Phoxl Pax3 HD pRB-family Transcriptionaln repressors (Wiggan et a1.,1998) Chxl0 Pax3 HD hDaxx Transcriptional co-repressor (Hollenbach et al., 1999) Pax5 Pax6 HD PRB Transcriptional co-repressor (Cvekl et a|.,1999) TBP and basal transcriptional (Eberhard and machinery Busslinger, 1999) Pax3 PaxT HD hDaxx Transcriptional co-repressor (Hollenbach et al., 1999) Pax6 HD Cdx-213 Transcription factor (Ritz-Laser et al., 1999) Otx2 HD HNF-3p Transcription factor (Nakano et a|.,2000) Crx HD Nrl Transcription Factor (Mitton et a|.,2000) Vsx-l HD Ubc9 Ubiquitin-conj ugating (Kurtzman and enzyme. Also facilitates Schechter,200l) nuclear import Pax6 HD Mitf Transcription factor (Planque et a|.,2001) Rax Chxl0 HD Pax6 Paired-class transcription (Mikkola et a1.,2001) factor Pax3 HD Mox2 Antennapedia-like (Stamataki et al., 2001) transcription factor Pax3 Pax6 Crx HD Importin 13 Nuclear import protein (Ploski et a|.,2004) Px6 HD cVax and Transcription factors (Leconte et a|.,2004) Tbx5 Pitx2 OAR Pit-1 Transcription factor (Amendt et a|.,1999)

Table 3.2: Proteins found to interact with domains of Paired-class homeodomain proteins

(OP: octapeptide, HD: homeodomain and OAR: aristaless domain)' CHAPTER 3 - I2O

Interestingly, the DNA sequence of the octapeptide domain in Pax Paired-type genes contains a highly conserved TNTTCCT motif (Ziman and Kay, 1998). The motif is also highly conserved in the ARX octapeptide domain (Table 3.3). Ziman and Kay (1998) postulated that this motif acts as a binding site for modif,,ing proteins that regulate C-methylation or demethylation machinery. DNA methylation status plays an important role during development to regulate the transcription level of genes (Ehrlich, 2003). Therefore, ARX mutations such as 98C>T found in an NS-XLMR family (Bienvenu et al., 2002), which mutates the second cytosine residue in the octapeptide DNA motit may affect the transcription levels of ARX.

3.2.1.2 Homeodomain

As discussed in Chapter I the Q5s Paired-like homeodomain mediates binding of the transcription factor to DNA by sequence specific DNA recognition. When tested in transcription studies, we have observed that the homeodomain of ARX is also able to repress transcription (Figure 3.3). Repression by the homeodomain is most likely mediated through its interaction with other proteins as Paired-class homeodomains directly interact with other proteins, most of which are involved in transcription (Table 3.2). All nonsense and missense mutations in the human ARX homeodomain discovered to date affect highly conserved residues among the ARX orthologs (Figure 3.4). Hence these mutations likely affect DNA

binding, interactions with other transcriptional machinery or both. Mutations in the ARX

homeodomain may also affect nuclear import. Located at both ends of the Paired-class

homeodomain are NLS-like motiß as indicated in Figure 3.4. These NlS-motifs are required

for nuclear import of the Paired-class protein Cartl (Furukawa et a1.,2002), Vsx-l import by

ubiquitin-conjugating enzyme 9 (Ubc9) (Kurtzman and Schechter, 2001) and Pax3, Pax6 and CHAPTER 3 - I2I

Gene DNA Arx Mouse TAC TGC ATC GAC ALrU ATC CTG GGC Arx Rat TAC TGC ATC bAU Atr\- ATC CTG LrLr t- (:trU ARX Human TAC T\JU ¡tr\- GAC AGC ATC CTG arx Fish TAC TGC ATA GAC AGT ATA CTG bbu (Jf\U arx-A Frog TAC TGT ATA AGT ATC CTG \J(Ju (J(Ju PaxT Mouse CAC AGC ATC GAT (JtJU ATC CTG aLa (JAU (Jbu PAXT Human AGC ATC ATC CTG bUU nñ^ (](Ju Pax3 Mouse CAC A(r\- .H.I \- GAT ATC CTG ¡\Lr I ñ^r- (:trU PAX3 Human AbU ATC GAC ATC CTG A(]\- Paxl Mouse CAT GTC AGC AAC ATC CTG (Jbu AtrU AAC ATC CTG GGC PAXI Human CAC -L ULr GTC (¡(¡tl Pax2 Mouse TAC TCC ATC AAU bbu ATC CTG Pax5 Mouse TAC TCC ATC AGT Lr(:\- ATC CTG bbu PAX5 Human TAC TCC ATC AGC tr(¡U ATC CTG GGC Pax9 Mouse CAC TCC GTC AI,-U GAC ATC CTG trLrU a^ñ (Jb\- PAXg Human TCC GTC ^ña GAC ATC CTG (:tr(: PaxS Mouse TAC TCT ATC AAC CTC CTA GGA PAXS Human TAC TCC ATC AAT Lr\J\J CTC CTG Lr(:U tr trtr PaxS Dog TAC TCC ATC AAC tr(:(: CTC CTG CTC CGC PaxQNR Quail IU\J IU\J ATA AAC AGA GTC (.:LrU trtrA PaxZft Fish L ¡.\. \- TCT ATT AAT ATC CTA Concensus TC RRY RRY RTC CT

Table 3.3: DNA sequences of the conserved octapeptide domain encoded by various

orthologs and, Pax genes. Invariable nucleotides are shown in blue. Last line shows the

TNsTCCT motif which is highly conserved (R: A or G, Y : C or T). Modified from Ziman

and Kay (1998).

Crx import by Importin 13 (IPO13) (Ploski et a1.,2004). Furthermore these NlS-motifs are

invariant across ARX orthologs, except for the Hydra prdl genes which are the most distantly

related among the ARX orthologs. Interestingly as discussed in Chapter 4 IPO13 was found to

directly interact with the human ARX homeodomain (section 4.2.5). The significance of this

interaction is discussed in Chapter 4 section 4.3'2 and in Chapter 5 section 5.3' CHAPTER 3 - 122

Helix I Helix II Helix III

KRKQRRYRT T F T SYQLE E LERAE QKT HY PDVF T RE E LAMRLDLT EÀRVQVÍüE ONRRÀKI|IRKRE K Bovine Human MouSê Rat Xenopus Zebrafish --- Bee KIG T ::::a: : Cricket TKIG I . . . . ç. . Drosophila KIG I ....4.. C. elegans .....T.vQ .Y..Q.R S, purpuretus N R . . Q. . L. C...... R L. variegates N R ..Q..L.c. F prdl-a .....v.vH prdl-b V. NR M.VK G....I. ++ + ++ HN L XX C R P

Figure 3.4: Nonsense and missense mutations in ARX affect highly conserved residues

among ARX orthologs. Species of the ARX ortholog is listed on the left-hand side. The

homeodomain is depicted as a line above the consensus sequence, with the cr-helices denoted

by black boxes labelled helix I, II and III. Solid lines under the consensus sequence depict

basic residues that are part of NLS-like motifs (Ploski et a\.,2004). Residues identical to the

consensus sequence are shown by a dot. Nonsense (X) and missense mutations identified in

humans are indicated below the ortholog alignment by arrows.

3.2.1.3 Aristaless Domain

As shown in Figure 3.2 the aristaless domain of ARX orthologs is highly conserved in the

Chordata (Vertebrata), Arthropoda and Nematoda phyla, but is less well conserved in the

Echinodermata and Cnidaria phyla. This indicates that the aristaless domain plays a very

important part in the normal function of ARX. Furthermore, the importance of the aristaless

domain to the normal function of the ARX protein is shown in humans where mutations that CHAPTER 3 - 123 delete the aristaless domain (IVS4-816 EX5701del, 1372delG, 1187-l188insC and l4l9- l420insAC) cause ISSX and XLAG (Kitamura et a\.,2002; Stromme et al., 2002; Hartmann et a1.,2004;KaTo et aL.,2004).

Of various homeobox genes studied so far, the aristaless domain has been found to function as both a transcriptional activation (Simeone et al., 1994b; Rao e/ al., 2007) and repression domain (Amendt et al., 1999; Noris and Kern,2001; Brouwer et a1.,2003). An aristaless domain repression model was first suggested by Amendt et al. (1999) and later refined by

Norris and Kern (2001) and Brouwer eÍ al. (2003). In the repression model, the aristaless domain represses transcriptional activation by regulating DNA binding and transcriptional activities in response to cell specific cofactors such as another transcription factor (Figure

3.5). In the absence of cell specific cofactors, TheAristaless-related Paired-class protein folds so that the aristaless domain is in direct contact with the N-terminus of the protein. This folding interferes with the transcription factor DNA binding as well as hides a potential transactivation domain. When a cell specific cofactor binds to the aristaless domain, it causes a conformational change that unmasks the homeodomain and potential transactivation domain, thus allowing transcriptional activation to proceed. In the case of Pit-l binding to

Pitx2, the cofactor binding causes synergistic activation of gene transcription (Amendt et al., teee). CHAPTER 3 - 124

C

C A. B. N N

Homeodomain Homeodomain

Decreased DNA binding Increased DNA binding Repressed transcription activity Increased transcription activity

Figure 3.5: Model of aristaless domain mediated repression. A. In the absence of a cell specific cofactor the Aristaless-related Paired-class protein folds so that the aristaless domain

(OAR) binds directly to the N-terminal tail (dotted lines), therefore interfering with DNA binding and transcription activity. ^8. A cell specific cofactor binds to the aristaless domain, causing a conformational change in the Paired-class protein which exposes an activation domain (AD), resulting in increased DNA binding as well as increased transcription activity

(Modif,red from Amendt et a1.,1999; Nonis and Kern 2001).

From studies performed within our laboratory, wo have found that the human ARX aristaless domain acts as a transcriptional activator in HEK 293T cells, while the ARX protein as a whole strongly represses transcription (Figure 3.3). While ARX represses transcription in

HEK 293T cells, it may have no affect or activate transcription in other cell types. Similar positive effects on transcription were found with the aristaless domain for the Aristaless- related Paired-class homeodomain protein Cartl, which activated transcription in 293 cells

(Furukawa et al., 2002). Unlike ARX, the Aristaless-related Paired-class homeodomain protein SHOX had no affect on transcription in the non-osteogenic HEK 293T cell line, but acted as a transcriptional activator in the osteogenic cell line U2Os (Rao e/ a1.,2001). When CHAPTER 3 - 125 the aristaless domain was deleted from the SHOX protein it could no longer activate transcription in the U2Os cell line, demonstrating that the aristaless domain activates transcription. This suggests a cell-type specific mode of activity for Paired-class homeodomain proteins in gene transcription. Therefore the type of proteins that interact with the ARX aristaless domain may also affect its transcriptional ability. Furthermore, it is the sum of all ARX protein interactions which would determine whether ARX acts as a transcriptional repressor or activator in different cell types. Interestingly the proteins identified as interacting with the human ARX aristaless domain were Pyruvate Kinase M2

(PKM2) and Protein Interacting with C Kinase I (PICKI) (Chapter 4 section 4.2.5). While both of these proteins are not generally known to be part of the transcriptional machinery,

PKM2 may play a role in providing energy for ARX mediated gene transcription and PICKI may play a role in regulating the phosphorylation of ARX as discussed in 4.3.3 and 4.3.4 respectively.

3.2.2 Conservation of ARX Polyalanine Tracts

The most frequent mutations in ARX occur within the first two polyalanine tracts (Chapter I

Table 1.4). Sequence data available from the GenBank database shows that the polyalanine tracts are highly conserved in mammals with the fourth polyalanine tract l00o/o conserved in all vertebrates except for zebrafish where the fourth polyalanine tract is 89olo conserved

(Figure 3.6 A, B). Notably, the polyalanine tracts are absent in invertebrates, except for the cricket arx. Cricket arx contains fìve of the nine polyalanine residues in a similar position to the fourth polyalanine tract of the mammalian ARX orthologs. Interestingly, upon alignment of ARX there was a noticeable difference between the rat ortholog to the other mammalian orthologs, where the first two polyalanine tracts were completely absent in rat ARX protein CHAPTER 3 - 126

(Figure 3.6 C). A search of the GenBank database failed to find any rat EST, mRNA or genomic Arx seqtences that contained these first two polyalanine tracts.

A. fuA¡tLA¡A¡AJDreea B. fuAs*'aÀaÀa Human Bovine Mouse Human Rat FIousê Rat Xenoplis Zebrafish Cricket

c. NLS I Hmån GS F}iS S ÍIÀPEEÂE LHI PPI;LRR FPPF L43 Mousê LHI PPKI,RRI pppp L44 Ret Pt¡ 93

2 Hmen Mouse 222 Ret L50

Acidic J HMan ÀT [ -1,]ELrl F r.8 ELLLII 298 Mouse ¡T Ii,1,ìn l, Íl F I: n E l,LL t I 300 Ret À E'; ]EI,::] F I.E EI,T,LFI 230

Homeodomain PE D.À.E L' irì/UI ii¡-.i4.: D'; E E al], L K RYRTTFT :JY.JLE I LÛ R.ÀB']KT HY FD! F T :358 Human '-lKD'lE Mouse pI DAE.itiD.;E D Si1.¡ùI Íi.ACiS D g E B {:;LLK NYFIT T !'T:JYQ],E E LE RA.E L.ìKT }IY FDVF T :360 pE Rat f'ÀE GKn =;E D:l¡.i.L i::lÀ.1t:iD F.j E E Gl,L R E l,E FiÀt- T H'¿ Pt'\¡F T i 294

Figure 3.6: Multiple protein sequence alignment of ARX polyalanine tracts. l. Polyalanine tract 3 and B. Polyalanine tract 4. Amino acids that are identical to the consensus sequence

(shown above each polyalanine tract) are shaded (60%: light grey, 80%: dark grey and l00Yo: black). Non-conserved amino acids are unshaded. C. Mammalian ARX exon 2 including polyalanine tracts 1 and2. Amino acid positions are shown to the right. Dashes indicated gaps or lack of sequence data. Exon 2 NLS, polyalanine tracts, acidic domain and the start of the homeodomain are boxed. CHAPTER 3 - 127

Taking into account the close relationship between rat and mouse, we speculated that the absence of the first two polyalanine tracts in rat Arx sequences might be due to sequencing effors rather than de facto absence of this sequence in rat. Furthermore, Arx is highly GC rich and unstable as demonstrated by the frequency of de novo mutations discovered in the first two polyalanine tracts of humans (Chapter 1 Table 1.4). Therefore it was decided to perform rat genomic DNA sequencing to confrrm the absence/presence of the first two polyalanine tracts in rat Arx.

3.2.2.1Rlat Arx Ortholog Contains the First Two Polyalanine Tracts

Rat genomic DNA was purified from the PC12 cell line. Ptat Arx exon 2 sequence was amplified using oligonucleotide primers designed against human ARX exon 2 DNA encompassing the first two polyalanine tracts (Table 3.4).It was decided to use htman ARX exon 2 primers as rat ARX protein sequence from the beginning of exon 2 appeared To diverge signif,rcantly from both human and mouse sequences (Figure3.6 C). Furthermore, both the human and mouse IRX DNA sequences are almost identical at the beginning of exon 2 suggesting a high conservation of sequence and function.

Forward Primer Reverse Primer Size (bp) exon2primers CAGCAGCGCCCCGTTCGAGG GTTCTCGCGGTACGACTTGC 330

Table 3.4: Oligonucleotide primers used to amplify rat Arx exon 2 sequence. Pnmers are listed in the 5' to 3' orientation. CHAPTER 3 - 128

PCR amplifiedrat Arx exon 2 DNA was sequenced. The correct rut Arx exon 2 sequence was generated from genomic DNA of PC12 cells. This sequence was then used to correct the rat genomic DNA from the GeneBank database (NW_048042 region 24896077 ...24907541), and aligned it with both human and mouse ARX exon 2 sequences (Figure 3.7). Amino acids of mammalian ARX exon 2 were then aligned using ClustalW (Megalign module of DNASTAR program) (Figure 3.8). This alignment confirmed that like the human and mouse orthologs, rat

Arx does indeed contain the first two polyalanine tracts and that the sequence of rat exon 2 as current in the GenBank database is incorrect.

Human 90 Mouse 9A Rat 90

Hunqn | !74 |' MouEe Á( i;,-;r:l- -À, T'11.i, ÃCjú':¡lA,l,1'l I L77 Rat : 180

Hunån ::C; , 64 2 MouEê A,l il À;,; i;¡G,i,iT À ¡:J'., ¡,\r,l il,4r;i rtl, ,.: ll C'i 6l Rat ; i lA,-i,lrì iÀG,"iT Ajr,:Àr-À i i' 64

Hunan 354 Mouse 351 Rat 354

Human | 444 Mousê ÀGT'i : 441 Rat i,;¡ i ;'1, " À, i, , iÜ' i i li À,1, ; :444

Human : 534 Mousê ¡ 531 Rat ; 534

Human 62 Moua e 62 1 Rat 62 4

Human 699 MouEe I i'i L l, rl'i' C;,4 i""r: T ?05 7!4 Råt f,l,i ' : r--'-;'-C i, C

Human ?49 Mous ê 795 Ret 804

Hunen 877 Mouss 083 Rat 492

Figure 3.7: ARX exon 2 DNA sequence alignment of human, mouse and rat. Nucleic acid positions are shown on the right. Conserved residues are shaded (60%: grey and 100V": black). Dashes indicated gaps introduced for optimal alignment' CHAPTER 3 - 129

PolyA I Humen ;fl t't'isl-l:::¡,I'FETiELHLFt'liLFlFlLì,-;Pr-:L-1,-lFlLL,-1, l¡-ùr-i$r-Å:arJù-¡¡.Â'¡J\¡T¡. FFI FI, L28 MouEe FFiSI:ìir¡.EEE-Å.ELHLFE,FiLFlFll,iJtlEr';i;,aFlLL,-l, rÅrÂJr¡.À:ù!ù-r,.¡rq-À-¡-!,#l It.AT GT¡.I ]FE:']EVE, F' L29 Rat F' i:j :.4F'FE¡\ELHLF'F'liLF:F: L'i 1t'rlL llFlI-,lr-lr r¡3-¡.ù3f,r-irr1,t\f,1¡-ù.¡.¡.iJqTnTfiT,irlER iEVEE'F' L30

Pol 4.2

Humen E,F' FI E '-]E tTLliIËrl¡.f',-r-1.¡i:lltjFll:l¡l::ìïFlEllr-1.ù,ErF-iiFErEE'¡.LtE1,(j : l-93 Mousê E'E E'ÈÀ.F Ë, lE E ñfr Éì¡.'- t,T L li I ! Lr¡.E,riii-lT r:l Flì:j K 5ïFlEllLl.rr. FF''/ErF E' F¡.LtrE z L92 RåT F F,E'A¡ì F: F' ]E il ¡,, , rì. t,T Ll-;I:l,-r¡.8,l'ì,¡!lI Ë F ! Fi i:i-,'REl,J,rÀF E'J E E'E FùLtrELG : 193

Human : CL IEE L'rj:l¡.8'¡.ù,,;';,1T,:TEnt,EEELLEtEEt,Et¡EEIEELLEtt'EEELLEtt,¡.F:¿i 25

f r_i n-À-, r,lT Mouse : ,; E, l, ]':,r'A H E E lì F L Ë ¡!ù. S Í_1 E' lj -À, F ;ai r:[e DTIE E E r,E E r EEE E E E L¡6 ¡'¡'þ6 ¡ ¡r,e r'r .u.rre 2S 7 IT RåT ] r-i E r ir ;,.jÀH E, E E F L S¡.ù-S r ; L,' l !i -À, E,¡¡ _lf_lr ;T : T EE IIEE T EDEEEE LLE I EE ELI,E TIT ¡.R.N, 25 I

3

Humen : T,}iE E'F: F: .À.T E, l' l e L l:i F li E E L L L H Ë E t'ÀE L ;Ìi t, IE D r-i'\.'Íl L i:i ¡.,_1 ij 3 1_8 Mouse : Ll:E FFl Fl,- 31.¡.4T T, lT'1. À T lì,;L-ilì T, 1l F, Fl E E L L L H F E tr.ù.E L il4 L,-j E tr Ë'1.¡{- L li.ù.L l l:i t, 320 ,.¡AT j Rat : LliE E Fl F:r- S-.,'ÀT T,-T'! E':;r_j E L :j E ti E E L L L H E E tr¡.E,:lti t r E t, l:l'.¡,' L !:i ¡-r l i:l tl 323

Homeodomain Human : ÊEE{;LLKR ¡,leRRyH.r.r pr syçLE E LE R¡'F'lÍiT Hy FD\¡FT JJO Mousê : Í E E ¡.l,,,R e'.'ntt rt s'1L! LE E LE RAF .,.,KT Hy rDVF ï - : 360 'JL],IiR r-rrir pf,vF Rat : FJ E E GLLHR tl.¡R r.l'Rr r ryr ,-'y.JLE E LE R ÀF H'i T 363

Figure 3.8: Sequencing of rat genomic DNA shows that rat ARX contains the first two

polyalanine tracts. Amino acid positions are shown to the right. Dashes indicated gaps

introduced for optimal alignment. Conserved amino are shaded (60%: grey and 100%o: black).

Non-conserved amino acids are unshaded, Polyalanine tracts, acidic domain and the start

the homeodomain are boxed.

Hence alignment of the ARX orthologs showed that the first three polyalanine tracts are

highly conserved in mammals and the fourth polyalanine tract is highly conserved in the

vertebrates. The appearance of the first three polyalanine tracts almost exclusively in

mammalian ARX proteins suggests convergent evolution (Lavoie et a1.,2003). This is where

the rapid appearance of conserved polyalanine tracts in mammalian ARX orthologs may have

occurred independently, increasing the biological complexity of mammalian ARX for

functional reasons. CTIAPTER 3 - I30

Conservation of polyalanine tracts in mammals but not in other vertebrates is not an unusual event. For example both HOXAI3 and class III POU transcription factors contain polyalanine tracts only in mammals (Sumiyama et al., 1996; Mortlock et al.,2000). However, we do not know the function of polyalanine tracts. It is unlikely that polyalanine tracts are not functional considering that expansion of polyalanine tracts in eight other proteins cause various diseases

(Chapter I Table 1.6). Polyalanine tracts are found in at least 494 human proteins and are highly enriched in transcription factors suggesting a role for polyalanine tracts in transcription

(Lavoie et al., 2003). Studies have shown that regions rich in alanines are capable of repressing transcription in the Drosophila proteins kruppel (Licht et al., 7990), engrailed (Han and Manley,1993) and even-skipped (Licht et aI., 1994), and in human octamer binding protein 1 (Kim et al., 1996). All of the polyalanine tracts encoded within the human ARX protein are capable of repressing transcription activity, but the fourth polyalanine tract of

ARX is capable of repressing transcription the strongest (Figure 3.3). Interestingly, the fourth polyalanine tract is also the most conserved (Figure3.6 B). However the question remains as to how these polyalanine tracts repress transcription.

In proteins where expansions of polyalanine tracts cause disease the structural consequences to the proteins areyet to be determined. Studies of polyalanine tracts within spider dragline silk and silk fibroin from the wild silkworm Samia cynthia ricini, show that they form o- helical structures (Xu and Lewis, 1990; Nakazawa and Asakura, 2003). Furthermore, studies on polyalanine peptides have shown that the polyalanine peptides can fold into p-sheets, a left-handed L-helix or a right-handed c¿-helix depending on environment, concentration, terminal charges and tract length (Blondelle et a1.,1997; Son et a1.,2001). Interestingly, as discussed in Chapter 1 (section 1.3.6) it has been shown that expansion of polyalanine tract length over a threshold of 18-22 residues in proteins including ARX (Chapter 5 section 5.2.5) CHAPTER 3 - 13I can cause the formation of cytoplasmic and nuclear aggregates (Uyama et al., 2000; Fan et aL.,2001; Albrecht et a|.,2004; Caburet et aL.,2004; Nasrallahet a1.,2004).It has also been shown that polyalanine peptides first form undefined aggregates that after a lag phase convert into small stabilized B-sheets (Nguyen and Hall, 2004). Hence it appears that expansion of polyalanine tracts is able to cause structural changes within proteins after aggregate formation has begun to occur.

Polyalanine regions are also thought to act as spacer or hinge regions to help maintain the proper orientation of other domains within a protein (Karlin et a1.,2002; Brown and Brown,

2004). Therefore, expansion of polyalanine tracts can potentially affect the orientation or spacing of domains within a protein. If the polyalanine containing protein was a transcription factor, altered protein conformation could affect transcription by an increase/decrease of binding to another protein or to DNA. While the affect on the expansion of the polyalanine tract in the ZIC2 protein has not been structurally determined, it was found that the mutated

ZIC2 profein had altered transcriptional activity and DNA binding in a promoter specific context (Brown et aL.,2005). This suggests that polyalanine tracts can affect transcriptional activity by altering DNA binding in a sequence specific manner.

3.3 SUMMARY

In this chapter the GenBank and Ensembl databases were used to identifu partial bovine and

Hydra ARX ortholog sequence and full length orthologs of ARX from the mouse, rat, zebrafish, Xenopus, C. elegans, honey bee, cricket, Drosophila and sea urchins. The amino acid sequences from the ARX orthologs were aligned to ascertain the phylogenetic relationships between the orthologs and the regions and domains of ARX conserved through CHAPTER 3 - 132 evolution. As expected vertebrate ARX orthologs were closely related to each other as were the invertebrate arx orthologs. The knowledge generated as part of this analysis of conservation was used to infer how mutations identified in the human ARX protein may disrupt the normal function of ARX in development. From the alignment of ARX orthologs, it was found that the octapeptide domain, exon 2 NLS, fourth polyalanine tract and to a lesser extent the acidic domain are highly conserved in vertebrates. The homeodomain is highly conserved across all species, and the aristaless domain is highly conserved across all species except C. elegans and cnidarians where is less well conserved (21%). Analysis of rat Arx sequences found in the databases showed that they were missing part of exon 2 which encoded two polyalanine tracts at a similar position to the first two polyalanine tracts of human ,4RX. Sequencing of rat genomic DNA however, subsequently showed That rat Arx does encode two polyalanine tracts within exon 2. Analysis also showed that the first three polyalanine tracts are only conserved in mammals. The conserved domains of ARX have been shown in closely related proteins to be involved in transcriptional regulation and in some cases to directly bind to other proteins. Furthermore, ARX domains and polyalanine tracts have been shown to play a role in transcriptional repression and activation. Therefore mutations which affect each of these domains and regions of human ARX are likely to disrupt its normal function in a cellular environment and cause misregulation of ARX mediated transcription. To discover the functional consequences of mutations in ARX, experiments such as the identihcation of proteins interacting with ARX and how mutations in ARX affect both these protein interactions and ARX transcriptional activity must be performed. Some of these issues are presented and discussed in Chapter 4 and Chapter 5 with work concerning the use of yeast two-hybrid screening to identifr proteins that interact with ARX. CHAPTER 4

Yeast Two-Hybrid Screening

4.1 INTRODUCTION. 134

4.1.1 BASrcs oF THE PROQUESTTM YEASr Two-Hverul SvstsÀ4 .....'..'..'...... 135

4.1.2 SCREENING A CDNA LIBRARY WITH ARX FOR NOVEL INTERACTING PROTEINS 138

140

4.2.I CONSTRUCTION OF ARX DOMAIN BAIT PLASMIDS ..'.'...... ' I4O

4.2.2 TRANSFORMATION INTO YEAST STR¡ru MAV203....,...... I43

4.2.3 ExpRESSToN oF GAL4DB¡-ARX DovAIN FusIoN PRorElNS...... '.'.-..-.--..144

4.2.4 AUT}ACTIVATION TESTING AND HIS3 REPORTER GENE BASAL EXPRESSION LEVEL TESTING,...... ,...I45

4.2.6 RETRANSFORMING YEAST V/ITH THE INTERACTING PNOTEINS BY GAP R8P4IR....,...... ,... 150 4.2.7 PICKI ORF Inrsnacrs wIrH rm ARX ARISTALsss Dotrlem ...... '...... 154

159

4.3.1 Pnorens rHAr INTERACT wtrH ARX DoMAINS By YEAST Tvúo-HYBRID AN¡LYSIS...... 159

4.3.1.1 Importin I 3 (IPOI 3) 164

4.3.1.2 Pyruvate Kínase M2 (PKM2) t68

4.3.1.3 Protein Interacting with C Kinase I (PICKI)...... -...... '..'..-..- 170 4.3.2P)LYALRNINE Yp¡,st Two-HvsRIl ScRrpNINc ".-..-..-...... 174 CHAPTER 4 - 134

4.I INTRODUCTION

ARX is a novel member of the paired-type homeobox gene family of transcription factors. As such not much was known about the function of ARX at the beginning of this study. Though some of the functional roles of ARX are beginning to emerge (see Chapter I section 1.3.3), it

is still not known what genes ARX regulates as a transcription factor (aside from PAX4) or what proteins ARX interacts with in the cellular environment.

Finding what proteins ARX interacts with could be extremely important. It may provide clues

as to l) what genes are transcriptionally regulated by ARX; 2) how the function of ARX as a

transcription factor is regulated; 3) the precise role of ARX in complex developmental

pathways; 4) if mutations in ,41?X disrupts these protein interactions; and 5) how these l,RX

mutations cause a wide variety of diseases and even how just one mutation in ARX (i.e. the

polyalanine 24 bp duplication mutation) can cause different diseases. Furthermore, by

identifring the proteins that interact with ARX, we also potentially discover other proteins

that may be involved in causing mental retardation and epilepsy.

In this Chapter yeast two-hybrid screening was used to discover novel proteins interacting

with ARX. Yeast two-hybrid screening is a powerful and well developed tool that is

commonly used for the identification and characterization of novel protein-protein

interactions. To identiff novel protein interacting with ARX, the yeast two-hybrid screening

was performed using the ProQuestrM Yeast Two-Hybrid System with Gateway@ Technology

(Invitrogen). CHAPTER 4 - 135

4.1.1 Basics of the ProQuestrM Yeast Two-Hybrid System

The yeast two-hybrid system was first developed by Fields and Song, and has since been modified and improved (Fields and Song, 1989). Itis an invivo based systemthatdetectsthe

interaction between two proteins (protein X and protein Y) by the reformation of an active

transcription factor in the yeast Saccharomyces cerevisiae. The yeast two-hybrid system

exploits the observation that transcription factors are made up of at least two domains' A

DNA binding domain (DBD) mediates binding of the transcription factor to the gene

promoter by sequence specifrc DNA recognition. Transcription factors also have an activation

domain (AD), which recruits other transcriptional machinery to the gene for mRNA

production. Both the DBD and AD must be localized to the gene promoter for transcription to

occur. In the yeast two-hybrid system an active transcription factor is reformed when protein

X, fused to a DBD, forms a dimer with protein Y, fused to an AD. The reformed active

transcription factor is then detected by the activation of chromosomally-integrated reporter

genes containing DNA binding sites specific for the DBD (Figure 4.1). However, activation

of the reporter gene will not occur if the DBD and AD are not brought together in close

spatial association at the promoter of the reporter gene.

The ProQuestrM Yeast Two-Hybrid System utilizes the GAL4 transcription factor, which is

normally involved in regulating galactose utilization in yeast (for review see Johnston, 1987).

In the ProQuestrM system, the gene of interest (such as ARþ is sub-cloned into a vector in

frame with the GAL4oso. The GAL4pso-ARX fusion protein is then used to screen a cDNA

library that is expressed by a separate vector as fusion proteins with the GAL4no. Both the

GAL4oeo and GAL4¡¡ fusion proteins are transformed into the modified yeast strain

MaV203. CHAPTER 4 - 136

A. Expression

Reporter Gene GAL4 binding site

B

No Expression

Reporter Gene GAL4 binding site

Figure 4.1: Basis of the yeast t'ù/o-hybrid system. Yeast cells express GAL4DBo-X and

GAL4no-Y fusion proteins. A.If the two fusion proteins interact, then an active transcription factor is reformed, transcriptional machinery is recruited and reporter gene expression occurs.

B. If the two fusion proteins do not interact, the AD is not localized to the promoter, transcriptional machinery is not recruited and reporter gene expression does not occur.

MaV203 yeast contains deletions in the GAL4 and GALB} (repressor of GAL4) genes to enable the use of GAL4 as the basis of the yeast two-hybrid system. MaV203 yeast also contains a set of non-reverting auxotrophic mutations in leu2 and trpl to allow for selection of the GAL4oeo and GAL4aD expression vectors, and in his3 for growth dependent upon induction of the reporter gene I11S3. The two other reporter genes in the MaV203 yeast are lacZ and URA3. All three reporter genes are stably integrated at different loci in the yeast genome. Except for the GAL4 binding sites, the promoters of the three ProQuestrM reporter genes are unrelated (Figure 4.2). The advantage of unrelated reporter gene promoters is a CHAPTER 4 - 137 reduced chance of detecting false positive interactions, where the fusion proteins non- specifically bind to promoter sequences or to other proteins bound to the promoters. In other words three separate interaction events must happen to activate all three reporter genes'

UAS64¿.,¡ A. Growth on plates lacking + histidine and containing 3AT

UAS6¡¿.1 lacZ +Þ Blue on X-Gal GALl

GAL4 binding sites URS Growth on plates URAs + lacking uracil sPol

B. HISS lacZ URA3

X:Y do interact + Blue +

X:Y do not interact White

Figure 4.2: ProQuestrM Yeast Two-Hybrid System reporter genes. ,4. Structure of the promoter regions for the three reporter genes and the expected growth/colour results if reporter gene expression is activated. B. Expected growth and colour results of the reporter genes depending on if the fusion proteins X and Y interact or not. Figure modified from the

ProQuestrM Yeast Two-Hybrid Systems with Gateway@ Technology manual (Invitrogen).

Included with the ProQuestrM Yeast Two-Hybrid System is the five Yeast Control Strains

A - E (derivatives of the yeast strain MaV103). Expressed within these five Yeast Control

Strains are sets of plasmids expressing fusion proteins which have a spectrum of interacting

strengths (Table 4.1). CHAPTER 4 - I38

Control Strain Resident Plasmids cDNA Insert Interaction Streneth Control A pPC97 No insert none pPC86 No insert pPC97-RB human RB Acc#M28419 Control B amino acids 302-928 weak pPC86-E2F I human E2Fl Ãcc#M96577 amino acids 342-437 pPC97-CYH2"-dDP DrosophilaDP Acc#X79708 Control C amino acids l-377 moderately strong pPC86-dE2F Drosophila E2F Acc# U10184 amino acids 225-433 pPC97-Fos rat cFos Ãcc#X06769 Control D amino acids 132-2lI strong pPC86-Jun mouse cJun Acc#Xl276I amino acids 250-325 pCLl (encoding GAL4 Control E full length GAL4) Acc# K10486 very strong amino acids l-881 pPC86 no insert

Table 4.1: ProQuestrM Yeast Control Strains A - E. Table modified from the ProQuestrM

Yeast Two-Hybrid Systems with Gateway@ Technology manual (Invitrogen).

4.1.2 Screening a cDNA Library with ARX for Novel Interacting Proteins

The ProQuestrM Yeast Two-Hybrid System was used to screen human fetal and adult brain cDNA libraries (Invitrogen) for novel protein interactions with ARX. The main reason that human brain libraries were chosen was that ARX is expressed predominantly in the brain and skeletal muscle (Stromme et al,, 2002). Thus oDNA libraries made from either brain or skeletal muscle tissue should provide a good source of biologically relevant proteins that interact with ARX. Also in patients where ARX is mutated there is always some form of mental retardation, with additional epilepsy symptoms in some patients. It therefore suggests CHAPTER 4 - 139 that one of the most important developmental roles ARX plays involves the development and maintenance of normal brain function. The role of ARX in normal development and function of the brain is further supported by the observation that in Arx knockout mice, the brain is small due to impaired proliferation and migration of GABAergic interneurons (Kitamvra et al., 2002). Moreover the Arx knockout mice had abnormal differentiation of GABAergic interneurons within the forebrain.

For several reasons it was decided not to use the entire ARX protein to screen human brain oDNA libraries. These reasons included that the yeast two-hybrid system is based on the reformation of an active transcription factor to activate reporter gene expression. Therefore, if entire ARX was used in the library screen, it may have self activated the reporter genes without interacting with a protein encoded by the oDNA library vector. Whether the entire

ARX protein self activates the reporter genes or not is cunently being tested. Secondly by using individual domains in a yeast two-hybrid screen, we localize the interactions to a smaller region of ARX. However, there is a chance of not identifying a protein that interacts with ARX, as it is possible that more than one ARX domain could be required for the interaction. Furthermore, some of the ,4,RX mutations discovered to date affect the octapeptide, homeodomain and aristaless domain. In some cases the ARX mttations truncate the ARX protein deleting these domains (Chapter I Table 1.4). The mutations therefore suggest that these ARX domains play an important role in regulating the function of ARX.

This is supported by the observation that in related Paired-type homeobox genes these domains are capable of interacting with transcriptional machinery proteins (Chapter 3 Table

3.2), and in the case of the homeodomain it is also required for DNA binding. It is therefore expected that the same domains in ARX interact with similar types of proteins. Finally, the

ARX homeodomain and aristaless domain are highly conserved in evolution, and the ARX CHAPTER 4 - I4O octapeptide domain is highly conserved in vertebrates (Chapter 3 Figure 3.2). lt was therefore decided to screen the human brain cDNA libraries with the ARX octapeptide, homeodomain and aristaless domain (Figure 4.3).

Octapeptide AlaAla Ala Ala TNII T T NLS Acidic Homeodomain Aristaless + + + I

GAL4¡sp-Octapeptide GAL4¡s¡-Homeodomain GAL4ono-Aristaless tr'igure 4.3: Domains of ARX fused to the GAL4os¡ for use in yeast two-hybrid screening

4.2 RESULTS

4.2.1 Construction of ARX Domain Bait Plasmids

Gateway@ technology (Invitrogen) was used to clone ihe ARX octapeptide, homeodomain and aristaless domains initially into the Gateway@ donor vector pDONRrM2Ol to generate an entry clone. The entry clones containing an ARX domain were then used to facilitate cloning into the Gateway@ destination vector pDESTrM32 to generate an expression clone (Figure

4.4). The pDESTrM32 vector contains the GAL4 DNA binding domain (GAL4oeo) thus allowing expression of GAL4oeo-ARX domain fusion proteins in yeast cells.

Oligonucleotide primers were designed to clone the octapeptide (aa l-69), homeodomain

(aa 303-43I) and aristaless domain (aa 472-562) of ARX in frame with the GAL4oso in the CHAPTER 4 - I4I pDESTrM32 vector (Table 4.2). When designing the primers, attB recombinational sequences were added onto the 5' end of each primer. For the ARX ochapeptide domain and the homeodomain a stop codon sequence was added to the reverse primer between lhe attB2 site and the template specific sequence. This stop codon was to ensure that protein translation stops after the ARX domain once it was cloned into the destination vector. The addition of a stop codon in the reverse primer sequence for the aristaless domain was not necessary as the stop codon that is part of the,4ÂXcDNA sequence was utilized.

ARX Domain Forward Primer Reverse Primer Size (bp) Octapeptide G G GGACAAGTTTGTACAÀAAA GGGGACCACTTTGTACAAG 271 AGCAGGCT T CAT GAGCAATCA AAAGCTGGGTCCTACTTAG GTACCAGGAG GGGAGCCTTGCAC Homeodomain GGGGACAAGTTTGTACAÀÀAA GGGGACCACTTTGTACAAG 4s4 AGCAGGCTT C GAGGGCAAGGA AÀÀGCTGGGTCCTAAGTCC CGGCGAG AAGCGGAGTCGAGC Aristaless G G G GACAAGTTT GTACA.AÀ.AÀ GGGGACCACTTTGTACAAG 337 AGCAGGCTT C CGACACC CAGC AA.A,GCTGGGTC T TAGCACA TTTCATC CCTCCTTGCC

Table 4.2: Oligonucleotide primers used for PCR amplification of ARX domains for cloning into the Gateway@ vectors (Invitrogen). Primers are listed in the 5' to 3' orientation. The attBl and attB2 recombinational sites are indicated in bold, and ARX specific sequences are underlined.

The attB-ARX domain PCR products were cloned into the donor vector pDONRrM2Ol by performing a BP recombination event. The recombination reaction was performed between the attB sites in the ARX domain PCR products and the attP sites in the pDONRrM2Ol vector using the BP ClonaserM enzyme mix (Invitrogen). The recombination between Lhe attB and a/tP sites created attL sites located either side of the ARX domain within the resulting entry CHAPTER 4 - 142

atlBl attB2 auPl aîtP2 attLl ailRl atlR2 ARX domain ccdB gene BP ClonaserM ARX domain ccdB gene + + arlB flanked PCR pDONRrM2Ol Entry By-product product Vector Clone

Step 2 attLl aîtRl attR2 attBl attB2 attPl attPz ARX domain ccdB gene LR ClonaserM ARX domain ccdB gene + + Entry Entry pDESTrM32 Expression Vector Clone Clone Vector By-product

Figure 4.4: Overview of cloning the tttree ARX domains (octapeptide, homeodomain and aristaless) into the ProQuestrM yeast two-hybrid system with Gateway@ technology. In step I using the BP ClonaserM enzyme mix, The ARX domain PCR product containing flanT<:ng attB recombination sites, is cloned into the pDONRrM2Ol vector to create an entry clone. The LR ClonaserM enzyme mix is then used in step 2 to clone the ARX domains into the pDESTrM32 vector to create the expression clone which will express GAL4osr-ARX domain fusion proteins in yeast. Between the 3' end of each ARX domain and the recombination site a stop codon is encoded (asterisk). CHAPTER 4 - 143 vector. The BP recombination reaction was transformed into magnesium chloride competent

DH5arM Escherichía coli (Invitrogen) and selected for by growing on Luria broth medium containing the antibiotic kanamycin (Roche). Entry clones were then sequenced to ensure that there were no mutations in the ARX domain sequences, and that the ARX domains were in frame with codons located within the recombination site. A LR recombination event was then used to clone the ARX domain from the pDONRrM2Ol vector into the destination vector pDESTrM32 containing the GAL4oeo. LR ClonaserM enzyme mix (Invitrogen) was used for the recombination reaction between the attl- sites in the entry vector and the a/¡R sites in the pDESTrM32 vector. The LR recombination reaction was transformed into magnesium chloride competent DH5c¿rM cells and selected for by growing on Luria broth medium containing the antibiotic gentamicin (Pharmacia). The resulting ARX domain expression vectors were re-sequenced to confirm that the construction of the GAL4ost-ARX domain fusion proteins contained no mutations and were within a single open reading frame.

4.2.2Transformation into Yeast Strain MaV203

ARX domains in the pDESTrM32 expression vector were transformed into the ProQuestrM yeast strain MaV203 using a small scale lithium acetate method. Selection of yeast transformed with the expression vector occurred by growing at 30'C on synthetic complete

(SC) medium deficient in leucine. As controls for the transformation and fufther construct testing, MaV203 yeast were also transformed with the vector pDBLeu (Invitrogen) expressing the GAL4nso, or cotransformed with the GAL4 activation domain (GAL4AD) Gateway@ expression vector pEXP-4D502. pDBLeu and pEXP-4D502 vector transformations were CHAPTER 4 - 144 selected for in yeast by growing on SC medium deficient in leucine and tryptophan respectively.

4.2.3 Expression of GAL4nsn-ARX Domain Fusion Proteins

Expression of the GAL4oso-ARX domain fusion proteins in MaV203 yeast was confirmed using western blot analysis. Crude yeast protein lysates were prepared from yeast transformed with the ARX domains in the pDESTrM32 vector. The crude protein lysates were then separated by SDS-PAGE analysis under reducing conditions. An anti-GAL4oso horseradish peroxidase conjugated antibody (Santa Cruz Biotechnology, Inc) detected the fusion proteins

GAl4ogo-Aristaless (26 kD), GAl4ren-Homeodomain (32 kD) and GAl4os¡-Octapeptide

(24 l

4D502 (lane 7). CHAPTER 4 - T45

¡ld trE;f (.)

a + tì (5

pEXP-A.D502 + + ++ 37kD + 2skD r lÖ 20kD + 1234s67

Figure 4.5: Expression of GAL4oen-ARX domain fusion proteins transformed into MaV203 yeast. GAL4oeo-ARX domain fusion proteins were detected by a 1:1000 dilution of the anti-

GAL4oeo HRp antibody followed by ECL detection. GAL4osn-ARX domain fusion proteins were expressed in the absence (lanes 1, 3 and 5) and presence (lanes 2, 4 and 6) of the

GAL4no encoded by the pEXP-4D502 vector, but not in MaV203 yeast only transformed

with the pEXP-4D502 vector (lane 7).

4.2.4 Lutoactivation Testing and HIS3 Reporter Gene Basal Expression Level Testing

GAL4oeo-ARX domain fusion proteins were tested for non-specif,tc activation

(autoactivation) of yeast reporter genes from the ProQuestrM system' For each of the

GAL4oeo-ARX domains four individual colonies (one of which was used for Western blot

analysis) were patched onto yeast media plates deficient in leucine and tryptophan- Patched

yeast colonies were grown for 18 hours at 30'C to create a master plate. Yeast Control Strains CHAPTER 4 - 146

A - E supplied by the ProQuestrM Yeast Two-Hybrid System were also patched in duplicate on the master plate. Patched yeast colonies were then replica plated onto various yeast media plates. These plates were used to test for autoactivation of yeast reporter genes and to determine the amount of 3-Amino-1,2,4-Triazole (3AT) (SIGMA) required to repress basal expression levels of the I11S3 reporter gene (Figure 4.6 and Figure 4.7).

Initial selection for interacting proteins in yeast two-hybrid screening with the ProQuestrM system involves the activation of the HIS3 reporter gene. To maximise the sensitivity to the

HIS3 reporter gene, the MaV203 yeast expresses a basal level of 111,53. The enzyme encoded by the HIS3 reporter gene (imidazole glycerol phosphate dehydratase) is specifically inhibited in a dose-dependent manner by 3AT. Therefore for each GAL4ogo-ARX fusion protein the threshold at which 3AT suppressed 111,53 basal expression, and thus growth on SC medium deficient in histidine, was determined. It was found that there was no autoactivation of the

,F11S3 reporter gene for all three GAL4¡g¡-ARX fusion proteins. It was also determined that for selection of interacting proteins with the HIS3 reporter gene in a library screen to use

20 mM 3AT for the GAl4¡s¡-Octapeptide fusion protein, and25 mM 3AT for the GAL4os¡-

Homeodomain and the GAl4teo-Aristaless fusion proteins.

Similarly it was found for each GAL4oeo-ARX fusion protein that there was no autoactivation of fhe URA3 reporter gene on SC medium deficient in uracil (data not shown for GAl4osp-Aristaless). The third ProQuestrM reporter gene (lacQ was tested for autoactivation using a B-galactosidase filter assay with X-gal (Progen) as a substrate. Both the

GAl4oeo-Octapeptide and GAl4os¡-Aristaless fusion proteins did not autoactivate the lacZ reporter gene. As the GAl4osD-Homeodomain autoactivatedthe lacZ reporter gene, only the

HIS3 and URA3 reporter genes were used in GAl4rer-Homeodomain library screening. CHAPTER 4 - 147

Controls Gal4¡sp + Gal4no A None Gal4¡s¡-Octapeptide B Weak Gal4nso-Octapeptide + Gal4ro C Moderate/Strong trtrtrtr Gal4¡sp-Homeodomain D Strong + Gal4no Gal4¡s¡-Homeodomain E Very Strong

B. C lacZ Reporter Gene ARA3 Gene

\

D I11^S3 Reporter Gene with Increasing 3AT Concentration

Figure 4.6: GAl4oeo-Octapeptide and GAl4osn-Homeodomain autoactivation testing.

A. Layott1 of GAl4DB¡-Octapeptide and GAl4ogo-Homeodomain transformed MaV203 patches on the master plate (SC -Trp -Leu). B. lacZ reporter gene testing results showed that

GAl4osn-Octapeptide patches (white) did not autoactivate gene expression and that

GAl4oso-Homedomain patches (blue) autoactivatedthe lacZ gene. C. Autoactivation testing results for the URA3 reporter gene (SC -Trp -Leu -Ura). Since no growth was observed for

both ARX domains, they did not autoactivate URA3 reporter gene expression. D. Results

HIS3 reporter gene expression and the threshold at which É1153 reporter gene expresslon was

inhibited by 3AT (SC -Trp -Leu -His +3AT). Basal HIS3 reporter gene expression and

therefore growth of yeast patches was inhibited at20 mM 3AT for GAl4oep-Octapeptide and

25 mM 3AT for GAl4oen-Homeodomain. CHAPTER 4 - 148

Controls A. Gal4nso-Aristaless A None B Weak + Gal4ps¡ Gal4no C Moderate/Strong D Strong Gal4oeo-Aristaless + Gal4¡p E Very Strong

B. lacZ Reporter Gene

C' HISL Reporter Gene with Increasing 3AT Concentration

10 mM 25 mM 50 mM 75 mM 100 mM

\' í tt ìi ll xt ¡¡ aa

Figure 4.1: G{L4oeo-Aristaless autoactivation testing. GAl4osp-Aristaless was transformed alone into MaV203 yeast, or cotransformed with the pEXP-4D502 vector expressing the

GAL4AD. A.Layo¡t of GAl4oeo-Aristaless MaV203 patches on the master plate (SC -Trp -

Leu). B. lacZ reporter gene testing results demonstrated that GAl4oeo-Aristaless transformed

MaV203 patches remained white and therefore did not autoactivate gene expression. C.

Results of HIS3 reporter gene expression and the threshold at which 11153 reporter gene

expression was inhibited by 3AT (SC -Trp -Leu -His +3AT). Basal ,É1153 reporter

expression and therefore growth of yeast patches was inhibited at25 mM 3AT for GAL4oso-

Aristaless CHAPTER 4 - 149

4.2.5Library Screening

For each of the GAL4¡sp-ARX domain fusion proteins, at least 1 x 106 library clones were screened for interacting proteins. Using a large scale lithium acetate method (Chapter 2 section 2.11.6.1) a human brain cDNA library was transformed into the same yeast colonies that were shown by \üestern blot analysis to express the fusion proteins. The human brain cDNA libraries screened were the ProQuestrM Pre-made human adult brain cDNA library

(Invitrogen) for the GAl4osn-Aristaless fusion protein and the ProQuestrM Pre-made human fetal brain cDNA library (Invitrogen) for the GAl4rso-Octapeptide and the GAL4osr-

Homeodomain. Both cDNA libraries were constructed in the Gateway@ vector pEXP-4D502 where the proteins encoded by the oDNA library are be fused to the GAL4et.

Yeast cells transformed with a GAL4oBo-ARX fusion protein and the oDNA libraries were initially screened for interacting proteins using the 1/1,53 reporter gene. Clones that activated the I11^S3 reporter gene within five days of incubating the transformations at 30oC were retested for HIS3 reporter gene activation as well as for activation of the lacZ and URA3 reporter genes (summarized in Table 4.3). No positive clones were identified for the

GAl4reo-Octapeptide fusion protein. For the GAl4oso-Homeodomain and GAL4oso-

Aristaless fusion proteins, 33 and 12 positive clones were identified respectively. The results for DNA sequencing and homology search of the positive clones are summarized in Table

4.4. CHAPTER 4 - 150

# Activated At ARX Domain # of Colonies HIS3 lscZ URA3 Least Two Genes Octapeptide 31 7 0 0 0

Homeodomain t639 1391 N/D 33 JJ

Aristaless 16 t4 t2 t2 12

Table 4.3: Results of screening human brain cDNA libraries with the ARX domains

octapeptide, homeodomain and aristaless. Each colony identified through library screening as

containing a potential protein interactor was retested for HIS3,lacZ (where appropriate) and

URA3 reporter gene expression. Numbers under each reporter gene indicate the number o

colonies that activated each reporter gene. N/D: not determined due to autoactivation.

Colonies that activated at least two reporter genes were considered positive clones.

4.2.6 Retransforming Yeast with the Interacting Proteins by Gap Repair

MaV205 yeast containing the GAl4oeo-Homeodomain or GAl4¡sp-Aristaless fusion

proteins were retransformed with the library encoded proteins from the clones that were

identif,red as positively interacting with the ARX domains. The purpose of retransforming the

library encoded proteins was to eliminate technical false positives. False positives may arise

as a result of spontaneous mutation of the GAL4oeo-ARX fusion proteins converting them

into autoactivators or the yeast being transformed by multiple pEXP-4D502 constructs during

the screening process. CHAPTER 4 - I5I

ARX Domain ldentihed Protein Interactor GenBank # Clones Pulled Accession # Out of Aristaless pyruvate kinase M2 variant | (PKM2) NM 002654 protein interacting with C kinase I (PICKI) NM 012407 Homeodomain importin 13 (IPOI3) NM 014652 014191 c¿ subunit ofvoltage gated sodium channel (SCN8A) NM ribosomal protein L4 (RPL4) 8C018840 heat-shock protein 40 (DNAJ4}) AF087870 heat-shock protein 70, non-ATPase,2 (HSPAIA) 8C009322 cordon-bleu homolog (mouse) (C O B L) 8C029275 acid-B-glucos idase (G BA) 8C000349 RNA binding motif protein 24 (RBM24) NM 153020 heterogeneous nuclear ribonucleoprotein K (HNRPK) 8C013220 oxysterol binding protein 2 (OSBP2) 4F288741 major histocompatibility complex, class l, A 8C019236 precursor (HLA-A) sex determining region Y box l0 (SOX|0) BC0 I 8808 I bromodomain adjacent to zinc finger domain 2A NM 013449 I (BAZ2A) neuronal guanine nucleotide exchange factor (,À/GEF) NM 019850 I mitochondria tumor suppressor | (MTUSI) NM 020749 I proteosome 265 subunit 8T009736 I NM 178014 I B-tubulin polypeptide QUB B) NM 006086 I B-tubulin 3 QUBB3) I cr,-tubulin 3 QUBA3) 8C050637 chromosome 10 sequence 4L355334 and 2 AL590502 chromosome I sequence I dystroglycan | (DAGI) NM^L592295 004393 1 fascin homolog l, actin bundling protein 8C007539 I homeodomain of ARX NM 139058 2 unidentihed 1

Table 4.4: fdentity of potential interacting proteins in the 12 positive clones from

GAl4oso-Aristaless library screen and the 33 positive clones from the GAL4DBD-

Homeodomain library screen. Next to each potential interacting protein is listed its GenB

accession number as well as the number of times it was identified as interacting with

particular ARX domatn.

Library encoded proteins were retransformed into the yeast using the gap repair method. Gap

repair involves transforming linear DNA fragments into yeast, where the yeast joins these

fragments together by homologous recombination (Figure 4.8). The library inserts from

positively interacting pEXP-4D502 clones, were amplified by PCR using the primers listed in CHAPTER 4 - 152

Table 4.5. The vector pPC86 (Invitrogen) expressing just the GAL4AD was linearized with the

SmaI enzyme (New England Biol-abs). Both a linear library insert and linearized pPC86 were

transformed into MaV203 yeast containing the appropriate GAL4oso-ARX fusion protein'

The retransformations were performed in duplicate to give more accurate results. Successfully

gap repaired clones were selected for on SC medium deficient in leucine and tryptophan.

Library Insert PCR Product Transform linear pPC86 and library insert PCR product into MaV203 SmaI yeast, which will perform homologous pPC86 recombination between the two DNA fragments

pPC86 + Library Insert

Figure 4.8: Schematic of the gap repair principle. Sequences (indicated in blue) are

between the vectors pEXP-4D502 (from which the library insert originates) and pPC86

allow homologous recombination. After transformation MaV203 repairs the pPC86 vector

homologous recombination with the library insert PCR product. The gap repaired vector

then selected for by growing on SC medium deficient in tryptophan. Non-repaired vectors

should not have grown on medium deficient in tryptophan. CHAPTER 4 - 153

Forward Reverse

GTAAATTTCTGGCAAGGTAGAC Gap Repair Primers CGGTCCGAACCTCATAACAACTC

Table 4'5: Primers used to amplif,' human brain cDNA library inserts located in pEXp-4D502 vector. Primers are listed in a 5' to 3' direction. The library inserts

loying these primers were used for gap rePair

As controls for the gap repair process GAL oìo-ARX domain transformed Mav203 yeast were also transformed with 1) undigested pPC86 (positive control for transformation); 2) linearized ppC86 vector alone (negative control for gap repair); and 3) linearized pPC86 vector plus the amplified pPCS6 vector insert from Yeast Control Strain D (positive control for gap repair), Furthermore, the linear library inserts with linearized pPC86 and all of the controls were transformed into Mav203 yeast with the vector pDBLeu. Since pDBLeu

expresses the GAL4osD, this would determine if the library inserts were specifically

interacting with the ARX domain or if the interactions were occurring with the GAL4oso

alone.

As Each successfully gap repaired clone was tested for ProQuestrM reporter gene activation'

Strain D expected the undigested pPC86 control and the linearized pPC86 * Yeast Control

pCR did not activate reporter gene expression. From the proteins identified from the cDNA

libraries (Table 4.4) it was found that IPO13 reactivated reporter gene expression when

transformed into yeast containing GAl4oeo-Homeodomain, Likewise PKM2 and PICK1

reactivated reporter gene expression when transformed into yeast containing GAL4oso-

Aristaless. Furthermore reactivation of reporter gene expression was specific to the relevant CHAPTER 4 - 154

ARX domains, as IPOI3, PKM2 and PICK1 did not interact with the GAL4osp alone. Hence

IPO13, PKM2 and PICKI were considered authentic protein interactors of ARX from yeast two-hybrid screening. The authentic protein interactors were further sequenced to make sure that the library insert was in frame with the GAL4et domain encoded within the pEXP-

4D502 vector, and to determine how much of the interacting protein was present within the vector. It was found that the first 216 amino acids of IPO13 (963 amino acids) were absent, and the first 341 amino acids of PKM2 (531 amino acids) were absent. However, the entire

ORF of PICKI (415 amino acids) was present.

4.2.7 PICKI ORF Interacts with the ARX Aristaless I)omain

Sequencing of the authentic interactor PICKI from the pEXP-4D502 vector confirmed that the PICKI open reading frame (ORF) was in frame with the GAL4er. Interestingly, sequencing of the PICK| library clone also revealed what appeared to be 134 base pairs (bp) of the PICKI 5 prime untranslated region (5' UTR) between the GAL4nr and the PICKL

ORF. The 5' UTR sequence was both in frame with the GAL4no and did not contain a stop codon that would prevent expression of the PlCKl ORF.

Expressed sequence tag analysis from the UniGene database confirmed that the 5' UTR from

the PICKI library clone was represented within the PICKI EST cluster Hs .180871 along with several other variants in the 5' UTR (Figure 4.9). The first methionine codon from the

PICKT library clone is preceded by a sequence highly similar to Kozak's consensus for

translation initiation (Kozak, l9S7). The presence of a Kozak sequence further supports the

belief that the first 134 bp of the PICKI library insert are 5' untranslated sequence that is

fortuitously in frame with both the GAL4ao and PICK1 ORF. CHAPTER 4 - 155

Number of 614 EST clones 24r s57 I I {

203* ATG 557 6t4 201 392 29

ATG

557 614 209 294 I 6 ATG 614 218 294 557

ARX Libr *y Interactor (PI C K 1) --l ATG 557 6r4 236 392 _---1 2 550* ATG

line) in the EST cluster Hs .180871. The different variations Figure 4.9: Schematic of the first two PICKI exons separated by an intron (dashed

the number of times these EST clones were present in the EST ciuster' in exon 1 are seen in red, green, blue, and black. Highlighted in pink, are methionine codon in exon 2' PICKI EST sequences were Asterisk designates a stop codon if exon 1 was translated in-frame with the first PICKI 5' UTR from -4D502 vector is shown in greY compared to genomic PICKI sequence to give the length of the intron sequence PEXP CHAPTER 4 - 156

To resolve whether the PICK| 134 bp 5' UTR or the PICKL ORF was interacting with the

ARX aristaless domain, both the 5' UTR and ORF of PICKL were cloned into the pPC86 vector by gap repair (Figure 4.10). A combination of pEXP-4D502 vector and PICKI

specìfic primers (Table 4.6) were used to clone the PICKL5' UTR and ORF in frame with the

GAL4ao of the pPC86 vector. To allow for homologous recombination in yeast the

pEXP-4D502 primers were chosen based upon their sequence being identical to sequences

within the pPC86 vector. The PICKI specific primers were designed to contain an additional

30 to 40 nucleotides identical to the pPCS6 vector at the 5' end of each primer. Furthermore;

the reverse primer for PICKI 5' UTR had a stop codon placed between the vector sequence

and pICKI sequence. PICK\ 5' UTR and ORF PCR products as well as Smal linearized

pPC86 were cotransformed in duplicate into MaV203 yeast already transformed with the

GAl4¡ep-Aristaless domain or the pDBLeu vector. Successfully gap repaired clones were

selected on SC medium deficient in leucine and tryptophan. Gap repaired PICKL GAL4I¡-

5'UTR and GAL4^'-ORF clones were then tested for activation of the ProQuestrM reporter

genes. There was a small amount of growth for the gap repair negative control (linearized

pPCS6). This small amount of growth may have been due to incomplete digestion of the

pPC86 vector, and it was therefore decided to include this control on repofter gene testing.

Retesting of the three yeast reporter genes showed that the PICKI ORF but not the 5' UTR

specifically activated yeast reporter gene expression when interacting with the ARX aristaless

domain (Figure 4.11). CHAPTER 4 - 157

PICKl Forward Reverse

5'UTR TAGGTTCCGAGAGTTGGAGTG ORF CCAAACCCA.A.AA.AÀAGAGGGTGGGTCGACCCA CGCGTCCGGGATGT TTGCAGAC TTGGATTATG

Table 4.6: Primers used to separately amplify the PICKI 5 ' UTR and ORF, to be used in gaP repair. Primers are listed in a 5' to 3' direction. Nucleotides in bold are

are specific to PICKI homologous between PEXP-4D502 and pPC86. Sequences underlined

A. PICK1 Library Insert

PICKI 5'UTR PICKI ORF

B.

pPC86 pPC86

I I

pPC86 + + 5'UTR ORF

Primers (black Figure 4. 1 0 Overview of PICKI 5 UTR and oRF gap repalr A in were designed to amplify the PICK| 5' UTR and oRF (red) from the PICKL insert

library vector pEXP-4D502 (yellow). The reverse primer for the 5' UTR and the

primer for the ORF were designed with additional pPC86 sequence (blue squares on end

black triangles) to allow for homologous recombination' B. PICKI 5' UTR and O

amplified pCR products were transformed into MaV203 yeast with linearized pPC86 for

repair to occur CHAPTER 4 - 158

A. I Uncut pPC86 ITI t Smal pPC86 GAL4DBD lrr I¡TIIIT ¡IT¡TI t Smal pPC86 * Yeast Control Strain D PCR GAL4oso-Aristaless trrr¡¡tl¡l¡rTIT¡TTTTTT t Smal pPC86 + PICKI 5'UTR GAL4psp-Homeodomain r rrr¡¡lrr t Smal pPC86 + PICKI ORF ARX Yeast Control Strains A - E I Non-associated homeodomain gap repair results

B fILS3 Reporter lacZReporter URA3

Figure 4.ll: PICKI 5' UTR and ORF gap repair results with GAl-4oeo-Alistaless.I of the transformed MaV203 yeast patches. Listed to the left of each yeast patch row ls strain of MaV203 yeast used for gap repair. GAL4oeo was expressed from the vector. Each gap repair was performed in duplicate. To the right of the layout is a colour showing what was gap repaired within the MaV203 yeast. The brown, green and purple patches were controls for the gap repair and transformation. B. Retesting of the ProQuest yeast reporter genes with the gap repaired PICKI clones. The PICK1 ORF, but not the PICKI

5' UTR, specifically interacted with the ARX aristaless domain to activate all three

genes. As expected none of the gap repair controls activated reporter gene expression. CHAPTER 4 - 159

4.3 DISCUSSION

As stated previously, yeast two-hybrid screening is a powerful and well developed tool that is commonly used for identifring novel protein interactions. There are several advantages in using the yeast two-hybrid system in the identification of proteins interacting with ARX.

These reasons include that yeast two-hybrid screening is a well defined, simple and sensitive method of detecting whether two proteins interact. Under the right circumstances of having a good quality library, reporter genes and cellular environment for the bait protein, yeast two- hybrid screening can be quick and easy to perform. The major advantage of yeast two-hybrid screening is the ability to rapidly isolate novel genes from an organism, tissue, cell type or developmental stage that encodes proteins which interact with a known protein of interest

(Allen et aL.,1995).

However, there are several disadvantages to yeast two-hybrid screening. As noted in the introduction (section 4.1.1) yeast two-hybrid screening is a transcription factor based system.

Hence proteins such as transcription factors that contain transcriptional activation domains may autoactivate reporter gene expression. This problem is not restricted to transcription factors as it is estimated that 5-70%o of proteins are capable of at least weakly inducing transcriptional activation when fused to a DNA binding domain (Toby and Golemis, 2001).

This can sometimes be circumnavigated by using parts/domains of a transcription factor in the

screening, such as was performed here, rather than the full length of the protein. Also, while proteins may interact within the yeast two-hybrid system, they may not interact within the cell type/tissue/developmental stage/organism from which they originated, and as such are

considered biological false positives (Allen et al., 1995). Thus proteins and cDNA libraries

used for yeast two-hybrid screening should be chosen with care and any protein interactions CHAPTER 4 - 160 identified must be confirmed using other in vitro and in vivo means. Furthermore, some protein interactions can be missed due to incorrect folding or the lack of post-translational

modifications normally performed by non-yeast proteins (Allen et al', 1995)' Protein

interactions can also be missed by the competition for nutrients in the yeast media. Yeast cells

This that have been transformed with a oDNA library compete with each other during growth.

therefore selects against fusion proteins that retard growth'

Depending on the yeast two-hybrid system and the protein of interest used, novel interactions

between proteins may not be identified despite extensive screening. In screening human brain

gDNA libraries for proteins that interact with ARX, two different yeast two-hybrid systems

were unsuccessfully used before the ProQuestrM system. The yeast two-hybrid systems used

to screen for interacting proteins were the Display Systems Biotech yeast two-hybrid system

and the Dual Bait Hybrid HunterrM yeast two-hybrid system (Invitrogen). A number of

reasons may exist as to why these two systems were unsuccessfully used to screen for

proteins that interact with ARX. These may include poor cDNA library quality or interference

with proteins interacting with ARX domains by the DNA binding domain. In both the Display

Systems Biotech and the Dual Bait Hybrid HunterrM yeast two-hybrid systems the ARX

domain was fused to the LexA DNA binding domain, yet in the ProQuest system the ARX

domains was fused to the GAL4 DNA binding domain. Alternatively, success in the

identification of proteins interacting with ARX may rely on the quality of the yeast two-

hybrid systems used. 'While a number of articles have been published using the Display

Systems Biotech yeast two-hybrid system, only three references were found which

successfully used a Dual Bait type yeast two-hybrid system (Serebriiskii et al., 1999i'

Serebriiskii et a\.,2001; Serebriiskii et a1.,2002). Conversely numerous articles have been

published with regards to the successful use of the ProQuestrM yeast two-hybrid system CHAPTER 4. 16I indicating that it is a superior system. Fortunately, as described within this chapter, the

ProQuestrM yeast two-hybrid system was successfully used to identifli at least three proteins that interact with the ARX domains in yeast. These three proteins are PKM2, PICK1 and

IPOl3, and they will be examined in more detail further on in this discussion.

Even though the yeast two-hybrid screening was successful, it was noticeable that no proteins were detected as interacting with the ARX octapeptide domain (Table 4.3). The lack of interactors were not due to the absence of the GAl4nso-Octapeptide fusion protein as its expression was detected by Western blot (Figure 4.5). Instead it is possible that the ARX octapeptide domain fragment was not folded correctly within the yeast, resulting in failure interact with other proteins. Alternatively, it may be that not enough colonies were screened for interacting proteins. When using mammalian cDNA libraries it is desirable to screen a minimum of I x 106 library clones to be confident of detecting the presence of most interactors (Toby and Golemis, 2001). While approximately I x 106 clones were screened with the GAl4oeo-Octapeptide fusion protein, the fetal brain cDNA library itself actually contains approximately I x 107 primary clones. Therefore only 10% of the library was screened and as a result the rarer library clones were unlikely to have been screened by the

GAl4oeo-Octapeptide fu sion protein.

Furthermore, while a there were many GAL4oeo-ARX domainllibrary clones that activated

HIS3 reporter gene expression, there were somewhat fewer clones that activated the IacZ and

URA3 reporter genes (Table 4.3). The most likely reason why so many clones \ /ere detected

initially was that background interference was occurring. As mentioned in the results,

MaV203 yeast express a basal level of ,F11,S3, which is inhibited in a dose dependent manner

by 3AT. The concentration of 3AT chosen for each GAL4oeo-ARX domain library screen CHAPTER 4.162

gene expression' To reduce was at the threshold of repressing the basal level of HIS3 reporter have been the number of background clones detected the concentration of 3AT could

made the detection of increased. Hovvever, increase of 3AT concentration would have also weaker protein interactions less likely.

IPO13, it is likely Despite successfully identifying the ARX homeodomain as interacting with the library screen' that many protein interactors for the homeodomain were not detected in

HIS3 and URA3 Due to the autoactivation of the lacz teporter gene (Figure 4.6 B), only the the HIS3 and lacZ reporter genes \¡/ere used for GAL4pso-ARX library screening' Both

gene is only activated reporter genes are very permissive to activation, but the URA3 reporter

promoter contains the by strong protein interactions. This is because the URA3 reporter gene is therefore URS1 sequence (Figure 4.2 A), which strongly represses gene transcription' It

confirmed with likely that weaker protein interactions were not detected since it could not be

proteins were interacting' the lacZreporter gene that the ARX homeodomain and library

Analysis 4.3.1 proteins that Interact with ARX Domains by Yeast Two-Hybrid

Before yeast two-hybrid screening began it was expected that the ARX octapeptide' arc part of the homeodomain and aristaless domain would pull out other proteins that

in related transcriptional machinery. This was due to the observation that the same domains 3 Table paired-type homeodomain proteins interact with these types of proteins (see chapter

3.2). Furthermore, that ARX acts as a transcription factor is supported by unpublished

(GFP) tagged full length ARX, observations within our laboratory. Green fluorescent protein

cells, but is absent localizes to the nucleus of HeLa, HEK 293T, human fibroblast and PC12

in small intranuclear patches which may be nucleoli (Figure 4'12) (courtesy of Cheryl CHAPTER 4 - 163

findings by Shoubridge). The localization of ARX within the cell nucleus is consistent with Moreover Nasrallah et al. (2004), who also observed that ARX localizes to the cell nucleus' the entire ARX protein and various ARX domains are capable of repressing gene exptession, though interestingly the ARX aristaless domain seems to function as a transcriptional

activation domain (see Chapter 3 Figure 3'3).

Figure 4.12: Localization of full length AI{X to the nucleus of HEK 293T cells

and immunofluorescence. cells were transiently transfected with a GFP-ARX construct

the hours later were analysed by immunofluorescence. A. DAPI anti-fade (blue) stains protein of HEK 293T cells. B.Immunofluorescence of the GFP tag (green) fused to the ARX patches' C GFP-ARX localized to the nucleus of the cell, but not to small internuclear

localized lmmunofluofescence using an ARX monoclonal antibody (red)' Again GFP-ARX

the nucleus but not in small internuclear patches. D. Overlay of GFP and but not immunofluorescence coincide (yellow) showing nuclear localization of GFP-ARX,

small internuclear Patches.

it was Detection of IpO13 interacting with the ARX homeodomain was not a surprise since (PAX6, PAX3 recently found to interact with and import paired-type homeodomain proteins that the ARX and CRX) into the nucleus (Ploski et al., 2004). However it was surprising

and PICK1 aristaless domain interacts with PKM2 and PICKI. This is because both PKM2 purpose proteins are mainly thought to be cytoplasmic (see below)' Nevertheless, the of CHAPTER 4 - 164 performing yeast two-hybrid screening was to detect novel protein interactions. More detail on each of the ARX domain interactors will now be discussed.

4.3.1.1 Importin 13 (IPO13)

Within interphase eukaryotic cells, a double membrane, known as the nuclear envelope (NE),

pore separates the nucleus from the cytoplasm. Embedded within the NE is the nuclear

complex (NpC). The NPC connects the cytoplasm to the nucleus to allow free diffusion of

complex ions and small molecules, as well as transport of macromolecules across the NE by a

system of soluble carriers. Importin p-related transport receptors mediate most nuclear

The two transport pathways (Gorlich et al.,1997; Moroianu, 1998; Chook and Blobel, 2001).

types of receptors within this family are importins that mediate nuclear import and exportins

which mediate nuclear export. Importin B-related transport receptors are constantly shuttling

between the cytoplasm and the nucleus transporting their various cargos against a

RanGDP/GTP concentration gradient (Figure 4.13)' CHAPTER 4 - 165

Nuclear Import Nuclear Export

Importin

Cargo Cargo

Exportin RanGTP RanGTP

Nucleus Nucleus Cytoplasm Cytoplasm \_ NPC RanGDP o Cargo Cargo o RanGDP Exportin

F.igure 4.13: Transport across the NPC mediated by Importin B-related transport receptors

(1)' Nuclear import: importins bind to their cargo within the cytoplasm in low RanGTP levels

They then transport the cargo across the NE and into the nucleus where RanGTP levels high. Upon RanGTp binding (2) importins release their cargo (3) and return to the nuc

still bound to RanGTP (4). Importins are then recycled when RanGTP is hydrolysed

RanGDp thus removing it from the receptor. Nuclear export'. within the nucleus

is bind to both their cargo and RanGTP (1). Once transported through the NPC, the RanGTP

hydrolysed to RanGDP, releasing both Ran and the catgo (2). Exportins then return to

nucleus to continue cargo transport' CHAPTER 4 - 166

IpOl3 is ubiquitously expressed as indicated by Northern blot analysis of human and rat

data). tissues (Zhang et a\.,2000) and EST analysis from the UniGene database (unpublished

It is one of the few importin proteins that is observed to mediate both nuclear import and

the export (Mingot et a|.,2007; Ploski et a1.,2004). IPOl3 is a963 amino acid protein, where

first 300 amino acids of importin proteins are responsible for binding RanGTP, and the rest of

the residues are thought to be involved in cargo binding (Nishizuka, 1992; Dasso and Pu,

1998; Bogerd et a1.,1999;Vetter et a1.,1999; Plafker and Macara, 2000;Ploski et aL.,2004).

Both the I\OI3 construct used by Ploski et al. (2004) in yeast two-hybrid screening and the

IPOI3 sequence pulled out of the fetal brain oDNA library with the GAl4Dso-Homeodomain

fusion protein, lack the RanGTP binding site. The likely reason why only one IPOL3 clone

was pulled out with the ARX homeodomain is that other IPOIS clones within the oDNA

library contain the RanGTP binding site. Hence, when performing the yeast two-hybrid

yeast screen, IpOl3 clones with the RanGTP binding site may have interacted with the

nuclear RanGTp and kept on dissociating with the ARX homeodomain. When performing

yeast two-hybrid screening ploski et at. (2004) observed that IPO13 binds to basic residues

located at the N- and C-terminal ends of the PAX6 homeodomain. These residues in PAX6

confer are apparently important for the binding of IPOl3, but are not sufficient individually to

the complete binding and import capacity of which the full homeodomain length is capable.

These basic residues are highly conserved in the paired-type homeodomain family, including

ARX (Figure 4.14). Furthermore, these same basic residues have been shown to be important

for the nuclear localization of the Paired-class homeodomain proteins CART1, VSX-I, and

OTXI (Kurtzman and Schechter, 2001; Furukawa et a1.,2002; Zhang et al''2002)' The ARX

region encompassing the homeodomain (aa 303-431) used within the yeast two-hybrid

screening performed here, encompassed the basic amino acids making up the two NLS CHAPTER 4 - 167

by sequences. Therefore, the yeast two-hybrid screening results and the work performed

to ploski et at. (2004), indicate that IPO13 transports ARX into the cell nucleus viabinding the ARX homeodomain.

A B C 100 g t. Pl'6 2os-?cg I(ldspll Ê fsE 9âC 2. Rx 1¡l-?14 ayelp 9?T L Àlx4 )l!-ìn'.1 100+ {. P¿r? fI5-295 plsä rÕ0+ ì26-.{ù6 h!'çg1pf rrq Àrx I asrÐasl 1kÉYeqea 909 186 ruL lül fpPt r.00 + Påxl :lt-297 1ñaEnhllpgg nknâ5 1 L k¡!.39dv 95t 8. lrr¡r1 'a2 L'¿2 ì./'xt yqanv e5t l6:-?4:l qegrnpfLrayd is 94t ID ÀLxf l5l-211 ygärf.r,/ 9:l t 14!-!26 Chx10 I qqakshf3åDydt 5 9lc CarÈ: l3t-:t0 1 00t 1l Cffi 3l-11-,f -t 4r Ir:S-f,'18 I,l P.Ð:/. aaaaaatngss gkks 1q PrLx2b 16-'l?'l r kgaag¡¡g¡rf-kEct 95r LI: ¡l 168 rm2r ll 8-7 T I7 CâC I5J 2.}J it-1t¿ s'tt IB Otx? ÊrËakl(ko 3P','r 9'r t 19 ÕLxI iá ll{i asa rll,¡:gvkk: pkg s 82ê 12.¡ - 20.1 2l) Gscl h.kg.rl ígaasqf eacr 88x 21 thox2 llt-?t0 I t¿rìhì dåc r 88t sh0){ lIb rt5 '/ Iq rcrrrlqae lckttg IqPqf rtg L 85+ Pi Bi-1í3 Lxf gg I B1T pjtxt riil B t ckgef 3.f tr) I iì 'l t{! dI,rkg..Jyvpq I s,JI 81t PLLX: B7-168 t0l]IdlrlsÞaåf sst I B4* 2f: Prút)i ,i Û - 1.11 hsË RK--R-RT-FT--QLE-l,E--P-RT'TÞDLf-RE-LA-K--L'E-RUQ]/'I'¡F'I¡RÊAK-R---'--- IKII'URIR

Figure 4.14: Protein alignment of homeodomains frorn the paired-type homeodomain farnilY

Column A lists the homeodomain protein. Column B designates the position of the s

in each protein Above the sequence alignment, the dashed line shows where

cr, helices homeodomain is located, and the black boxes labelled I, II and III, represent the

the homeodomain. Amino acids that are identical to the consensus sequence (shown at

bottom) are in capitals with light shading. Non-identical amino acids are shown in lowercas

Darker shading within the sequences designates the basic amino acids involved in binding

IPO13. Column C shows the percentage of similarity each sequence has to the

Ploski sequence. PAX6, PAX3 and CttX are paired-type homeodomain proteins shown by

at. (2004) to interact with IPO13. ARX (listed at position 5) contains identical basrc

et al acids to pAX6 and is 100% identical to the consensus sequence (adapted from Ploski

2004) CHAPTER 4 - 168

4.3.1.2 Pyruvate Kinase M2 (PKM2)

Pyruvate kinase (PK) is a key enzyme in the glycolytic pathway that catalyses the formation

of pyruvate and adenosine triphosphate (ATP) from phosphoenolpyruvate (PEP) and

adenosine diphosphate (ADP) (Figure 4.15). In mammals four isoenzyme forms of PK (R, L,

M1 and M2) are expressed by two different genes in a tissue specific manner. R and L PK

isoenzymes are encoded by the PKL gene (Noguchi et a\.,1987; Kanno et a1.,1992) and the

Ml and M2 PK isoenzymes are encoded by the PKM gene (Takenaka et al.,1989; Takenaka

et a1.,1991). PKR isoenzyme is expressed exclusively in red blood cells, PKL mostly in the

liver, PKM| mostly in skeletal muscle, heart and brain, and PKM2 is expressed in a wide

variety of tissues such as kidney, intestine, lung, testis, stomach and fetal tissues (Faulkner

and Jones, 1975;Hall and Cottam,1978; Imamura and Tanaka,1982)'

Glucose ATP Hexokinase K ADP

Phosphohexose tsomerase Fructose-6-phosPhate tt ATp Phosphofructokinas $> Oo,, Fructose- I :6-b i sPhos Phate Triose phosphate tsolrerase Aldolase 1t Glyceraldehyde # Dihydroxyacetone t-on".on"lf, phosphate Glyceraldehyde-3- NAD+ + pi phosphate dehvdrogenase I :3-Bisphospboglycerate

3-Phosphoglycerate kinase 1[ îi; 3-Phosphoglycerate Phosphoglycerate 1t mutase 2-Phosphoglycerate Enolase 1['",o Phosplroenolpyruvate Il ADP pyruvate kinase L oTP Pyruvate

Figure 4.15: Summary of the glycolytic pathway. Enzymes catalysing the reactions are ln

yellow boxes. Pyruvate kinase catalyses the last step (Elliott and Elliott, 1997). CHAPTER 4 - 169

PK predominantly exists in monomeric and tetrameric forms which have distinct electrophoretic, kinetic, and immunological properties. PK is activated by PEP (Fothergill-

Gilmore and Michels, 1993) and is inhibited by ATP, alanine, and phenylalanine (Markus e/ al., 1980; Kahn and Marie, 1982). Fructose-1,6-bisphosphate also activates PKM2 by converting it from the monomeric form to the tetrameric form (Kato et al., 1989; Ashizawa et al.,l99l).

Both monomeric PKM1 (Parkison et al., 1997) and PKM2 (Kitagawa et al., 1987) are capable of binding to the thyroid hormone 3,3',5-triiodo-L-thyronine (T3). Thyroid hormones play critical roles in growth, differentiation and metabolism (Yen, 2001). In humans, neonatal hypothyroidism (absence of thyroid hormone) causes mental retardation and neurological deficits. Affects of hypothyroidism include impairment of radial glial cell maturation in the fetal and postnatal neocortex (Martinez-Galan et al., 2004) and alteration of synaptic transmission and plasticity in the CAI area of the hippocampus (Sui and Gilbert, 2003).

The thyroid hormone T3 is sequestered in the cytoplasm by nicotinamide adenine dinucleotide phosphate (NADPH)-activated monomeric PKM2 (Hashizume et aL.,7989a).By sequestering T3 within the cytoplasm NADPH-activated monomeric PKM2 modulates

T3lthyroid hormone nuclear receptor mediated transcription (Ashizawa and Cheng,1992).ln contrast, NADP-activated monomeric PKM2 is involved in the transport of T3 from the cytoplasm to the nucleus (Hashizume et al., 1989b; Hashizume et al., 1989c). Monomeric

PKM2 only has 5% of the enzymatic ability of tetrameric PK, but when bound to T3 its pyruvate kinase activity is inhibited. Binding to T3 also impedes the conversion of PKM2 from a monomer to a tetramer (Kato et a1.,7989). CHAPTER 4 - 170

Only the last 136 amino acids of PKM2 variant I was found by yeast two-hybrid screening to interact with the ARX aristaless domain. This same region of PKM2 was also found to interact with the proteins HERC1 (Garcia-Gonzalo et a1.,2003) and Opa (Williams et al.,

1998), both of which do not localize to the nucleus. HERC proteins are suggested to act as guanine nucleotide exchange factors and E3 ubiquitin ligases due to their domain structure.

Opa proteins are bacter\al (Neisseria gonoruhoeae) outer membrane proteins involved in the adherence to and invasion of human cells. PKM2 has a diffuse cytoplasmic expression pattern and subcellular localization experiment show that it can also display a punctate perinuclear pattern (Williams et al., 1998; Garcia-Gonzalo et aI., 2003). The perinuclear punctate subcellular localization indicates that PKM2 is capable of interacting with intracellular membrane compartments (Wasiak et a\.,2002). Despite PKM2 being known as a cytoplasmic protein, it has also been purified from the nucleus of rat liver and neoplastic cells (Guminska et a1.,1988; Ignacak and Stachurska, 2003). This suggests that the presence of PKM2 in the nucleus is to use glycolysis as a direct source of energy for DNA replication and gene transcription. It is therefore possible that the interaction of PKM2 variant I with ARX provides energy for ARX regulated transcription.

4.3.1.3 Protein Interacting with C Kinase I (PICKI)

PICKI (also known as Protein Kinase C, Alpha Binding Protein PRKCABP) was originally identified as interacting with and being a substrate of protein kinase Ccr (Staudinget et al.,

1995). PKCa is a serine/threonine kinase that is activated in response to a variety of hormones, mitogens and neurotransmitters (Nishizuka, 1992). Encoded at the amino-terminus of PICK1 is a PDZ domain, which modulates protein-protein interactions and serves to localize proteins to specific subcellular sites (Saras and Heldin, 1996; Fanning and Anderson, CHAPTER 4 - I7I

of lggg). The pICKI pDZ domain binds to aPDZ-binding motif at the carboxyl-terminus

domain pKCcr, and mediates homooligomerization with the PICKI cr helical coiled-coiled

PDZ (Staudinger et al., 1997; Boudin and Ctaig,2001; Perez et al., 2001). The PICK1 domain also binds to the C-termini of a range of other proteins (Table 4'7)'

Table 4.7: Proteins identified as interacting with PICKI

Proteins Reference (Torres et Eph receptor tyroslne kinases and ephrin- B ligands al.,1998) (Xia et al., 1999) GIuR2 and GluR3 AMPA (cr-amino-3 -hydroxy-5-methYl isoxazole-4-propionic acid) glutamate receptors subunits Presynaptic glutamate receptor mGluRTA (El Far et a1.,2000) GTP-bound small GTPase ADP ribosylation factors (ARF)-1 (Takeya et a1.,2000) and -3 TIS21 (Lin et aI.,200lb) Monoamine plasma membrane transporters DAT (dopamine (Torres et a|.,2001) transporter) and NET (norepinephrine transporter) (Jaulin-Bastard et al., 2001) Epidermal growth factor receptor ErbB2 Prolactin-releasing peptide (PrRP) receptor (Lin et a\.,2007a) (Duggan et a\.,2002) Brain sodium channel I (BNaClcr) and acid-sensing ion channel (Hruska-Hag eman et al., 2002) (BNaC2a) subunits 2003 Kainate subunits GluR5 and GluR6 et al.

mGluRT, one observed function of pICKI is to induce clustering of Eph receptor, GluR2,

DAT, NET, prRp receptor and BNaClc¿ in heterologous expression systems. Furthermore,

pICKI can modulate PKCa mediated phosphorylation. PICK1 inhibits PKCct mediated

recruits phosphorylation of mGluRT and TIS2I (Dev et al., 2000 Lin et al., 2001b), but it KAR- activated PKCc¿ to stimulated BNaC2cr activity (Baron et a1.,2002) and to maintain

receptor mediated synaptic responses (Hirbec et a1.,2003). PICK1 also plays a role in AMPA

of GluR2 recycling at synaptic membranes by modulating PKCcr mediated phosphorylation

(Daw et a1.,2000;Iwakura et a1.,2001;Petez et aL,2001 Hanley et a1.,2002). CHAPTER 4 - 172

the carboxyl- pDZ domains generally bind to motifs found within the last four amino acids at

residue is terminus of the protein. In regards to the PDZ binding motif the location of each (-1) the next given a starting position of (0) for the carboxyl-terminal valine, followed by for S/T-X-V/I residue and so forth. Class I PDZ binding motifs have the consensus sequence

any (where X is any amino acid), class IIPDZ binding motifs are þ-X-$ (where þ represents

binding hydrophobic residue) (Songyang et al., 1997;Dev et al-,2001), and class IIIPDZ

previously, the motifs are X-DÆ-X-V (Stricker et a\.,1997; Tochio et a1.,1999). As noticed

class II pICKI pDZ domain has atypical specifìcity in that it is able to bind to both class I and

binding motifs (El Far et a1.,2000; Perez et a\.,2001;Duggan et al',2002)' The carboxyl- binding motif. terminus of ARX is K-E-V-C and does not resemble a typical class I or II PDZ most closely Instead with glutamic acid (E) at the -2 position, the ARX carboxyl-terminus PDZ domains to resembles a class llIPDzbinding motif. Furthermore, it is not common for

interacts bind to proteins with a cysteine at the extreme carboxyl-terminus. However, PICKI

with BNaclcr, and BNaC2c¿ proteins (Duggan et a1.,2002), both of which encode a cysteine

at their extreme carboxyl-terminus. It therefore appears that PICK1 can bind to sequences

binds to class III even more diversified than first thought, where it is now possible that it also

PDZ binding motifs.

pICKI is ubiquitously expressed with highest levels in the brain and testis as indicated by

and northern blot analysis (Staudinger et a1.,1995), western blot analysis (Xia et al',1999)

studies EST analysis from the UniGene database (unpublished data). Subcellular localization

the in heterologous expression systems show that PICK1 is diffusely distributed within small cytoplasm, with occasional perinuclear/mitochondrial localization and formation of

Far et al'' intracellular clusters (Staudinger et a\.,7995;Dev et al',1999;Xiaet al',1999; El

also been 2000; Torres et al.,2001; Wang et a1.,2003). PICKI subcellular localization has CHAPTER 4.173 observed within the nucleus of epithelial cells (Jaulin-Bastard et a\.,2001), and is distributed throughout hippocampal neurons (Perez et al., 2001). However, upon coexpression of

interacting partners, PICKI is redistributed in clusters to the perinuclear region and/or the

synaptic membrane depending on the cell type and identity of the interacting partner (Dev et

a1.,1999;Xia et a\.,1999; Boudin et a\.,2000; El Far et a\.,2000;'Lin et al.,200la;Perez et

a\.,2001;Torres et aI.,20011' Duggan et al-,2002).

The entire ORF of PICKI including the PDZ domain was pulled out of the cDNA library

during ARX aristaless domain yeast two-hybrid screening. Interestingly an additional 134

base pairs of the PICKI 5' UTR was part of this library clone. However, this is not an unusual

occurrence as the 5' UTR of PICKI has previously been part of a library clone in yeast two-

hybrid screening (Staudinger et al., 1995). More impoftantly, when tested by gap repair

(Figure 4.11), it was the PICKI ORF that interacted with the ARX aristaless domain and not

the PICK1 5'UTR.

What functional role PICK1 plays in interacting with ARX remains unknown at present. ARX

is the first transcription factor that potentially interacts with PICKI, as only two other non-

membrane bound proteins (ARF and TIS21) have been found to interact with PICKI so far.

However, it has been demonstrated that PKC phosphorylates the Aristaless-related Paired-

class homeodomain protein PITX2, and by doing so regulates PITX2 mediated transcription

(Espinoza et al., 2005). It is therefore possible that PICKI modulates PKCa mediated

phosphorylation of ARX, and by doing so regulates ARX mediated transcription. At present

we do not know if ARX is a phosphorylated protein but its sequence does encode several

potential PKC phosphorylation sites' CHAPTER 4 - 174

4.3.2 P oly alanine Yeast Two-Hybrid Screening

The most frequent ARX mutafions occur in the first two polyalanine tracts (see Chapter I

Table 1.4) and yet there is only a small amount of information concerning the role of

polyalanine tracts in transcription factors (see Chapter 3 section 3.2.2). It was therefore

decided to screen the human fetal brain cDNA library to identif, proteins ìnteracting with the

wild-type lengths of the first two polyalanine repeats. The ARX polyalanine yeast two-hybrid

screening is an ongoing project. Even though the human fetal brain cDNA library has not

been screened enough to assure coverage of the library, the protein AlUp (ataxin-l-

interacting ubiquitin-like protein) has been isolated as potentially interacting with the first two

ARX polyalanine tracts. AlUp was originally isolated as interacting with the ataxin-1 protein,

which when mutated by an expansion of a polyglutamine stretch causes spinocerebellar ataxia

(Davidson et a1.,2000). It was shown that AlUp stabilizes the levels of ataxin-l in a cell

(Riley et a1.,2004). Hence, it is possible that AlUp also plays a role in the stability of the

ARX protein.

4.4 SUMMARY

yeast two-hybrid screening was used to identiff proteins that interact with three individual

domains of ARX (octapeptide, homeodomain and aristaless). The screening identified IPOI3

as interacting with the ARX homeodomain and the proteins PKM2 and PICK1 as interacting

with the ARX aristaless domain. IPOI3 has previously been found to interact with and

mediate nuclear import of paired type homeodomain proteins and as such most likely

mediates transport of ARX into the cell nucleus. However, both PKM2 and PICK1 are novel

interactors of ARX. PKM2 modulates T3 mediated transcription in its monomer form, and is CHAPTER 4 - 175 part of the glycolytic pathway in its tetramer form. By interacting with ARX, PKM2 may perform a yet undiscovered function, or it could possibly provide energy for ARX mediated gene transcription. PICKI seems to be an adaptor protein that can regulate the localization' clustering and PKCa mediated phosphorylation of a range of proteins. It is possible that pICKI performs a similar role with ARX. However, these interactions have as yet only been

confirmed in yeast. This will be addressed in the subsequent chapter where experiments

involving coimmunoprecipitation and colocalization in a heterologous expression system with

ARX and the novel interactors will be discussed. CHAPTER 5

Confirmation of YzIt Protein Interactions

5.2.1 ExpnnssloN oF PICKI AND IPOI3 IN HEK 293T CELLS"'.....".. """""""' 178 5.2.2GAL4DBD-ARX/V5-PICKI COIMMUNOPRECIPITATIoN.'.'..'...... '... """"'181

5.2.2.1 Optimization of HEK 293T Cell Lysis Conditions 181 r83 5. 2. 2. 2 V 5 - P IC K I C oimmunoprec ipil ate s w ith GA L4 ono-A RX

5.2.3 Myc-AR)lV5-lPOl3 CoMMUNOPRECIPITATION """"""" 184

5.2.4 COLOCALIZATION OF ARX WITH PICK1 AND IPO13 IN HEK 293T CELLS.."...... "...".188

RNO 5.2.5 EXPANSION oF PoLYALANINE TRACTS TN GFP-ARX INCREASES THE FORMATION OE NUCI-ERR

5.2.6 IPOI3 AND PICKI COI-OCAIIZB WITH GFP.ARX AGGREGATES IN THENUCLEUS AND CYTOPT,NSU....I93

195

202 CHAPTER 5 - 177

5.1 INTRODUCTION

In the previous chapter, yeast two-hybrid screening was used to identify four novel protein interactors of the ARX protein. IPOI3 was identihed as interacting with the ARX homeodomain, the proteins PKM2 and PICKI were identihed as interacting with the ARX

aristaless domain and AlUp was identified as interacting with the first two polyalanine tracts

of ARX. However, as both the ARX domains/regions and the identified interacting proteins

were artificially (via the GAL4 domains) transported into the nucleus of the yeast two-hybrid

system, these protein interactions had to be confirmed by olher in vitro means. Furthermore,

while any of the four novel protein interactors may interact with an individual ARX

domain/region, they may not interact with the entire ARX protein. As such interaction

between the entire ARX protein and the four novel protein interactors had to be confirmed.

Common invitro methods of confirming the interaction between two proteins from yeast two-

hybrid screening includes GST-pull doln, coimmunoprecipitation and colocalization. As a

cell line expressing ARX initially available, it was decided to confrrm the protein interactions

with overexpressed ARX. For the purpose of this thesis coimmunoprecipitation and

colocalization studies were used to confirm the interactions between ARX and the novel

protein interactors. GST-pull down was not used due to a number of reasons. Firstly, cloning

ARX was a difficult and lengthily process and there was the convenience of already having

ARX cloned into mammalian expression vectors. Secondly, during the process of the

coimmunoprecipitation studies performed in this thesis ARX was cloned into bacterial

expression vectors with GST and maltose-binding protein tags. Unfortunately even when

expressed under various conditions, it was found that the bacteria cleaved the ARX protein

thus making the bacterial expression system unviable (Olivia McKenzie personal CHAPTER 5 - I78

and communication). 'When confirming the interactions the preference was given to IPOI3

PICKl simply due to the availability of reagents and time constraints.

5.2 RESULTS

5.2.1 Expression of PICKL and IPOI3 in HEK 293T Cells

To ascertain whether the entire ARX protein interacts with endogenously expressed PICKI

and IpOl3 in HEK 293T cells, it was first determined if HEK 293T cells expressed PICKI

and IpOl3 by SDS-PAGE analysis. HEK 293T cells were lysed and20 Fg of protein lysate

\ryas run along side 20 Vg of adult brain protein lysate (BD Bioscinces) on a NuPAGE@

Novex 4-12yo Bis-Tris gradient gel. Adult brain protein lysate was used as a positive control

since pICKI and IPO\j mRNA was shown to be present in the adult brain (data not shown).

In adult brain protein lysate and HEK 293T protein lysate, PICKI and IPOI3 proteins were

detected by polyclonal antibodies directed against the two proteins specifically (Figure 5.1).

The polyclonal anti-PICKl antibody (Afhnity BioReagents) detected endogenous PICKI

around the expected size of 46.6 kD, and the polyclonal anti-IPO13 antibody (kindly provided

by professor Dirk Görlich, ZMBH, Heidelberg, Germany) detected endogenous IPO13

protein around the expected size of 108.2 kD. However, subsequent attempts to detect

endogenous levels of PICKI and IPOI3 at the corect size became difficult due to the

appearance of more than 1 protein band at the same size when the respective gels used for

western blots were electrophoresed further (data not shown). It was therefore decided to clone

7ICKI and IPOI3 gDNA into the mammalian cell expression vector pcDNA3.1A/5-DEST

(Invitrogen) which would express the two proteins with a V5 fusion tag. An antibody against CHAPTER 5 - 179 the V5 tag could then be used in conjunction with PICK1 and IPO13 specific polyclonal antibodies to detect expression of PICK1 and IPO13 proteins in HEK 293T cells'

The same PICKI and IPO t 3 library insert PCR products used for ye ast two-hybrid gap repair

and sequencing (see Chapter 4 section 4.2.6) were used to clone the PICKI and IPOI3 genes

into the Gateway@ donor vector pDONRfM20l by a BP recombination reaction (Invitrogen).

The pDONRrM2Ql vector was then used as a template to clone the PICKI and IPOI3 genes

into the Gateway@ destination vector pcDNA3.l/V5-DEST by a LR recombination reaction

(Invitrogen).

B. A. (lF i: ?1 o\ Á^ O\ Êe N v É I¡¡ É r¡

00kD- 150 kD 75 kD- IPOI3 PICKI 100 kD - - 75 kD 108.2 kD 50 kD- <_ 46.6 kD 37 kD- 50kD-

Figure 5.1: Endogenous expression of PICKI and IPO13 in adult brain protein lysate

HEK 293T protein lysate.,,4. PICK1 was detected with 2 p"glml of anti-PICKl antibody and

1:1000 dilution of the goat anti-rabbit HRP secondary antibody (DAKO)' .8. IPO13 was

1 : 1000 dilution detected with a 1 : 1000 dilution of anti-PO 13 antibody in rabbit serum and a

of the goat anti-rabbit HRP antibody CHAPTER 5 - 180

V5-pICK1 and V5-PO13 were each transfected in the absence and presence of GAL4oeo-

ARX (encoded on the pM vector BD Biosciences) or Myc-ARX (encoded in the pCMV-Myc vector, BD Biosciences) into HEK 293T cells. Expression of VS-PICKl and V5JPO13 was

then confirmed at the expected sizes of 55.9 kD and 88.6 kD respectively by SDS PAGE

analysis using a monoclonal anti-V5 horseradish peroxidase (HRP) conjugated antibody

(Invitrogen) (Figure 5.2 and B) and the polyclonal anti-PICKl and anti-IPOl3 antibodies ^ respectively (data not shown)'

B. A. úX \,,iÈ ì-ô V, ñ l.o 1 :l Êa- à I ooY ZfËrE Y o ¿ <,Ä z>O ln 5rl.¡ 150 kD- .'. li 150 kD - 100 kD 75kD-- 100 kD - * * 75 kD- lQ G 50 kD- 50 kD-

Figure 5.2: Expression of ,4' V5-PICKl and,B. V5-IPO13 in HEK 293T cells. Expression of

the V5 tagged proteins (asterisk) was detected with a 1:5000 dilution of the monoclonal anti-

V5 HRP antibody. CHAPTER 5 - 181

5.2.2 G Coimmunoprecipitation ^L4DBD-ARX/V5-PICKI

5.2.2.1Optimization of HEK 293T Cell Lysis Conditions

HEK 293T cells were tested for the mildest lysis conditions that would solubilize transfected

GAL4oeo-ARX and the majority of cellular proteins, but would potentially disrupt protein interactions which naturally occurred in the cells as least as possible. The lysis conditions used (Table 5.1) were derived from a variety of sources and included using minimal salt concentration (< 150 mM NaCl) and non-ionic detergents (Nonidet P-40 or Triton X-100).

Of the lysis buffers tested on HEK 293T cells transfected with GAL4oen-ARX, buffer 5 (see

Table 5.1) was among the lowest in NaCl and Nonidet P-40 concentration. Furthermore, buffer 5 efficiently solubilized GAL4oso-ARX (Figure 5.3). Therefore, buffer 5 was used for all future coimmunoprecipitation experiments'

Ëô.trîçra¡\O< LLLLILZ oooo.q)-q) ======.úêôÊaêôcôêôz 150 kD- 100 kD- GAL4DBD-ARX 75 kD- -ülrl 50 kD ID

Figure 5.3: Lysis buffers tested on HEK 2937 cells transfected with pM-ARX for the mildest

lysis conditions which efficiently solubilized GAL4oeo-ARX. GAL4oeo-ARX expression

was detected with a l:1000 dilution of the monoclonal anti-GAl4oso HRP antibody (Santa

Cruz Biotechnology) and the signal was amplified with a 1:1000 dilution of the goat anti-

mouse HRP antibody (DAKO) CHAPTER 5 - 182

Buffer 5 Buffer 6 Buffer I Buffer 2 Buffer 3 Buffer 4 NaCl 120 mM NaCl 150 mM NaCl 150 mMNaCl 50 mM Tris-HCl (pH 8.0) 150 mM NaCl 150 mM 20 Tris-HCl (pH 7.5) 50 mM Tris-HCl (pH 8.0) 50mMTris-HCl @H7.4) 50 mM Tris-HCl (pH 8.0) 1% Nonidet P-40 20 mM Tris-HCl (pH 7.5) mM Nonidet P-40 l% Nonidet P-40 X-100 l% Nonidet P-40 l% Triton X-100 0.5% 1% Triton EDTA (pH 8.0) 2 mM EDTA (pH 8.0) 2 mM EDTA (pH 8.0) I mM l0% glycerol 0.25%" (vlv) sodium

293T cells. Before lysis a final Table 5.1: Coimmunoprecipitation lysis buffer conditions tested for solubility of GAL4oeo-ARX from HEK

PMSF was added to each buffer concentration of lx Protease lnhibitor cocktail (SIGMA)' 1 mM NaVO¿, 1 mM NaF and 1 mM CHAPTER 5 - 183

5.2.2.2 VS-PICKl Coi m m unoprecipitates with GAL4rsn-ARX

HEK 293T cells were transfected with V5-PICKI in the absence and presence of GAL4oeo-

ARX. Cell extracts were immunoprecipitated with the monoclonal anti-GAl4¡sn HRP

antibody or the monoclonal anti-V5 HRP antibody using ProteinA-Sepharose beads

(pharmacia Biotech). GAL4oso-ARX was immunoprecipitated with the monoclonal anti-

GAL4oeo HRP antibody at the expected size of 75.2kD (Figure 5.4 A). Furthermore, when

GAL4nst-ARX was immunoprecipitated with the monoclonal anti-GAl4osn HRP antibody,

V5-PICKI was coimmunoprecipitated, indicating that GAL4oso-ARX and V5-PICKl were

associated when coexpressed in the same cells (Figure 5.4 B). However, while the

monoclonal anti-V5 HRP antibody did immunoprecipitate V5-PICKI (Figure 5.4 B), it did

not coimmunoprecipitate GAL4D3¡-ARX (results not shown). Since the level of GAL4oso-

ARX expression and immunoprecipitation seems to be lower than V5-PICK1, this may be the

reason why GAL4oso-ARX was not detected when coimmunoprecipitated with the

monoclonal anti-V5 HRP antibodY. CHAPTER 5 - 184

A. tnput GAL4pBD IP B. XXú¿, GAL4DBD V5 IP r^ t- Input IP ¿S2=o4Ê46 V5-PICKl + + âllâr + + o{o{ GAL4DBD-ARX z9zo 75 kD 150 kD t- ¿ 100 kD tr ÇÇ 75 kD 50 kD- o/o of total 2216t6 o/o of f¡Ál 0.1 0.7 9.7 t6 16 16 5 s 5 WB anti-GAl4¡s¡ rÙB PolYclonal anti-V5

Figure 5.4: V5-PICKl coimmunoprecipitated with GAL4oBD-ARX from cotransfected HEK

293T cells. HEK 293T cells were transfected as indicated and solubilized in lysis buffer 5'

Sotubilized proteins were immunoprecipitated with either the monoclonal anti-GAl4oep HRP antibody or the monoclonal anti-Vs HRP antibody. Immunoprecipitated proteins (asterisk) were detected with A. a l:1000 dilution of the monoclonal anti-GAl4Deo HRP antibody or,B. a 1:5000 dilution of a polyclonal anti-V5 antibody (Bethyl Laboratories) and a 1:1000 dilution of the goat anti-rabbit HRP secondary antibody. Percentage of extract loaded into each lane is indicated under each gel'

5.2.3 Myc-ARX/V5-IPO l3 Coimmunoprecipitation

As it was difficult to detect high levels of GAL4oeo-ARX expression during

coimmunoprecipitation with the monoclonal GAL4oeo HRP antibody alone, ARX protein

fused to a Myc tag (encoded in the pCMV-Myc vector, BD Biosciences) was used for future

experiments. Myc-ARX was not used for V5-PICKI coimmunoprecipitations as the construct

had not yet been made. Therefore HEK 293T cells were transfected with V5-IPO13 in the

absence and presence of Myc-ARX. Cell extracts were then immunoprecipitated with a CHAPTER 5 - I85 monoclonal anti-Myc antibody (Santa Cruz Biotechnology) or the monoclonal anti-V5 HRP antibody using ProteinA-Sepharose beads (Pharmacia Biotech).

Myc-ARX was immunoprecipitated with the monoclonal anti-Myc antibody around the

expected size (62.2 kD) (Figure 5.5), as was V5-IPO13 with the monoclonal anti-Vs HRP

antibody (Figure 5.7). Significantly when V5-IPOI3 was immunoprecipitated with the

monoclonal anti-V5 HRP antibody, Myc-ARX was coimmunoprecipitated (Figure 5.5).

However, Myc-ARX was also non-specifically immunoprecipitated from Myc-ARX extracts

with the monoclonal anti-V5 HRP antibody and a low concentration of NaCl (100 mM) in the

wash buffer (Figure 5.5). To increase the stringency of the immunoprecipitation, increasing

amounts of NaCl was included in the wash buffer. The point at which non-specific Myc-ARX

immunoprecipitation by the monoclonal anti-V5 HRP antibody was minimized was tested by

the increasingly stringent wash buffers on Myc-ARX extracts in the absence and presence of

V5-pO13 (Figure 5.6). Myc-ARX transfections in the absence and presence of V5-IPO13

were also immunoprecipitated with the monoclonal anti-Myc antibody and increasingly

stringent wash buffers, to confirm that the increased NaCl concentration did not disrupt

monoclonal anti-Myc antibody immunoprecipitation of Myc-ARX (Figure 5.6). Hence, it was

determined that to minimise non-specific immunoprecipitation of Myc-ARX with the

monoclonal anti-V5 HRP antibody, a wash buffer containing 500 mM NaCl was to be used

for Myc-ARXA/5 -IPO I 3 coimmunoprecipitation experiments' CHAPTER 5 - 186

Input Myc IP V5 tP Myc-ARX v5-IPO13 100 kD 75 kI) ett Myc-ARX

50 kD-

7o oftotal 0.7 0.7 0.7 5 s 5 13 t3 13

Figure 5.5: Myc-ARX coimmunoprecipitated with V5-IPO13, but was also non specifically immunoprecipitated with the monoclonal anti-Vs HRP antibody. HEK 293T cells were transfected as indicated. Cell extracts were immunoprecipitated with the monoclonal anti-

Myc antibody or the monoclonal anti-V5 HRP antibody. Immunoprecipitated proteins were detected with a 1:5000 dilution of the monoclonal anti-Myc HRP antibody (Invitrogen).

Percentage ofextract loaded into each lane is indicated under the gel

NaCl (mM) 100 200 300 500 900 100 200 300 500 900 Myc-ARX ++++++++++ vs-IPO13 +++++ 100 kD - 75 kD- ----_ IP V5 50kD- WB anti-Myc 100 kD- HRP 75 kD- IP Myc

s0 kD-

Figure 5.6: Optimisation of Myc-ARX coimmunoprecipitation with V5-PO13 by increasing

NaCl concentration in the wash buffer. At 500 mM NaCl, Myc-ARX is no longer non

specifically immunoprecipitating with the monoclonal anti-V5 HRP antibody, but continues

to coimmunoprecipitate with V5-IPO13 using the monoclonal anti-V5 HRP antibody and to

immunoprecipitate with the monoclonal anti-Myc antibody. V5 IP lanes contain 13% of IP

extract and IP lanes contain 5% ofIP extract. CHAPTER 5 - 187

Therefore, Myc-ARX was specifrcally coimmunoprecipitated with v5-IP013 using the monoclonal anti-v5 HRP antibody and a 500 mM NaCl wash buffer (Figure 5.7). However, immunoprecipitations with the monoclonal anti-Myc antibody in the same wash buffer shows that there continued to be non-specific immunoprecipitation of V5-IPO13 (Figure 5'7)'

Further optimisation of the wash buffers (NaCl concentration or amount of non-ionic

non-specific detergent) in Myc immunoprecipitations would therefore be required to minimise

immunoprecipitation of V5-IPO I 3.

Inout Mvc IP V5 IP Myc-ARX + + v5-IPO13 + +

100 kD - Myc-ARX 75 kD- (Drt(|t WB anti-Myc 50 kD-

7o of total 0.7 0.7 0.7 5 5 5 13 13 13 100 kD - 75 kD- -tr lr v5-rPol3 WB polyconal 50kD- anti- V5 o/o of total 0.7 0.7 0.7 13 13 13 555

293 Figure 5.7: Myc-ARX coimmunoprecipitated with V5-IPO13 from cotransfected HEK

cells. HEK 2g3T cells were transfected as indicated. Solubilized proteins were anti-V5 immunoprecipitated with either the monoclonal anti-Myc antibody or the monoclonal

HRP antibody. Immunoprecipitated proteins were detected with a 1:5000 dilution of

monoclonal anti-Myc HRP antibody or a 1:5000 dilution of the polyclonal anti-V5 antibody of and a 1:1000 dilution of the goat anti-rabbit HRP secondary antibody. Percentage

loaded into each lane is indicated under each gel CHAPTER 5 - I88

5.2.4 Cotocalization of ARX with PICK1 and IPO13 in HEK 293T Cells

As an additional method to yeast two-hybrid and coimmunoprecipitation, colocalization

studies were performed to confirm that ARX interacts with PICK1 and IPO13. To determine

if ARX colocalizes with PICKI and IPO13 within mammalian cells, HEK 293T cells were

examined for the immunocytochemical localization of V5-PICKl and V5-PO13 in the

absence and presence of GAL4oso/Myc-ARX (Figures 5.8 and 5.9). In cells transfected with

ARX alone, ARX localized to the nucleus but was absent in small internuclear patches, which

likely represent nucleoli (Figure 5.8 B and 5.9 B). These localization results were consistent

with those seen with GFP-ARX localization (Chapter 4 section 4.3.1).

V5-pICK1 showed diffuse localization to the cytoplasm with little or no localizalion to the

nucleus (Figure 5.S D). Cross reactivity between the antibodies used was not detected. These

results are consistent with the pattern of distribution reported by (Staudinger et al.,1995l'Dev

et al.,l99\Torres et at.,2001). Cotransfection studies with ARX and PICKI constructs were

next performed. In a small proportion of cells (15%) when GAL4rsr-ARX and V5-PICKI

were coexpressed, the expression pattern of V5-PICK1 was drastically altered to overlap

expression of GAL4oeo-ARX in the nucleus (Figure 5.S H). Alternatively in 27o/o of

cotransfected cells expression of GAL4p3¡-ARX was altered, where in addition to strong

nuclear expression, GAL4ost-ARX expression was seen in a diffuse pattern in the cytoplasm

(results not shown). Ho'\ruever, in the vast majority of cells (54%) coexpressing GAL4oao-

ARX and V5-PICKl, expression of V5-PICKI and GAL4osr-ARX was not altered (Figure

5.S L). This indicates that the interaction between ARX and PICK1 proteins in HEK 2937

cells may be a transient event or dependent on the cell cycle stage or other yet unknown

factors. CHAPTER 5 - 189

GAL4DRD-ARX Vs-PICKI

GAL4^"^-ARX/V5-PICKl

f igure 5.8: V5-PICKI colocalizes with GAL4oso-ARX in a small Proportion cotransfected HEK 293T cells. HEK 293T cells were transfected with pM-ARX and/or pcDNA3.l/nV5-DEST-PICKI as described above the panels. After 48 hour post transfection, cells were stained for chromatin (DAPI: blue), GAL4oso-ARX (monoclonal anti-ARX antibody: green) or V5-PÍCK1 (polyclonal anti-PICKl antibody: red), Cotransfection

GAL4oeo-ARX and V5-PICKl either resulted in VS-PICKI colocalizing with GAL4oso-

ARX in the cell nucleus of a small proportion of cells (G and IÐ ot had no affect on the

expression pattern of VS-PICKI (K and L) CHAPTER 5 - I9O

The localization of IPOI3 in HEK 293T cells were tested next. Endogenously expressed

IPO]3 localized predominantly to the cytoplasm, but also partly to the nucleus (Figure 5.9 D).

This is as expected since importin proteins shuttle between the cytoplasm and the nucleus when transporting cargo. However, the IPOI3 construct (V5-IPO13) was diffusely localized throughout the cell (Figure 5.9 G). Strong expression of V5-IPO13 likely occurred in the

nucleus due to the lack of the Ran GTPase binding site, where V5-IPOl3 would not be able to

release its cargo and shuttle back to the cytoplasm (see Chapter 4 section 4.2.6 for mote

detail). When coexpressed within HEK 293T cells, Myc-ARX and V5-POl3 expression (as

detected by both polyclonal anti-V5 antibody and polyclonal anti-IPO13 antibody) completely

overlapped within the nucleus (Figure 5.9 K) indicating a direct interaction between the two

proteins within HEK 293T cells.

5.2.5 Expansion of Polyalanine Tracts in GFP-ARX Increases the Formation of Nuclear

and Cytoplasmic Aggregates

As discussed in Chapter 1 (section 1.3.6) expansion of polyalanine tracts that are associated

with disease phenotypes have been shown to cause the formation of both intranuclear andlot

cytoplasmic aggregates. Two of the most common mutations in ARX include expansion of

the first polyalanine tract (GCG)lo+2, which results in an increase from 16 to 23 alanines

(ARXs¡p), and a24bp duplication in the second tract which results in an increase from 12 to

20 alanines (ARXoup). It has been previously shown that expansion of the first polyalanine

tract in mouse ARX from 15 to 23 alanines resulted in the formation of nuclear aggregates

(Nasrallah et al., 2004). To determine whether expansion of the first two polyalanine tracts

(ARXEX' and ARX¡up) results in aggregation of human ARX within the nucleus or

cytoplasm, GFP tagged ARX normal (ARX¡6ru\a), ARXByp and ARXoup were transiently CHAPTER 5 . 191 transfected into SH-Sy5y neuroblastoma cells and PC12 cells. The formation of aggregates for was assessed 48 hours post transfection, where over 1000 transfected cells were counted each construct from at least three different transfections. Less than 5%o of transfected SH-

Sy5y neuroblastoma and 8% of transfected PC12 cells displayed aggregation of GFP-

ARX¡6p¡u1, where aggregation was mainly seen in the nucleus (Figure 5.10).

11

âr X ú I CJ q) ¿ è0 f¡ì

(.¡

I ra)

(.)

rñI x ú

I

Figure 5.9: V5-IPO13 colocalizes with Myc-ARX in cotransfected HEK 293T cells. HEK

293T cells were transfected with pCMV-Myo-ARX and/or pcDNA3.1/nV5-DEST-rPo13 as for described to the left of the panels. After 48 hour post transfection, cells were stained

chromatin (DApI: blue), Myc-ARX (monoclonal anti-ARX antibody: green) or IPO13A/5-

IpO13 (polyclonal antiJPOl3 antibody: red). Endogenous IPO13 expression predominantly

occurred in the cytoplasm (D), whereas V5-IPO13 expression occurred diffusely throughout

the cell (G). Cotransfection of Myc-ARX and V5-IPO13 resulted in V5-IPO13 colocalizing

with Myc-ARX in the cell nucleus (.úl CHAPTER 5 - T92

50 45 SH-SySY Neuroblastoma Cells 40 35 30 "^ 25 20 t5 l0 5 0 ARX¡e¡¡a ARXEXp ARXoup ARX¡6¡¡a ARX¡¡p ARX¡I.rp

Intranuclear Aggregates Cytoplasmic Aggregates

50 45 PCl2 Cells 40 35 30 '^ 25 20 15 l0 5 0 ARXN9RM ARXEXP ARXDUP ARXN9RM ARX¡¡P ARX¡UP Intranuclear Aggregates Cytoplasmic Aggregates

figure 5.10: Polyalanine expansion lncreases the formation of nuclear and cytoplasmic

aggregates. SH-SY5Y neuroblastoma and PC12 cells were transfected with ARXNonrr,r

(yellow), ARXsxp (red) or ARXoup (green) and wefe analysed 48 hours later. Compared to

ARX¡s¡¡y1 expression of ARXexp caused a marked increase of aggregate formation' most

which occurïed in the cytoplasm. However, ARXoup expression did not cause a

increase of aggregate formation compared to ARXNonvr' CHAPTER 5 - I93

Overexpression of GFP-ARX'¡p resulted in the formation of aggregates in 43%o of SH-SY5Y

cells neuroblastoma cells, which is a 7-fold increase compared to GFP-ARX¡6n¡¡a transfected

(Figure 5.10). Similarly, GFP-ARXExp caused a 5-fold increase of aggregate formation in

PC12 cells compared to GFP-ARX¡'¡¡¡a. Interestingly the majority of GFP-ARXsvp a$$re$ate

formation in both SH-SYsY neuroblastoma and PCl2 cells \ryas seen in the cytoplasm usually

in addition to low levels of diffuse nuclear staining (Figure 5.11). One possible explanation

for the cytoplasmic aggregafe formation is that the mislocalization and aggregate formation of

GFp-ARXsxp in the cytoplasm may be due to interference in nuclear import. Compared to of GFP-ARXN6p¡'{, ovefoXpression of GFP-ARXoup did not result in a marked increase

nuclear or cytoplasmic aggregate formation (Figure 5.10) in both SH-SY5Y neuroblastoma

and PC12 cells.

5.2.6 IpO13 and PICK1 Colocalize with GFP-ARX Aggregates in the Nucleus and

Cytoplasm

As noted previously transiently transfected V5-IPO13 and Myc-ARX colocalize in the

when nucleus (Figure 5.9 K). However, V5-PO13 was also strongly expressed in the nucleus

Myc-ARX was not present due to the lack of the Ran GTPase binding site (Figure 5.9 F and

D). G), whereas endogenous IPO|3 predominantly localized to the cytoplasm (Figure 5.9

2937 Thus ARXNop¡u, ARXpxp and ARXrup were cotransfected with V5JPO13 into HEK

cells to 1) confirm whether the colocalization was due to the coincidence of two

the two overexpressed proteins localizing to the nucleus or due to a direct interaction between

proteins; and 2) to investigate the hypothesis of impaired nuclear import as a consequence of

to bind to the expansion of the first two polyalanine tracts in human ARX causing an inability

IPOI3 CHAPTER 5 - 194

Diffuse Nuclear NOIìM

Nuclear Aggregates

NOIìlvl DLJ P

Cytoplasmic Aggregates

Figure 5.11: GFP tagged ARXNonrvr, ARXsxP and ARXo¡p expression in SH-SY5Y neuroblastoma cells. SH-SY5Y neuroblastomas were transfected with phrGFP-N1-ARXuon¡,,r,

-ARXs¡p or -ARXp¡p as indicated in the top left hand corner of each cell. After 48 hour post

transfection, cells were viewed for GFP-ARX immunofluorescence using a FITC filter'

Expression of GFP-ARX constructs was observed as a diffuse nuclear pattern,

aggregates or cytoP lasmic aggregates . Similar results were observed for PC12 cells. CHAPTER 5 - I95

V5-IPOI3 lryas transfected into HEK 293T cells with Myc-ARX¡e¡¡¡a, Myc-ARXp>c' or Myc-

ARXoup and the transfected cells were analysed 48 hours later. Significantly expression of

V5-IPO13 colocalized in all cells transiently transfected with Myc-ARXNorur,t, -ARXnxp and

-ARXoup aggregates in the nucleus and cytoplasm. Figure 5.12 D and H shows the colocalization of V5-PO13 with Myc-ARXNoruu in nuclear and cytoplasmic aggregates.

Similar results were observed for the Myc-ARXsxp and Myc-ARX¡¡p cotransfections.

Interestingly when V5-PICKI was transfected into HEK 293T cells it also colocalized with the Myc-ARX¡oR\4 nuclear and cytoplasmic aggregates (Figure 5.12L).It has not yet been determined whether Vj-PICK| continues to colocalize with nuclear and cytoplasmic aggregates formed by Myc-ARXgyp and Myc-ARX¡uP constructs.

5.3 DISCUSSION

In Chapter 4 yeast two-hybrid screening identified the ARX homeodomain as interacting with the protein IPOI3, the ARX aristaless domain as interacting with the proteins PICKI and

PKM2 and the first two polyalanine tracts of ARX as interacting with AlUp. The purpose of the work described in this Chapter was to confirm the interaction in mammalian cells between the entire ARX protein and the novel protein interactors. It was decided to confirm the

interaction of just IPOI3 and PICKI with ARX to begin with. This was achieved by

performing coimmunoprecipitation and colocalization experiments in HEK 293T cells. CHAPTER 5 - T96

DAPI Myc-ARX v5-IPOl3 Overlay

¿ 4 * ú

I à r¿ Q

ra¡

Figure 5.12: V5-IPO13 and V5-PICK1 colocalize with Myc-ARX¡sp¡a nuclear cytoplasmic aggregates. HEK 293T cells were transfected with phrGFP-N1-ARXNonv and pcDNA3.1/nV5-DEST-IPO13 or pcDNA3.1/nV5-DEST-PICK1 and fixed 48 hours post transfection, Cells were stained for chromatin (DAPI: blue), Myc-ARX¡ozuvr (monoclonal

ARX antibody: green), V5-PO13 (polyctonal IPO13 antibody: red (C. and G')) or V5-PICK1

(polyclonal PICK1 antibody: red (rK.)). A.-D. Vi-IPO13 and Myc-ARX colocalize in nuclear

aggregates. E.-H. V5-IPO13 and Myc-ARX colocalize in cytoplasmic aggregates (-ÉL inset

black arrow). L-L.Vl-PICKl colocalizes with Myc-ARX aggregates (red arrows)' CHAPTER 5 - 197

Even though endogenous IPOI3 expression \ /as detected in HEK 293T cells by

immunofluorescence (Figure 5.9 D), both IPO13 and PICKl expression was difficult to detect

by SDS PAGE analysis. Hence, both IPOI3 and PICKI were cloned into pcDNA3.l/nV5-

DEST expression vector, enabling both the detection (Figure 5.2) and immunoprecipitation of

IPOI3 and PICK1 via a tused V5 tag in HEK 293T cells.

PICKI was shown by coimmunoprecipitation to interact directly with ARX (Figure 5.4).

HEK 293T cells were initially transfected with GAL4¡3¡-ARX and cell lysis conditions were

examined for the lysis buffer that contained a low concentration of NaCl and non-ionic

detergent but still solubilized GAL4reo-ARX (Table 5.1 and Figure 5.3). HEK 293T cells

were then transiently transfected with V5-PICKI in the absence and presence of GAL4osn-

ARX. Cell extracts were immunoprecipitated with the monoclonal anti-GAl4osn HRP

antibody or the monoclonal anti-V5 HRP antibody. The monoclonal anti-GAl4oeo HRP

antibody successfully immunoprecipitated GAL4oso-ARX and the monoclonal anti-Vs HRP

antibody successfully immunoprecipitated V5-PICKI (Figure 5.4). However, while V5-

PICKI was successfully coimmunoprecipitated with GAL4¡s¡-ARX using the monoclonal

anti-GAl4osr HRP antibody (Figure 5.4 B), GAL4oeo-ARX was not successfully

coimmunoprecipitated with V5-PICK using the monoclonal anti-Vs HRP antibody (results

not shown). A possible explanation for this may involve the expression level of GAL4oso-

ARX in HEK 293T cells. Expression of GAL4oeo-ARX was obviously lower than that of V5-

PICKI (Figure 5.4) despite analysing over twice the amount of cell extract by SDS PAGE

analysis. This was unlikely to be due to the quality of the antibody as previous use of the

monoclonal anti-GAl4rs¡ antibody showed that it was able to detect the GAL4rnl protein

efficiently (Chapter 4 Figure 4.5). Conversely the low level of GAL4osn-ARX expression

may be due to the SV40 promoter in the pM vector, which does not drive expression in CHAPTER 5 - 198 mammalian cells as well as the CMV promoter encoded on the pcDNA3.l/nV5-DEST vector

(Foecking and Hofstetter, 1986; Davis and Huang, 1988; Liu et a1.,1997). Furthermore, it is our experience that to detect the coimmunoprecipitation of proteins by SDS PAGE analysis, a higher percentage of immunoprecipitation extract (13-16%) must be analysed compared to the

detection of immunoprecipitated proteins (5%). Therefore, if expression of GAL4oso-ARX is

low before immunoprecipitation, it may be too low to detect from coimmunoprecipitation. To

determine if the reason why GAL4oso-ARX was not coimmunoprecipitated with V5-PICKl

was due to the SV40 promoter, the coimmunoprecipitation experiments should be repeated

with Myc-ARX driven by the CMV promoter.

V5-PICK1 was also shown to interact with GAL4tsr-ARX by colocalization, but in only a

small proportion (15%) of cotransfected cells (Figure 5.8 H). A reason why V5-PICKI may

colocalizes with GAL4osr-ARX in only a small proportion of cotransfected cells is that the

interaction between PICKI and ARX might be only a transient event or dependent on the cell

cycle stage or yet other unknown factors. However, PICKI interaction with ARX is also

supported by the observation that V5-PICKI colocalizes with aggregates formed by Myc-

ARX (Figure 5.I2 L). As mentioned in Chapter 4 (section 4.3.1.3 and references therein),

pICKI is capable of modulating PKCcr phosphorylation. Furthermore, PKC has been shown

to phosphorylate the Aristaless-related Paired-class homeodomain protein PITX2, and by

doing so regulates PITXZ mediated transcription (Espinoza et a1.,2005)' Hence, a further

extension of the analysis of the PICKI/ARX interaction would be to investigate whether ARX

is phosphorylated by PKCa and if PICKI is required for this phosphorylation to occur.

IpOl3 was shown by coimmunoprecipitation to interact directly with ARX (Figure 5.7). Due

to the difficulty of detecting coimmunoprecipitation of GAL4osp-ARX with V5-PICKI (see CHAPTER 5 - 199 above), ARX was cloned into the pCMV-Myc vector which as the name suggests drives

were expression of proteins in mammalian cells with a CMV promoter' HEK 293T cells transiently transfected with v5-IPo13 in the absence and presence of Myc-ARX. Myc-ARX and was successfully immunoprecipitated by the monoclonal anti-Myc HRP antibody v5-

IpOl3 was successfully immunoprecipitated by monoclonal anti-V5 HRP antibody (Figure

5.7). However, Myc-ARX was also non-specifically immunoprecipitated by the monoclonal

anti-V5 HRp antibody when V5-IPO13 was not present (Figure 5.5). Therefore the wash

buffer used in coimmunoprecipitation to wash away unbound proteins \,vas made

progressively more stringent by increasing the NaCl concentration. It was found that a wash

buffer containing a concentration of 500 mM NaCl, minimised the non-specific

immunoprecipitation of Myc-ARX by monoclonal anti-V5 HRP antibody without affecting

coimmunoprecipitation of Myc-ARX with V5-IPO13 or immunoprecipitation of Myc-ARX

by the monoclonal anti-Myc HRP antibody (Figure 5.6). Further optimisation of the wash

buffer (NaCl or non-ionic detergent concentration) is required to minimise non-specific

immunoprecipitation of VS-IPO13 by the monoclonal anti-Myc HRP antibody in the absence

of Myc-ARX (Figure 5.7). Nevertheless, coimmunoprecipitation of Myc-ARX with v5-

IpO13 is consistent with the findings of Ploski et al. (2004) where IPO13 was found to

directly interact with the homeodomains of the Paired-class proteins PAX6, PAX3 and CRX'

The interaction between Myc-ARX and v5-IPO13 \¡/as subsequently analysed by

colocalization studies in HEK 293T cells. Transiently transfected HEK 293T cells showed a

different cellular localization of V5jPO13 (diffuse throughout cell) compared to

There endogenously expressed IPO13 (predominantly cytoplasmic) (Figure 5'9 D and G)'

rather than \ryere a number of reasons why V5-IPO13 was used for colocalization experiments

viewed in endogenously expressed IPO13. These reasons included the observation that when CHAPTER 5 -2OO the same view plane transfected HEK 293T cells showed significantly stronger expression of

V5-1pOl3 than endogenous IPOI3 expression. Furthermore, there was the distinct possibility that colocaltzationbetween Myc-ARX and endogenous IPO13 would not be detected as once

Myc-ARX was transported into the nucleus IPO13 would release Myc-ARX by interacting

with Ran GTPase. However, if the Ran GTPase binding site is absent in importin proteins, the

disassociation effect of Ran GTPase is eliminated (Plafker and Macara, 2000). Unfortunately

since the V5-IPO|3 construct lacks the Ran GTPase binding site and was diffusely expressed

in the cell, it was difficult to determine if colocalization in the nucleus was due to coincidence

or a direct interaction between Myc-ARX and V5-IPO13. This is where the observation that

Myc-ARX could form nuclear and cytoplasmic aggregates was explored further in this

context.

In SH-SY5Y neuroblastoma and PCl2 cells GFP-ARX usually localizes to the nucleus in a

diffuse pattern (Figure 5.12).In a small percentage of transfected cells (lessthan 5% of SH-

Sy5y neuroblastoma and 8% of PC12 cells) GFP-ARX forms nuclear and cytoplasmic

aggregates (Figure 5.11 and Figure 5.12). Expansion of the first ARX polyalanine tract from

16 to 23 alanines dramatically increased the formation of cytoplasmic and nuclear aggregates,

with most of the aggregates forming in the cytoplasm (Figure 5.ll). Expansion of the second

ARX polyalanine tract from 12 to 20 alanines did not result in a marked increase of aggregate

formation in the nucleus or cytoplasm compared to normal polyalanine tract length. In

contrast, expansion of the first polyalanine tract in mouse ARX from 15 to 23 alanines

resulted in the formation of only nuclear aggregates (Nasrallah et a\.,2004). However, these

results coincide with those of Albrecht et aI. (2004), where cytoplasmic aggregation of

HOXDI3 occurs beyond a threshold of a polyalanine tract length of 22 alanines, but as the

polyalanine tract length increases so does the number of cells with cytoplasmic aggregation. CHAPTER 5 -2OI

Furthermore, expansion of polyalanine tracts over the same threshold in RLINX2, HOXAl3

SOX3 and FOXL2 resulted in cytoplasmic aggregates (Albrecht et a1.,2004; Caburet et al.,

2004). This suggests that polyalanine tracts longer than 22 cause the mislocalization of

transcription factors in the cytoplasm by the formation of cytoplasmic aggregates.

Albrecht et at. (2004) suggest that the formation of cytoplasmic aggregates prevents the

transcription factors form entering the nucleus. Significantly, V5-IPO13 colocalized to both

nuclear and cytoplasmic aggregates containing ARX with normal, expanded and duplicated

polyalanine tracts. This confirms that IPO13 interacts directly with ARX, regardless of

whether the polyalanine tracts are expanded over 22 alan\nes. However, while V5JPO13

binds to ARX, expansion of the polyalanine tracts and thus cytoplasmic aggregation may

prevent it IPOI3 from interacting with the nuclear pore machinery, and thus entry into the

nucleus. Therefore, disruption of ARX import into the nucleus by IPOl3 is potentially one of

the cellular mechanisms that are affected in ARX patients.

Interestingly mutations in basic residues of the ARX homeodomain NLS that IPO13 binds to

causes a more severe phenotype than expansion of the polyalanine tracts (see Chapter 3

Figure 3.4 and Chapter I Table 1.4). This suggests that where expansion of the first two

polyalanine tracts may disrupt nuclear import of ARX to a certain extent, mutation of certain

residues in the homeodomain NLS causes a severe impairment of nuclear import and

therefore a severe phenotype. Thus it is presently being investigated whether the same

mutations in the ARX homeodomain NLS that cause XLAG and Proud syndrome also

prevent binding of IPOI3 to ARX and therefore impair its nuclear import. The process of

is identifying a DNA binding site for the ARX homeodomain to create a reporter gene system

also currently being investigated. The generation of a reporter gene system with an ARX CHAPTER 5 -202 binding site would allow a more accurate investigation into the affects of the polyalanine expansions and homeodomain NLS mutations on nuclear import and gene expression- One of the DNA binding sites with which is currently being worked on is located in the promoter of the PAX4 gene identified by Collombat et al' (2005) as binding the ARX protein'

5.4 SUMMARY

In Chapter 4 IPO13 was found to interact with the ARX homeodomain, the proteins PICKI

to and pKM2 were found to interact with the ARX aristaless domain and AlUp was found

interact with the first two polyalanine tracts in ARX. Here IPOI3 and PICK1 were conltrmed

to interact directly with the entire ARX protein by coimmunoprecipitation. While the

interaction between PICKI and ARX was confirmed in part by colocalization, a further

extension of the analysis of the PICKI/ARX interaction would be to investigate if ARX is

phosphorylated by pKCa and if this phosphorylation was modulated by PICK1. Conversely

the interaction between IpOl3 and ARX was convincingly confirmed by colocalization

studies. Interestingly, the human ARX formed nuclear and cytoplasmic aggregates and

expansion of the first polyalanine tract from 16 to 23 alanines markedly increased the number

of cells containing cytoplasmic aggregates. Significantly, IPO13 colocalized with these

cytoplasmic aggregates formed by ARX¡6¡¡a, ARXpxp and ARXouP constructs, suggesting

that mislocalization of ARX due to the formation of cytoplasmic aggregates may be the result

of impaired nuclear import of ARX by IPO13. Furthermore impaired nuclear import may be

one of the means by which expansion of the first polyalanine tract causes ISSX or mutations

in the homeodomain cause XLAG and Proud syndrome' CHAPTER 6 Zebrafish Knockdown Model

204 6.I .I USING ZEBRAFISH EMBRYOS AS EN ARX MOIEL SYSTEM

6.1.2 OVERVIEW oF ZEBRAFISH EARLY EMBRYOS DEVELOPMENT....'.'."""""" """"""""""""205

6.1.3 DEVELoPMENT oF rlIE VERTEBRATE CNS ...... '.'.. """"""211

6.1.4 ZEBRAFTSH ARx KNocKDowN Molel """"'213 ...... 2 I 6 6. 1.4. I emx Genes...... 217 6.1.4.2 myoD Gene 217 6.1.4.3 shh Gene 2t8

...... 220 6.2.I GENERATION OF A ZEBRAFISH KNOCKDOWN MOIET- 22I 6.2.2 REDUCED EXPRESSION OF EMX3 BUT NOT SHH AND MYOD IN I2 HPF ARX INJECTED EMBNYOS .'".."""'

6.2.3 M]CROINJECTION oF ARx MonpI{oLII.IOS RESULTS IN REDUCED DLX2R EUI OLX5A FOREBRAIN ExpRESSIoN IN 24 HPF ZesRArIsu ElvIBRYos '...... '..' """"""""""222

235 CHAPTER 6 -204

6.1 INTRODUCTION

6.1.1Using Zebrafish Embryos as an ARX Model System

ARX plays an important role during development as indicated by the disease phenotypes

observed in patients with naturally occurrin g ARX mutations (reviewed in Chapter 1). The use

of human embryos for the specific purpose of investigating ARX protein function was

virtually impossible, thus an alternative model system was required' Zebrafish as a model

organism for studying ARX protein function was chosen for a number of reasons. Firstly,

analysis of the human and zebrafi sh ARX orthologs show that they are highly conserved

except for the first two polyalanine tracts (see Chapter 3). Secondly, expression of human,

mouse and zebrafish ARX orthologs is highly conserved. In humans lÄX mRNA expression

was detected in the fetal and adult brain (occipital, frontal and temporal lobes of the cerebral

cortex, amygdala, corpus callosum, caudate nucleus and hippocampus) and skeletal muscle

(Bienvenu et a\.,2002: Stromme et a1.,2002). Similarly, in mice lrx expression was detected

in the brain (telencephalon: ganglionic eminences, hippocampus, cerebral cortex; and the

diencephalon), floor plate and somites (Miura et a1.,1997; Bienven:uet al',2002). While in

zebrafish arx mRNA expression \'r'as detected in the forebrain (telencephalon and

diencephalon), floor plate and somites (Miura et al., 1997). Conservation of ARX ortholog

sequence and expression pattern therefore suggests that ARX is conserved in function.

Furthermore, the zebrafish genome has been sequenced hence making it easier to identify

zebrafrsh orthologs of other developmentally important genes. Additionally, zebrafish are

vertebrates and compared to other models they are easy to maintain, produce large numbers of

externally developing progeny, easy to observe and most importantly are accessible to genetic CHAPTER 6 -205 manipulation. From manipulation of the zebrafish embryos, it was hoped that the ARX gene could be placed in regulatory pathways important for brain and embryo development.

6.1.2 Overview of Zebrafish Early Embryos Development

A comprehensive description of zebrafish development has been published by Kimmel et al'

(1995). A summary of the principal periods involved in zebrafish embryo development, and a

brief description of the important events involved is provided in Table 6'l.It should be noted

that in regards to zebrafish development the term period refers to an interval of time

characterized by the occurrence of a certain events and stage refers to certain events within

each period. During the zygote period, the chorion inflates and lifts away from the newly

fertilized egg. Fertilization also activates cytoplasmic segregation where the animal cytoplasm

separates from the vegetal cytoplasm creating a blastodisc (Figure 6'l)' After the first

cleavage of the blastodisc into two cells (now called blastomeres), the embryo enters the

cleavage period. In the cleavage period, the blastomeres rapidly divide in a synchronous

manner, where depending on the stage of development, a specific subset of blastomeres

remain connected by cytoplasmic bridges (Kimmel and Law, 1985)'

From the 128-cell stage, where the blastodisc takes on a ball shaped appearance, until the

onset of gastrulation the fertilized embryo is known to be in the blastula period of

development. One of the major events to occur during the blastula period includes the

lengthening of cell cycles (known as the midblastula transition) which become asynchronous

in their division (Kane and Kimmel, 1993). Blastomeres lying immediately adjacent to the

yolk (marginal blastomeres) are still connected to the yolk cell by cytoplasmic bridges.

Furthermore, during the blastula period the marginal cells release their cytoplasm and nuclei CHAPTER 6 -206 together into the yolk cell, giving rise to the yolk syncytial layer (YSL) (Kimmel et al.' 1995).

Nuclei now present in the YSL continue to undergo mitotic division until the onset of epiboly, where the nuclei begin to enlarge due to RNA transcription. The RNA transcribed from the ySL is required for establishment of the germ layers and induction of ventrolateral mesoderm/endoderm formation (Chen and Kimelman, 2000). Epiboly begins late in the blastula period and continues in the gastrula period. In epiboly both the blastodisc and the ySL thin and spread over the yolk cell, eventually surrounding the yolk cell completely.

Period D Zygote 0-314 The newly fertilized egg through the completion of the first zygotic cell cycle Cleavage 0.7- 2.2 Cell cycles 2 through 7 occur rapidly and synchronously Blastula 2U4-sll4 Rapid, metasynchronous cell cycles (8, 9) give way to lengthened, asynchronous ones at the midblastula transition; epiboly then begins Gastrula 5v4-10 Morphogenetic movements of involution, convergence and extension form the epiblast, hypoblast and embryonic axis Segmentation 10-24 Somites, pharyngeal arch primordia, and neuromeres develop; primary organogenesis; earliest movements; the tail appears Pharyngula 24-48 Phylotypic-stage embryo; body axis straightens from its the early curvature about the yolk sac; circulation, pigmentation, and fins begin to develop Hatching 48-72 Completion of rapid morphogenesis of primary organ systems; cartilage development in head and pectoral fin; hatching occurs asynchronously Larval 72-29 days Swim bladder inflates; food-seeking and active avoidance behaviours + hours post fertilizatron

Table 6.1: Periods of early zebrafish embryo development (Kimmel et aI.,1995) CHAPTER 6 -207

.u¡úl poL

100 pm -ìl Bimd tt¡.úl polc pqb I 8-cell l-cell 2-cell 4-cæll 1.25 h 0.2 h 0.75 h lh

128-ccll l6-cell 32-celt 2.25 b 1.5 h 1,75 h 2h

bldclcm

256-cell h¡gh sphere 30o/o 4,7 h 2.5 h 3.3 h 4h

hyfotl¡f ñô¡ddod@

g@ñ 90% epibolY 50% epibolY shield 75% epibolY 5.3 h 6h 8h th

Figure 6.1: Camera lucida sketches of early zebrafish embryo development from the zygole to the gastrula period. In the earliest stages the animal pole is to the top of the embryos, w later becomes the anterior of the embryo. Face views are shown during cleavage and blastula periods, and the animal pole view showing the germ ring and shield are shown during the gastrula period. Key features of development are indicated (Kimmel et a\.,1995) CHAPTER 6 -208

At approxim ately 50%o epiboly the gastrulation period begins and ends at l00o/o epiboly

(Kimmel et al., 1995). Cells at the blastoderm margin migrate back upon themselves

(involution) to form the germinal ring. The presence of the germinal ring creates two germinal layers of cells. Throughout gastrulation the upper germinal layer, the epiblast, continues to feed cells into the lower germinal layer, the hypoblast. At the end of gastrulation, cells

remaining in the epiblast give rise to ectoderm, and the cells in the hypoblast layer give rise to

mesoderm and endoderm. Expression of the gene goosecoid marks where cells rapidly

converge at one position of the germinal ring forming the embryonic shield, thus indicating

the future dorsal side of the embryo (Stachel et a\.,7993). Towards the end of the gastrulation

period the tail bud forms and the first sign of the central nervous system (CNS) appears with

the formation of the neural plate (Kimmel et aL.,1995).

As the segmentation period proceeds embryo length also increases by the extension of the

embryo tail (Figure 6.2). Furthermore, somites begin to form in the trunk and tail of the

embryo progressing along the anterior to posterior axis in a caudal direction (Kimmel et al',

1995). It is from the interior cells of the somite that pioneer muscle cells arise (Felsenfeld e/

at., l99l). Sclerotome also arises from a ventromedial cluster of cells in the somite, which

later develops into vertebral cartilage and connective tissue (Morin-Kensicki and Eisen,

lggT). During the segmentation period the pronephric kidneys develop and the notochord

differentiates in an anterior to posterior direction (Kimmel et a1.,1995). Also appearing are

the optic and the pharyngeal or visceral arches primordia, which later develop into the eyes

and into jaw and gill structures respectively. The segmentation period is also the time of

major CNS development. Firstly the neural tube develops followed by differentiation of

neurons, including motorneurons and interneurons, and subdivision of the brain into the

forebrain, midbrain and hindbrain (Kimmel, 1993). CHAPTER 6 -209

ôn

100 pm bud 3-somite 6-somite l0 somite 10h llh t2h 14h Pharyngula

l4-somite 18-somite 21-somite prim-6 16h 18h 19.5 h 25h

rnlcrior Poslcr¡or

vcnlr¡l long pec (tlalghins'Ant)

Figure 6.2: Camera lucida sketches of zebrafish embryo development from the segmentation

to the hatching period. Anterior is to the top and dorsal to the left, except for the hatching

embryo where orientation is as specified. Key features of development are indicated (Kimmel

et a1.,1995) CHAPTER 6.210

Towards the end of the segmentation period primordium of the hypothalamus, epiphysis

(presumptive pineal gland) and cerebellum also appear. Associated with neural tube development is the appearance of the olfactory placode, lens placode and the otic (ear) placode (Kimmel et al.,1995).

The pharyngula period concentrates on the development of the pharyngeal arches (Kimmel et a1.,1995). Other major events occur include the rapid lengthening and straightening of the tail, which ceases after the f,rrst few hours, and lengthening the rest of the embryo, where the head straightens out from the embryo. Furthermore, in the pharyngula period, the zebrafish fins begin to develop, pigmentation cells differentiate and the circulatory system forms with the heart beginning to beat. Lastly, the zebrafish embryos become more tactile sensitive, where the flexions become more coordinated into rhythmic bouts of swimming.

During the hatching period morphogenesis of many organs is completed and rapid changes in the pharyngeal arches occur where jaw, mouth, cartilage and the rudiments of gill structures are developed (Kimmel et al., 1995). Interestingly, individuals within a single clutch of embryos will hatch asynchronously during the third day or slightly later. However, since the embryos are all at the same developmental stage they are all considered larvae after the third day even if they have not yet hatched. In the larval period melanin accumulation distinctly colors the fish larvae and circulation becomes more complex. The appearance of the first visible bone called the cleithrum (serves as an anchor of the pectoral fin girdle), marks the end of zebrafish embryogenesis (Kimmel et aL.,1995). CHAPTER 6.211

6.1.3 Devetopment of the Vertebrate CNS

As ARX plays a major role in the development and function of the brain, a brief summary of vertebrate CNS development is provided here. In vertebrates the neural tube develops by two distinct mechanisms (reviewed by Lowery and Sive, 2004). An anterior neural tube extending

from the future brain to the future trunk (cervicothoracic region) forms by the process known

as primary neurulation. A posterior neural tube develops in the lumbar and tail region by the

process known as secondary neurulation (Figure 6.3 A). At the transition zone, where primary

and secondary neurulation meet, a mix of the two neurulation mechanisms occurs and the two

neural tubes eventually combine into a single tube. During primary neurulation the neural

tube develops from a sheet of epithelial cells along the dorsal midline of the embryo which

begins to acquire neuronal properties (Wilson and Hemmati-Brivanlou,1997). A neural plate

is formed which then proceeds to fold into a neural tube. In contrast, the neural tube from

secondary neurulation forms from mesenchymal cells, which coalesce into a rod- The

mesenchymal rod then transforms into epithelium (the presumptive neuroepithelium) and a

lumen develops to form a tube.

During the early stages of primary neurulation, the rostral part of the neural tube forms three

vesicles: the forebrain (prosencephalon), the midbrain (mesencephalon) and the hindbrain

(rhombencephalon) (Figure 6.3 B). Later during development the forebrain vesicle further

divides into the telencephalon and the diencephalon, and the midbrain vesicle divides into the

metencephalon and the myelencephalon (Figure 6.3 C) (Kandel et a1.,2000). Each of these

five major subdivisions in the embryonic central nervous system (CNS) further matures into

the different structures seen within the adult brain' CHAPTER 6 -212

B. A. Primarv Neuruletlon S€condery neurulat¡on

1. lnitial epithelium 1, Dispersad mesenchyme

.t Ô a a tt ata rrrtt t ar l |}- rfla¡ t - t-tal a - a ira l' t a t a a t a t a' a - nffilttrbß

2. Columnat¡zat¡on 2, Mee€nchymal condensat¡on

3, Medullary cord,lneural rod C

¡ote¡rur l.rlor tt a I riÓt a ¡ rl o Lðt al Ç ¡l Mrlbrñ 4. Epithelialtmnsition/cavitation 4. Closure tà¡rdE¡tr¡dâ CdaUrl Hnôt¡,l It ¡ tt ta aa :ttt a at t lt (n.ür¡lol aa t aD

5. Neural tube comPlete 5. Neural lube compl€le

The Figure 6.3: Formation of the neural tube along the anteroposterior axis in vertebrates.24.

anterior part of the neural tube forms by primary neurulation from epithelial cells and the

posterior part of the neural tube forms by secondary neurulation from mesenchyme cells

(Lowery and Sive, 2004).,8. In the early of neural tube development three vesicles are

formed. A series of ring-like constrictions in the neural hrbe mark the approximate boundaries two between the forebrain, midbrain, hindbrain and spinal chord. C. As development proceeds

additional constrictions occur in the neural tube marking the major subdivisions of the CNS

(Kandel et aI.,2000) CHAPTER 6 -213

Each stage of development is dependent on the expression of selected genes in a temporal and

spatial specific manner. These genes are tightly regulated by both intrinsic (cell surface and

secreted molecules involved in lateral inhibition such as Notch-Delta signalling, and

transcription factors) and extrinsic factors (secreted factors such as insulin-like growth factor,

fìbroblast growth factors and nerve growth factor) (Calof, 1995; Bally-Cuif and

Hammerschmidt, 2003). The effects of mutations in these developmentally imporlant genes

are observed in a diverse range of degenerative disorders and cancers seen in humans.

Understanding the genetic pathways as well as the role of individual proteins in development

thus provides useful insights into the causes of disease and potentially provides clues as to

they might be prevented/treated.

Signifìcantly the formation of the CNS and the key genes responsible for regulating CNS

development are highly conserved in organisms such as Drosophila melanogasrer (fruit fly),

Mus musculrzs (mouse), Xenopus laevis (frog), Danio rerio (zebtafish) and Homo sapiens

(human). The use of model organisms therefore provides an avenue by which individual

genes can be studied in relation to important developmental genetic pathways and protein

function

6.1.4 Zebrafish ørx Knockdown Model

A zebrafìsh arx knockdown model was generated in collaboration with Michael Lardelli

(University of Adelaide, Australia) using antisense oligonucleotide (morpholino) technology.

Morpholinos are synthetic DNA analogs, which possess a neutrally charged backbone that

makes them resistant to nuclease digestion and to non-specifìc interactions with cellular

proteins (Figure 6.4) (Corey and Abrams, 2001). Morpholinos are microinjected into CHAPTER 6 - 214

delivered to zebrafish embryos at the 2 to 4 cell stage, where they are efficiently and evenly

gene is the entire zebrafish embryo (Nasevicius and Ekker, 2000). Translation of a specif,rc blocked by designing the typically 25 bp morpholinos against sections of the region

of the encompassing the 5 prime cap to about 25 bases past the AUG translation start site target 6RNA. Once delivered into the cell the bound morpholino sterically blocks the

scanning of the mRNA by the 40s ribosomal subunit (Summerton, 1999)' Furthermore' of morpholino based targeting can be completely penetrant up to at least 48 hours cellular development, after which the rate of cell proliferation can surpass the morpholino

concentration (Nasevicius and Ekker, 2000).

Nl

Phosphodiester Morpholino DNA

6.4 on of DNA and morpholino structures ( and Abrams, 2001).

Morpholinos are an efficient means by which to block translation. Out of 17 genes screened

for morpholino effectiveness, 16 were successfully blocked in their expression' thus

producing phenocopies of known mutations in zebrafish embryos (Nasevicius and Ekker,

the 2000; Lele et a1.,2001). For example, embryos microinjected with a morpholino against

the same gene no tail were indistinguishable from embryos that had a null mutation within

possible gene (Nasevicius and Ekker, 2000). However, mistargeting of the morpholino is if CHAPTER 6 -215 two genes are similar enough in sequence in the area of morpholino design. It is also likely that a morpholino will not 100% inhibit transcription of the target mRNA at all concentrations used, which is why morpholino microinjected embryos are referred to as 'knockdown' rather than'knockout'. Therefore, Nasevicius and Ekker (2000) suggested the use of a second non- overlapping morpholino targeted to the one gene or RNA rescue to sort out the 'pure' effects

of the morpholinos in zebrafish embryos compared to those caused by mistargeting.

In our approach three morpholinos were targeted against the arx mRNA leader sequence

(Figure 6.5). Knockdown of the arx protein in development was then characterised by

assessing the effect on the expression of other developmentally important genes at two

different developmental time points. Expression of zebrafish arx mRNA was first detected at

10 hpf in the presumptive diencephalon (Miura et al., 1997). By 24 hour arx mRNA

expression was detected in the telencephalon, diencephalon, floor plate and somites. Zebrafish

embryos microinjected with arx morpholinos were therefore analysed at both 72 and24hpf to

observe immediate and long term effects on the expression of other developmentally

important genes due to the knockdown of the arx protein. Furthermore, the time point of 24

hpf was chosen because l) the basic brain structures of the zebrafìsh are already formed and

2) 24 hpf is well within the time period when morpholinos should be capable of blocking arr

translation.

The genes analysed in arx morpholino microinjected embryos were chosen based upon their

spatial and temporal expression in relation to arx. Table 6.2 shows the time points at which

genes were analysed in arx morpholino microinjected embryos. A brief description of each of

these genes and their normal expression patterns in zebrafrsh is included below. CHAPTER 6 -216

Rl\A Probe 12 hPf 24 hpf Zebrafìsh Embryo Gene Reference emxl (Kawahara and Dawid, 2002) emx3 { (Kawahara and Dawid, 2002) (Morita et a|.,1995) myoD ./ (Weinberg et al.,1996) ^/ shh (Krauss et a\.,1993) dlxla (Ellies et al.,1997) dlx2a ./ (Akimenko et a\.,1994) dlx5a et a\.,1994 ^/

Table 6.2: Developmental stage at which whole mount in situ was performed on zebrafish embryos with variou s in vitro transcribed RNA probes ({: whole mount in situ hybridization performed; -: whole mount in situ hybridization not performed)'

6.1.4.1 emx Genes

The zebrafi sh emx genes contain a homeodomain homologous to the Drosophila empty spiracles (ems)head gap gene (Dalton et a\.,1989). Normal expression of zebrafish emxl was first detecte d aT 14 hpf in the epiphysis which is part of the forebrain (Kawahara and Dawid,

ZO0Z). By 16 hpf emxl expression was detected in the telencephalon and by 25126 hpf emxl was further detected in the olfactory placode and a small group of cells in the diencephalon' In

contrast, emx3 expression begins at 12 hpf in the anterior neuroectoderm, which at this stage

hasjustformedtheneuraltube(Moritaetal.,1995). By24hpf emx3 expressionwasdetected

in the dorsal telencephalon (Morita et al., !995; Kawahara and Dawid, 2002).In the mouse it

was demonstrated that Emxl expression was important for telencephalon development (Qiu e/

a\.,1996; Yoshida et a|.,1997). CHAPTER 6 -217

6.1.4.2 myoD Gene

The myoD gene encodes a myogenic bHLH transcription factor. In zebrafish, normal expression of myoD was first detected at 10 hpf in the posterior half of developing somite

(Weinberg et al., 1996; Miura et al., 1997). By 24 hpf myoD expression occurred in the

middle of each chevron-shaped somite with respect to the anteroposterior axis and more

intensely in ventral regions of the somites with respect to the dorsoventral axis. Expression of

the zebrafish myoD gene in developing somites appears to mark specification of myogenic

precursor cells, from which trunk skeletal muscle later arises (Weinberg et al., 1996).

Knockout of the mouse MyoD gene demonstrates that MyoD plays an important role in

skeletal muscle development and in adult muscle function (Rudnicki et al.,1993; Megeney el

al., 7996; Kablar et al., 1997; Cornelison et al',2000)-

6.1.4.3 shh Gene

Sonic hedgehog (SHIÐ is a veftebrate homolog of the Drosophila hedgehog segment polarity

gene (Nusslein-Volhard and Wieschaus, 1980). Sf/fI is proteolytically cleaved to produce two

proteins that are secreted (N-SHH and C-SHH) (Bumcrot et al., 1995), where N-SHH

mediates signalling in vertebrates and invertebrates (Hammerschmidt et al., 1997). During

embryo development SHH is essential for a number of early patterning processes including:

left-right asymmetry, dorsoventral patterning of the CNS and somites, patterning of the limb

and some involvement in organogenesis (Hammerschmidt et a\.,1997; Marti and Bovolenta,

2002). Expression of the zebrafìsh shh gene occurs in tissues with polarizing activity in

zebrafish embryos (Krauss et al., 1993). Krauss et al. (1993) first detected sfrfr expression at

60% epiboly in the inner cell layer of the embryonic shield (hypoblast). By onset of the CHAPTER 6 -218 segmentation period sftfr expression was detected along the ventral floor of the brain. As segmentation continued sfrfr expression was detected in the floor plate and notochotd. By 24 hpf expression of shh \n the notochord was switched off. Finally, in early zebrafish development shh expression was also detected in the posterior fin mesoderm.

6.1.4.4 d/x Genes

In vertebrates there exist six to eight Dlx genes, which contain homeoboxes most similar to the Drosophila Distal-less (Dll) gene (Stock et al.,1996). The vertebrate Dlx genes are found in three convergently transcribed pairs: Dlxl/Dlx2, Dlx5/Dlx6 and Dlx3/D/xZ (Simeone et al.,

1994a; McGuinness et a\.,1996; Nakamura et a\.,7996; Ellies ¿r al.,1997). Zebraf,rsh have two additional dlx genes, dlx2b and dlx4a, which are not linked to other dlx genes (Stock et a1.,1996; Ellies et al., 1997). Different combinations of Dlx genes regulate the development of the neural plate border (Woda et al., 2003), forebrain differentiation, GABAergic interneuron differentiation and migration and development of craniofacial structures, limbs and retina (de Melo et aL.,2005).

Normal expression of the zebrafish dlxla gene (also known as dlxt) was ftrst detected around

l3 hpf in the ventral forebrain. Forebrain dlxla expression lasted for three days with positive

cells in the presumptive telencephalic and diencephalic bands (Ellies et aL.,1997). Zebrafish

dlxla was also expressed in the pharyngeal arch primordia, presumptive pectoral fin buds and

weakly expressed in the medial fìn fold. Expression of the zebrafish dlx2a (also known as

dtx2) gene closely resembles that of dlxla. Beginning around 12hpf dlx2a was expressed in

cranial neural crest cells, which migrate to the branchial ach primordia (Akimenko et al.,

1994). By l3 hpf cells of the ventral forebrain also began to express dlx2a in the telencephalic CHAPTER 6 -219 and diencephalic bands. Furthermore, dlx2a was also expressed in a subset of pectoral fin bud

cells and median fin fold cells during development. Similar to dlxla and dlx2a, zebrafish

dlx5a (also known as dtx4) was expressed in the forebrain telencephalic and diencephalic

bands beginning around 13 hpf (Akimenko et a1.,1994). However, expression of dlx2a and

dtx5a differ in the telencephalon (Akimenko ¿/ at., 7994). Expression of dlx2a in the

telencephalon is located more medially close to the ventricular surface, whereas dlx5a

expression occurred as bilateral bands more superficially. Zebrafish dlx5awas also expressed

in the branchial and gill arches, otic vesicle and in distinct subsets of cells in the pectoral fin

buds and median fin fold.

As can be concluded by the above mentioned genes, the focus \ryas on genes involved in CNS

development and more specifically in forebrain development. The reason behind this decision

was that the brain structure involved in cognitive function, and thus affected by mutations in

ARX in human patients, arise from the telencephalon (Kandelet a\.,2000). However, shhand

myoD were included as they are ultimately important for the development of other body

structures including skeletal muscle, organs and limbs. Therefore while the genes chosen here

were by no means exhaustive they do provide a starting point for the analysis of ARX

function with respect to regulatory pathways involved in brain and embryo development.

Thus far preliminary results in the zebrafish arx knockdown model indicate that ARX is

important for forebrain development by either directly or indirectly being involved in

transcriptional regulation of the genes emxl, dlx2a and dlx5a. CHAPTER 6 -220

6.2 RESULTS

6.2.1 Generation of a Zebrafish Knockdown Model

Zebrafish genomic DNA was sequenced to obtain the arx 5 prime untranslated region

(5'UTR) and start of the open reading frame (ORF). Two antisense morpholino

oligonucleotides were then designed against the zebrafìsh arx S'I)TR and ORF (Figure 6.5).

Microinjection of arx morpholino 1 (arx-7) at the two to four cell stage had no effect on the

viability of the zebrafish embryo. However, microinjection of arx motpholino 2 (arx-2) was

toxic to the embryos. Therefore, a third arx morpholino (arx-3) was designed against the start

of the zebrafish arx ORF (Figure 6.5). Although microinjection of 1 mM arx-3 into zebrafish

embryos was partially toxic to the zebrafish embryos, microinjection of 0.5 mM arx-3 kept a

sufficient number of embryos viable for experimental purposes. Hence 0.5 mM of all

morpholinos was microinjected in these experiments for comparison purposes. Sibling

zebrafish embryos were microinjected with arx-\, arx-3 or a standard control non-functional

morpholino (5'- ccT cTT ACC TCA GTT ACA ATT TAT A -3'; Gene Tools LLC) and

were exami ned 24 hours later. There were no gross morphological differences between the

uninjected and control morpholino injected embryos compared to the arx morpholino injected

embryos in the formation of the forebrain, floor plate, notochord and somites. CHAPTER 6 -221 c aa tgc aa c a gaa t gg ag ag cggaa gct'actccggatcagtgcata tggcatÈ agc g9c ca999tgggaÈaggcaagagagacgtttcaga Èac cacÈcga (ATG) AGCAG T CAGTACGACGAC GATAGCCGCGATC GGAGCGAATGT A]UU\GCAÀGTCGCCCA CC GTGCTTT CT TCCTACTGCATAGACAGTATAC

f igure 6.5: Location of the designed arx antisense morpholino oligonucleotides in zebrafish arx cDNA. Shown above is partial sequence of the zebrafish arx cDNA with 5'UTR in lowercase and ORF in uppercase. The first methionine codon of the ORF is in brackets. The three arx morpholinos are highlighted in yellow (arx-I), red (arx-2) and blue (arx-3)'

6.2.2 Reduced Expression of emx3 but not shh and myoD in 12 hpf arx Injected

Embryos

The effect of reduced arx protein levels on expression of the developmentally important genes emx3, myoD and, shh was tested on 12 hpf embryos. After microinjection with arx'l ot arx-3 morpholinos, zebrafish embryos were fixed in phosphate buffer solution (PBS) + 4% formaldehy de aT 12 hpf. To serve as internal controls for these experiments sibling embryos

from the same pool of embryos were either microinjected with 0.5 mM of control non-

functional morpholino or remained uninjected. Whole mount in situ hybridization with in

vitro ffanscribed digoxygenin-labeled riboprobes was then performed on approximately 30 -

50 fixed zebrafish embryos per morpholino/uninjected treatment.

Microinjection of arx-l and arx-3 morpholinos resulted in reduced emx3 expression in the

presumptive brain in comparison to uninjected and control morpholino microinjected 12 hpf CHAPTER 6-222 embryos (Figure 6.6 A - D). In contrast, microinjection of arx-L and arx-3 motpholinos had no observable effect on myoD expression in the posterior of each formed somite (Figure 6.6 E

- H) and sfrfr expression in the ventral floor of the brain, floor plate and notochord (Figure 6.6 I - L). These results suggest that arx plays a role in early zebrafish brain development.

6.2.3 Microinjection of arx Morpholinos Results in Reduced dlx2a and dlx5a Forebrain

Expression in 24 hpf Zebrafish Embryos

Expression of a number of developmentally important genes was examined in 24 hpf

zebrafish embryos after microinjection of arx-|, arx-3 or control morpholinos into sibling

embryos. Following microinjection of the arx and control morpholinos, approximately 30 -

50 embryos were fixed at the 24 hpf developmental stage. Fixed embryos microinjected with

the arx morpholinos were then examined for the effect on emxl, emx3, myoD, shh, dlxla,

dlx2a and dlx5a gene transcription in comparison to control morpholino injected embryos and

uninjected embryos. Gene transcription was examined by whole mount in situ hybridization

using tn vitro transcribed digoxygenin-labeled riboprobes.

Expression of emx3 and shh was initially examined in arx microinjected embryos that had

been grown at28.5"C for exactly 24hpf post microinjection before fixation. There was no

observed effect on emx3 expression in the dorsal telencephalon of arx microinjected embryos

in comparison to uninjected and control morpholino microinjected embryos (Figure 6.7 A,E,

I and M). However, expression of shh in arx microinjected embryos was reduced in both the

hypothalamus and diencephalon in comparison to uninjected and control morpholino

microinjected embryos (Figure 6.7 B, F, J and N). CHAPTER 6 -223

Figure 6.6: Microinjection of arx morpholinos resulted in reduced emx3 expression in the presumptive brain of 12 hpf zebrafish embryos, but had no observable effect on myoD and

mM sfrå express ion. Zebraftsh embryos were uninje cted (,4, E, I) or microinjected with 0'5 control (8, F, J), arx-I (C, G, $ or arx-3 (D, H,Z) morpholinos' Embryos were then fixed at presumptive 12 hpf and stained for the indicated genes. Expression of the gene emx3 in the brain (white arrow) was reduced after microinjection of arx morpholinos (C, D)' Expression of myoD (yellow arrow) in the posterior of each formed somite (yellow box) was unaffected by microinjection of arx morpholino s (G, IÐ. s/2fr expression throughout the ventral region

the central nervous system (blue arrow) is also unaffected by microinjection of arx

morpholinos (K ¿). All embryos are shown from the lateral view with dorsal to the top except

E - H which are shown at the dorsal axial view. Anterior is to the left and posterior to the

right in all embryos CHAPTER 6 -224

Interestingly microinjection of The arx morpholinos seemed to delay the development of the

to zebrafish embryos so that they looked to be about 22 hpf instead of 24 hpf in comparison the control morpholino microinjected and uninjected 24hpf embryos (Figure 6'7 I,J, M and

N). Compared to uninjected and control morpholino microinjected embryos, arx

microinjected embryos were smaller in body length (less tail extension) and the embryo head

was not straightened out as far from the embryo. Expression of shh was therefore re-examined

in zebrafish embryos, which after arx morpholino microinjection, were fixed at what was

at observed to be at a developmental stage equivalent to that observed for uninjected embryos

24 hpf gro\^/n at 28.5"C. In arx microinjected embryos that were observed to be at the

developmental stage of 24 hpf, there was no observed effects on shh expression in the

Figure 6.7: Fixation of arx microinjected embryos at exactly 24 hpf or at the developmental

stage equivalent to that observed for uninjected embryos aT 24 hpf, affects interpretation of

the arx zebrafish knockdown model. Zebrafish embryos were uninjected (,4 - D) or

microinjected with 0.5 mM of control (E - IÐ, arx-l (I - L) or arx-3 (M - P) morpholinos'

Afïer arx morpholino microinjection embryos were either fixed at exactly 24 hpf (1, J, M, N

or fixed at the observed 24 hpf developmental stage (K, L, O, P). All control morpholino

microinjected and uninjected embryos were fixed at exactly 24 hpf' Expression of emx3

(white arrow) was unaffected by arx morpholino microinjection (1, luÐ. Expression of shh was

noticeably reduced in the hypothalamus (yellow triangle) and diencephalon (blue triangle)

arx morpholino microinjected embryos fixed at exactly 24 hpf (¿ Ð' Expression of shh was

unaffected in the hypothalamus, diencephalon and floor plate (black arrow) of arx

microinjected embryos fixed at the observed developmental stage of 24 hpf (K' L, O, P)' All

embryos are shown from the lateral view with dorsal at the top and anterior to the left. CHAPTER 6 -225

A c

E G

t\ I K +r

N o

Figure 6.7: See previous page for legend.

hypothalamus, diencephalon (Figure 6.7 C, G, K and O) and floor plate (Figure 6'7 D,H,L

and p). It was therefore decided to continue all whole mount in situ hybridization experiments

on arx microinjected embryos that were observed to be at the developmental stage of 24 hpf

when grown at 28.5"C. This enabling detection of direct effects on individual genes and

discount potentially unrelated arx morpholino effects on gene transcription due to a

developmental delay on the entire embryo. CHAPTER 6 -226

No consistent effect on emxl expression in the telencephalon was observed after

microinjection of arx-l or arx-3 morpholinos in comparison to uninjected and control

morpholino microinjected embryos (Figure 6.8 A, F, K and P). Similar results were observed (with for myoD a¡1d dlxla expression in 24 hpf embryos. Expression of myoD in the middle

respect to the anteroposterior axis) of each chevron-shaped somite was unaffected by

microinjection of arx morpholinos (Figure 6.8 B, G, L and Q)' Microinjection of arx

morpholinos also had no observed effect on dlxla expression in the telencephalic and

diencephalic bands of the forebrain (Figure 6.8 C, H, M and R). However, the telencephalic

and diencephalic bands of both dlx2a and dlx5a expression in the forebrain was noticeably

reduced in response to microinjection of the arx morpholinos (Figure 6'8 N, O, S and T) in

comparison to uninjected and control morpholino injected embryos (Figure 6.8 D, E, I and J).

While these results do not exclude a role for arx in regulating gene expression in the

notochord and somites, they strongly support a role for arx in the development of the

forebrain.

Figure 6.8: Microinjection of arx morpholinos reduces dlx2a and dlx5a forebrain expression

but not emxl, myoD and dlxla expression. Zebrafish embryos were uninjected (A - Ð ot

microinjected with 0,5 mM of control (F - J), arx-l (K - O) or arx-3 (P - T) morpholinos and

were fixed at developmentally observed 24 hpf . Expression of the genes emxl (K, P), myoD of arx (L, e) and dlxla (M, R) (black arrows) were not affected by microinjection

morpholinos. Expression of the genes dlx2a (¡/' Ð and dlx5a (O, T) (yellow arrows) was

reduced in the telencephalon (t) and diencephalon (d) after microinjection of arx morpholinos.

All embryos are showing a lateral view of the rostral brain with dorsal to the top anterior to

the left, fot B, G, L and which show a lateral view of the tail with dorsal to the top CHAPTER 6 -223

,nyoD H. '\iñflñ#fl

myoD

t

**__**.i R

Figure 6.8: See previous page for legend. CHAPTER 6 -228

6.3 DISCUSSION

Homeodomain proteins are a group of structurally and functionally conserved transcription

factors that specify embryo development by regulating target genes in a precise spatial and

temporal matter. Mutations in homeodomain proteins have been discovered to cause a wide

range of developmental disorders (reviewed inZhao and Westphal,2002). Recently mutations

in ARX were found to cause mental retardation, epilepsy and X-linked lissencephaly

(Bienvenu et al., 2002; Kitamura et al., 2002; Stromme et al., 2002). However, it is only

within the last year that the function of ARX in development has begun to be deciphered.

In an effort to determine what genetic regulatory pathways ARX is part of in embryo

development, a zebraftsh knockdown model was generated. A zebrafrsh arx knockdown

model was generated by using antisense morpholino technology to block arx translation.

Morpholinos are DNA analogs that are resistant to nuclease digestion (Corey and Abrams,

2001). Microinjected morpholinos are efficiently delivered to every cell in a developing

embryo, where they bind to and sterically block translation of the target mRNA (Nasevicius

and Ekker, 2000). With regards to the zebrafish arxknockdown model, three non-overlapping

morpholinos were designed to block arxtranslation. Of these morpholinos, arx-2 was found

to be toxic to the zebrafish embryos. Microinjection of the arx morpholinos aø-l and arx-3

had no observed gross morphological effects on zebrafish embryos.

Knockdown of the arx protein on other developmentally important genes was established by

whole mount in situ hybridization. Seven genes were chosen for examination in the arx

knockdown model based upon their spatial and temporal expression pattern in relation to

zebrafish arx (Table 6.1). Furthermore these genes were chosen because they are important CHAPTER 6 -229 for the development of the CNS (especially the forebrain) and skeletal muscle, which are two main areas of zebrafish d/Í expression (Miura et a|.,7997).

Zebrafish cru expression was initially detected at l0 hpf in the presumptive diencephalon, and by 12hpf arx was detected in the telencephalon, diencephalon, floor plate and somites (Miura

et al.,1997). Therefore 12 hpf was chosen as the first developmental stage at which the effect

of reduced arx protein levels on gene expression was analysed. This enabled the examination

of more immediate effects of reduced arx protein levels compared to a later developmental

stage. The second developmental stage chosen for analysis was that of 24 hpf' By 24 hpf

zebrafish arx expression was detected in a band-like shape in the telencephalon and

diencephalon (which extended to the ventral thalamus) and also continued to be expressed in

the floor plate and somites (Miura et al., 1997). Hence, 24 hpf arx morpholino injected

embryos were analysed for more long term effects of reduced arx protein levels. Furthermore,

24 hpf embryos were also chosen because the most basic brain structures of the zebrafish

have already formed, and it is within the most affective period for morpholino action

(Nasevicius and Ekker, 2000).

Of the genes analysed after microinjection of the arx morpholinos, there \¡r'as no observed

effect on both myoD and shh expression at the 12 hpf and 24 hpf developmental stages

(Figure 6.6 and 6.8). Expression of myoD specifies myogenic precursor cells in zebraftsh

embryos (Weinberg et al., 1996) and is important for skeletal muscle development and

function (Rudnicki et al., 1993; Megeney eî al.,1996;Kablar et a1.,7997; Cornelison et al',

2000). Even though microinjection of arx morpholinos had no effect on somite formation

(Figure 6.8), this does not mean that arx plays no role in the development of skeletal muscle

which arises from cells within the somite. It is possibletha|arx regulates expression of other CHAPTER 6 -230 proteins important for skeletal muscle development such as myf5. Analysis of mouse MyoD

and Myf5 genes has shown that Myf5 regulates the timing of MyoD expression, and can

compensate for MyoD absence in skeletal muscle development (Rudnicki et al., 1992i'

Tajbakhsh et al., lg97). Thus further analysis of genes important for skeletal muscle

development, such as myf5, would need to occur in the zebrafish arx knockdown model

before any conclusions can be made about the role of arx in zebrafish skeletal muscle

development.

As stated previously, sfrå expression is essential for various patterning processes within early

embryo development, including development of the CNS and somites (Hammerschmidt et al',

1997;Marti and Bovolenta,2002). Microinjection of arx morpholinos did not appear to effect

expression of shh in the brain and floor plate (Figures 6.6 and 6.7) thus suggesting thatarx

does not regulate sftfr expression. Interestingly while examining shh expression in24 hpf arx

microinjected embryos it was noticed that the arx microinjected embryos did not appear to be

as developmentally advanced as uninjected and control morpholino microinjected embryos

(Figure 6.7). Aplausible explanation forthis delay in development is that knockdown of the

arx protein caused a brief delay in development, which becomes more obvious by 24 hpf.

Alternatively, it is possible that microinjection of some morpholinos non-specifically cause a

delay in embryo development as microinjection of morpholinos targeted against genes

unrelated to arx in zebrafish embryos have been observed to cause a similar slight delay in

development (Simon 'Wells and Ben Tucker, University of Adelaide personal

communication).

In an attempt to compensate for any indirect effects on gene expression due to the delay in

development, the effect on gene expression by microinjection of arx morpholinos rwas CHAPTER 6 -231 analysed on zebrafish embryos that were observed to be at a developmental stage equivalent to that observed for uninjected embryos grown at28.5"C for 24 hpf. The exception to this was

24 hpf embryos examined for changes in emx3 expression (Figure 6.7), as there was not time to repeat the analysis of this gene. However, since there was no effect on emx3 expression in

24 hpf embryos that were delayed developmentally, it is possible that2 hours would not have made a major difference. Significantly at12 hpf, expression of emx3 was slightly reduced in the presumptive forebrain (Figure 6.6). The effect on emx3 expression due to the knockdown of the arx protein was transitory since it was not affected in 24 hpf embryos, and therefore may have been compensated by other genes as development proceeded. As no specific function in telencephalon development has been assigned to emx3 yet, it is unknown what effect the transitory reduction in emx3 expression would have on dorsal telencephalon development.

Expression of emxl was also analysed in arx microinjected 24 hpf embryos (Figure 6.8).

Though emxl expression was not affected in 24 hpf embryos microinjected with arx morpholinos, emxl expression in all embryos appeared to be lower than that seen by

Kawahara and Dawid (2002). The reason for this was that less in vitro transcribed digoxygenin-labeled emxl riboprobe happened to be used for whole-mount in silu hybridization analysis on this occasion. In the mouse Emxl is expressed in the medial, dorsal, and lateral telencephalon (subpallium) (Gorski et al., 2002). Since emxl expression is not affected by microinjection of arx, this therefore suggests that arx does not play a role in the development of cells arising from the emxl lineage (radial glia, Cajal-Retzius cells,

excitatory-glutamatergic-projection neurons, astrocytes and oligodendrocytes) (Gorski et al.,

2002). CHAPTER 6.232

Finally expression of the three dlx genes dlxla, dlx2a and dlx5a was analysed in arx microinjected24hpfembryos (Figure 6.8). While expression of dlxla in the forebrain of 24 hpf embryos was unaffected by microinjection of arx morpholinos, forebrain expression of dlx2a and dlx5a was clearly reduced. Among other functtons, Dlxl, Dlx2 and Dlx5 gene expression is necessary for migration and differentiation of y-aminobutyric acid (GABA)ergic

interneurons from the ventral telencephalon (lateral and medial ganglionic eminences) to the

neocofiex, hippocampal CA fields and olfactory bulb (Anderson et al., 1997a; Anderson ef

al., 1997b; Pleasure et a\.,2000; Long et a\.,2003). GABAergic interneuron migration and

differentiation is also regulated by Dlxl and Dlx2 genes in the ventral thalamus (Andrews e/

aL.,2003).

Several lines of evidence support a role for arx regulating expressi on of dlx genes in zebrafish

forebrain GABAergic interneurons. Firstly, in mice Arx is expressed in GABAergic

interneurons in regions of the developing forebrain which overlap DIx2 andDlx5 expression

domains (Colombo et a\.,2004; Poirier et a\.,2004). Secondly, in Arx-deftcient mice, various

structures arising from the telencephalon and diencephalon were observed to be small or

absent and the mice had smaller brains and olfactory bulbs (Kitamura et al., 2002). The

smaller brain and olfactory bulb in Arx deficient mice was found to be caused by aberrant

migration and differentiation of GABAergic interneurons. Fufthermore, the phenotypes

observed in the Arx deficient mice was reminiscent of the phenotypes observed\n Dlxl/2 -l-

as well as Dlx5 -/- mice (Anderson et al., 1997b; Kitamura et a1.,2002;Long et a1.,2003).

Interestingly, Dlxl/2 -l- mice showed reduced,4rx expression, and ectopic expression of Dlx

genes v/as also shown to induce ,4rx expression (Cobos et a1.,2005). Similarly in Xenopus

overexpression of arx was able to induce ectopic expression of dlx5 (Seufert et aL.,2005).

This suggests that there may be co-regulation of transcription occuring between Arx, Dlx2 CHAPTER 6 -233

in forebrain and Dlx5 genes. The evidence also suggests that ARX plays a very important role development and especially in GABAergic interneuron development and migration'

However, there is an apparent discrepancy in the effects of ,4RX deficiency between zebrafish

and mice. ln arx microinject ed 24 hpf zebrafish embryos expression of dlx2a and dlx5a but

not dlxla was clearly reduced in the telencephalon and diencephalon. Yet \n Arx-deficient

the mice, there \Mas no reduction of Dlx2 and Dlx5 expression in interneurons migrating from

ganglionic eminences to the olfactory bulb (Yoshiharc et at.,2005). Taking in consideration

that there are four major classes of interneurons (Kawaguchi et al.,1995:' Figueredo-Cardenas

et al.,1996), it is possible that arx is directly or indirectly involved in regulating dlx2a and arx dlx5a expression only in certain GABAergic interneuron subtypes. Alternatively fhe role

plays in regulating dix expression may be compensated for by other transcription factors in

certain GABAergic interneuron subtypes. A closer examination of the functions of D/x genes

in forebrain development may provide a potential explanation for this apparent discrepancy

between mice and zebrafìsh.

Dtxt -l-mutant mice had no observed forebrain abnormalities (Qiu et a\.,1997) and although

there were no abnormalities in forebrain structures, Dtx2 -l- mice had reduced levels of

tyrosine hydroxylase expressing GABAergic interneurons in the olfactory bulb (Qiu et al',

1995). Ho¡ever, Dtxl/2 -/- mice showed a severe reduction in GABAergic interneuron

differentiation and migration from the ganglionic eminences to the neocortex, olfactory bulb

and hippocampus, implying that the functions of Dlxl and Dlx2 are largely redundant in

forebrain development (Anderson et al., 1997a; Anderson et al., 1997b; Marin et al''2000;

pleasure et al., 2000). Furtherm ore, DlxI and Dlx2 either directly or indirectly tegulate Dlx5

expression which is expressed in the same neuronal cells of the forebrain (Anderson et al', CHAPTER 6 -234

¡997b;Eisenstat et al., 1999). Lastly expression of DIxS is required, among other functions, for the differentiation but not migration of GABAergic interneurons into the olfactory bulb

(Long et a1.,2003). Therefore taken together, the evidence suggests that in Arx-deftcient mice, the reason why there was no reduced expression of Dtx2 and Dlx5 was: 1) the actions of

Arx is compensated for, or Arx regtilates Dlx2 and Dlx5 genes in only certain GABAergic

interneuron subtypes 2) redundancy between DlxI and Dlx2 enabled the majority of neural

precursor cells to migrate to the olfactory bulb; and 3) Dlx5 is not necessary for neural

precursor cell migration to the olfactory bulb. As such it likely that arx ditectly or indirectly

regulates expression of dlx2a and dlx5a in zebrafish forebrain development' The regulation of

Dlx2 and Dlx5 by Arx in only certain GABAergic interneuron subtypes may also account for

the reason why there was not a total absence of dlx2a and dlx5a forebrain expression in

zebrafi sh arx morphol ino m icro inj ected embryo s.

Another explanation for the differences seen between zebrafish and mouse models may be

accounted for by the methods used to create deficiencies in Arx expression. The Arx deficient

mice used by Yoshihara et al. (2005) was the same that was used by Kitamura et al. (2002),

where a STOP-IRES-LacZ-Neomycin resistance cassette was inserted downstream of the

second exon of the Arx gene. Conversely , the zebrafish arx knockdown model was created by

microinjection of arx morpholinos. In the zebrafish arx knockdown model, reduced

expression of the arx protein has not been confirmed as an antibody that recognises zebrafish

arx protein was not available at the time. Nor had arx mRNA rescue on arx morpholino

microinjected embryos been performed due to the difficulty of cloning arx and time

limitations. Moreover, even when knockdown of the arx protein is confirmed, this does not

guarantee that other developmentally important genes are free from non-specific binding and

thus blocking of translation by the arx morpholinos. To resolve the issue of whether or not CHAPTER 6 -235 arx reg¡lates d/x forebrain expression in zebrafish embryos a zebrafish ar¡ knockout model should be created, and expression of arx should be analysed within a zebrafish d/x knockout model.

Significantly, loss of imprinting of maternally transcr\bed DLX5 in human lymphoblastoid

cells was observed in Rett syndrome patients with certain MECP2 mutations (Horike et al.,

2005). As noted in Chapter 1 (sections 1.2.1.3 and 1.3.4.1) not only can mutations in MECP2

and CDKL5 cause Rett syndrome (Amir et al., 1999; Scala et a1.,2005) and mutations in

CDKL; and ARX can cause X-linked West syndrome (Stromme et a1.,2002; Kalscheuer ¿/

al., 2003b), but MECP2 is phosphorylated by CDKL5 (Mari et al., 2005)' Hence, this

supports the possibility of ARX, MECP2, CDKL5 and now DLX5 acting in common or

associated molecular pathwaYs.

6.4 SUMMARY

To investigate the role of ARX in developm ent a zebraftsh arx knockdown model was created.

Translation of the zebrafish arx protein was blocked by microinjection of arx morpholinos

into zebrafish embryos. Embryos microinjected with arx morpholinos were then analysed for

the expression of developmentally important genes to place the arx gene in regulatory

pathways important for brain and embryo development. Analysis of zebrafish embryos at two

different developmental stages showed that expression of myoD, emxl, shh and dlxlawerc

unaffected by knockdown of the arx protein. This therefore suggests that arx does not

regulate expression of these genes or is acting downstream of these genes in controlling

embryo development. CHAPTER 6 -236

Expression of emxl was initially reduced by knockdown of the arx protein, but was

unaffected later during development. Furthermore, expression of the dlx2a and dlx5a genes

was visibly reduced in response to microinjection of arx morpholinos. Therefore) arx may

directly or indirectly regulate dlx2a and dlx5a expression and the initial stages of emx3

expression in the forebrain. The zebrafish knockdown model thus far suggests that arx plays a

very important role in forebrain development, and in particular differentiation and migration

of GABAergic interneurons. These results coincide with the knowledge that mutations in ARX

cause mental retardation, epilepsy and XLAG, and that the absence of Arx in mice results in

abnormal GABAergic interneuron migration. It would therefore be very interesting if

migration of GABAergic interneurons \ryas also affected in the zebrafish arr knockdown

model. It would also be interesting to analyse the expression of other developmentally

important genes in the zebrafish arx knockdown model to elucidate the role of arx in floor

plate and skeletal muscle development. Moreover, the zebrafish arx knockdown model

indicates an association between ARX, MECP2, CDKLS and now DLXï as acting in common

or linked molecular pathways due to the phenotypic overlap that occurs in patients with

mutations in ARX, MECP2 or CDKLS. However, knockdown of the arx protein must be

confirmed and a zebrafish a¡z knockout model must be created to discount potential non-

specific effects due to the arx morpholinos. CHAPTER 7

Conclusions CHAPTER 7 -238

Since the commencement of this study in February 2002 major advances in the knowledge of the novel Paired-type homeobox gene ARX has occurred. The discovery that mutations in

ARX causes S-XLMR (X-linked West syndrome, myoclonic epilepsy with general\zed

spasticity and intellectual disability (XMESID) and Partington syndrome) and NS-XLMR was

published in2002 (Bienvenu et a1.,2002; Stromme et a1.,2002). During the last few years

mutations in ARX have also been found to cause X-linked lissencephaly with abnormal

genitalia (XLAG) and related phenotypes (hydranencephaly with ambiguous genitalia, Proud

syndrome and XLAG with cerebellar hypoplasia, hydranencephaly or renal phosphate

wasting) (Kitamura et a1.,2002;Uyanik et a1.,2003 Hahnet a1.,2004; Hartmann et a1.,2004;

Kato et at.,2004). Furthermore, the role of ARX in development has begun to be elucidated-

Studies have shown that ARX is important for the proliferation, differentiation and migration

of GABAergic interneurons in the forebrain and olfactory bulb and plays a role in the

differentiation of the testes (Kitamura et al., 2002; Colombo et al., 2004; Yoshihara et al.,

2005). Expression of ARXhas also been found to be essential for differentiation of endocrine

pancreatic c-precursor cells (Collombat et a1.,2003) and for maintaining the functional and

structural integrity of amphid sensory organs during larval development (Tucker et a|.,2005)'

The aim of this study was to improve understanding of the normal molecular actions of ARX.

A summary of the main contributions and significance of the work generated as part of this

thesis are listed below.

l. Characterized and novel ARX orthologs were identified and analysed from different

species. The homeodomain and aristaless domain were found to be highly conserved

between vertebrate and invertebrate ARX orthologs. However, the octapeptide CHAPTER 7 -239

domain, exon 2 NLS, fourth polyalanine tract and to a lesser extent the acidic domain

are only highly conserved in vertebrates.

2. Ptat Arx sequence from the databases showed that the deposited sequences were

missing part of exon 2 which encoded two polyalanine tracts at a similar position to

the fìrst two polyalanine tracts of human lRX. Sequencing of ra'. Arx genomic DNA

subsequently showed that rct Arx does encode two polyalanine repeats within exon 2.

Analysis also showed that the first three polyalanine tracts of human ARX arc only

conserved in mammals.

3. Identification of Importin 13 (IPO13) as interacting with the ARX homeodomain, the

proteins Pyruvate Kinase M2 (PKM2) and Protein that Interacts with C Kinase

(PICKI) interacting with the ARX aristaless domain and ataxin-1-interacting

ubiquitin-like protein (AlUp) as interacting with the first two polyalanine repeats in

ARX by yeast two-hybrid screening.

4. The interaction between the entire ARX protein and IPO13 and PICK1 was confirmed

by coimmunoprecipitation and colocalization,

5. Immunofluorescence experiments revealed that ARX formed nuclear and cytoplasmic

aggregates and that expansion of the first polyalanine repeat from 16 to 23 alanines, as

seen in human patients, markedly increased the number of cells containing

cytoplasmic aggregates. Both IPO13 and PICK1 were found to colocalize with these

aggregates, suggesting that nuclear import and potentially phosphorylation of ARX

may be hindered due to expansion of the fìrst polyalanine tract. CHAPTER 7 -240

6. A zebrafish a¡a knockdown model was generated using two anti-sense morpholino

oligonucleotides to specifically interfere with the translation of the arx protein-

preliminary studies at the mRNA level showed reduced forebrain expression of emx3

at 12hpfand reduced forebrain expression of dlx2a and dlx5a at24hpf in response to

microinjection of the arx morpholinos. This suggests that arx acts directly or indirectly

upstream in the regulatory pathway of these genes and plays an important role in

forebrain and in particular GABAergic interneuron development.

In summary mutations in ARX have been found in a number of XLMR families with various associated phenotypes. The research presented within this thesis contributes to the understanding of the affects mutations in highly conserved residues and domains of ARX may have on its role as a transcription factor. At least two proteins (IPO13 and PICKI) have been confirmed in vitro as interacting with ARX. It is now possible to determine how specific mutations within ARX will affect these protein interactions and what the consequences would be towards ARX function. Furthermore, a zebrafish knockdown model has been generated, where the affects on the transcription of other developmentally important genes, in particular dlx2a and dlx5a, are consistent with the role of ARX in GABAergic interneuron development as demonstrated in other animal models (mouse and Xenopus). Hence, research presented within this thesis improves understanding of ARX and the molecular pathways in brain development in which ARX is involved. References REFERENCES -242

AAMR. 2002. Mental Retardation: Definition, Classification, and Systems of Supports, lOth ed. Washington DC: American Association on Mental Retardation. Acosta R, Montanez C, Fuentes-Mera L, Gonzalez E, Gomez P, Quintero-Mora L, Mornet D, Alvarez-Salas LM, Cisneros B. 2004. Dystrophin DpTl is required for neurite

outgrowth in P Cl2 cells. Experimental Cell Resear ch 29 6 :265 -27 5 . Adams PD, Ohh M. 2001. Identification of Associated Proteins by Coimmunoprecipitation. In: Sambrook J, Russell DW, Editors. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press. p 18.60-18.68. Akimenko MA, Ekker M, Wegner J, Lin W, Westerfìeld M. 1994. Combinatorial expression of three zebrafish genes related to distal-less: parl of a homeobox gene code for the

head. J Neurosci 14:3475-3486. Albrecht A, Mundlos S. 2005. The other trinucleotide repeat: polyalanine expansion disorders. Curr Opin Genet Dev 75:285-293. Albrecht AN, Kornak U, Boddrich A, Suring K, Robinson PN, Stiege AC,Lutz R, Stricker S, Wanker EE, Mundlos S. 2004. A molecular pathogenesis for transcription factor

associated poly-alanine tract expansions. Hum Mol Genet 73:2351-2359. Allen JB, Walberg MW, Edwards MC, Elledge SJ. 1995. Finding prospective partners in the library: the two-hybrid system and phage display find a match. Trends Biochem Sci

20:5 I 1-516. Allen KM, Gleeson JG, Bagrodia S, Partington MW, MacMillan JC, Cerione RA, Mulley JC, Walsh CA. 1998. PAK3 mutation in nonsyndromic X-linked mental retardation. Nat

Genet 20:25-30. Amendt BA, Sutherland LB, Russo AF. 1999. Multifunctional role of the Pitx2 homeodomain protein c-terminaltail. Mol cell Biol 19:7001-7010. American Psychiatric Association.1994. American Psychiatric Association, Diagnostic and Statistical Manual of Mental Disorders, 4th ed. Washington DC. Amiel J, Laudier B, Attie-Bitach T, Trang H, de Pontual L, Gener B, Trochet D, Etchevers H, Ray P, Simonneau M, Vekemans M, Munnich A, Gaultier C, Lyonnet S. 2003. Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome. Nat Genet 33:459-461. Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. 1999. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding

protein 2. Nat Genet 23:185-188. REFERENCES -243

Anderson SA, Eisenstat DD, Shi L, Rubenstein JL.lgg7a.Interneuron migration from basal forebrain to neocortex: dependence on Dlx genes. Science 278:474-476. Anderson SA, Qiu M, Bulfone A, Eisenstat DD, Meneses J, Pedersen R, Rubenstein JL. 1gg7b. Mutations of the homeobox genes Dlx-l and Dlx-2 disrupt the striatal subventricular zone and differentiation of late born striatal neurons. Neuron 79:27-37. Andrews GL, Yun K, Rubenstein JL, Mastick GS. 2003. Dlx transcription factors regulate differentiation of dopaminergic neurons of the ventral thalamus. Mol Cell Neurosci 23:107-120. Ashizawa K, Cheng SY. 1992. Regulation of thyroid hormone receptor-mediated transcription by a cytosol protein. Proc Natl Acad Sci U S A 89:9277-9281. Ashizawa K, Willingham MC, Liang CM, Cheng SY. 1991.In vivo regulation of monomer- tetramer conversion of pyruvate kinase subtype M2 by glucose is mediated via

fructose 1,6-bisphosphate. J Biol Chem 266:16842-16846. Attree O, Olivos IM, Okabe I, Bailey LC, Nelson DL, Lewis RA, Mclnnes RR, Nussbaum p1L. 1992. The Lowe's oculocerebrorenal syndrome gene encodes a protein highly

homologous to inos ito I polyphosphate-5 -phosphatase. Nature 3 5 8:239 -242.

Bagrodia S, Taylor SJ, Jordon KA, Van Aelst L, Cerione RA. 1998. A novel regulator of pZl-

activated kinases. J Biol Chem 273:23633-23636- Bahi N, Friocourt G, Carrie A, Graham ME, Weiss JL, Chafey P, Fauchereau F' Burgoyne RD, Chelly J.2003.IL1 receptor accessory protein like, a protein involved in X-linked mental retardation, interacts with Neuronal Calcium Sensor-1 and regulates exocytosis. Hum Mol Genet 12:1415-1425. Bally-Cuif L, Hammerschmidt M. 2003. Induction and patterning of neuronal development,

and its connection to cell cycle control. curr opin Neurobiol l3:16-25. Banerjee-Basu S, Baxevanis 4D.2001. Molecular evolution of the homeodomain family of transcription factors. Nucleic Acids Res 29:3258-3269. Baron A, Deval E, Salinas M, Lingueglia E, Voilley N, Lazdunski M. 2002. Protein kinase C stimulates the acid-sensing ion channel ASIC2a via the PDZ domain-containing

protein PICK1. J Biol Chem 277:50463-50468. Becker MA, Smith PR, Taylor W, Mustafi R, Switzer RL. 1995. The genetic and functional basis ofpurine nucleotide feedback-resistant phosphoribosylpyrophosphate synthetase superactivity. J Clin Invest 96:2133-2141. Berciano MT, Villagra NT, Ojeda JL, Navascues J, Gomes A,Lafarga M, Carmo-Fonseca M' 2004. Oculopharyngeal muscular dystrophy-like nuclear inclusions are present in REFERENCES -244

normal magnocellular neurosecretory neurons of the hypothalamus. Hum Mol Genet 13:829-838. Berger W, Meindl A, van de Pol TJR, Crqmers FPM, Ropers HH' Doerner C, Monaco A, Bergen AAB, Lebo R, Warburg M, zergollern L, Lorenz B, Gal A, Bleeker- Wagemakers EM, Meitinger T. 1992.Isolation of a candidate gene for Norrie disease by positional cloning. Nat Genet l:199-203 Berry-Kravis E, Israel J. 1994. X-linked pachygyria and agenesis of the corpus callosum: evidence for an X chromosome lissencephaly locus. Ann Neurol36:229-233. Berube NG, Mangelsdorf M, Jagla M, Vanderluit J, Garrick D, Gibbons RJ, Higgs DR, Slack RS, Picketts DJ. 2005. The chromatin-remodeling protein ATRX is critical for neuronal survival during corticogenesis. J. clin. Invest. 115:258-267. Berube NG, Smeenk CA, Picketts DJ. 2000. Cell cycle-dependent phosphorylation of the ATRX protein correlates with changes in nuclear matrix and chromatin association. Hum Mol Genet 9:539-547. Bhat SS, Rogers RC, Holden KR, Srivastava AK. 2005. A novel in-frame deletion in ARX is associated with lissencephaly with absent corpus callosum and hypoplastic genitalia. American Journal of Medical Genetics Part A 138A:70-72- Bienvenu T, Poirier K, Friocourt G, Bahi N, Beaumont D, Fauchereau F, Ben Jeema L, Zemni R, Vinet MC, Francis F, couvert P, Gomot M, Moraine c, van Bokhoven H, Kalscheuer v, Frints S, Gecz J, Ohzaki K, chaabouni H, Fryns JP, Desportes v, Beldjord C, Chelly J.2002. ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation. Hum Mol Genet

11:981-991. Billuart P, Bienvenu T, Ronce N, des Portes V, Vinet ly'rC, Zemni R, Roest Crollius H, Carie A, Fauchereau F, chery M, Briault s, Hamel B, Fryns JP, Beldjord c, Kahn A, Moraine C, Chelly J. 1998. Oligophrenin-l encodes a rhoGAP protein involved in X-

linked mental retardation. Nature 392:923 -926 - Blondelle SE, Forood B, Houghten RA, Perez-PayaE. 1997. Polyalanine-based peptides as models for selÊassociated beta-pleated-sheet complexes. Biochemistry 36:8393-8400. Bogerd HP, Benson RE, Truant R, Herold A, Phingbodhipakkiya M, Cullen BR- 1999. Definition of a consensus transportin-specific nucleocytoplasmic transport signal. J

Biol Chem 27 4:977 l-9777 . Bonneau D, Toutain A, Laquerriere A, Marret S, Saugier-Veber P, Barthez MA, Radi S, Biran-Mucignat V, Rodriguez D, Gelot A.2002. X-linked lissencephaly with absent REFERENCES - 245

corpus callosum and ambiguous genitalia (XLAG): clinical, magnetic resonance

imaging, and neuropathological fìndings. Ann Neurol 5l:340-349. Boudin H, Craig AM. 2001. Molecular determinants for PICKI synaptic aggregation and mGluRTa receptor coclustering: role of the PDZ, coiled-coil, and acidic domains. J

Biol Chem 27 6:3027 0-3027 6. Boudin H, Doan A, Xia J, Shigemoto R, Huganir RL, Worley P, Craig AM. 2000. Presynaptic clustering of mGluRTa requires the PICK1 PDZ domain binding site. Neuron 28:485-

497. Brais B, Bouchard JP, Xie YG, Rochefort DL, Chretien N, Tome FM, Lafreniere RG' Rommens JM, Uyama E, Nohira o, Blumen S, Korczyn AD, Heutink P, Mathieu J,

Duranceau A, Codere F, Fardeau M, Rouleau GA. 1998. Short GCG expansions in the

PABP2 gene cause oculopharyngeal muscular dystrophy. Nat Genet 18l.164-167. Brouwer A, ten Berge D, Wiegerinck R, Meijlink F. 2003. The OAR/aristaless domain of the homeodomain protein Cartl has an attenuating role in vivo. Mech Dev 120:241-252. Brown G, Otero L, LeGris M, Brown R. 1994. Pyruvate dehydrogenase deficiency. J Med

Genet 3l:875-879. Brown L, Paraso M, Arkell R, Brown S. 2005. In vitro analysis of partial loss-of-function ZIC2 mutations in holoprosencephaly: alanine tract expansion modulates DNA binding and transactivation. Hum Mol Genet l4:4ll-420- Brown LY, Brown SA. 2004. Alanine tracts: the expanding story of human illness and trinucleotide repeats. Trends Genet 20:5 1-58. Brown LY, Odent S, David V, Blayau M, Dubourg C, Apacik C, Delgado MA, Hall BD, Reynolds JF, Sommer A, Wieczorek D, Brown SA, Muenke M. 2001. Holoprosencephaly due to mutations in ZIC2: alanine tract expansion mutations may

be caused by parental somatic recombination. Hum Mol Genet 10:791-796. Brown SA, Warburton D, Brown LY, Yu CY, Roeder ER, Stengel-Rutkowski S, Hennekam RC, Muenke M. 1998. Holoprosencephaly due to mutations inZIC2, a homologue of Drosophila odd-paired. Nat Genet 20:180-183. Bruckner AL. 2004.Incontinentia pigmenti: a window to the role of NF-kappaB function.

Semin Cutan Med Surg 23:116-124. Brunner HG, Nelen M, Breakefield XO, Ropers HH, van Oost BA. 1993. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A.

Science 262:578-580. REFERENCES -246

Bruyere H, Lewis S, Wood S, Macleod PJ, Langlois S. 1999. Confirmation of linkage in X- linked infantile spasms (West syndrome) and refinement of the disease locus to

Xp2 1.3-Xp22.1. Clin Genet 55 : I 73-1 8 1. Brymora A, Cousin MA, Roufogalis BD, Robinson PJ. 2001. Enhanced protein recovery and reproducibility from pull-down assays and immunoprecipitations using spin columns.

Anal Bioch em 29 5:l 19-122. Bumcrot DA, Takada R, McMahon AP. 1995. Proteolytic processing yields two secreted

forms of sonic hedgehog. Mol Cell Biol 75:2294-2303 ' Burdon KP, McKay JD, Sale MM, Russell-Eggitt IM, Mackey DA, Wirth MG, Elder JE, Nicoll A, Clarke MP, FitzGerald LM, Stankovich JM, Shaw MA, Sharma S, Gajovic S, Gruss P, Ross S, Thomas P, Voss AK, Thomas T, Gecz J, Craig JE. 2003. Mutations in a novel gene, NHS, cause the pleiotropic effects of Nance-Horan syndrome, including severe congenital cataracl, dental anomalies, and mental

retardation. Am J Hum Genet 73:1120-1130. Caballero IM, Hendrich B. 2005. MeCP2 in neurons: closing in on the causes of Rett syndrome. Hum Mol Genet 14 Spec No 1:Rl9-26. Caburet S, Demarez A, Moumne L, Fellous M, De Baere E, Veitia RA. 2004. A recurrent polyalanine expansion in the transcription factor FOXL2 induces extensive nuclear

and cytoplasmic protein aggregation. J Med Genet 4l:932-936' Calado A, Tome FM, Brais B, Rouleau GA, Kuhn U, Wahle E, Carmo-Fonseca M. 2000. Nuclear inclusions in oculopharyngeal muscular dystrophy consist of poly(A) binding

protein 2 aggregates which sequester poly(A) RNA. Hum Mol Genet 9:2321-2328. Calof AL. 1995. Intrinsic and extrinsic factors regulating vertebrate neurogenesis. Cun Opin Neurobiol 5:19-27. Carrie A, Jun L, Bienvenu T, Vinet MC, McDonell N, Couvert P, Zernni R, Cardona A, Van Buggenhout G, Frints S, Hamel B, Moraine C, Ropers HH, Strom T, Howell GR, V/hittaker A, Ross MT, Kahn A, Fryns JP, Beldjord C, Marynen P, Chelly J.1999. A new member of the IL-l receptor family highly expressed in hippocampus and involved in X-linked mental retardation. Nat Genet 23:25-31. Cason AL, Ikeguchi Y, Skinner C, Wood TC, Holden KR, Lubs HA, Martinez F, Simensen RJ, Stevenson RE, Pegg AE, Schwartz CE. 2003. X-linked spermine synthase gene (SMS) defect: the first polyamine deficiency syndrome. Eur J Hum Genet ll:937-944.

Chelly J, Mandel JL.2001. Monogenic causes of X-linked mental retardation. Nat Rev Genet 2:669-680, REFERENCES -247

Chelly J, Tumer Z, Tonnesen T, Petterson A, Ishikawa-Brush Y, Tommerup N, Horn N,

Monaco AP. 1993. Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nat Genet 3:14-19. Chen S, Kimelman D.2000. The role of the yolk syncytial layer in germ layer patteming in

zebrafi sh. Development 127 :4681 -4689.

Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, Jaenisch R, Greenberg ME. 2003. Derepression of BDNF Transcription Involves Calcium-Dependent

Phosphorylation of MeCP2. Science 3 02 :8 85 -8 89. Chih B, Afridi SK, Clark L, Scheiffele P. 2004. Disorder-associated mutations lead to functional inactivation of neuroligins. Hum. Mol. Genet. 13 1471-1477.

Chook YM, Blobel G. 2001. Karyopherins and nuclear import. Cur Opin Struct Biol 1 l:703- 7t5.

Claes S, Devriendt K, Lagae L, Ceulemans B, Dom L, Casaer P, Raeymaekers P, Cassiman

JJ, Fryns JP. 1997. The X-linked infantile spasms syndrome (MIM 308350) maps to Xpl1.4-Xpter in two pedigrees. Ann Neurol 42:360-364.

Cobos I, Broccoli V, Rubenstein JL.2005. The vertebrate ortholog of Aristaless is regulated

by Dlx genes in the developing forebrain. J Comp Neurol 483:292-303.

Collombat P, Hecksher-Sorensen J, Broccoli V, Krull J, Ponte I, Mundiger T, Smith J, Gruss

P, Serup P, Mansouri A. 2005. The simultaneous loss of Arx and Pax4 genes promotes a somatostatin-producing cell fate specification at the expense of the {alpha}- and {beta}-cell lineages in the mouse endocrine pancreas. Development 132:.2969-2980. Collombat P, Mansouri A, Hecksher-Sorensen J, Serup P, Krull J, Gradwohl G, Gruss P.

2003. Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes Dev 17:2591-2603.

Colombo E, Galli R, Cossu G, Gecz J, Broccoli V . 2004. Mouse orthologue of ARX, a gene mutated in several X-linked forms of mental retardation and epilepsy, is a marker of adult neural stem cells and forebrain GABAergic neurons. Dev Dyn 231:631-639.

Comery TA, Harris JB, Willems PJ, Oostra BA, Irwin SA, Weiler IJ, Greenough WT. 1997. Abnormal dendritic spines in fragile X knockout mice: maturation and pruning

deficits. Proc Natl Acad Sci U S A 94:5401-5404. Corey DR, Abrams JM.2001. Morpholino antisense oligonucleotides: tools for investigating vertebrate development. Genome Biol 2:REVIEWSl0l5. Cornelison DD, Olwin BB, Rudnicki MA, Wold 8J.2000. MyoD(-/-) satellite cells in single- fiber culture are differentiation defective and MRF4 deficient. Dev Biol 224:122-137. REFERENCES - 248

Cowan LD, Hudson LS. 1991. The epidemiology and natural history of infantile spasms. J

Child Neurol 6:3 55-364. Crawford DC, Acuna JM, Sherman SL.2001. FMRI and the fragile X syndrome: human genome epidemiology review. Genet Med 3:359-371.

Cremers FP, Pfeiffer RA, van de Pol TJ, Hofker MH, Kruse TA, 'Wieringa B, Ropers HH. 1987. An interstitial duplication of the X chromosome in a male allows physical fine mapping of probes from the Xql3-q22 region. Hum Genet 77:23-27. Crisponi L, Deiana M, Loi A, Chiappe F, Uda M, Amati P, Bisceglia L, Zelante L, Nagaraja R, Porcu S, Ristaldi MS, Marzella R, Rocchi M, Nicolino M, Lienhardt-Roussie A, Nivelon A, Verloes A, Schlessinger D, GaspariniP, Bonneau D, Cao A, Pilia G. 2001. The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. Nat Genet 27:159-166.

Crow YJ, Tolmie JL. 1998. Recurrence risks in mental retardation. J Med Genet 35:177-182.

Cuervo A, Dice J. 2000. Unique properties of lamp2a compared to other lamp2 isoforms. J Cell Sci 113:4441-4450. Cvekl A, Kashanchi F, Brady JN, Piatigorsky J. 1999. Pax-6 interactions with TATA-box- binding protein and retinoblastoma protein. Invest Ophthalmol Vis Sci 40:1343-1350. D'Adamo P, Menegon A, Lo Nigro C, Grasso M, Gulisano M, Tamanini F, Bienvenu T, Gedeon AK, Oostra B, Wu SK, Tandon A, Valtorta F, Balch WE, Chelly J, Toniolo D. 1998. Mutations in GDI1 are responsible for X-linked non-specific mental retardation. Nat Genet 19:134-139.

D'Adamo P, Welzl H, Papadimitriou S, Raffaele di Barletta M, Tiveron C, TatangeloL,Pozzi L, Chapman PF, Knevett SG, Ramsay MF, Valtorta F, Leoni C, Menegon A, Wolfer DP, Lipp HP, Toniol o D. 2002. Deletion of the mental retardation gene Gdi I impairs associative memory and alters social behavior in mice. Hum Mol Genet 11:2567- 2580. Dalton D, Chadwick R, McGinnis W. 1989. Expression and embryonic function of empty

spiracles: a Drosophila homeo box gene with two patterning functions on the anterior-

posterior axis of the embryo. Genes Dev 3:1940-1956. Daniels RH, Zenke FT, Bokoch GM. 1999. alphaPix stimulates p2l-aciivated kinase activity through exchange factor-dependent and -independent mechanisms. J Biol Chem 274:6047-6050. Dasen JS, Barbera JP, Herman TS, Connell SO, Olson L, Ju B, Tollkuhn J, Baek SH, Rose DW, Rosenfeld MG. 2001. Temporal regulation of a paired-like homeodomain REFERENCES -249

repressor/TlE corepressor complex and a related activator is required for pituitary

organogenesis. Genes Dev l5:3193-3207 .

Dasso M, Pu RT. 1998. Nuclear transport: run by Ran? Am J Hum Genet 63:3 I 1-3 16. Davidson JD, Riley B, Burright EN, Duvick LA, Zoghbi HY, Orr HT. 2000. Identification

and characterization of an ataxin-1-interacting protein: AlUp, a ubiquitin-like nuclear protein. Hum. Mol. Genet. 9:2305-2312. Davis MG, Huang ES. 1988. Transfer and expression of plasmids containing human cytomegalovirus immediate-early gene 1 promoter-enhancer sequences in eukaryotic

and prokaryotic cells. Biotechnol Appl Biochem 70:6-12. Daw MI, Chittajallu R, Bortolotto ZA, Dev KK, Duprat F, Henley JM, Collingridge GL, Isaac JT. 2000. PDZ proteins interacting with C-terminal GluR2/3 are involved in a PKC- dependent regulation of AMPA receptors at hippocampal synapses. Neuron 28:873-

886. De Baere E, Beysen D, Oley C,Lorenz B, Cocquet J, De Sutter P, Devriendt K, Dixon M, Fellous M, Fryns JP, Garza A, Jonsrud c, Koivisto PA, Krause A, Leroy BP, Meire F, Plomp A, Van Maldergem L, De Paepe A, Veitia R, MessiaenL.2003. FOXL2 and BPES: mutational hotspots, phenotypic variability, and revision of the genotype- phenotype conelation. Am J Hum Genet 72:478-487.

Debeer P, Bacchelli C, Scambler PJ, De Smet L, Fryns JP, Goodman FR. 2002. Severe digital abnormalities in a patient heterozygous for both a novel missense mutation in

HOXD13 and a polyalanine tract expansion in HOXAl3. J Med Genet 39:852-856. de Melo J, Du G, Fonseca M, Gillespie LA, Turk WJ, Rubenstein JL, Eisenstat DD. 2005. Dlxl and Dlx2 function is necessary for terminal differentiation and survival of late- born retinal ganglion cells in the developing mouse retina. Development 132:3ll-322. des Portes V, Boddaert N, Sacco S, Briault S, Maincent K, Bahi N, Gomot M, Ronce N, Bursztyn J, Adamsbaum c, Zilbovicius M, chelly J, Moraine c. 2004. specific clinical and brain MRI features in mentally retarded patients with mutations in the Oligophrenin-l gene. Am J Med Genet A 124:364-371.

des Portes V, Pinard JM, Billuart P, Vinet MC, Koulakoff A, Canie A, Gelot A, Dupuis E, Motte J, Berwald-Netter Y, Catala M, Kahn A, Beldjord C, Chelly J. 1998. A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell 92:51-61. REFERENCES - 250

Dev KK, Nakajima Y, Kitano J, Braithwaite SP, Henley JM, Nakanishi S. 2000. PICKI interacts with and regulates PKC phosphorylation of mGLURT. J Neurosci 20:7252-

7257. Dev KK, Nakanishi S, Henley JM. 2001. Regulation of mglu(7) receptors by proteins that interact with the intracellular C-terminus. Trends Pharmacol Sci22:355-361. Dev KK, Nishimune A, Henley JM, Nakanishi S. 1999. The protein kinase C alpha binding protein PICKI interacts with short but not long form alternative splice variants of AMPA receptor subunits. Neuropharmacology 38:635 -644. Dingman HF, Tarjan G. 1960. Mental retardation and the normal distribution curve. Am J Ment Dehc 64:991. Dobyns WB, Berry-Kravis E, Havernick NJ, Holden KR, Viskochil D. 1999. X-linked lissencephaly with absent corpus callosum and ambiguous genitalia. Am J Med Genet 86:331-337. Duggan A, Garcia-Anoveros J, Corey DP. 2002. The PDZ domain protein PICKI and the sodium channel BNaCI interact and localize at mechanosensory terminals of dorsal root ganglion neurons and dendrites of central neurons. J Biol Chem 277:5203-5208. Dulac O, Plouin P, Jambaque I. 1993. Predicting favorable outcome in idiopathic West

syndrome. Epilepsia 3 4:7 47 -7 5 6. Dumitrescu AM, Liao XH, Best TB, Brockmann K, Refetoff S. 2004. A novel syndrome combining thyroid and neurological abnormalities is associated with mutations in a monocarboxylate transporter gene. Am J Hum Genet 74:168-175. Eberhard D, Busslinger M. 1999. The partial homeodomain of the transcription factor Pax-5 (BSAP) is an interaction motif for the retinoblastoma and TATA-binding proteins.

Cancer Res 59: I 716 s-7724s; discussion 7724s-1725s. Eberhard D, Jimenez G, Heavey B, Busslinger M. 2000. Transcriptional repression by Pax5 (BSAP) through interaction with corepressors of the Groucho family. Embo J 19:2292-2303. Ehrlich M. 2003. Expression of various genes is controlled by DNA methylation during mammalian development. J Cell Biochem 88:899-910. Eisenstat DD, Liu JK, Mione M, Zhong W, Yu G, Anderson SA, Ghattas I, Puelles L, Rubenstein JL.1999. DLX-1, DLX-2, and DLX-5 expression define distinct stages of

basal forebrain differentiation. J Comp Neurol 414:217-237. REFERENCES - 251

El Far O, Airas J, Wischmeyer E, Nehring RB, Karschin A, Betz H. 2000. Interaction of the C-terminal tail region of the metabotropic glutamate receptor 7 with the protein kinase

C substrate PICKI. Eur J Neurosci 72:4275-4221. El-Hodiri HM, Qi XL, Seufen DW. 2003. The Xenopus arx gene is expressed in the developing rostral forebrain. Dev Genes Ev ol 212:608-612. Elion EA. 1999. Detection of Protein-Protein Interactions by Coprecipitation. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, Editors.

Cument Protocols in Molecular Biology. John Wiley & Sons, Inc. p 20.5.1-20.5.9. Ellies DL, Stock DW, Hatch G, Giroux G, Weiss KM, Ekker M. 1997. Relationship between the genomi c organization and the overlapping embryonic expression patterns of the zebrafish dlx genes. Genomics 45:580-590. Elliott WH, Elliott DC. 1997. Biochemistry and Molecular Biology, First ed: Oxford University Press. 466 p. Emes RD, Ponting CP. 2001. A new sequence motif linking lissencephaly, Treacher Collins and oral-facial-digital type 1 syndromes, microtubule dynamics and cell migration. Hum. Mol. Genet. 10:2813-2820. Endo H, Hasegawa K, Narisawa K, Tada K, Kagawa Y, Ohta S. 1989. Defective gene in lactic acidosis: abnormal pyruvate dehydrogenase E1 alpha-subunit caused by a frame

shift. Am J Hum Genet 44:358-364. Ervasti JM, Campbell KP. 1991. Membrane organization of the dystrophin-glycoprotein

complex. Cell 66:1 l2l-1131. Espinoza HM, Ganga M, Vadlamudi U, Martin DM, Brooks BP, Semina EV, Murray JC, Amendt BA. 2005. Protein Kinase C Phosphorylation Modulates N- and C-Terminal Regulatory Activities of the PITX2 Homeodomain Protein. Biochemistty 44:3942- 3954. Fan X, Dion P, Laganiere J, Brais B, Rouleau GA. 2001. Oligomerization of polyalanine expanded PABPNI facilitates nuclear protein aggregation that is associated with cell

death. Hum Mol Genet 10:234I-2351. Fanning AS, Anderson JM. 1999. PDZ domains: fundamental building blocks in the organization of protein complexes at the plasma membrane. J Clin Invest 103:767-

772. Fauchereau F, Herbrand U, Chafey P, Eberth A, Koulakoff A, Vinet MC, Ahmadian MR, Chelly J, Billuart P. 2003. The RhoGAP activity of OPHNI, a new F-actin-binding REFERENCES -252

protein, is negatively controlled by its amino-terminal domain. Mol Cell Neurosci 23:574-586. Faucherre A, Desbois P, Satre V, Lunardi J, Dorseuil O, Gacon G. 2003. Lowe syndrome protein OCRL1 interacts with Rac GTPase in the trans-Golgi network. Hum Mol Genet 12:2449-2456. Faufkner A, Jones CT.1975. Pyruvate kinase isoenzymes in tissues of the human fetus. FEBS Letters 53:167-169. Faulkner NE, Dujardin DL, Tai CY, Vaughan KT, O'Connell CB, Wang Y, Vallee RB. 2000. A role for the lissencephaly gene LISI in mitosis and cytoplasmic dynein function.

Nat Cell Biol 2:7 84-7 9 l. Feinberg AP, Leahy WR. 1977. Infantile spasms: case report of sex-linked inheritance. Dev Med Child Neurol 19:524-526. Felsenfeld AL, Curry M, Kimmel CB. 1991. The fub-l mutation blocks initial myofrbril formation in zebrafish muscle pioneer cells. Dev Biol 148:23-30'

Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Sylvie O, Bernard L, Malcolm S, Winter R, Ballabio A, Franco B.200l.Identification of the gene for oral-facial-digital type I syndrome. Am

J Hum Genet 68:569-576. Ferreira A, Chin LS, Li L, Lanier LM, Kosik KS, Greengard P. 1998. Distinct roles of synapsin I and synapsin II during neuronal development. Mol }'{ed 4:22-28. Fields S, Song O. 1989. A novel genetic system to detect protein-protein interactions. Nature 340:245-246. Figueredo-Cardenas G, Morello M, Sancesario G, Bemardi G, Reiner A.1996. Colocalization of somatostatin, neuropeptide Y, neuronal nitric oxide synthase and NADPH- diaphorase in striatal interneurons in rats. Brain ResearchT35:317-324. Filmus J.2002. The contribution of in vivo manipulation of gene expression to the understanding of the function of glypicans. Glycoconj J 19:319-323-

Fishburn J, Turner G, Daniel A, Brookwell R. 1983. The diagnosis and frequency of X-linked conditions in a cohort of moderately retarded males with affected brothers. Am J Med Genet 14:713-724. Foecking MK, Hofstetter H. 1986. Powerful and versatile enhancer-promoter unit for mammalian expression vectors. Gene 45: 101-105. Fothergill-Gilmore LA, Michels PA. 1993. Evolution of glycolysis. Prog Biophys Mol Biol 59:105-235. REFERENCES - 253

Fox JW, Lamperti ED, EksiogluYZ, Hong SE, Feng Y, Graham DA, Scheffer IE, Dobyns WB, Hirsch BA, Radtke RA. 1998. Mutations in filamin 1 Prevent Migration of Cerebral Cortical Neurons in Human Periventricular Heterotopia. Neuron 2l:1315- 1325. Freude K, Hoffmann K, Jensen LR, Delatycki MB, des Portes V, Moser B, Hamel B, van Bokhoven H, Moraine C, Fryns JP, Chelly J, Gecz J, Lenzner S, Kalscheuer VM, Ropers HH. 2004. Mutations in the FTSJ1 gene coding for a novel S- adenosylmethionine-binding protein cause nonsyndromic X-linked mental retardation.

Am J Hum Genet 75:305-309. Frints SG, Borghgraef M, Froyen G, Marynen P, Fryns JP. 2002a. Clinical study and haplotype analysis in two brothers with Partington syndrome. Am J Med Genet 112:361-368.

Frints SG, Froyen G, Marynen P, Willekens D, Legius E, Fryns JP.2002b. Re-evaluation of MRX36 family after discovery of an ARX gene mutation reveals mild neurological

features of Partington syndrome. Am J Med Genet ll2:427-428. Friocourt G, Koulakoff A, Chafey P, Boucher D, Fauchereau F, Chelly J, Francis F. 2003. Doublecortin functions at the extremities of growing neuronal processes. Cereb Cortex

13:620-626. Frisen L, Lagerstedt K, Tapper-Persson M, Kockum I, Nordenskjold A. 2003. A novel duplication in the HOXA13 gene in a family with atypical hand-foot-genital

syndrome. J Med Genet 40:e49. Furukawa K, Iioka T, Morishita M, Yamaguchi A, Shindo H, Namba H, Yamashita S, Tsukazaki T. 2002. Functional domains of paired-like homeoprotein Cartl and the

relationship between dimerization and transcription activity. Genes Cells 7: I 135-1147 .

Galliot B, de Vargas C, Miller D.1999. Evolution of homeobox genes: Q50 Paired-like genes

founded the Paired class. Dev Genes Evol 209:18 6-197 .

Garcia CC, Blair HJ, Seager M, Coulthard A, Tennant S, Buddles M, Curtis A, Goodship JA.

2004.Identification of a mutation in synapsin I, a synaptic vesicle protein, in a family

with epilepsy. J Med Genet 41:183-186. Garcia-Gonzalo FR, Cruz C, Munoz P, Mazurek S, Eigenbrodt E, Ventura F, Bartrons R, Rosa JL. 2003.lnteraction between HERCI and M2-type pyruvate kinase. FEBS Lett 539:78-84. REFERENCES.254

Gecz J, Bielby S, Sutherland GR, Mulley JC. 1997. Gene structure and subcellular localization of FMR2, a member of a new family of putative transcription activators. Genomics 44:201-213. Gecz J, Gedeon AK, Sutherland GR, Mulley JC. 1996. Identification of the gene FMR2,

associated with FRAXE mental retardation. Nat Genet 13:105-108. Gibbons RJ, McDowell TL, Raman S, O'Rourke DM, Garick D, Ayyub H, Higgs DR. 2000. Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nat Genet 24:368-371. Gibbons RJ, Picketts DJ, Villard L, Higgs DR. 1995. Mutations in a putative global transcriptional regulator cause X-linked mental retardation with [alpha]-thalassemia (ATR-X syndrome). Cell 80:837-845. Giovedi S, Darchen F, Valtorta F, Greengard P, Benfenati F. 2004a. Synapsin Is a Novel Rab3 Effector Protein on Small Synaptic Vesicles: II. FTINCTIONAL EFFECTS OF THE Rab3A-SYNAPSIN I INTERACTION. J. Biol. Chem. 279:43769-43779. Giovedi S, Vaccaro P, Valtorta F, Darchen F, Greengard P, Cesareni G, Benfenati F. 2004b. Synapsin Is a Novel Rab3 Effector Protein on Small Synaptic Vesicles: I. IDENTIFICATION AND CHARACTERIZATION OF THE SYNAPSIN I.RAb3 INTERACTIONS IN VITRO AND IN INTACT NERVE TERMINALS. J. BioI. Chem. 279:437 60-437 68.

Glass IA. 1991. X linked mental retardation. J Med Genet 28:361-371. Gleeson JG, Allen KM, Fox JW, Lamperti ED, Berkovic S, Scheffer I, Cooper EC, Dobyns WB, Minnerath SR, Ross ME, Walsh CA. 1998. Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell 92:63-72. Goodman FR, Bacchelli C, Brady AF, Brueton LA, Fryns JP, Mortlock DP, Innis JW, Holmes LB, Donnenfeld AE, Feingold M, Beemer FA, Hennekam RC, Scambler PJ. 2000. Novel HOXAI3 mutations and the phenotypic spectrum of hand-foot-genital

syndrome. Am J Hum Genet 67:197-202. Goodman FR, Mundlos S, Muragaki Y, Donnai D, Giovannucci-Uzielli ML, Lapi E, Majewski F, McGaughran J, McKeown C, Reardon W, Upton J, Winter RM, Olsen BR, Scambler PJ. 1997. Synpolydactyly phenotypes correlate with size of expansions in HOXDI3 polyalanine tract. Proc Natl Acad Sci U S A94:7458-7463- Gorlich D, Dabrowski M, Bischoff FR, Kutay U, Bork P, Hartmann E, Prehn S, Izaurralde E. 1997. Anovel class of RanGTP binding proteins. J Cell Biol 138:65-80. REFERENCES - 255

Gorski JA, Talley T, Qiu M, Puelles L, Rubenstein JL, Jones KR. 2002. Cortical excitatory neurons and glia, but not GABAergic neurons, are produced in the Emxl-expressing

lineage. J Neurosci 22:6309-6314. Govek EE, Newey SE, Akerman CJ, Cross JR, Van der Veken L, Van Aelst L. 2004. The X- linked mental retardation protein oligophrenin-1 is required for dendritic spine

morphogenesis. Nat Neurosci 7 :3 64-37 2.

Greengard P, Valtorta F, Czernik AJ, Benfenati F. 1993. Synaptic vesicle phosphoproteins

and regulation of synaptic function. Science 259:780-785.

Gronskov K, Hjalgrim H, Nielsen IM, Brondum-Nielsen K.2004. Screening of the ARX gene

in 682 retarded males. Eur J Hum Genet 12:701-705. Grossman F. 1973. Manual on terminology and classification in mental retardation. Washington DC: American Association on Mental Deficiency. Grossman F. 1983. Classification in mental retardation. Washington DC: American Association on Mental Deficiency. Grueneberg DA, Henry RW, Brauer A, Novina CD, Cheriyath V, Roy AL, Gilman M. 1997. A multifunctional DNA-binding protein that promotes the formation of serum response factor/homeodomain complexes: identity to TFII-I. Genes Dev 1l:2482-

2493. Grueneberg DA, Natesan S, Alexandre C, Gilman MZ. 1992. Human and Drosophila homeodomain proteins that enhance the DNA-binding activity of serum response factor. Science 257 :1089-1095. Gu Y, Mcllwain KL, Weeber EJ, YamagataT, Xu B, Antalfff BA, Reyes C, Yuva-Paylor L, Armstrong D, Zoghbi H, Sweatt JD, Paylor R, Nelson DL- 2002. Impaired Conditioned Fear and Enhanced Long-Term Potentiation in Fmr2 Knock-Out Mice. J.

Neurosci. 22:27 53 -27 63 . Gu Y, Shen Y, Gibbs RA, Nelson DL.1996.Identification of FMR2, a novel gene associated with the FRAXE CCG repeat and CpG island. Nat Genet 13:109-113. Guerrini R, Moro F, Andermann E, Hughes E, D'Agostino D, Carrozzo R, Bemasconi A, Flinter F, Parmeggiani L, Volzone A, Parini E, Mei D, Jarosz JM, Morris RG, Pratt P, Tortorella G, Dubeau F, Andermann F, Dobyns WB, Das S. 2003. Nonsyndromic mental retardation and cryptogenic epilepsy in women with doublecortin gene mutations. Ann Neurol 54:30-37. REFERENCES - 256

Guminska M, Stachurska MB, Ignacak J. 1988. Pyruvate kinase isoenzymes in chromatin extracts of Ehrlich ascites tumour, Morris hepatoma 7777 and normal mouse and rat

livers. Biochim Biophys Acta 966:207 -213 - Guo W, Worley K, Adams V, Mason J, Sylvester-Jackson D, Zhang Y-H, Towbin JA, Fogt DD, Madu S, Wheeler DA, McCabe ERB. 1993. Genomic scanning for expressed

sequences in Xp21 identifies the glycerol kinase gene. Nat Genet 4:367-372. Hahn A, Gross C, Uyanik G, Hehr U, Hugens-Penzel M, Alzen G, Neubauer BA. 2004. X- linked lissencephaly with abnormal genitalia associated with renal phosphate wasting.

Neuropediat ñcs 3 5 :202-20 5 .

Hall A. 1998. Rho GTPases and the actin cytoskeleton. Science 279:509-514. Hall ER, Cottam GL. 1978. Isozymes of pyruvate kinase in vertebrates: their physical, chemical, kinetic and immunological properties. Int J Biochem 9:785-793. Hamel BC, Smits AP, van den Helm B, Smeets DF, Knoers NV, van Roosmalen T, Thoonen GH, Assman-Hulsmans CF, Ropers HH, Mariman EC, Kremer H.1999. Four families (MRX43, MRX44, MRX45, MRX52) with nonspecific X-linked mental retardation: clinical and psychometric data and results of linkage analysis. Am J Med Genet 85:290-304. Hammerschmidt M, Brook A, McMahon AP.1997. The world according to hedgehog. Trends Genet 13:14-21. Han K, Manley JL. 1993. Functional domains of the Drosophila Engrailed protein. Embo J 12:2723-2733. Hane B, Schroer RJ, Arena JF, Lubs HA, SchwartzCF,, Stevenson RE. 1996. Nonsyndromic X-linked mental retardation: review and mapping of MRX29 to Xp27. Clin Genet

50:176-l 83. Hane B, Stevenson RE, Arena JF, Lubs HA, Simensen RJ, Schwaltz CE. 1999. Gene for apparently nonsyndromic X-linked mental retardation (MRX32) maps to an 18-Mb region of Xp21 .2-p22. Am J Med Genet 85:271-275. Hanley JG, Khatri L, Hanson PI, Ziff EB. 2002. NSF ATPase and alpha-lbeta-SNAPS

disassemble the AMPA receptor-PlCKI complex. Neuron 34:53-67. Hartmann H, Uyanik G, Gross C, Hehr U, Lucke T, Arslan-Kirchner M, Antosch B, Das AM, Winkler J.2004. Agenesis of the corpus callosum, abnormal genitalia and intractable epilepsy due to a novel familial mutation in the Aristaless-related homeobox gene.

Neuropediatrics 35 : 1 57-l 60. REFERENCES -257

Harum KH, Alemi L, Johnston MV. 2001. Cognitive impairment in Coffrn-Lowry syndrome correlates with reduced RSK2 activation. Neurology 56:207-214.

Hashizume K, Miyamoto T, Ichikawa K, Yamauchi K, Kobayashi M, Sakurai A, Ohtsuka H, Nishii Y, Yamada T. 1989a. Purification and characterization of NADPH-dependent cytosolic 3,5,3'-triiodo-L-thyronine binding protein in rat kidney. J Biol Chem 264:4857-4863. Hashizume K, Miyamoto T, Ichikawa K, Yamauchi K, Sakurai A, Ohtsuka H, Kobayashi M, Nishii Y, Yamada T. 1989b. Evidence for the presence of two active forms of cytosolic 3,5,3'-triiodo-L-thyronine (T3)-binding protein (CTBP) in rat kidney. Specialized functions of two CTBPs in intracellular T3 translocation. J Biol Chem 264:4864-4871.

Hashizume K, Miyamoto T, Kobayashi M, Suzuki S, Ichikawa K, Yamauchi K, Ohtsuka H, Takeda T. 1989c. Cytosolic 3,5,3'-triiodo-L-thyronine (T3)-binding protein (CTBP) regulation of nuclear T3 binding: evidence for the presence of T3-CTBP complex- binding sites in nuclei. Endocrinology 124:2851-2856. Heiss NS, Knight SW, Vulliamy TJ, Klauck SM, Wiemann S, Mason PJ, Poustka A, Dokal I. 1998. X-linked dyskeratosis congenita is caused by mutations in a highly conserved

gene with putative nucleolar functions. Nat Genet 19:32-38- Herber R. 1961. Modifications in the manual on terminology and classification in mental

retardation. Am J Ment Defic 64:499-500. Herbst DS, Miller JR. 1980. Nonspecific X-linked mental retardation II: the frequency in British Columbia. Am J Med Genet 7:461-469. Hirbec H, Francis JC, Lauri SE, Braithwaite SP, Coussen F, Mulle C, Dev KK, Coutinho V, Meyer G, Isaac JT, Collingridge GL, Henley JM. 2003. Rapid and differential regulation of AMPA and kainate receptors at hippocampal mossy fibre synapses by PICK1 and GRIP. Neuron 37:625-638. Hillman MA, Gecz J.2001. Fragile XE-associated familial mental retardation protein 2

(FMR2) acts as a potent transcription activator. J Hum Genet 46:251-259. Holinski-Feder E, Golla A, Rost I, Seidel H, Rittinger O, Meindl A' 1996. Regional localization of rwo MRX genes to Xq2S (MRX28) and to Xpl1.4-Xp22.12 (MRX33).

Am J Med Genet 64:125-130. Hollenbach AD, McPherson CJ, Lagutina I, Grosveld G.2002. The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3.

Biochim Biophys Acta 7 57 4:321 -328. REFERENCES - 258

Hollenbach AD, Sublett JE, McPherson CJ, Grosveld G. 1999. The Pax3-FKHR oncoprotein is unresponsive to the Pax3-associated repressor hDaxx. Embo J 18:3702-3711. Horesh D, Sapir T, Francis F, Wolf SG, Caspi M, Elbaum M, Chelly J, Reiner O. 1999.

Doublecortin, a stabilizer of microtubules. Hum Mol Genet 8:1599-1610. Horike S, Cai S, Miyano M, Cheng JF, Kohwi-Shigematsu T. 2005. Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome. Nat Genet 37:31-40. Hou P, Estrada L, Kinley AW, Parsons JT, Vojtek AB, Gorski IL.2003. Fgdl, the Cdc42 GEF responsible for Faciogenital Dysplasia, directly interacts with cortactin and mAbpl to modulate cell shape. Hum. Mol. Genet. 12:1981-1993.

Hruska-Hageman AM, 'Wemmie JA, Price MP, Welsh }r4J.2002.Interaction of the synaptic protein PICKI (protein interacting with C kinase 1) with the non-voltage gated sodium

channels BNCI (brain Na* channel 1) and ASIC (acid-sensing ion channel). Biochem

J 361:443-450. Huber KM, Gallagher SM, Warren ST, Bear MF .2002. Altered synaptic plasticity in a mouse model of fragile X mental retardation. Proc Natl Acad Sci U S A 99:7746-7750. Huttenlocher PR. 1974. Dendritic development in neocortex of children with mental defect

and infantile spasms. Neurology 24:203-210. Huynh KD, Fischle W, Verdin E, Bardwell VJ. 2000. BCoR, a novel corepressor involved in BCL-6 repression. Genes Dev 14:1810-1823. Ignacak J, Stachurska MB. 2003. The dual activity of pyruvate kinase type M2 from chromatin extracts of neoplastic cells. Comp Biochem Physiol B Biochem Mol Biol 134:425-433. Ikemoto A, Bole DG, Ueda T.2003. Glycolysis and Glutamate Accumulation into Synaptic Vesicles. ROLE OF GLYCERALDEHYDE PHOSPHATE DEHYDROGENASE

AND 3 -PHO SPHOGLYCERATE KINASE. J. B iol. Chem. 27 8:5929 -59 40' Imamura K, Tanaka T. 1982. Pyruvate kinase isozymes from rat. Methods Enzymol 90 Pt

E: I 50-165.

Innis JVy', Mortlock D, Chen Z,Lttdwig M,'Williams ME, Williams TM, Doyle CD' Shao Z, Glynn M, Mikulic D, Lehmann K, Mundlos S, Utsch 8.2004. Polyalanine expansion in HOXA13: three new affected families and the molecular consequences in a mouse model. Hum Mol Genet 13:2841-2851. International League Against Epilepsy (ILAE). 1981. Proposal for revised clinical and electroencephalographic classification of epileptic seizures. From the Commission on REFERENCES - 259

Classification and Terminology of the International League Against Epilepsy. Epilepsia 22:489-501. International League Against Epilepsy (ILAE). 1989. Proposal for revised classification of epilepsies and epileptic syndromes. Commission on Classification and Terminology of

the International League Against Epilepsy. Epilepsia 30:389-399. Irwin SA, Idupulapati M, Gilbert ME, Harris JB, Chakravarti AB, Rogers EJ, Crisostomo RA, Larsen BP, Mehta A, Alcantara cJ, Patel B, swain RA, weiler IJ, oostra BA, Greenough WT. 2002. Dendritic spine and dendritic field characteristics of layer V pyramidal neurons in the visual cortex of fragile-X knockout mice. Am J Med Genet lll:140-146. Irwin SA, Patel B, Idupulapati M, Harris JB, Crisostomo RA, Larsen BP, Kooy F, Willems PJ, Cras P, Kozlowski PB, swain RA, weiler IJ, Greenough wT. 2001. Abnormal dendritic spine characteristics in the temporal and visual cortices of patients with fragile-X syndrome: a quantitative examination. Am J Med Genet 98:16I-167. Iwakura Y, Nagano T, Kawamura M, Horikawa H, Ibaraki K, Takei N, Nawa H. 2001. N- methyl-D-aspartate-induced alpha-amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid (AMPA) receptor down-regulation involves interaction of the carboxyl terminus of GluR2/3 with Pickl. Ligand-binding studies using Sindbis vectors carrying AMPA

receptor decoys. J Biol Chem 276:40025-40032. Jaulin-Bastard F, Saito H, Le Bivic A, Ollendorff V, Marchetto S, Birnbaum D, Borg JP. 2001. The ERBB2/HER2 receptor differentially interacts with ERBIN and PICKI PSD-95/DLGIZO-I domain proteins. J Biol Chem 276:15256-15263.

Jensen LR, Amende M, Gurok U, Moser B, Gimmel V, Tzschach A, Janecke AR, Tariverdian G, Chelly J, Fryns JP, Van Esch H, Kleefstra T, Hamel B, Moraine c, Gecz J, Turner G, Reinhardt R, Kalscheuer VM, Ropers HH, Lenzner S. 2005. Mutations in the JARIDIC gene, which is involved in transcriptional regulation and chromatin remodeling, cause X-linked mental retardation. Am J Hum Genet 76:227-236- Jin H, May M, Tranebjaerg L, Kendall E, Fontan G, Jackson J, Subramony SH, Arena F, Lubs H, Smith S, Stevenson R, Schwartz C, Vetrie D. 1996. A novel X-linked gene, DDP, shows mutations in families with deafness (DFN-I), dystonia, mental deficiency and blindness. Nat Genet 14:177-180.

Jin P, Alisch RS, Warren ST. 2004. RNA and microRNAs in fragile X mental retardation. Nat Cell Biol6:1048-1053. REFERENCES - 260

Johnston M. 1987. A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol Rev 5l:458-47 6. Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J, Wolffe AP. 1998. Methylated DNA and MeCP2 recruit histone deacetylase to repress

transcription. Nat Genet I 9: I 87- I 91.

Jouet M, Rosenthal A, Armstrong G, MacFarlane J, Stevenson R, Paterson J, Metzenberg A, Ionasescu V, Temple K, Kenwrick S. 1994. X-linked spastic paraplegia (SPGI), MASA syndrome and X-linked hydrocephalus result from mutations in the Ll gene. Nat Genet 7:402-407. Kablar B, Krastel K, Ying C, Asakura A, Tapscott SJ, Rudnicki MA. 1997. MyoD and Myf-5 differentially regulate the development of limb versus trunk skeletal muscle'

Developme nr. 124 :47 29 -47 3 8. Kahn A, Marie J. 1982. Pyruvate kinases from human erythrocytes and liver. Methods Enzymol 90 Pt E:l3l-140. Kalscheuer VM, Freude K, Musante L, Jensen LR, Yntema HG, GeczJ, SefianiA, Hoffmann K, Moser B, Haas S, Gurok U, Haesler S, Aranda B, Nshedjan A, Tzschach A, Hartmann N, Roloff TC, Shoichet S, Hagens O, Tao J, Van Bokhoven H, Turner G, Chelly J, Moraine C, Fryns JP, Nuber U, Hoeltzenbein M, Scharff C, Scherthan H, Lenzner S, Hamel BC, Schweiger S, Ropers HH. 2003a. Mutations in the polyglutamine binding protein 1 gene cause X-linked mental retardation. Nat Genet

35:313-3 15. Kalscheuer VM, Tao J, Donnelly A, Hollway G, Schwinger E, Kubart S, Menzel C, Hoeltzenbein M, Tommerup N, Eyre H, Harbord M, Haan E, Sutherland GR, Ropers HH, Gecz J. 2003b. Disruption of the serine/threonine kinase 9 gene causes severe X-

linked infantile spasms and mental retardation. Am J Hum Genet 72:1401-1411. Kandel ER, Schwartz JH, Jessell TM. 2000. Principles of Neural Science, Fourth ed: McGraw-Hill Medical. l4l4 p. Kane DA, Kimmel CB. 1993. The zebrafrsh midblastula transition. Development 119:447- 4s6. Kanno H, Fujii H, Miwa S. 1992. Structural analysis of human pyruvate kinase L-gene and identifìcation of the promoter activity in erythroid cells. Biochem Biophys Res Commun 188:516-523. Karlin S, Brocchieri L, Bergman A, Mrazek J, Gentles AJ. 2002. Amino acid runs in eukaryotic proteomes and disease associations. Proc Natl Acad Sci U S A 99:333-338. REFERENCES - 261

Kato H, Fukuda T, Parkison C, McPhie P, Cheng SY. 1989. Cytosolic thyroid hormone- binding protein is a monomer of pyruvate kinase. Proc Natl Acad Sci U S A 86:7861- 7865.

Kato M, Das S, Petras K, Kitamura K, Morohashi K, Abuelo DN, Barr M, Bonneau D, Brady AF, Carpenter NJ, Cipero KL, Frisone F, Fukuda T, Guerrini R, Iida E, Itoh M, Lewanda AF, Nanba Y, Oka A, Proud VK, Saugier-Veber P, Schelley SL, Selicorni A, Shaner R, Silengo M, Stewart F, Sugiyama N, Toyama J, Toutain A, Vargas AL,

YanazawaM, Zackai EH, Dobyns 'WB. 2004. Mutations of ARX are associated with striking pleiotropy and consistent genotype-phenotype conelation. Hum Mutat 23:147-159. Kato M, Das S, Petras K, Sawaishi Y, Dobyns WB. 2003. Polyalanine expansion of ARX

associated with cryptogenic West syndrome. Neurology 61:'267-276. Kato M, Dobyns WB. 2003. Lissencephaly and the molecular basis of neuronal migration. Hum Mol Genet 12 Spec No 1:R89-96. Kawaguchi Y, Wilson CJ, Augood SJ, Emson PC. 1995. Striatal interneurones: chemical, physiological and morphological characterization. Trends in Neurosciences 18:527-

535. Kawahara A, Dawid IB. 2002. Developmental expression of zebrafish emxl during early

embryogenesis. Gene Expr Patterns 2:201 -206. Kenwrick S, Watkins A, Angelis ED.2000. Neural cell recognition molecule Ll: relating biological complexity to human disease mutations. Hum. Mol. Genet. 9:879-886. Kholmanskikh SS, Dobrin JS, Wynshaw-Boris A, Letourneau PC, Ross ME. 2003. Disregulated RhoGTPases and actin cytoskeleton contribute to the migration defect in

Lis 1 -deficient neurons. J Neurosci 23 :867 3 -8681 . Kim MK, Lesoon-\üood LA, Weintraub BD, Chung JH. 1996. A soluble transcription factor, Oct-1, is also found in the insoluble nuclear matrix and possesses silencing activity in its alanine-rich domain. Mol Cell Biol l6:4366-4377. Kimmel CB. 1993. Patterning the brain of the zebrafish embryo. Annu Rev Neurosci 16:707-

732. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. 1995. Stages of embryonic development of the zebrafìsh. Dev Dyn 203:253-310. Kimmel CB, Law RD. 1985. Cell lineage of zebrafish blastomeres. I. Cleavage pattern and cytoplasmic bridges between cells. Dev Biol 108:78-85. REFERENCES -262

Kishi N, Macklis JD.2004. MECP2 is progressively expressed in post-migratory neurons and is involved in neuronal maturation rather than cell fate decisions. Mol Cell Neurosci 27:306-321. Kitagawa S, Obata T, Hasumura S, Pastan I, Cheng SY. 1987. A cellular 3,3',5-triiodo-L- thyronine binding protein from a human carcinoma cell line. Purif,rcation and

characterization. J Biol Chem 262:3903-3908. Kitamura K, Yanazawa M, Sugiyama N, Miura H, Iizuka-Kogo A, Kusaka M, Omichi K, Suzuki R, Kato-Fukui Y, Kamiirisa K, Matsuo M, Kamijo S, Kasahara M, Yoshioka H, Ogata T, Fukuda T, Kondo I, Kato M, Dobyns'WB, Yokoyama M, Morohashi K. 2002.Mutation of ARX causes abnormal development of forebrain and testes in mice

and X-linked lissencephaly with abnormal genitalia in humans. Nat Genet 32:359-369. Kleefstra T, Hamel BC. 2005. X-linked mental retardation: further lumping, splitting and emerging phenotypes. Clin Genet 67:451-467. Kleeßtra T, Yntema HG, Oudakker AR, Banning MJ, Kalscheuer VM, Chelly J, Moraine C, Ropers HH, Fryns JP, Janssen IM, Sistermans EA, Nillesen WN, de Vries LB, Hamel BC, van Bokhoven H.2004. Zinc ftnger S1 (ZNF8l) mutations associated with X-

linked mental retardation. J Med Genet 4l:394-399. Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C, Kunkel LM. 1987. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50:509-517. Kopczynski CC, Davis GW, Goodman CS. 1996. A Neural Tetraspanin, Encoded by late

bloomer, That Facilitates Synapse Formation. Science 27 1 :1867 -l 87 0 - Kozak M. 1987. An analysis of S'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15:8125-8148. Krauss S, Concordet JP, Ingham PW. 1993. A functionally conserved homolog of the Drosophila segment polarity gene hh is expressed in tissues with polarizing activity in

zebrafi sh embryos. Cell 7 5:l 431 -l 444. Kriegstein AR, Noctor SC. 2004. Patterns of neuronal migration in the embryonic cortex.

Trends Neurosci 27 :392-399. Kurlzman AL, Schechter N.2001. Ubcg interacts with a nuclear localization signal and mediates nuclear localization of the paired-like homeobox protein Vsx-l independent of SUMO-I modifìcation. Proc Natl Acad Sci U S A98:5602-5607. Kutsche K, Yntema H, Brandt A, Jantke I, Nothwang HG, Orth U, Boavida MG, David D, Chelly J, Fryns JP, Moraine C, Ropers HH, Hamel BC, van Bokhoven H, Gal A. REFERENCES - 263

2000. Mutations in ARHGEF6, encoding a guanine nucleotide exchange factor for

Rho GTPases, in patients with X-linked mental retardation. Nat Genet 26:247-250- Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of

bacteri opha ge T 4. Nature 227 :680-685 .

Lambert de Rouvroit C, Goffìnet 4M.2001. Neuronal migration. Mech Dev 105:47-56. Laumonnier F, Bonnet-Brilhault F, Gomot M, Blanc R, David A, Moizard MP, Raynaud M, Ronce N, Lemonnier E, calvas P, Laudier B, chelly J, Fryns JP, Ropers HH, Hamel BC, Andres C, Barthelemy C, Moraine C, Briault S.2004. X-linked mental retardation and autism are associated with a mutation in the NLGN4 gene, a member of the

neuroligin family. Am J Hum Genet 74:552-557. Laumonnier F, Ronce N, Hamel BC, Thomas P, Lespinasse J, Raynaud M, Paringaux C, Van Bokhoven H, Kalscheuer V, Fryns JP, Chelly J, Moraine C, Briault S. 2002. Transcription factor SOX3 is involved in X-linked mental retardation with growth hormone deficiency. Am J Hum Genet 7l:1450-1455- Lavoie H, Debeane F, Trinh QD, Turcotte JF, Corbeil-Girard LP, Dicaire MJ, Saint-Denis A, Page M, Rouleau GA, Brais B. 2003. Polymorphism, shared functions and convergent evolution of genes with sequences coding for polyalanine domains. Hum Mol Genet 12:2967-2979. Lebel RR, May M, Pouls S, Lubs HA, Stevenson RE, SchwartzCE.2002. Non-syndromic X- linked mental retardation associated with a missense mutation (P312L) in the FGDI gene. Clin Genet 6l:139-145. Leconte L, Lecoin L, Martin P, Saule S. 2004. Pax6 Interacts with cVax and Tbx5 to Establish the Dorsoventral Boundary of the Developing Eye. J. Biol. Chem.

279:47272-47277 . Lee SH, Sheng M. 2000. Development of neuron-neuron synapses. Current Opinion in Neurobiolo gy 10:125-131. Lehrke R. 1972. Theory of X-linkage of major intellectual traits. Am J Ment Deftc 76:6ll- 619. Lehrke RG. 1974. X-linked mental retardation and verbal disability. Birth Defects Orig Artic

Ser 10:1-100. Lele Z, Bakkers J, Hammerschmidt M. 2001. Morpholino phenocopies of the swirl, snailhouse, somitabun, minifin, silberblick, and pipetail mutations. Genesis 30:190- 194. REFERENCES -264

Leonard H, Wen X. 2002. The epidemiology of mental retardation: challenges and opportunities in the new millennium. Ment Retard Dev Disabil Res Rev 8:ll7-134. Lewis JD, Meehan RR, Henzel WJ, Maurer-Fogy I, Jeppesen P, Klein F, Bird A. 1992- Purifìcation, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell 69:905-914. Li L, Chin L, Shupliakov o, Brodin L, sihra T, Hvalby o, Jensen Y,zheng D, McNamara J,

Greengard P, Andersen P. 1995.Impairment of synaptic vesicle clustering and of synaptic transmission, and increased seizure propensity, in synapsin l-deficient mice.

Proc Natl Acad Sci U S A 92:9235-9239. Licht JD, Grossel MJ, Figge J, Hansen UM. 1990. Drosophila Kruppel protein is a

transcriptional repressor. Nature 3 4 6 :7 6-7 9 . Licht JD, Hanna-Rose W, Reddy JC, English MA, Ro M, Grossel M, Shaknovich R, Hansen U.lgg4. Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Kruppel protein. Mol Cell Biol 14:4057-4066. Lin SH, Arai AC, Wang Z, Nothacker HP, Civelli O.2001a. The carboxyl terminus of the prolactin-releasing peptide receptor interacts with PDZ domain proteins involved in alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor clustering. Mol Pharmacol 60:916-923. Lin WJ, Chang YF, Wang WL, Huang CY. 2001b. Mitogen-stimulated TIS21 protein interacts with a protein-kinase-Calpha-binding protein rPICKl. Biochem J 354:635- 643. Liu J, Prickett TD, Elliott E, Meroni G, Brautigan DL.2001. Phosphorylation and microtubule association of the Opitz syndrome protein mid-l is regulated by protein phosphatase 2Aviabinding to the regulatory subunit alpha 4. PNAS 98:6650-6655. Liu Z, Cashion LM, Twu JJ. 1997. A Systematic Comparison of Relative PromoterÆnhancer Activities in Mammalian Cell Lines. Analytical Biochemistry 246:150-152.

Long JE, Garel S, Depew MJ, Tobet S, Rubenstein JL. 2003. DLX5 regulates development of peripheral and central components of the olfactory system. J Neurosci 23:568-578.

Lower K, Mangelsdorf M, Gecz J.2001. Molecular genetics of X-linked mental retardation: a complex picture emerging. Expert Rev Mol Diagn l:220-225. Lower KM, Turner G, Kerr BA, Mathews KD, Shaw MA, Gedeon AK, Schelley S, Hoyme HE, White SM, Delatycki MB, Lampe AK, Clayton-Smith J, stewart H, van Ravenswaay cM, de vries BB, cox B, Grompe M, Ross S, Thomas P, Mulley JC, REFERENCES - 265

Gecz J.2002. Mutations in PHF6 are associated with Borjeson-Forssman-Lehmann

syndrome. Nat Genet 32:661-665. Lowery LA, Sive H.2004. Strategies of vertebrate neurulation and a re-evaluation of teleost

neural tube formation. Mechanisms of Development 721: I 189-1 197. Mackintosh NJ. 1998. IQ and Human Intelligence: Oxford University Press. 419 p. Magnaghi P, Roberts C, Lorain S, Lipinski M, Scambler PJ. 1998. HIRA, a mammalian homologue of Saccharomyces cerevisiae transcriptional co-repressors, interacts with

Pax3. Nat Genet 20:74-77, Mailhos C, Andre S, Mollereau B, Goriely A, Hemmati-Brivanlou A, Desplan C. 1998. Drosophila Goosecoid requires a conserved heptapeptide for repression of paired-class

homeoprotein activators. Developm ent 125 :937 -9 47 - Mari F, Azimonti S, Bertani I, Bolognese F, Colombo E, Caselli R, Scala E, Longo I, Grosso S, Pescucci c, Ariani F, Hayek G, Balestri P, Bergo A, Badaracco G, Zappella M, Broccoli V, Renieri A, Kilstrup-Nielsen C, Landsberger N. 2005. CDKL5 belongs to

the same molecular pathway of MeCP2 and it is responsible for the early-onset seizure variant of Rett syndrome. Hum. Mol. Genet. 14:1935-1946.

Marin O, Anderson SA, Rubenstein JLR. 2000. Origin and Molecular Specification of Striatal

Interneurons. J. Neuros ci. 20 :6063 -607 6. Marin-Padilla M. 1972. Structural abnormalities of the cerebral cortex in human chromosomal aberrations: a Golgi study. Brain Res 44:625-629. Markus M, Plesser T, Boiteux A, Hess B, Malcovati M. 1980. Analysis of progress curves. Rate law of pyruvate kinase type I from Escherichia coli. BiochemJ 189:421-433. Marti E, Bovolenta P. 2002. Sonic hedgehog in CNS development: one signal, multiple outputs. Trends Neurosci 25:89-96. Martinez-Galan JR, Escobar del Rey F, Morreale de Escobar G, Santacana M, Ruiz-Marcos A.2004. Hypothyroidism alters the development of radial glial cells in the term fetal

and postnatal neocortex of the rat. Brain Res Dev Brain Res 153:109-1 14. Malarazzo V, Ronnett GV. 2004. Temporal and regional differences in the olfactory proteome

as a consequence of MeCP2 deficiency. Proc Natl Acad Sci U S A 101 :7763-7768. Matera I, Bachetti T, Puppo F, Di Duca M, Morandi F, Casiraghi GM, Cilio MR' Hennekam R, Hofstra R, Schober JG, Ravazzolo R, Ottonello G, Ceccherini I. 2004. PHOX2B mutations and polyalanine expansions conelate with the severity of the respiratory phenotype and associated symptoms in both congenital and late onset Central

Hypoventilation syndrome. J Med Genet 41:373-380. REFERENCES - 266

Mavropoulos A, Devos N, Biemar F, Zecchin E, Argenton F, Edlund H, Motte P, Martial JA, peers B. 2005. sox4b is a key player of pancreatic falpha] cell differentiation in

zebrafi sh. Developmental B i ology 285 :21 | -223 . McDowell TL, Gibbons RJ, Sutherland H, O'Rourke DM, Bickmore WA, Pombo A, Turley H, Gatter K, Picketts DJ, Buckle vJ, chapman L, Rhodes D, Higgs DR. 1999. Localization of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and the shoft arms of acrocentric chromosomes. Proc Natl Acad Sci

U S A 96:13983-13988. McGuinness MC, Lu J-F, ZhangH-P, Dong G-X, Heinzer AK, Watkins PA, Powers J, Smith KD. 2003. Role of ALDP (ABCDI) and Mitochondria in X-Linked Adrenoleukodystrophy. Mol. Cell. B iol. 23 :7 44-7 53' McGuinness T, Porteus MH, Smiga S, Bulfone A, Kingsley C, Qiu M, Liu JK, Long JE, Xu D, Rubenstein JL. 1996. Sequence, organization, and transcription of the Dlx-l and

Dlx-2 locus. Genomics 35:47 3 -485.

Mclaren J, Bryson SE. 1987. Review of recent epidemiological studies of mental retardation: prevalence, associated disorders, and etiology. Am J Ment Retard92:243-254.

Megeney LA, Kablar B, Garett K, Anderson JE, Rudnicki MA. 1996. MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev 10:1173-1183. Meijlink F, Beverdam A, Brouwer A, Oosterveen TC, Berge DT. 1999. Vertebrate aristaless- related genes. Int J Dev Biol43:651-663. Melkman T, Sengupta P. 2005. Regulation of chemosensory and GABAergic motor neuron development by the C. elegans Aristaless/Arx homolog alr-1. Development 132:1935- 1949. Meloni I, Muscettola M, Raynaud M, Longo I, Bruttini M, Moizard MP, Gomot M, Chelly J' des Portes v, Fryns JP, Ropers HH, Magi B, Bellan c, volpi N, Yntema HG, Lewis SE, Schaffer JE, Renieri A. 2002. FACL4, encoding fatty acid-CoA ligase 4, is mutated in nonspecific X-linked mental retardation. Nat Genet 30:436-440. Michelson AM, Markham AF, Orkin SH. 1983. Isolation and DNA Sequence of a Full- Length gDNA Clone for Human X Chromosome-Encoded Phosphoglycerate Kinase' PNAS 80:472-476. Michener CD, Sokal RR. 1957. A quantitative approach to a problem in classification. Evolution 1l:130-162. REFERENCES -267

Mikkola I, Bruun JA, Holm T, Johansen T. 2001. Superactivation of Pax6-mediated transactivation from paired domain-binding sites by dna-independent recruitment of different homeodomain proteins. J Biol Chem 276:4109-4118. Mingot JM, Kostka S, Kraft R, Hartmann E, Gorlich D.2001.Importin l3: a novel mediator of nuclear import and export. Embo J 20:3685-3694- Mitton KP, Swain PK, Chen S, Xu S, Zack DJ, Swaroop A. 2000. The Leucine Zipper of NRL Interacts with the CRX Homeodomain. A POSSIBLE MECHANISM OF TRANSCRIPTIONAL SYNERGY IN RHODOPSIN REGULATION. J. BioI. ChEM.

27 5:29794-29799 . Miura H, Yanazawa M, Kato K, Kitamura K. 1997 . Expression of a novel aristaless related homeobox gene 'Arx' in the vertebrate telencephalon, diencephalon and floor plate. Mech Dev 65:99-109.

Mochizuki Y, He J, Kulkarni S, Bessler M, Mason PJ.2004. Mouse dyskerin mutations affect accumulation of telomerase RNA and small nucleolar RNA, telomerase activity, and

ribosomal RNA processing. PNAS 101 : 10756-107 61 - Montini E, Andolfi G, Caruso A, Buchner G, Walpole SM, Mariani M' Consalez G, Trump D, Ballabio A, Franco B. 1998. Identification and characterization of a novel serine- threonine kinase gene from theXp22 region. Genomics 51:427-433. Morin-Kensicki EM, Eisen JS. 1997. Sclerotome development and peripheral nervous system

segmentation in embryonic zebrafish. Development 124:159-167 - Morita T, Nitta H, Kiyama Y, Mori H, Mishina M. 1995. Differential expression of two zebrafish emx homeoprotein mRNAs in the developing brain. Neurosci Lett 198:131- 134. Moroianu J. 1998. Distinct nuclear import and export pathways mediated by members of the karyopherin beta family. J Cell Biochem 70:231-239-

Mortlock DP, Sateesh P, Innis JW. 2000. Evolution of N-terminal sequences of the vertebrate HOXAl3 protein. Mamm Genome 1l:l5l-158. Moser HW, Wolf PA. 1971. The nosology of mental retardation: including the report of a survey of 1378 mentally retarded individuals at the Walter E. Fernald State School. Birth Defects Orig Artic Ser 7:ll7-134. Mosser J, Douar AM, Sarde CO, Kioschis P, Feil R, Moser H, Poustka AM, Mandel JL, Aubourg P. 1993. Putative X-linked adrenoleukodystrophy gene shares unexpected homology with ABC transporters. Nature 367:726-730- REFERENCES - 268

Mulley JC, Kerr B, Stevenson R, Lubs H.lgg2.Nomenclature guidelines for X-linked mental

retardation. Am J Med Genet 43:383-391. Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D, Cole wG, Henn W, Knoll JH, Owen MJ, Mertelsmann R, Zabel BU, Olsen BR. 1997. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell89:773-779. Muragaki Y, Mundlos S, Upton J, Olsen BR. 1996. Altered growth and branching patterns in synpolydactyly caused by mutations in HOXDl3. Science 272:548-551. Nakamura S, Stock DW, Wydner KL, Bollekens JA, Takeshita K, Nagai BM, Chiba S, Kitamura T, Freeland Tly'r, Zhao Z, Minowada J, Lawrence JB, Weiss KM, Ruddle FH. 1996. Genomic analysis of a new mammalian distal-less gene: Dlx7. Genomics 38:314-324. Nakamoto M, Nakano S, Kawashima S, Ihara M, Nishimura Y, Shinde A, Kakizuka A.2002. Unequal crossing-over in unique PABP2 mutations in Japanese patients: a possible

cause of oculopharyngeal muscular dystrophy. Arch Neurol 59:474-477. Nakano T, Murata T, Matsuo l, Aizawa S. 2000. OTX2 directly interacts with LIM1 and

HNF-3beta. B iochem B iophys Res Commu n 267 :64 -7 0. Nakazawa Y, Asakura T. 2003. Structure determination of a peptide model of the repeated helical domain in Samia cynthia ricini silk fibroin before spinning by a combination of

advanced solid-state NMR methods. J Am Chem Soc 125:7230-7237. Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A. 1998. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a

histone deacetylase complex. Nature 3 93 : 3 86-3 89. Nasevicius A, Ekker SC. 2000. Effective targeted gene 'knockdown' in zebrafish. Nat Genet 26:216-220. Nasrallah IM, Minarcik JC, Golden IA. 2004. A polyalanine tract expansion in Arx forms intranuclear inclusions and results in increased cell death. J Cell Biol 167:411-416. Ng D, Thakker N, Corcoran CM, Donnai D, Perveen R, Schneider A, Hadley DW, Tifft C, Zhang L, Wilkie AO, van der Smagt JJ, Gorlin RJ, Burgess SM, Bardwell VJ, Black GC, Biesecker LG. 2004. Oculofaciocardiodental and Lenz microphthalmia syndromes result from distinct classes of mutations in BCOR. Nat Genet 36:.4ll-416. Nguyen HD, Hall CK.2004. Molecular dynamics simulations of spontaneous fibril formation by random-coil peptides. Proc Natl Acad Sci U S A 101:16180-16185. REFERENCES - 269

Nimchinsky EA, Oberlander AM, Svoboda K. 2001. Abnormal development of dendritic

spines in FMR1 knock-out mice. J Neurosci 21:5139-5146. Nimchinsky EA, Sabatini BL, Svoboda K. 2002. STRUCTURE AND FUNCTION OF DENDRITIC SPINES. Annual Review of Physiology 64:313-353. Nishino I, Fu J, Tanji K, Yamada T, Shimojo S, Koori T, Mora M, Riggs JE, Oh SJ' Koga Y, sue cM, Yamamoto A, Murakami N, Shanske s, Byrne E, Bonilla E, Nonaka I, DiMauro S, Hirano M. 2000. Primary LAMP-2 deficiency causes X-linked vacuolar cardiomyopathy and myopathy (Danon disease). Nature 406:906-910. Nishizuka Y. lgg2.Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258:607-614' Noguchi T, Yamada K, Inoue H, Matsuda T, Tanaka T. 1987. The L- and R-type isozymes of rat pyruvate kinase are produced from a single gene by use of different promoters' J

Biol Chem 262:14366-1437 1. Norris RA, Kern MJ. 2001. The identification of Prxl transcription regulatory domains provides a mechanism for unequal compensation by the Prxl and Prx2 loci. J Biol Chem 276:26829-26837. Nusslein-Volhard C, Wieschaus E. 1980. Mutations affecting segment number and polarity in

Drosophila. Nature 287 :7 95 -801 . Oberle I, Rousseau F,HeilzD, Kretz C, Devys D, Hanauer A, Boue J, Bertheas MF, Mandel JL. 1991. Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome. Science 252:1097-1102- ohira R, zhangY-H, Guo w, Dipple K, shih SL, Doerr J, Huang B-L, Fu LJ, Abu-Khalil A, Geschwind D, McCabe ERB. 2002. Human ARX gene: genomic charactefizalion and

expression. Molecular Genetics and Metabolism 77:179-l 88. Oldenburg KR, Vo KT, Michaelis S, Paddon C. 1997. Recombination-mediated PCR-directed plasmid construction in vivo in yeast. Nucleic Acids Res 25:451-452. Parkison C, Ashizawa K, McPhie P, Lin KH, Cheng SY. 1991. The monomer of pyruvate kinase, subtype M1, is both a kinase and a cytosolic thyroid hormone binding protein. Biochem Biophys Res Commun 179:668-674. Partington MW, Mulley JC, Sutherland GR, Hockey A, Thode A, Turner G. 1988. X-linked mental retardation with dystonic movements of the hands. Am J Med Genet 30:'251- 262. Partington MW, Turner G, Boyle J, Gecz J.2004. Three new families with X-linked mental

retardation caused by the 428-45ldup(24bp) mutation in ARX. Clin Genet 66:39-45. REFERENCES -270

Pasteris NG, Cadle A, Logie LJ, Porteous ME, Schwartz CE, Stevenson RE, Glover TW, Wilroy RS, Gorski JL. 1994. Isolation and characterization of the faciogenital dysplasia (Aarskog-Scott syndrome) gene: a putative Rho/Rac guanine nucleotide

exchange factor. Cell 7 9 :669 -67 8. Patterson D, Costa AC. 2005. Down syndrome and genetics - a case of linked histories. Nat Rev Genet 6:137-147.

Penrose LS. 1938. A clinical and genetic study of 1280 cases of mental defect. In: Special Report Series, Medical Research Council. London: Her Majesty's Stationary Office. PerezJL, Khatri L, Chang C, Srivastava S, Osten P,Ziff E8.2001. PICKI targets activated protein kinase Calpha to AMPA receptor clusters in spines of hippocampal neurons

and reduces surface levels of the AMPA-type glutamate receptor subunit 2. J Neurosci 21:5417-5428. Petris M, Mercer J. 1999. The menkes protein (ATP7A; MNK) cycles via the plasma membrane both in basal and elevated extracellular copper using a C-terminal di- leucine endocytic signal. Hum. Mol. Genet. 8:2107-2115. Pilia G, Hughes-Benzie RM, MacKenzie A, Baybayan P, Chen EY, Huber R, Neri G, Cao A, Forabosco A, Schlessinger D. 1996. Mutations in GPC3, a glypican gene, cause the

Simpson-Golabi-Behmel overgrowth syndrome. Nat Genet 72:241 -247 . Pilz DT, Matsumoto N, Minnerath S, Mills P, Gleeson JG, Allen KM, Walsh CA, Barkovich AJ, Dobyns WB, Ledbetter DH, Ross ME. 1998. LIS1 and XLIS (DCX) mutations

cause most classical lissencephaly, but different patterns of malformation. Hum Mol

Genet 7:2029-2037. Plafker SM, Macara IG.2000. Importin-I1, a nuclear import receptor for the ubiquitin-

conjugating enzyme, UbcM2. Embo J I 9: 5 5 02-5 5 I 3.

Planque N, Leconte L, Coquelle FM, Martin P, Saule S. 2001. Specific Pax-6Avlicrophthalmia Transcription Factor Interactions Involve Their DNA-binding Domains and Inhibit Transcriptional Properties of Both Proteins. J. Biol. Chem. 276:29330-29337.

Pleasure SJ, Anderson S, Hevner R, Bagri A, Marin O, Lowenstein DH, Rubenstein JL. 2000. Cell migration from the ganglionic eminences is required for the development of

hippocampal GABAergic interneurons. Neuron 28:7 27 -7 40. Ploski JE, Shamsher MK, Radu A. 2004.Paired-type homeodomain transcription factors are imported into the nucleus by karyopherin 13. Mol Cell Biol24:4824-4834. REFERENCES -271

Poirier K, Abriol J, Souville I, Laroche-Raynaud C, Beldjord C, Gilbet B, Chelly J, Bienvenu T. 2005a. Maternal mosaicism for mutations in the ARX gene in a family with X linked mental retardation. Human Genetics (in the press):1-4. Poirier K, Lacombe D, Gilbert-Dussardier B, Raynaud M, Desportes V, Brouwer A, Moraine c, Fryns J, Ropers H, Beldjord c, chelly J, Bienvenu T. 2005b. Screening of ARX in mental retardation families: consequences for the strategy of molecular diagnosis. Neurogenetics (in the press):l-8. Poirier K, Van Esch H, Friocourt G, Saillour Y, Bahi N, Backer S, Souil E, Castelnau- Ptakhine L, Beldjord C, Francis F, Bienvenu T, Chelly J. 2004. Neuroanatomical distribution of ARX in brain and its localisation in GABAergic neurons. Brain Res Mol Brain Ptes 122:35-46. Powell EM, Campbell DB, Stanwood GD, Davis C, Noebels JL, Levitt P. 2003. Genetic disruption of cortical interneuron development causes region- and GABA cell type- specific deficits, epilepsy, and behavioral dysfunction. J Neurosci23:622-631. Proud VK, Levine C, Carpenter NJ. 1992. New X-linked syndrome with seizures, acquired micrencephaly, and agenesis of the corpus callosum. Am J Med Genet 43:458-466. Purpura DP. 1974. Dendritic spine "dysgenesis" and mental retardation. Science 186:1126- 1128.

Qiu M, Anderson S, Chen S, Meneses JJ, Hevner R, Kuwana E, Pedersen RA, Rubenstein JL. 1996. Mutation of the Emx-1 homeobox gene disrupts the corpus callosum. Dev Biol 178:174-178.

Qiu M, Bulfone A, Ghattas I, Meneses JJ, Christensen L, Sharpe PT, Presley R, Pedersen RA, Rubenstein JL. 1997. Role of the Dlx homeobox genes in proximodistal patterning of the branchial arches: mutations of Dlx-1, Dlx-2, and Dlx-l and -2 alter morphogenesis of proximal skeletal and soft tissue structures derived from the first and second arches. Dev Biol 185:165-184. Qiu M, Bulfone A, Martinez S, Meneses JJ, Shimamura K, Pedersen RA, Rubenstein JL. 1995. Null mutation of Dlx-2 results in abnormal morphogenesis of proximal first and

second branchial arch derivatives and abnormal differentiation in the forebrain. Genes Dev 9:2523-2538. \ü, Quaderi NA, Schweiger S, Gaudenz K, Franco B, Rugarli EI, Berger Feldman GJ, Volta M, Andolfi G, Gilgenkrantz S, Marion RW, Hennekam RC, Opitz JM, Muenke M, Ropers HH, Ballabio A. 1997. Opitz GIBBts- syndrome, a defect of midline REFERENCES -272

development, is due to mutations in a new RING finger gene on Xp22. Nat Genet 17:285-291. Ramakers GJ. 2002. Rho proteins, mental retardation and the cellular basis of cognition.

Trends Neurosci 25 :191 -199. Ramser J, Abidi FE, Burckle cA, Lenski c, Toriello H, wen G, Lubs HA, Engert S, Stevenson RE, Meindl A, Schwartz CE, Nguyen G. 2005. A unique exonic splice

enhancer mutation in a family with X-linked mental retardation and epilepsy points to

a novel role of the renin receptor. Hum. Mol. Genet ' 14:.1019-1027. Ramser J, Winnepenninckx B, Lenski C, Errijgers V, Platzer M, Schwartz CE, Meindl A, Kooy RF. 2004. A splice site mutation in the methyltransferase gene FTSJI in Xpll.23 is associated with non-syndromic mental retardation in a large Belgian family (MRX9). J Med Genet 4l:679-683. Rao E, Blaschke RJ, Marchini A, Niesler B, Burnett M, Rappold G4.2001. The Leri-Weill and Turner syndrome homeobox gene SHOX encodes a cell-type specific transcriptional activator. Hum Mol Genet 10:3083-3091. Reed EW, Reed SC. 1965. Mental Retardation: A Family Study. Philadelphia: W. B.

Saunders. Renieri A, Pescucci C, Longo I, Ariani F, Mari F, Meloni I. 2005. Non-syndromic X-linked mental retardation: from a molecular to a clinical point of view. J Cell Physiol 204:8-

20. Riley BE, Xu Y, ZoghbiHY, Orr HT. 2004. The Effects of the Polyglutamine Repeat Protein Ataxin-l on the UbL-UBA Protein AlUp. J. Biol. Chem. 279:42290-42301. Ritz-Laser B, Estreicher A, Klages N, Saule S, Philippe J. 1999. Pax-6 and Cdx-213 interact to activate glucagon gene expression on the Gl control element. J Biol Chem 274:4124- 4132. Rizzoti K, Brunelli S, Carmignac D, Thomas PQ, Robinson IC, Lovell-Badge R. 2004. SOX3 is required during the formation of the hypothalamo-pituitary axis. Nat Genet 36:247- 255. Roberts SG. 2000. Mechanisms of action of transcription activation and repression domains. CellMol Life Sci 57:1149-1160. Robertson SP, Twigg SR, Sutherland-Smith AJ, Biancalana V, Gorlin RJ, Horn D, Kenwrick sJ, Kim cA, Morava E, Newbury-Ecob R, orstavik KH, Quarell ow, Schwartz cE, Shears DJ, Suri M, Kendrick-Jones J, Wilkie AO. 2003. Localized mutations in the REFERENCES -273

gene encoding the cytoskeletal protein filamin A cause diverse malformations in humans. Nat Genet 33:487-491.

Roesch K, Curran SP, TranebjaergL, Koehler Cl/..2002. Human deafness dystonia syndrome

is caused by a defect in assembly of the DDPI/TIMMSa-TIMMI3 complex. Hum Mol Genet 1l:477-486.

Roessler BJ, Bell G, Heidler S, Seino S, Becker M, Palella TD. 1990. Cloning of two distinct copies of human phosphoribosylpyrophosphate synthetase oDNA. Nucleic Acids Res

1 8: 193.

Ropers HH, Hamel BC. 2005. X-linked mental retardation. Nat Rev Genet 6:46-57. Rosenberger G, Jantke I, Gal A, Kutsche K.2003. Interaction of alphaPlX (ARHGEF6) with beta-parvin (PARVB) suggests an involvement of alphaPlX in integrin-mediated signaling. Hum Mol Genet 12:155-167. Rosenthal A, Jouet M, Kenwrick S. 1992. Aberrant splicing of neural cell adhesion molecule

L1 mRNA in a family with X-linked hydrocephalus. Nat Genet 2:107-112. Rudnicki MA, Braun T, Hinuma S, Jaenisch R. 1992. Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal

muscle development. Cell 7 I :383-390. Rudnicki MA, Schnegelsberg PN, Stead RH, Braun T, Arnold HH, Jaenisch R. 1993. MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 75:1351-1359. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol4:406-425.

Salomons GS, van Dooren SJ, Verhoeven NM, Cecil KM, Ball WS, Degrauw TJ, Jakobs C. 2001. X-linked creatine-transporter gene (SLC6A8) defect: a new creatine-deficiency

syndrome. Am J Hum Genet 68:1497-1500.

Salomons GS, van Dooren SJ, Verhoeven NM, Marsden D, SchwartzC, Cecil KM, DeGrauw

TJ, Jakobs C.2003. X-linked creatine transporter defect: an overview. J Inherit Metab Dis 26:309-318. Sapir T, Elbaum M, Reiner O. 1997. Reduction of microtubule catastrophe events by LISI,

platelet-activating factor acetylhydrolase subunit. Embo J I 6:697 7 -6984.

Saras J, Heldin CH. 1996. PDZ domains bind carboxy-terminal sequences of target proteins. Trends Biochem Sci 2l:455-458. Saugier-Veber P, Munnich A, Bonneau D, Rozet JM, Le Merrer M, Gil R, Boespflug-Tanguy O. 1994. X-linked spastic paraplegia and Pelizaeus-Merzbacher disease are allelic

disorders at the proteolipid protein locus. Nat Genet 6:257-262. REFERENCES -274

Scala E, Ariani F, Mari F, Caselli R, Pescucci C, Longo I, Meloni I, Giachino D, Bruttini M, Hayek G, Zappella M, Renieri A. 2005. CDKL5/STK9 is mutated in Rett syndrome variant with infantile spasms. J Med Genet 42:103-107. Scheffer IE, Wallace RH, Phillips FL, Hewson P, Reardon K, Parasivam G, Stromme P, Berkovic SF, Gecz J, Mulley JC.2002. X-linked myoclonic epilepsy with spasticity and intellectual disability: mutation in the homeobox gene ARX. Neurology 59:348- 3s6. Schutz CK, Ives EJ, Chalifoux M, Maclaren L, Farrell S, Robinson PD, White BN, Holden JJ. 1996. Regional localization of an X-linked mental retardation gene to Xp2l.l-

Xp22.l3 (MRX38). Am J Med Genet 64:89-96. Serebriiskii I,KhazakV, Golemis F,A.1999. A Two-hybrid Dual Bait System to Discriminate Specificity of Protein Interactions. J. Biol. Chem. 274:17080-17087. Serebriiskii IG, Mitina O, Pugacheva EN, Benevolenskaya E, Kotova E, Toby GG, Khazak V, Kaelin WG, Chernoff J, Golemis EA. 2002. Detection of Peptides, Proteins, and Drugs That Selectively Interact With Protein Targets. Genome Res. 12:1785-1791. Serebriiskii IG, Mitina OV, Chernoff J, Golemis E4.2001. Two-hybrid dual bait system to discriminate specificity of protein interactions in small GTPases. Methods Enzymol 332:277-300. Seufert DW, Prescott NL, El-Hodiri HM. 2005. Xenopus aristaless-related homeobox (xARX) gene product functions as both a transcriptional activator and repressor in forebrain development. Dev Dyn 232:373-324. Shoichet SA, Hoffmann K, Menzel C, Trautmann lJ, Moser B, Hoeltzenbein M, Echenne B, Partington M, Van Bokhoven H, Moraine C, Fryns JP, Chelly J, Rott HD, Ropers HH, Kalscheuer VM. 2003. Mutations in the ZNF41 gene are associated with cognitive deficits: identification of a new candidate for X-linked mental retardation. Am J Hum

Genet 73:1341-1354.

Simeone A, Acampora D, Pannese M, D'Esposito M, Stornaiuolo A, Gulisano M, Mallamaci A, Kastury K, Druck T, Huebner K, et al. 1994a. Cloning and characterization of two

members of the vertebrate Dlx gene family. Proc Natl Acad Sci U S A 9l:2250-2254. Simeone A, D'Apice MR, Nigro V, Casanova J, Graziani F, Acampora D, Avantaggiato V. lg94b. Orthopedia, a novel homeobox-containing gene expressed in the developing CNS of both mouse and Drosophila. Neuron 13:83-101. Smahi A, Courtois G, Vabres P, Yamaoka S, Heuertz S, Munnich A, Israel A, Heiss NS, Klauck SM, Kioschis P, Wiemann S, Poustka A, Esposito T, Bardaro T, REFERENCES -275

Gianfrancesco F, Ciccodicola A, D'Urso M, Woffendin H, Jakins T, Donnai D, Stewart H, Kenwrick SJ, Aradhya S, YamagataT, Levy M, Lewis RA, Nelson DL. 2000. Genomic rearrangement in NEMO impairs NF-kappaB activation and is a cause of incontinentia pigmenti. The International Incontinentia Pigmenti (IP) Consortium' Nature 405:466-472. Smith DS, Niethammer M, Ayala R, Zhou Y, Gambello MJ, Wynshaw-Boris A, Tsai LH. 2000. Regulation of cytoplasmic dynein behaviour and microtubule organization by mammalian Lisl. Nat Cell Biol 2:767-775. Smith S, Jaynes J.1996. A conserved region of engrailed, shared among all en-, gsc-, Nkl-, Nk2- and msh-class homeoproteins, mediates active transcriptional repression in vivo.

Developme nt 722:3 I 4l-3 1 5 0. Son HS, Hong BH, Lee CW, Yun S, Kim KS. 2001. A new type of helix pattern in

polyalanine peptide. J Am Chem Soc 123:514-515.

Songyang Z,Fanning AS, Fu C, Xu J, Marfatia SM, Chishti AH, Crompton A, Chan AC, Anderson JM, Cantley LC. 1997 . Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 275:73-77. Stachel SE, Grunwald DJ, Myers PZ. 1993. Lithium perturbation and goosecoid expression identifl a dorsal specification pathway in the pregastrula zebrafish. Development 117:1261-1274. Stamataki D, Kastrinaki M, Mankoo BS, Pachnis V, Karagogeos D.2001. Homeodomain proteins Moxl and Mox2 associate with Paxl and Pax3 transcription factors. FEBS Lett 499:274-278. Staudinger J, Lu J, Olson EN. 1997. Specific interaction of the PDZ domain protein PICKI with the COOH terminus of protein kinase C-alpha. J Biol Chem 272:32019-32024. Staudinger J,Zhou J, Burgess R, Elledge SJ, Olson EN. 1995. PICKl: a perinuclear binding protein and substrate for protein kinase C isolated by the yeast two-hybrid system. J Cell Biol 128:263-271. Stepp ML, Cason AL, Finnis M, Mangelsdorf M, Holinski-Feder E, Macgregor D, MacMillan

A, Holden JJ, Gecz J, Stevenson RE, SchwartzCE.2005. XLMR in MRX families 29, 32, 33 and 38 results from the dup24 mutation in the ARX (Aristaless related homeobox) gene. BMC Med Genet 6:16. Stock DW, Ellies DL, Zhao Z,Ekker M, Ruddle FH, Weiss KM. 1996. The evolution of the vertebrate Dlx gene family. Proc NatlAcad Sci U S A 93:10858-10863. REFERENCES -276

Stricker NL, Christopherson KS, Yi BA, Schatz PJ, Raab RW, Dawes G, Bassett DE, Jr., Bredt DS, Lili4..1997.PDZ domain of neuronal nitric oxide synthase recognizes novel

C-terminal peptide sequences. Nat Biotechnol 15:336-342. Stromme P, Sundet K, Mork C, Cassiman JJ, Fryns JP, Claes S. 1999. X linked mental retardation and infantile spasms in a family: new clinical data and linkage to Xpll.4-

Xp22.11. J Med Genet 36:374-378. Stromme P, Mangelsdorf ME, Shaw MA, Lower KM, Lewis SM, Bruyere H, Lutcherath V, Gedeon AK, Wallace RH, Scheffer IE, Turner G, Partington M, Frints SG, Fryns JP, Sutherland GR, Mulley JC, Gecz J. 2002. Mutations in the human ortholog of

Aristaless cause X-linked mental retardation and epilepsy. Nat Genet 30:441-445. Sui L, Gilbeft ME. 2003. Pre- and postnatal propylthiouracil-induced hypothyroidism impairs synaptic transmission and plasticity in area CAI of the neonatal rat hippocampus.

Endocrinolo gy I 44 :419 5 -4203. Sumiyama K, rüashio-Watanabe K, Saitou N, Hayakawa T, Ueda S. 1996. Class III POU genes: generation of homopolymeric amino acid repeats under GC pressure in

mammals. J Mol Evol 43: 170-178. Summerton J. 1999. Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim Biophys Acta 1489:141-158. Suzuki A, Yoshida M, Yamamoto H, OzawaB.1992. Glycoprotein-binding site of dystrophin is confined to the cysteine-rich domain and the first half of the carboxy-terminal domain. FEBS Lett 308:154-160. Tajbakhsh S, Rocancourt D, Cossu G, Buckingham M. 1997. Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and Myf-5 act upstream of MyoD. Cell 89:127-138. TakaiY, SasakiT, Matozaki T. 2001. Small GTP-binding proteins. PhysiolRev 81:153-208. Takei Y, Harada A, Takeda S, Kobayashi K, Terada S, Noda T, Takahashi T, Hirokawa N. 1995. Synapsin I deficiency results in the structural change in the presynaptic terminals in the murine nervous system. J Cell Biol 131:1789-1800. Takenaka M, Noguchi T, Inoue H, Yamada K, Matsuda T, Tanaka T. 1989. Rat pyruvate kinase M gene. Its complete structure and characterization of the 5'-flanking region. J

Biol Chem 264:2363-2367 . Takenaka M, Noguchi T, Sadahiro S, Hirai H, Yamada K, Matsuda T, Imai E, Tanaka T. 1991. Isolation and characterization of the human pyruvate kinase M gene. Eur J Biochem 198:101-106. REFERENCES -277

Takeya R, Takeshige K, Sumimoto H. 2000. Interaction of the PDZ domain of human PICKI with class I ADP-ribosylation factors. Biochem Biophys Res Commun267:149-155. Tanaka T, Serneo FF, Higgins C, Gambello MJ, Wynshaw-Boris A, Gleeson JG. 2004a. Lisl and doublecortin function with dynein to mediate coupling of the nucleus to the centrosome in neuronal migration. J Cell Biol 165:709-721' Tanaka T, Serneo FF, Tseng HC, Kulkarni AB, Tsai LH, Gleeson JG. 2004b. Cdk5 phosphorylation of doublecortin ser297 regulates its effect on neuronal migration. Neuron 4l:215-227.

Tang J, Wu S, Liu H, Stratt R, Barak OG, Shiekhattar R, Picketts DJ, Yang X.2004. A novel transcription regulatory complex containing death domain-associated protein and the ATR-X syndrome protein. J Biol Chem 279:20369-20377. Tarpey P, Parnau J, Blow M, Woffendin H, Bignell G, Cox C, Cox J, Davies H, Edkins S,

Holden S, Korny A, Mallya U, Moon J, O'Meara S, Parker A, Stephens P, Stevens C,

Teague J, Donnelly A, Mangelsdorf M, Mulley J, Partington M, Turner G, Stevenson R, Schwartz C, Young I, Easton D, Bobrow M, Futreal PA, Stratton MR, Gecz J, Wooster R, RaymondFL.2004. Mutations in the DLG3 gene cause nonsyndromic X-

linked mental retardation. Am J Hum Genet 75:318-324. Toby GG, Golemis EA. 2001. Using the yeast interaction trap and other two-hybrid-based

approaches to study protein-protein interactions. Method s 24:201 -277 . Tochio H,Zhang Q, Mandal P, Li M, Zhang M. 1999. Solution structure of the extended neuronal nitric oxide synthase PDZ domain complexed with an associated peptide. Nat Struct Biol6:417-421. Torres GE, Yao WD, Mohn AR, Quan H, Kim KM, Levey AI, Staudinger J, Caron MG. 2001. Functional interaction between monoamine plasma membrane transporters and the synaptic PDZ domain-containing protein PICKI. Neuron 30:12l-134- Torres R, Firestein BL, Dong H, Staudinger J, Olson EN, Huganir RL, Bredt DS, Gale NV/, Yancopoulos GD. 1998.PDZ proteins bind, cluster, and synaptically colocalize with

Eph receptors and their ephrin ligands. Neuron 21:1453-1463.

Trivier E, De Cesare D, Jacquot S, Pannetier S, Zackai E, Young I, Mandel JL, Sassone-Corsi P, Hanauer A. 1996. Mutations in the kinase Rsk-2 associated with Coffin-Lowry syndrome. Nature 384:567 -57 0. Trockenbacher A, Suckow V, Foerster J, Winter J, Krauss S, Ropers HH, Schneider R, Schweiger S. 2001. MIDl, mutated in Opitz syndrome, encodes an ubiquitin ligase

that targets phosphatase 2A for degradation. Nat Genet 29:287 -294. REFERENCES - 278

Tuchman M, Jaleel N, Morizono H, Sheehy L, Lynch MG. 2002. Mutations and polymorphisms in the human ornithine transcarbamylase gene. Hum Mutat 19:93-107. Tumer G, Partington M, Kerr B, Mangelsdorf M, Gecz J.2002.Yariable expression of mental retardation, autism, seizures, and dystonic hand movements in two families with an identicalARX gene mutation. Am J Med Genet ll2:405-4ll- Turner G, Tumer 8.1974. X-linked mental retardation. J Med Genet 11:109-113.

Turner G, 'Webb T, Wake S, Robinson H. 1996. Prevalence of fragile X syndrome. Am J Med Genet 64:196-197. Utsch B, Becker K, Brock D, Lenuze MJ, Bidlingmaier F, Ludwig M. 2002. A novel stable polyalanine tpoly(A)l expansion in the HOXAI3 gene associated with hand-foot- genital syndrome: proper function of poly(A)-harbouring transcription factors depends

on a critical repeat length? Hum Genet 110:488-494. Uyama E, Tsukahara T, Goto K, Kurano Y, Ogawa M, Kim YJ, Uchino M, Arahata K. 2000. Nuclear accumulation of expanded PABP2 gene product in oculopharyngeal muscular

dystrophy. Muscle Nerve 23 :l 5 49 -1 5 5 4. Uyanik G, Aigner L, Martin P, Gross C, Neumann D, Marschner-Schafer H, Hehr U, Winkler

J. 2003. ARX mutations in X-linked lissencephaly with abnormal genitalia. Neurology

67:232-235. Van Aelst L, Cline IHT.2004. Rho GTPases and activity-dependent dendrite development. Curr Opin Neurobiol 14:297-304. Van Aelst L, D'Souza-Schorey C. 1997. Rho GTPases and signaling networks. Genes Dev l7:2295-2322. Van Esch H, Poirier K, de Zegher F, Holvoet M, Bienvenu T, Chelly J, Devriendt K, Fryns JP. 2004. ARX mutation in a boy with transsphenoidal encephalocele and hypopituitarism. Clin Genet 65:503-505. Verkerk AJMH, Pieretti M, Sutcliffe JS, Fu Y-H, Kuhl DP{,Pizzuti A, Reiner O, Richards S, Victoria MF, Zhang F. 1991. Identifìcation of a gene (FMR-I) containing a CGG

repeat coincident with a breakpoint cluster region exhibiting length variation in fragile

X syndrome. Cell 65 :90 5-914. Vervoort VS, Beachem MA, Edwards PS, Ladd S, Miller KE, de Mollerat X, Clarkson K, DuPont B, Schwartz CE, Stevenson RE, Boyd E, Srivastava AK. 2002. AGTR2 mutations in X-linked mental retardation. Science 296:2401-2403. Vetter IR, Amdt A, Kutay U, Gorlich D,'Wittinghofer A. 1999. Structural view of the Ran- Importin beta interaction at 2.3 A resolution. Cell 97:635-646- REFERENCES -279

Vigevano F, Fusco L, Cusmai R, Claps D, Ricci S, Milani L. 1993. The idiopathic form of

West syndrome. Epilep sia 3 4:7 43 -7 46. Wang WL, Yeh SF, Chang YI, Hsiao SF, Lian WN, Lin CH, Huang CY, Lin WJ. 2003. PICKI, an anchoring protein that specifically targets protein kinase Calpha to mitochondria selectively upon serum stimulation in NIH 3T3 cells. J Biol Chem 278:37705-37712. Wasiak S, Legendre-Guillemin V, Puertollano R, Blondeau F, Girard M, de Heuvel E, Boismenu D, Bell AW, Bonifacino JS, McPherson PS. 2002. Enthoprotin: a novel clathrin-associated protein identified through subcellular proteomics. J Cell Biol

I 58:855-862. Weinberg ES, Allende ML, Kelly CS, Abdelhamid A, Murakami T, Andermann P, Doerre OG, Grunwald DJ, Riggleman 8.1996. Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development122..271-280. Wiggan O, Taniguchi-Sidle A, Hamel PA. 1998. Interaction of the pRB-family proteins with

factors containing paired-l ike homeodomains. Onco ge ne I 6:227 -23 6. Williams JM, Chen GC, Zhl L, Rest RF. 1998. Using the yeast two-hybrid system to identifu human epithelial cell proteins that bind gonococcal Opa proteins: intracellular gonococci bind pyruvate kinase via their Opa proteins and require host pyruvate for

growth. Mol Microbiol 27 :17 | -186. Wilson DS, Guenther B, Desplan C, Kuriyan J. 1995. High resolution crystal structure of a paired (Pax) class cooperative homeodomain dimer on DNA. Cell82l.709-719. Wilson JM, Kelley V/N. 1983. Molecular basis of hypoxanthine-guanine phosphoribosyltransferase deficiency in a patient with the Lesch-Nyhan syndrome. J

Clin Invest 7 l:1331-1335. Wilson P, Morris C, Anson D, Occhiodoro T, Bielicki J, Clements P, Hopwood J. 1990. Hunter Syndrome: Isolation of an Iduronate-2-Sulfatase cDNA Clone and Analysis of Patient DNA. PNAS 87:8531-8535. Wilson PA, Hemmati-Brivanlou A. 1997. Vertebrate neural induction: inducers, inhibitors,

and a new synthesis. Neuron 18:699-710. Woda JM, Pastagia J, Mercola M, Artinger KB. 2003. Dlx proteins position the neural plate border and determine adjacent cell fates. Development 130:331-342. Wong M, Trevathan E. 2001. Infantile spasms. Pediatr Neurol 24:89-98. V/orld Health Organisation. 1993. International statistical classification of diseases and related health problems: lOth revision. In. Geneva: WHO. REFERENCES - 280

Xia J, Zhang X, Staudinger J, Huganir RL. 1999. Clustering of AMPA receptors by the

synaptic PDZ domain-containing protein PICK1. Neuron 22:179-187 . Xiao B, Tu JC, Worley PF. 2000. Homer: a link between neural activity and glutamate receptor function. Cun Opin Neurobiol 10:370-374- Xing J, Ginty DD, Greenberg ME. 1996. Coupling of the RAS-MAPK Pathway to Gene Activation by RSK2, a Growth Factor-Regulated CREB Kinase. Science 273:959-963. Xu J, Chen Z. 2003. Advances in molecular cytogenetics for the evaluation of mental

retardation. Am J Med Genet C Semin Med Genet 117:15-24. Xu M, Lewis RV. 1990. Structure of a protein superfiber: spider dragline silk. Proc Natl Acad

Sci U S A87:7120-7124. Xu Q, Wang Y, Dabdoub A, Smallwood PM, williams J, woods c, Kelley MW, Jiang L, Tasman W,ZhangK, Nathans J.2004. Vascular Development in the Retina and Inner Ear: Control by Norrin and Frizzled-4, a High-Affinity Ligand-Receptor Pair. Cell I 16:883-895. Yang X, Matsuda K, Bialek P, Jacquot S, Masuoka HC, Schinke T, Li L, Brancorsini S,

Sassone-Corsi P, Townes TM. 2004. ATF4Is a Substrate of RSK2 and an Essential Regulator of Osteoblast Biology: Implication for Coffin-Lowry Syndrome. Cell 117:387-398. Yen PM.2001. Physiological and molecular basis of thyroid hormone action. Physiol Rev 8l:1097-1142. Yool DA, Edgar JM, Montague P, Malcolm S. 2000. The proteolipid protein gene and myelin disorders in man and animal models. Hum. Mol. Genet. 9:987-992' Yoshida M, Ozawa E. 1990. Glycoprotein complex anchoring dystrophin to sarcolemma. J Biochem (Tokyo) 108:7 48-7 52. Yoshida M, Suda Y, Matsuo I, Miyamoto N, Takeda N, Kuratani S, Aizawa S. 1997. Emxl and Emx2 functions in development of dorsal telencephalon. Development 124:l0l-

111. Yoshihara S-i, Omichi K, Yanazawa M, Kitamura K, Yoshihara Y. 2005. Arx homeobox gene is essential for development of mouse olfactory system. Development 132:757-

762. Yu S, Pritchard M, Kremer E, Lynch M, Nancarrow J, Baker E, Holman K, Mulley JC, Warren ST, Schlessinger D, et al. 1991. Fragile X genotype charactetized by an

unstable region of DNA. Science 252:1179-1181- REFERENCES - 281

Zechner U, Wilda M, Kehrer-Sawatzki H, Vogel W, Fundele R, Hameister H. 2001. A high density of X-linked genes for general cognitive ability: a run-away process shaping human evolution? Trends Genet 17:697-701. Zemni R, Bienvenu T, Vinet MC, Sefiani A, Carie A, Billuart P, McDonell N, Couvert P, Francis F, Chafey P, Fauchereau F, Friocourt G, des Portes V, Cardona A, Frints S, Meindl A, Brandau O, Ronce N, Moraine C, van Bokhoven H, Ropers HH, Sudbrak R, Kahn A, Fryns JP, Beldjord C, Chelly J. 2000. A new gene involved in X-linked mental retardation identified by analysis of anX;2 balanced translocation. Nat Genet 24:167-170.

Zhang C, Sweezey NB, Gagnon S, Muskat B, Koehler D, Post M, Kaplan F. 2000. A novel karyopherin-beta homolog is developmentally and hormonally regulated in fetal lung.

Am J Respir Cell Mol Biol22:451-459.

ZhangH, Webb DJ, Asmussen H, Niu S, Horwitz AF. 2005. A GITI/PX/Rac/PAK signaling

module regulates spine morphogenesis and synapse formation through MLC. J

Neurosci 25 :337 9 -3388. Zhang YA, Okada A, Lew CH, McConnell SK. 2002. Regulated nuclear trafficking of the homeodomain protein otxl in cortical neurons. Mol Cell Neurosci 19:430-446. ZhaoY, Westphal H.2002. Homeobox genes and human genetic disorders. Curr Mol Med 2:13-23. Ziman MR, Kay PH. 1998. A conserved TNSTCCT motif in the octapeptide-encoding region of Pax genes which has the potential to direct cytosine methylation. Gene 223:303-

308. Amendments

1. 1.2.1.3 SOX3 is a HMG box-containing transcription factor not a homeodomain

protein.

2. Chapter 5, pl77 line I2lI3, "As a cell line expressing ARX initially available..."

changed to "As a cell line expressing ARX was not initially available....".

3. Chapter 5, p198 line 12,"colocalize" not "colocalizes".

4. Chapter 5,p20I line 6, replace "form" with "from".

5. Chapter 6,p226line 13, remove the word "strongly".

6. Chapter 6, p224line 4, insert the sentence "The primary criteria used to determine the

24 hpf developmental stage for uninjected embryos grown at 28.5"C was the presence

of approximately 30 somites, the angle of the head to the trunk which was

approximately L20 degrees and a body length around 1.9 mm.".

7 . Chapter 6, p225 line 4, replace "enabling" with "enabled".

8. Chapter 6,p226line 9/10, insert "in all observed embryos" before "....in response to

microinjection of the arx morpholinos....".

9. Chapter 6 p229line 14, replace "affective" with "effective".

10. Chapter 6, p23l line 9, insert the sentence "However, it should be noted that the

modest reduction of emx3 forebrain expression in 12 hpf embryos may have been due

to a slight developmental delay rather than a response to arx protein knockdown.".

11. Chapter 7 p240line 8 insert the following paragraphs:

There are several potential avenues to investigate as a direct result of this thesis. As noted previously, four naturally occurring point mutations within basic amino acid residues located at the N-terminal end of the ARX homeodomain have been shown to cause XLAG

(Kitamura et al., 2002; Uyanik et a1.,2003; Kato et al., 2004) and Proud syndrome (Kato et a1.,2004). This same region in PAX6 was found by Ploski et aI. (2004) to bind to IPO13 along with the basic residues at the C-terminal of the PAX6 homeodomain. Therefore, the next logical step 'would be to investigate whether these mutations affect the interaction between ARX and IPO13. This can be done by introducing the naturally occurring mutations within the N-terminal basic region of the ARX homeodomain and assessing any changes in the interaction with IPO13 by yeast two-hybrid analysis. The interaction between IPO13 and

ARX can be investigated by deleting the N-terminal or C-terminal basic regions of the ARX homeodomain and analysed in both yeast and mammalian cell models. These findings would

address if other import mechanisms besides IPO13 are involved in transporting ARX into the

nucleus in mammalian cells.

Further studies into whether PICK1 is involved in PKCo¿ regulated phosphorylation of ARX

would also be very interesting. The absence of the C-terminus of ARX, which contains the

PICK| binding site and the aristaless domain, can cause XLAG (Kitamura et al., 2002;

Uyanik et a1.,2003; Hahn et a1.,2004; Hartmann et a1.,2004; Kato et a1.,2004) and ISSX

(Strpmme et al., 2002). To ascertain whether ARX is a phosphoprotein, and if PKCcr

phosphorylates ARX, in vitro kinase assays can be used. Addition of PICK1 to these in vitro

kinase assays would determine if PICK1 modulates (increases or decreases) phosphorylation

of ARX by PKCcr. The amino acids in ARX that are important for PICK1 binding can also be

confirmed by either deleting or mutating residues of the PICK1 binding site at the C-terminus

of ARX. The interaction of ARX and PICK1 on the subsequent phosphorylation of the

homeobox transcription factor, likely by PKCa, may provide the molecular switch for ARX

modulated transcriptional activator or repressor activity. Hence, these types of investigations

could contribute to elucidating the function and regulation of ARX across development.

12. Insert into references, p278:

"Tucker M, Sieber M, Morphew M, Han M. 2005. The Caenorhabditis elegans

aristaless orthologue, ak-I, is required for maintaining the functional and structural

integrity of the amphid sensory organs. Mol Biol Cell 16:4695-4704.