DOCSLIB.ORG

Developmental Biology Catalog

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Developmental Biology Catalog ptglab.com 1 ANTIBODIES FOR DEVELOPMENTAL BIOLOGY www.ptglab.com 2 Antibodies For Developmental Biology Front Cover: IF result (trunk or trunck-associated region; nucleus stain; RED) of NKX2-2 antibody (13013-1-AP) with E16.5 mouse pancreas by Dr. Nicholas George, Sarvetnick Lab – UNMC. (Green, E-Cadherin; RED, NKX2-2; Blue, DAPI). ptglab.com 3 WELCOME Foreword Developmental biology covers a broad spectrum of scientific research relating to the growth and development of living things. Not only does it concern the embryogenic events immediately following fertilization, it also encompasses the genetic control of cell growth, differentiation and morphogenesis – key components of regeneration and aging in the adult organism. In this development-focused catalog This catalog is essentially a shortlist you will find antibodies to those targets of around one quarter of the antibodies involved in pattern formation, such as Proteintech has for developmental biology HOX gene products and proteins involved protein targets. If you can’t find an antibody in Notch and Hedgehog signaling; neural to your target of choice here, we’re confident tube formation, such as sonic hedgehog that with over 2,000 primary antibodies protein; and organogenesis such as Wnt, relating to development in the complete FGF, BMP and EYA proteins. At the center Proteintech inventory you’ll find what you’re of the catalog, you will also find a primer looking for online at www.ptglab.com. on the primary cilium, with details on Proteintech®* antibodies recognizing the proteins involved in the generation and maintenance of this vital developmental structure. What’s Inside 6–7 Focus Article Antibodies For Cilia Development 8 Focus Article Investigating Kidney Development With Proteintech’s SIX2 Antibody 9–11 Antibodies: ABLIM1 GSK3B 12–13 Antibodies For Cilia Development 14–17 Antibodies: GSK3B ZHX2 18 Contact Us Please Note: All products featured in this catalog are for research use only. *Proteintech® and the Proteintech logo are trademarks of Proteintech Group registered in the US Patent and Trademark Office. 4 Antibodies For Developmental Biology THE BENCHMARK IN ANTIBODIES Since the day it was founded, Proteintech has been making all of its products to the highest standards possible whilst taking complete responsibility for the quality of each product. • Proteintech makes every single antibody in its 12,000+ catalog. • Each Proteintech product is unique and cannot be bought under a different label. • Antibodies are tested with siRNA treated samples to demonstrate specificity. • It works in every single species and application or get a full money-back refund. Proteintech has over 12,000 antibodies in its extensive catalog, all fully validated and available for next day delivery. www.ptglab.com ptglab.com 5 6 Antibodies For Developmental Biology FOCUS ARTICLES Antibodies For Cilia Development The primary cilium acts as a sensory organelle that transfers By Deborah Grainger information from the environment to the cell interior. Once thought of as an evolutionary artifact, this organelle is now understood to be crucial for regulating important cellular processes, including the cell cycle, cytoskeletal organization, intraflagellar transport and signaling pathways such as hedgehog, notch and canonical and non-canonical Wnt/planar call polarity (PCP) pathways. Proteintech has over 70 antibodies recognizing cilia-related proteins in its catalog. This article reviews a selection of these targeting proteins involved in cilia development, or ciliogenesis… CP110 CP110, also named CCP110 or KIAA0419, antibody was utilized for Western is a 110 kDa centriolar protein, not to be blotting (WB) and immunofluorescence Catalog Number confused with CEP110 (centriolin). CP110 studies looking at the impact of blocking positively regulates centriole duplication or upregulating M129 on ciliogenesis 12780-1-AP while restricting centriole elongation and and cilia elongation. Cilia formation was ciliogenesis. It acts as a key negative regulator inhibited when M129 levels were depleted, Type of ciliogenesis in collaboration with CEP97 and, conversely, potently upregulated with by capping the mother centriole, thereby M129 overexpression. Correspondingly, WB Rabbit Polyclonal preventing cilia formation. experiments showed that CP110 protein The Proteintech antibody anti-CP110 levels were depleted in the presence Applications (12780-1-AP) has appeared in several of overexpressed M129. Several other ELISA, FC, IF, IHC, IP, WB publications since its first appearance Proteintech antibodies were also used in Nature Cell Biology in mid-2012. In by the authors for this work, including this paper the authors describe CP110’s those targeting housekeeping protein 34 Publications regulation by the microRNA miR-129-3p GAPDH (60004-1-Ig), the actin nucleation (M129). The Proteintech anti-CP110 protein ARP2 (10922-1-AP) and actin binding LIM protein 1 (ABLIM1, 15129-1-AP). KD/KO Validated Immunohistochemical of paraffin-embedded human prostate cancer using CP110 antibody (12780-1-AP) at a dilution of 1:100 (10x objective). IFT88 IFT88 (intraflagellar transport protein 88; Proteintech’s polyclonal IFT88 antibody also known as TG737 or TTC10) is a component (13967-1-AP) has appeared in over 40 Catalog Number of IFT particles required for cilium biogenesis. publications to date, recently appearing in Along with other molecular motors and IFT Nature Cell Biology in June 2014. The paper 13967-1-AP particles, IFT88 helps mediate intraflagellar looks at the role of another protein, Kif7, transport, an important process essential for in mammalian Hedgehog (Hh) signaling and Type the assembly and maintenance of both primary cilium tip organization, but utilizes anti-IFT88 and motile cilia and flagella in many organisms. as a marker for cilium retraction along with Rabbit Polyclonal IFT88 also localizes to spindle poles during acetylated tubulin in immunofluorescence mitosis and is required for spindle orientation. staining. The IFT88 signal outlines the original Applications Defects in IFT88 lead to polycystic kidney shape of the cilium, while acetylated tubulin disease, characterized by progressive cyst marks the shrinking microtubules of the ELISA, IF, IHC, IP, WB development and bilaterally enlarged kidneys. retreating cilium. The Proteintech polyclonal IFT88 antibody 102 Publications was raised against the C-terminal region of human IFT88 and can detect endogenous levels of IFT88. KD/KO Validated ptglab.com 7 Acetylated α-tubulin (K40) The acetylation of K40 on α-tubulin is a Proteintech’s anti-ace tubulin (K40) antibody hallmark of stable microtubules, and anti- (66200-1-Ig) can be used to reliably mark the Catalog Number acetylated α-tubulin (anti-ace tubulin) is the cilium; as mentioned previously, it can also antibody of choice for researchers wishing to be used to gauge cilium retraction in tandem 66200-1-Ig perform control immunofluorescence staining with IFT88. of stable cilia. The acetylated residue of Type α-tubulin is K40, which is catalyzed by Mouse Monoclonal α-tubulin acetyl-transferase (α-TAT). Applications ELISA, IF, IHC, WB 4 Publications Immunofluorescent analysis of MDCK cells using TUBA1A (ace-40Lys) antibody (66200-1-Ig) at a dilution of 1:50 and Alexa Fluor 488-congugated AffiniPure Goat Anti-Mouse IgG (H+L). ARL13B ARL13B, (also named ARL2L1), is a small one that further investigates its interaction ciliary G protein of the Ras superfamily. with the phosphatase inositol polyphosphate- Catalog Number Localized to cilia, it is required for cilium 5-phosphatase E (INPP5E) – another JBTS- biogenesis as well as sonic hedgehog signaling causing protein when mutated. Along with 17711-1-AP and antibodies targeting ARL13B can be used a C-terminal motif and prenylation signals, to mark the cilium (PMID:22072986). Defects ciliary targeting of INPP5E is facilitated by Type in ARL13B lead to Joubert syndrome (JBTS), ARL13B. ARL13B missense mutations that an autosomal recessive disorder characterized cause JBTS in humans disrupt the ARL13B– Rabbit Polyclonal by malformation of the cerebellum. INPP5E interaction. The paper, which appeared Consequentially JBTS patients lack muscle in PNAS at the end of 2012, identifies several Applications control and tone, among other defects. more centrosomal and ciliary proteins ELISA, IF, IHC, IP, WB Proteintech’s anti-ARL13B antibody involved in ARL13B–INPP5E interactions, (17711-1-AP) has featured in 30 peer- and found that this functional network of reviewed publications to date, including proteins is also involved in JBTS and the 114 Publications related ciliopathy nephronophthisis. KD/KO Validated BBS2 No information is available regarding Proteintech®’s BBS2 antibody (11188-2-AP) the specific function of Bardet–Biedl has appeared in several publications since Catalog Number syndrome (BBS) protein 2, but it is known its addition to the catalog. One of these to be one of the seven BBS proteins that appearances, in the Journal Cell, describes 11188-2-AP form the stable core of the BBSome. The how the BBSome establishes an electron-rich BBSome is a component of the ciliary basal coat complex that sorts membrane proteins Type body and is integral to the formation of a to primary cilia, including the somatostatin functional primary cilium as mutations in receptor 3 (SSTR3) signaling molecule. The Rabbit Polyclonal BBS proteins, as well as several others, lead BBSome coat model suggested by the authors to their eponymous syndrome BBS. BBS is a could explain the variety
Load more

Recommended publications
  • Supplementary Information
    doi: 10.1038/nature08795 SUPPLEMENTARY INFORMATION Supplementary Discussion Population naming In some contexts, the indigenous hunter-gatherer and pastoralist peoples of southern Africa are referred to collectively as the Khoisan (Khoi-San) or more recently Khoesan (Khoe-San) people. This grouping is based on the unique linguistic use of click-consonants1. Many names, often country-specific, have been used by Bantu pastoralists and European settlers to describe the hunter-gatherers, including San, Saan, Sonqua, Soaqua, Souqua, Sanqua, Kwankhala, Basarwa, Batwa, Abathwa, Baroa, Bushmen, Bossiesmans, Bosjemans, or Bosquimanos. In addition, group-specific names such as !Kung and Khwe are often used for the broader population. The two most commonly used names, “San” and “Bushmen”, have both been associated with much controversy due to derogatory connotations2. “San” has become the more popular term used in Western literature, although “Bushmen” is arguably the more commonly recognized term within the communities. Since they have no collective name for themselves, the term Bushmen was selected for use in this paper as the term most familiar to the participants themselves. Regarding identification of individuals The five men identified in this study have all elected to have their identity made public knowledge. Thus we present two complete personal genomes (KB1 and ABT), a low-coverage personal genome (NB1), and personal exomes for all five men. On a scientific level, identification allows for current and future correlation of genetic data with demographic and medical histories. On a social level, identification allows for maximizing community benefit. For !Gubi, G/aq’o, D#kgao and !Aî, their name represents not only themselves, but importantly their extended family unit and a way of life severely under threat.
    [Show full text]
  • Six3 Overexpression Initiates the Formation of Ectopic Retina
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION in the developing eye and ventral forebrain. Recently, in Six3 overexpression initiates Drosophila a member of the Six subclass of homeobox the formation of ectopic retina genes, optix, has been isolated, which by sequence com- parison of the homeobox appears to be the ortholog of Felix Loosli, Sylke Winkler, Six3 (Toy et al. 1998). Functional analysis of optix, how- 1 and Joachim Wittbrodt ever, has not yet been reported. In medaka fish (Oryzias latipes) Six3 is expressed in Sonderforschungsbereich (SFB) Junior Group, Institute for Human Genetics, University of Go¨ ttingen, c/o the anterior-most neuroectoderm at gastrula stages and Max-Planck-Institute (MPI) for Biophysical Chemistry, Am later in the developing retina (Loosli et al. 1998). Mosaic Fassberg, 37077 Go¨ttingen, Germany misexpression of mouse Six3 in small clones, in response to injected plasmid DNA, resulted in the formation of The homeobox gene sine oculis (so) is essential for visual ectopic lenses in the region of the otic vesicle, suggesting system formation in Drosophila. A vertebrate member a decisive role for Six3 during vertebrate lens develop- of the so/Six gene family, Six3, is expressed in the devel- ment (Oliver et al. 1996). Considering the expression of oping eye and forebrain. Injection of Six3 RNA into Six3 in the retinal primordia and the essential role of a medaka fish embryos causes ectopic Pax6 and Rx2 ex- Drosophila homolog, so,inDrosophila eye develop- pression in midbrain and cerebellum, resulting in the ment, we investigated a potential role of Six3 in early formation of ectopic retinal primordia.
    [Show full text]
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Onc2010217.Pdf
    Oncogene (2010) 29, 4671–4681 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc ORIGINAL ARTICLE DEK oncoprotein regulates transcriptional modifiers and sustains tumor initiation activity in high-grade neuroendocrine carcinoma of the lung T Shibata1,2, A Kokubu1, M Miyamoto1, F Hosoda1, M Gotoh2, K Tsuta3, H Asamura4, Y Matsuno5, T Kondo6, I Imoto7,8, J Inazawa7,8 and S Hirohashi1,2 1Cancer Genomics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 2Pathology Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 3Clinical Laboratory Division, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 4Division of Thoracic Surgery, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 5Department of Surgical Pathology, Hokkaido University Hospital, Sapporo, Hokkaido, Japan; 6Proteome Bioinfomatics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 7Department of Molecular Cytogenetics, Medical Research Institute and Graduate School of Biomedical Science, Tokyo Medical and Dental University, Tokyo, Japan and 8Center of Excellence Program for Frontier Research on Molecular Destruction and Reconstitution of Tooth and Bone, Tokyo Medical and Dental University, Tokyo, Japan Lung cancer shows diverse histological subtypes. Large- Introduction cell neuroendocrine cell carcinoma and small-cell lung carcinoma show similar histological features and clinical Lung cancer is one of the most prevalent cancers behaviors, and can be classified as high-grade neuro- worldwide, and shows diverse histological subtypes, endocrine carcinoma (HGNEC) of the lung. Here we including adenocarcinoma, squamous cell carcinoma, elucidated the molecular classification of pulmonary large-cell carcinoma, large-cell neuroendocrine carcino- endocrine tumors by copy-number profiling. We compared ma (LCNEC) and small-cell lung carcinoma (SCLC; alterations of copy number with the clinical outcome of Travis and Brambilla, 2004).
    [Show full text]
  • Transient Activation of Meox1 Is an Early Component of the Gene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Access to Research and Communications Annals 1 Transient activation of Meox1 is an early component of the gene 2 regulatory network downstream of Hoxa2. 3 4 Pavel Kirilenko1, Guiyuan He1, Baljinder Mankoo2, Moises Mallo3, Richard Jones4, 5 5 and Nicoletta Bobola1,* 6 7 (1) School of Dentistry, Faculty of Medical and Human Sciences, University of 8 Manchester, Manchester, UK. 9 (2) Randall Division of Cell and Molecular Biophysics, King's College London, UK. 10 (3) Instituto Gulbenkian de Ciência, Oeiras, Portugal. 11 (4) Genetic Medicine, Manchester Academic Health Science Centre, Central 12 Manchester University Hospitals NHS Foundation Trust, Manchester, UK. 13 (5) Present address: Department of Biology, University of York, York, UK. 14 15 Running title: Hoxa2 activates Meox1 expression. 16 Keywords: Meox1, Hoxa2, homeodomain, development, mouse 17 *Words Count: Material and Methods: 344; Introduction, Results and Discussion: 18 3679 19 19 * Author for correspondence at: AV Hill Building The University of Manchester Manchester M13 9PT United Kingdom Phone: (+44) 161 3060642 E-mail: [email protected] 1 Abstract 2 Hox genes encode transcription factors that regulate morphogenesis in all animals 3 with bilateral symmetry. Although Hox genes have been extensively studied, their 4 molecular function is not clear in vertebrates, and only a limited number of genes 5 regulated by Hox transcription factors have been identified. Hoxa2 is required for 6 correct development of the second branchial arch, its major domain of expression. 7 We now show that Meox1 is genetically downstream from Hoxa2 and is a direct 8 target.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Genetic Network Identifies Novel Pathways Contributing To
    Albright et al. BMC Medical Genomics 2014, 7:51 http://www.biomedcentral.com/1755-8794/7/51 RESEARCH ARTICLE Open Access Genetic network identifies novel pathways contributing to atherosclerosis susceptibility in the innominate artery Jody Albright3, Pamela M Quizon3, Aldons J Lusis4,5,6 and Brian J Bennett1,2,3* Abstract Background: Atherosclerosis, the underlying cause of cardiovascular disease, results from both genetic and environmental factors. Methods: In the current study we take a systems-based approach using weighted gene co-expression analysis to identify a candidate pathway of genes related to atherosclerosis. Bioinformatic analyses are performed to identify candidate genes and interactions and several novel genes are characterized using in-vitro studies. Results: We identify 1 coexpression module associated with innominate artery atherosclerosis that is also enriched for inflammatory and macrophage gene signatures. Using a series of bioinformatics analysis, we further prioritize the genes in this pathway and identify Cd44 as a critical mediator of the atherosclerosis. We validate our predictions generated by the network analysis using Cd44 knockout mice. Conclusion: These results indicate that alterations in Cd44 expression mediate inflammation through a complex transcriptional network involving a number of previously uncharacterized genes. Keywords: Atherosclerosis, Co-expression network, inflammation Background act in part by affecting local inflammation in the vessel Cardiovascular disease (CVD) is the leading cause of wall [3-5]. death in the United States and the incidence of CVD is Inflammation is a fundamental biological process that rapidly increasing in other countries [1]. A common cause provides protection from infection, but when dysregulated, of cardiovascular disease is atherosclerosis, a pathological acts as a source of chronic disease.
    [Show full text]
  • Rabbit Anti-NEURL2 Antibody-SL19213R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-NEURL2 antibody SL19213R Product Name: NEURL2 Chinese Name: E3Ubiquitin连接酶蛋白NEURL2抗体 Neuralized E3 Ubiquitin Protein Ligase 2; C20orf163; Chromosome 20 Open Reading Alias: Frame 163; Neuralized Homolog 2 (Drosophila) ; Neuralized-Like 2 (Drosophila); Neuralized-Like Protein 2; Neuralized Homolog 2; OZZ-E3; OZZ; NEUL2_HUMAN; Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Pig,Cow,Horse,Rabbit,Sheep, ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100-500IF=1:100- 500（Paraffin sections need antigen repair） Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 32kDa Cellular localization: cytoplasmic Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from human NEURL2:1-100/285 Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. PubMed: PubMed This gene encodes a protein that is involved in the regulation of myofibril organization. This protein is likely the adaptor component of the E3 ubiquitin ligase complex in Product Detail: striated muscle, and it regulates the ubiquitin-mediated degradation of beta-catenin during myogenesis.
    [Show full text]