ANTICANCER RESEARCH 24: 955-962 (2004) Expression and Localization of Homeodomain Proteins DLX4, HB9 and HB24 in Malignant and Benign Human Colorectal Tissues PAUL HOLLINGTON1*, PETRA NEUFING2*, BILL KALIONIS3, PAUL WARING4, JACKY BENTEL5, DAVID WATTCHOW6 and WAYNE D. TILLEY1 1Dame Roma Mitchell Cancer Research Laboratories, University of Adelaide, Hanson Institute, IMVS, Adelaide; 2Department of Immunology, Flinders Medical Centre, Bedford Park, South Australia; 3Perinatal Research Centre, Department of Perinatal Medicine, Royal Women’s Hospital, Carlton, Victoria; 4Department of Pathology, Peter Mac Callum Cancer Institute, Melbourne, Victoria; 5Department of Anatomical Pathology, Royal Perth Hospital, Perth; 6Department of General and Gastrointestinal Surgery, Flinders Medical Centre, Bedford Park, South Australia, Australia Abstract. Background: The purpose of this study was to identify accounting for 70% of these cancers (1). Fearon & homeobox genes expressed in the human colon and to determine Vogelstein (2) have described the molecular basis for whether their expression levels were altered between matched non- sporadic colon cancer as a multistep model of carcinogenesis. malignant and malignant colon tissues. Materials and Methods: These genetic events ultimately result in uninhibited cell Homeobox genes expressed in colon tissue were identified by growth, proliferation and clonal tumor development. Known reverse transcription polymerase chain reaction (RT-PCR). genetic mutations account for approximately 80% of sporadic Antibodies were raised to the homeodomain proteins DLX4, HB9 colon cancers (1) and, therefore, additional events which take and HB24 and immunohistochemistry was performed on 3 place during colon carcinogenesis or progression of the moderately-differentiated tumors and their corresponding non- disease remain to be elucidated. malignant colon tissue samples. Results: The RT-PCR screen Homeodomain (hdm) proteins comprise a large family of identified expression of DLX4, HB9, HB24 and MSX2 in the transcription factors that contain a highly conserved DNA normal colon. Immunoaffinity purified polyclonal antisera raised binding motif (the homeobox) (3,4) and have been shown to against DLX4, HB9 and HB24 detect specific immunoreactivity regulate cellular commitment and differentiation in a wide in glandular epithelial cells, stromal cells of the lamina propria but variety of species (4). Precise spatial and temporal expression not in the submucosa. Nuclear epithelial immunoreactivity of all of homeobox (hbx) genes is essential for correct axis formation three antibodies decreased in moderately-differentiated tumors and spatial patterning during embryonic development (3,5). An compared to the corresponding matched non-malignant mucosa. example which underpins the importance of hbx gene These data suggest that differential expression of HB9, HB24 and expression levels during gut development is provided by the DLX4 may be associated with colorectal carcinogenesis. overexpression of Hoxa-4 in mice which results in a megacolon phenotype (6). Altered hbx gene expression levels in adult Colon cancer is a common disease with an incidence of 1 in colon tissues can also lead to aberrant cellular differentiation 20 in the western population, with sporadic disease and is often associated with a transformed phenotype (7). Reduction of hbx gene CDX2 expression for example has been reported in a number of human colon cancers (8,9) and also in rat and mouse models of the disease (10,11). Evidence that *P. Hollington and P. Neufing contributed equally to this work and loss of hbx gene expression can result in hyperplastic or are listed in alphabetical order. dysplastic phenotypes has been provided more directly by targeted gene disruption experiments (12-14). For example, Correspondence to: Petra Neufing, Room 2E119 Department of heterozygous loss of hbx gene CDX2 results in multiple Immunology, Flinders Medical Centre, Bedford Park SA 5042, South Australia, Australia. Tel: (618) 8204 5276, Fax: (618) 8204 intestinal polyp-like lesions (12). Reduction of CDX2 4158, e-mail: [email protected] expression also results in concomittant down-regulation of molecules involved in cell-cell and cell-substratum interactions Key Words: Homeodomain, colorectal cancer, immunohistochemistry. such as ICAM-1 (15), E-cadherin, integrin-beta4, laminin- 0250-7005/2004 $2.00+.40 955 ANTICANCER RESEARCH 24: 955-962 (2004) Table I. Sequence, PCR cycling conditions and expected product size of primer sets used to amplify hbx genes of the Engrailed class, the diverged hbx genes DLX4, HB9, HB24, MSX2 and loading controls ‚-actin and cytokeratin 20. Gene Sense and antisense primers Cycling conditions Product Ref Size Eng TAGAATTCAGXCCXAGXACXGCXTT 40x(94ÆC 30'', 55ÆC 45'', 72ÆC 90'') 132 29 TAGAATTCCGXCGATTTTGAAACCA DLX4 CCGCCCGTGGTGAACTCCGACC 40x(94ÆC 30'', 72ÆC 30'', 72ÆC 60'') 160 30 CCCCCACGTTCACCGCGCCAGGTG HB9 GCGGATCCGGCACTCCAAGGAGGC 40x(94ÆC 45'', 58ÆC 60'', 72ÆC 90'') 480 31 GCGAATTCTATAAGCAGCCAAGCG HB24 CTGCCTAAGATGCCCGACTTC 33x(94ÆC 30'', 64ÆC 45'', 72ÆC 90'') 420 32 GTCCTCGTCCTCGTCCTCCTC MSX2 CAGACACAGTGCACACAGAA 40x(94ÆC 30'', 62ÆC 45'', 72ÆC 60'') 390 30 CCTTTGCAACTGTGAGGATG ‚-actin CAGATCATGTTTGAGACCTT 30x(94ÆC 1', 55ÆC 1', 72 ÆC 1') 148 33 CTGGTGGTGAAGCTGTAGCC Cyt20 CAGACACACGGTGAACTATGG 40X(94ÆC 30'', 55ÆC 45'', 72ÆC 90'') 370 34 GATCAGCTTCCACTGTTAGACG gamma2 chain, hemidesmosomal protein and alpha-actinin diagnostic requirements, as well as samples of normal mucosa from the (16). This suggests that loss of CDX2 expression may not only end of the resection specimen remote from the tumor, were harvested play a role in the initiation of colorectal carcinogenesis, but by a histopathologist and immediately stored in liquid nitrogen in the Flinders Cancer Centre tissue bank. The research protocol was could also favour metastasis of tumor cells. approved by the Flinders Medical Centre Clinical Investigations In contrast to CDX2, the expression of other hbx genes, such Committee and conforms to the statements on human experimentation as HOXB6, HOXB8, HOXC8 and HOXC9 increases at different by the NHMRC. Informed consent was given by the patients for the stages of colon tumor development (17,18). Furthermore, other use of tissue in experimental work, prior to surgery. studies have shown that HOXB8 interacts with a number of tumor suppressor genes such as N-CAM (19). N-CAM is RT-PCR screen with degenerate primers. Frozen specimens of matched structurally related to the DCC tumor suppressor gene and, like normal mucosa and colonic tumors were homogenised in 4M guanidium isothiocyanate. RNA was isolated by ultracentrifugation DCC, has been shown to act as a tumor suppressor gene in through a caesium chloride gradient (27). Two hundred ng of total colorectal cancer (20). Similarly, the Drosophila homologue of RNA was reverse transcribed with Superscript II reverse transcriptase HOXB8 (called abd-A) regulates a gene of the TGF-‚ class (Gibco BRL) using oligo (dT)17–adaptor primers according to the called the ‘decapentaplegic’ gene (21,22). In Drosophila, abd-A manufacturer's protocol. One tenth of this cDNA was amplified with also regulates a gene of the Wnt class called ‘wingless’ (23,24). antisense degenerate engrailed class primers (Table I). PCR reactions The APC gene is a component of the Wnt cell signalling were carried out in a final volume of 20 Ìl containing 1x Taq reaction pathway and both it and TGF-‚ are important in sporadic and buffer (Pharmacia Biotech, Sweden) 200 ÌM dNTPs, 1.5mM MgCl2, 200ng of sense and antisense primers, 4 Ìl template cDNA and 0.5U familial colorectal carcinogenesis (25,26). Taq DNA polymerase. PCR cycling conditions are listed in Table π. In light of the critical regulatory role of hbx genes, their DNA fragments were gel-purified, cloned into pBluescript and oncogenic potential in mouse models and evidence of their sequenced using the fmol® DNA Cycle Sequencing System (Promega, aberrant expression in solid tumors, it is likely that misexpression USA). Comparison of cloned DNA sequences to known hbx genes was of hbx genes may be a crucial event in oncogenesis and/or performed using the GenBank Sequence database and the ANGIS progression of colon tumors. In this work we report the isolation suite of analysis programs. of hbx genes DLX4, HB9, HB24 and MSX2, from adult human PCR screening using specific primers. All PCR reactions were carried out colorectal tissue and show, by immunohistochemistry, that the in 1x Taq reaction buffer (Pharmacia Biotech, Sweden), 200 ÌM expression of hdm proteins DLX4, HB9 and HB24 is reduced in dNTPs, 1.5 mM MgCl2 with 100 ng of each primer, 2 Ìl of cDNA colorectal tumors when compared to the corresponding non- reaction and 0.5 U of Taq polymerase in a final volume of 20 Ìl with the malignant tissue from the same patients. following exceptions: ‚-actin PCR reactions were performed in 2 mM MgCl2 on 4 Ìl of cDNA and in a final volume of 25 Ìl, DLX4 and HB9 Materials and Methods PCR reactions in addition contained 1M betaine and MSX2 reactions were performed using 4 Ìl of cDNA. Details of primers and PCR Tissue samples. Tissue samples were collected from patients undergoing cycling conditions are listed in Table π. PCR products were separated bowel resection for colon or rectal carcinoma at Flinders Medical on 1.5% agarose gels, stained with ethidium bromide and visualized Centre, South Australia. Samples of non-necrotic tumor surplus to with a FluorImager scanner (Molecular
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages8 Page
-
File Size-