Ferric Reductase Activity of the Arsh Protein from Acidithiobacillus Ferrooxidans
Total Page：16
File Type：pdf, Size：1020Kb
J. Microbiol. Biotechnol. (2011), 21(5), 464–469 doi: 10.4014/jmb.1101.01020 First published online 13 April 2011 Ferric Reductase Activity of the ArsH Protein from Acidithiobacillus ferrooxidans Mo, Hongyu1,2, Qian Chen1,2, Juan Du1, Lin Tang1, Fang Qin1, Bo Miao2, Xueling Wu2, and Jia Zeng1,2* 1College of Biology, Hunan University, Changsha, Hunan 410082, P. R. China 2Department of Bioengineering, Central South University, Changsha, Hunan 410083, P. R. China Received: January 14, 2011 / Revised: March 10, 2011 / Accepted: March 11, 2011 The arsH gene is one of the arsenic resistance system in iron (free or chelated) into ferrous iron before its incorporation bacteria and eukaryotes. The ArsH protein was annotated into heme and nonheme iron-containing proteins. Ferric as a NADPH-dependent flavin mononucleotide (FMN) reductase catalyzes the reduction of complexed Fe3+ to reductase with unknown biological function. Here we complexed Fe2+ using NAD(P)H as the electron donor. The report for the first time that the ArsH protein showed resulting Fe2+ is subsequently released and incorporated high ferric reductase activity. Glu104 was an essential into iron-containing proteins [17]. residue for maintaining the stability of the FMN cofactor. Here we report for the first time that the ArsH protein The ArsH protein may perform an important role for showed high ferric reduction activity. The ArsH from A. cytosolic ferric iron assimilation in vivo. ferrooxidans may perform an important role as a NADPH- Keywords: Acidithiobacillus ferrooxidans, ArsH, flavoprotein, dependent ferric reductase for cytosolic ferric iron assimilation ferric reductase in vivo. MATERIALS AND METHODS Arsenic resistance genes are widespread in nature. The arsenic resistance operon in the genome of Acidothiobacillus Materials ferrooxidans consists of four genes, arsR, arsB, arsC, and Acidithiobacillus ferrooxidans ATCC 23270 was obtained from the arsH [2, 3, 11]. Three of these genes, arsB, arsC, and arsR, American Type Culture Collection. A Hi-Trap chelating metal affinity have been studied and their arsenic resistance mechanisms column was purchased from GE Healthcare Ltd. Top10 competent have been elucidated [13, 14]. The function of ArsH of the cells and E. coli strain BL21(DE3) competent cells came from arsenic resistance pathway is not clear so far. ArsH from Invitrogen Life Technologies. The Plasmid Mini kit, a gel extraction Yersinia enterocolitica confers resistance to both arsenite kit, and synthesized oligonucleotides were obtained from Sangon Taq and arsenate [12]. Deletion of arsH from Serratia marcesens Company of Shanghai. DNA polymerase and restriction enzymes results in loss of resistance [18]. In contrast, ArsH from A. came from MBI Fermentas. All other reagents were of research grade and obtained from commercial sources. ferrooxidans or Synechocystis showed no arsenic resistance phenotype [2, 8]. Thus it is reasonable that the the ArsH from Cloning of the arsH Gene from A. ferrooxidans A. ferrooxidans may perform another specific function. Genomic DNA from A. ferrooxidans ATCC 23270 was prepared using Bioinformatic classification of the ArsH protein based on an EZ-10 spin column genomic DNA isolation kit from Bio Basic sequence homology showed that the ArsH protein belongs Inc., according to the manufacturer’s instructions for bacterial DNA to the NADPH-dependent flavin mononucleotide (FMN) extraction. This genomic DNA was used as a template for PCR reaction. reductases family, and it was later purified to be a flavoprotein The sequence of the forward primer was 5'-CGCGCGAATTCAGG containing a FMN cofactor, and showed NADPH-dependent AGGAATTTAAAATGAGAGGATCGCATCACCATCACCATCAC FMN reductase activity [16, 19]. GTCATCATGTCTGGAAATTTGCCCAATACC-3', containing an EcoRI Iron is an essential element for virtually all living organisms. site (GAATTC), a ribosome binding site (AGGAGGA), codons for the In aerobic environments the stable form is Fe3+, which has amino acid sequence MRGSHHHHHH (start codon and hexahistag), -17 and codons for amino acids 2-11 of ArsH protein. The sequence of little solubility in neutral aqueous solutions (10 M at the reverse primer was 5'-CTGCAG GGATCCTTATAGGTTCTGTA physiological pH). The cell has to convert cytosolic ferric GATTGACGCGCCGGGAAAG-3', containing a BamHI site (GGATCC), a stop anticodon (TTA), and anticodons for the last 10 amino acids *Corresponding author Taq Phone: +86 731 88821740; Fax: +86 731 88821740; of the ArsH. The PCR amplification was performed using DNA E-mail: [email protected] polymerase, and the samples were subjected to 25 cycles of 45 s of 465 Mo et al. denaturation at 95oC, 1 min of annealing at 61oC, and 2 min of Purification of the Recombinant ArsH Wild-Type and Mutant elongation at 72oC in a Mastercycler Personal of Eppendorf Model Proteins made in Germany. The amplification products were analyzed by The cells were then harvested and lysed by sonication using a 150- electrophoresis on a 1% agarose gel and stained with ethidium bromide. Watt Autotune Series High Intensity Ultrasonic sonicator. The insoluble The resulting PCR product was gel purified, double digested, and debris was removed by centrifugation and the clear supernatant was ligated into a pLM1 expression vector, resulting in the pLM1::ARSH used for protein purification with a Hi-Trap affinity column by a plasmid. The constructed pLM1::ARSH plasmid was then transformed standard procedure. The Hi-Trap column was first equilibrated with into TOP10 competent cells for screening purposes. A positive colony 0.1 M nickel sulfate to charge the column with nickel ions, followed with a gene insert in the plasmid was identified by single restriction by 5 column volumes of MililQ water to remove any unbound nickel digestion of the plasmid with EcoRI and double restriction digestion ions from the column, and then 5 column volumes of a start buffer of the plasmid with EcoRI and BamHI, followed by an agarose gel (20 mM potassium phosphate, pH 7.4, 0.5 M NaCl) to equilibrate analysis. The identified positive colony was grown in an LB medium the column. The clarified sample was applied to the Hi-Trap column containing ampicillin (50 mg/l), and the plasmid pLM1::ARSH was after being filtering through a 0.45 µm filter. Next, the column was isolated from harvested bacteria cells using a plasmid extraction kit. washed with 5 column volumes of the start buffer, followed by 5 The isolated pLM1::ARSH plasmid was then transformed into E. column volumes of a wash buffer (20 mM potassium phosphate, pH coli strain BL21(DE3) competent cells for expression purposes. DNA 7.4, 0.5 M NaCl, 50 mM imidazole), and then the protein was eluted sequencing of the cloned ArsH protein gene was performed and the with an elution buffer (20 mM potassium phosphate, pH 7.4, 0.5 M inserted gene sequence identified as previously reported without any NaCl, 500 mM imidazole). The eluted fractions were analyzed by mutation. SDS polyacrylamide gel electrophoresis (SDS-PAGE) with 15% of acrylamide according to Laemmli [9]. The purified enzyme fractions Construction of A. ferrooxidans ArsH Mutant Plasmids were dialyzed against a 20 mM potassium phosphate buffer, pH 7.4, A QuikChange mutagenesis kit (Stratagene) was applied for 5% glycerol and then stored in a freezer at -80oC. constructing the pArsH(E104A), pArsH(E104D), and pArsH(E104Q) The method of Bradford was used to determine the protein mutant expression plasmids. The plasmid pLM1::ARSH was used content with bovine serum albumin as the standard [4]. as a template for constructing mutant expression plasmids through PCR reaction. The following primers and their antisense primers Identification of the Prosthetic Group were synthesized to introduce the mutated sequences: Purified ArsH was visualized with ultraviolet light in a Shimadzu (1) E104A, 5'-CTGGTGTTCTCCGGCGCGTCATGGCGCCAT-3', UV-1800 spectrophotometer. The ratio of absorbance of the ArsH condon GAG for glutamic acid (E) was changed to condon GCG solution at 267 nm and 373 nm was calculated [16]. The amount for alanine (A) of flavin mononucleotide in purified ArsH was quantified by absorption (2) E104D, 5'-TGGTGTTCTCCGGATCGTCATGGCGCCATG-3', at 445 nm using a molar extinction coefficient of 12,020 M-1 cm-1. condon GAG for glutamic acid (E) was changed to condon GAT for aspartic acid (D) Enzyme Assays (3) E104Q, 5'-TCTGGTGTTCTCCGCAGCGTCATGGCGCCA-3', The ferric reductase assay was performed as described previously condon GAG for glutamic acid (E) was changed to condon CAG [17]. Electron acceptors other than Fe3+-EDTA were used at a for glutamine (Q) concentration of 0.25 mM. NADPH:flavin oxidoreductase activity PCR amplification was performed using Pfu DNA polymerase was measured with 0.1 mM NADPH, and Fe3+-EDTA was not and samples were subjected to 13 cycles of 0.5 min of denaturation included. One unit of activity is defined as 1 µmol of NADPH oxidized at 95oC, 1 min of annealing at 61oC, and 12 min of elongation at 72oC per minute. in a Mastercycler Personal of Eppendorf Model made in Germany. DpnI restriction enzyme was used to digest the parental supercoiled Molecular Structure Modeling of the ArsH from A. ferrooxidans double-stranded DNA. The constructed mutant plasmids were All simulations were performed with Discovery Studio 2.1 software transformed into TOP10 competent cells for screening purposes. The developed by Accelrys Software Inc., running on the Dell Precision positive colonies with the mutant plasmids were identified by sequencing. 470 workstation with Windows system. The first step was to search The isolated mutant plasmids were then used to transform E. coli for a number of related sequences to find a related protein as a strain BL21(DE3) competent cells for expression. template by the FASTA program. Then, the templates were aligned to find the conserved core and build the model. After a further improved Expression of Recombinant ArsH Wild-Type and Mutant Proteins and optimization procedure of the initial model, the simulation model The E. coli strain BL21(DE3) cells with pLM1::ARSH plasmid or was accomplished.