DOCSLIB.ORG

Melbourne Australia 16 – 19 November 2010

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

9th h 9t MelbourneMelbourne AustraliaAustralia 1616 –– 1919 NovemberNovember 20102010 Sponsored by ISBN 978-1-74264-590-2 (online) Welcome Welcome to the 9th Australasian Plant Virology Workshop (APVW). The organising committee would like to thank our fellow plant virologists and researchers of virus-like organisms for attending our virology workshop in Melbourne. This workshop provides a forum for plant virologists from Australia, New Zealand and the rest of the world to meet on a biannual basis and discuss plant virus and virus-like topics in a congenial environment, over four days. Our theme for the workshop is “Plant viruses: Friend or foe?” We would like to build on the concepts introduced to this group at the 8th Australasian Plant Virology Workshop and consider the role of viruses as both pathogens and as beneficial organisms. The talks and posters for this workshop have been aligned with seven themes: Plant virus ecology and diversity; New and emerging viruses; Virus-like organisms; Plant virus diversity and detection; New tools and technologies; Plant host-virus interactions; and Plant virus epidemiology and climate change. We have officially aligned the APVW with the Australasian Plant Pathology Society as a special interest group and we now have an official website aligned with APPS (http://www.australasianplantpathologysociety.org.au/). As part of the program we have also scheduled a one hour meeting to discuss the formalisation of the Australasian Plant Virology Special Interest Group (APV) and any issues that are relevant to our newly formed group. We would like to extend a special thanks to several organisations for their support: • Horticulture Australia Limited (HAL) for sponsoring this workshop • Cooperative Research Centre for National Plant Biosecurity who are a platinum sponsor of this workshop, and providing the satchels • Victorian Department of Primary Industries who sponsored Ulrich Melcher and Ko Verhoeven • Qiagen as an exhibition sponsor, and • The Jasper Hotel for their support in hosting the workshop. The organising committee would especially like to thank the help and support of Chris Bottcher, Jo Mackie, Narelle Nancarrow, Mirko Milinkovic, Jo Luck, Sabine Perone, Mai Hlaing Loh and Mark Whattam for their help in assisting with the smooth running of this workshop. We hope you enjoy the workshop and get a chance to enjoy the wonderful cosmopolitan city of Melbourne that we are lucky to call home. Enjoy the workshop. The Organisers Brendan Rodoni Fiona constable Linda Zheng 9th Australasian Plant Virology Workshop Scientific Program - Summary Monday (15th) Tuesday (16th) Wednesday (17th) Thursday (18th) Friday (19th) 9:00 – 10:45 9.00 – 9.30 Theme 2: New and Theme 5: New Tools and Theme 7: Plant Virus Workshop opening Emerging viruses (cont) technologies Epidemiology and Climate Theme 1: Plant Virus Ecology Change and Diversity Theme 3: Virus-like 9.30 – 10.30 R.E.F. Matthew’s organisms Memorial Lecture Ulrich Melcher 11.00 AM – 10:45 – 1:15 Coffee Coffee Coffee 4.00 PM Theme 1: Plant Virus Ecology 11:15 – 1:00 Bioinformatics Theme 3: Virus-like Theme 5: New Tools and Coffee/Early Lunch and Diversity (cont) Workshop organisms (cont) technologies (cont) 1:00 – 2:00 Lunch Lunch Lunch Workshop closes 2:00 – 3:00 Poster session 1 APVW General Meeting Poster Session 2 3:00 – 3:30 Coffee Coffee Coffee 3:30 – 5:00 Registration Theme 2: New and Theme 4: Plant virus Theme 6: Plant host-virus for Workshop Emerging viruses Diversity and Detection interactions 5:31 – 8:30 Welcome Organised tour/dinner Free Evening Official Workshop Dinner reception th 9 Australasian Plant Virology Programme Date/Session Time Activity Speaker Title Monday 15/11/2010 10:00 AM – 4:30 PM Bioinformatics workshop 3.30 – 5.30 PM 9th APVW Registration 6:00 – 8.00 PM Welcome Reception Tuesday 16/11/2010 Chair: Brendan Session 1 9.00 – 10.30 AM Open Workshop Rodoni Welcome Address Graham Mitchell Theme 1: Plant virus ecology and diversity R.E.F. Matthew’s 9.30 – 10.30 AM Ulrich Melcher Expanding concepts of plant viruses Memorial Lecture 10.30 – 11.15 AM Coffee Theme 1: Plant virus Chair: Brenda Session 2 11.15 AM – 1.00 PM ecology and diversity Coutts (cont) Transmission and effects of Botrytis virus X and 11.15 – 11.45 AM Oral presentation 1.2 Mike Pearson Botrytis virus F in Botrytis cinerea Diversity of plant rhabdoviruses and evolutionary 11.45 AM – 12.00 Oral presentation 1.3 Ralf Dietzgen links to some multipartite negative-sense RNA PM viruses Sequence diversity of Australian Zucchini yellow 12.00 – 12.15 PM Oral presentation 1.4 Monica Kehoe mosaic virus isolates Genome analysis confirms uniqueness of the 12.15 – 12.30 PM Oral presentation 1.5 Kieren Arthur indigenous Australian Velvet tobacco mottle virus 12.30 – 12.45 PM Oral presentation 1.6 Stephen Wylie Deep sequencing Australian native plant viruses Temporal and spatial analysis of Dasheen mosaic 12.45 – 1.00 PM Oral presentation 1.7 Colleen Higgins potyvirus genetic variability 1.00 – 2.00 PM Lunch Chair: Baozhong Session 3 2.00 – 3.00 PM Poster Session 1 Meng Sequence variation and the molecular detection of Poster 1.8 Kar Mun Chooi Grapevine leafroll-associated virus-3 (GLRaV-3) New Zealand isolates Potyviruses of wild and cultivated Passiflora spp. and legumes from Western Australia: biological Poster 1.9 Roger Jones properties and phylogenetic placement of coat protein sequences Virus incidence within processing vegetable crops in Poster 1.10 Calum Wilson Tasmania, and discovery of putative novel luteovirus Detection of grapevine viruses in wine grape Poster 1.11 Nuredin Habili vineyards in Thailand Biological characterisation of distinct strains of Iris Poster 1.12 Hanu Pappu yellow spot virus Grapevine virus A variants of group II are closely Poster 1.13 Nuredin Habili associated with Shiraz disease in South Africa and Australia and are also present in the USA Molecular characterization of Bean leaf roll virus and Pea enation mosaic virus from the Pacific Poster 2.10 Hanu Pappu Northwestern USA and development of ELISA assays for virus detection Diagnostic techniques for detecting nepoviruses: Cherry leafroll virus, Grapevine fanleaf virus, Poster 2.11 Elizabeth Woo Strawberry latent ringspot virus and Tomato ringspot virus DsRNA elements and virus-like particles in Poster 2.12 Mahmoud Khalifa Sclerotinia sclerotiorum Poster 2.13 Kathy Parmenter Passionfruit viruses in eastern Australia 3.00 – 3.30 PM Coffee Theme 2: New and Chair Anastasija Session 4 3.30 – 5.00 PM Sponsored by CRC for National Plant Biosecurity emerging viruses Chomic Beet black scorch virus, old endemic or emerging 3.30 – 3.45 PM Oral presentation 2.1 Claude Bragard virus? Assessing the potential threat posed by spread of 3.45 – 4.00 PM Oral presentation 2.2 Roger Jones introduced and indigenous viruses to Australian native plants Kiwifruit can be naturally infected by a wide range of 4.00 – 4.15 PM Oral presentation 2.3 Dan Cohen viruses Genome characterization of a Tobamovirus and a 4.15 – 4.30 PM Oral presentation 2.4 Ramesh Chavan Citrivirus from kiwifruit 4.30 – 4.45 PM Oral presentation 2.5 Arnaud Blouin Novel vitiviruses infecting kiwifruit Current and potential viral diseases issues for the ` 4.45 – 5.00 PM Oral presentation 2.6 Denis Persley Australian vegetable industry Optional: Organised 6.00 PM Discover Melbourne CBD tour/dinner Wednesday 17/11/2010 Theme 2: New and Chair: Stephen Session 5 9.00 – 10.30 AM emerging viruses (cont) Wylie Mosaic diseases of sugarcane in Indonesia: 9.00 – 9.15 AM Oral presentation 2.7 Nicole Thompson diagnostics and biosecurity implications Whitefly-transmitted viruses of Australian vegetable 9.15 – 9.30 AM Oral presentation 2.8 Cherie Gambley crops: endemic problems and exotic threats 9.30 – 9.45 AM Oral presentation 2.9 Joe Tang Strawberry latent ringspot virus in New Zealand Theme 3: Virus-like organisms Towards an understanding of the epidemiology of 9.45 – 10.15 AM Oral presentation 3.1 Ian Scott Candidatus Liberibacter solanacearum in New Zealand Developing and validating molecular diagnostics for Fiona Constable 10.15 – 10.30 AM Oral presentation 3.2 Liberibacter and Phytoplasmas for the Australian and New Zealand potato industry 10.30 – 11.00 AM Coffee Theme 3: Virus-like Chair: Nicole Session 6 11.00 AM – 1.00 PM organisms (cont) Thompson 11.00 – 11.45 AM Oral presentation 3.3 Ko Verhoeven Identification and epidemiology of pospiviroids 11.45 AM – 12.00 RT-PCR of 50 year old RNA identifies Peach latent Oral presentation 3.4 Paul Guy PM mosaic viroid in New Zealand A molecular comparison of Iranian and Australian 12:00 – 12:15 PM Oral presentation 3.5 John Randles Peach latent mosaic viroid isolates Genome comparison of two isolates of “Candidatus 12:15 – 12:30 PM Oral presentation 3.6 Mark Anderson Phytoplasma australiense” Gene expression and metabolite changes of tomato 12:30 – 12:45 PM Oral presentation 3.7 Kate Chamberlain plants in response to Candidatus Phytoplasma infection Ratana Sdoodee 12:45 – 1:00 PM Oral presentation 3.8 and Lucy Tran- Sugarcane white leaf disease – Thailand overview. Nguyen 1.00 – 2.00 PM Lunch APVW General Chair: Brendan Session 7 2.00 – 3.00 PM Meeting Rodoni Meeting agenda to be Australian quarantine policy for nucleic acids of 2.00 – 2.15 PM Mark Gibbs circulated plants and plant pathogens 3.00 – 3.15 PM Coffee (shortened) Theme 4: Plant virus Chair: Neena Session 8 3.15 – 5.00 PM diversity and detection Mitter Viruses for breakfast, lunch and dinner 3:15 – 3:30 PM Oral presentation 4.1 Andrew Geering Sugar beet soil-borne viruses – surprising “ménage a 3.30 – 3:45 PM Oral presentation 4.2 Claude Bragard trios” combination Diversity of Tobacco streak virus strains and first 3:45 – 4:00 PM Oral presentation 4.3 John Thomas report of Strawberry necrotic shock virus in Australia".
Recommended publications
  • Elisabeth Mendes Martins De Moura Diversidade De Vírus DNA

    Elisabeth Mendes Martins De Moura Diversidade De Vírus DNA

    Elisabeth Mendes Martins de Moura Diversidade de vírus DNA autóctones e alóctones de mananciais e de esgoto da região metropolitana de São Paulo Tese apresentada ao Programa de Pós- Graduação em Microbiologia do Instituto de Ciências Biomédicas da Universidade de São Paulo, para obtenção do Titulo de Doutor em Ciências. Área de concentração: Microbiologia Orienta: Prof (a). Dr (a). Dolores Ursula Mehnert versão original São Paulo 2017 RESUMO MOURA, E. M. M. Diversidade de vírus DNA autóctones e alóctones de mananciais e de esgoto da região metropolitana de São Paulo. 2017. 134f. Tese (Doutorado em Microbiologia) - Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, 2017. A água doce no Brasil, assim como o seu consumo é extremamente importante para as diversas atividades criadas pelo ser humano. Por esta razão o consumo deste bem é muito grande e consequentemente, provocando o seu impacto. Os mananciais são normalmente usados para abastecimento doméstico, comercial, industrial e outros fins. Os estudos na área de ecologia de micro-organismos nos ecossistemas aquáticos (mananciais) e em esgotos vêm sendo realizados com mais intensidade nos últimos anos. Nas últimas décadas foi introduzido o conceito de virioplâncton com base na abundância e diversidade de partículas virais presentes no ambiente aquático. O virioplâncton influencia muitos processos ecológicos e biogeoquímicos, como ciclagem de nutriente, taxa de sedimentação de partículas, diversidade e distribuição de espécies de algas e bactérias, controle de florações de fitoplâncton e transferência genética horizontal. Os estudos nesta área da virologia molecular ainda estão muito restritos no país, bem como muito pouco se conhece sobre a diversidade viral na água no Brasil.
  • Virus World As an Evolutionary Network of Viruses and Capsidless Selfish Elements

    Virus World As an Evolutionary Network of Viruses and Capsidless Selfish Elements

    Virus World as an Evolutionary Network of Viruses and Capsidless Selfish Elements Koonin, E. V., & Dolja, V. V. (2014). Virus World as an Evolutionary Network of Viruses and Capsidless Selfish Elements. Microbiology and Molecular Biology Reviews, 78(2), 278-303. doi:10.1128/MMBR.00049-13 10.1128/MMBR.00049-13 American Society for Microbiology Version of Record http://cdss.library.oregonstate.edu/sa-termsofuse Virus World as an Evolutionary Network of Viruses and Capsidless Selfish Elements Eugene V. Koonin,a Valerian V. Doljab National Center for Biotechnology Information, National Library of Medicine, Bethesda, Maryland, USAa; Department of Botany and Plant Pathology and Center for Genome Research and Biocomputing, Oregon State University, Corvallis, Oregon, USAb Downloaded from SUMMARY ..................................................................................................................................................278 INTRODUCTION ............................................................................................................................................278 PREVALENCE OF REPLICATION SYSTEM COMPONENTS COMPARED TO CAPSID PROTEINS AMONG VIRUS HALLMARK GENES.......................279 CLASSIFICATION OF VIRUSES BY REPLICATION-EXPRESSION STRATEGY: TYPICAL VIRUSES AND CAPSIDLESS FORMS ................................279 EVOLUTIONARY RELATIONSHIPS BETWEEN VIRUSES AND CAPSIDLESS VIRUS-LIKE GENETIC ELEMENTS ..............................................280 Capsidless Derivatives of Positive-Strand RNA Viruses....................................................................................................280
  • Exploring the Tymovirids Landscape Through Metatranscriptomics Data

    Exploring the Tymovirids Landscape Through Metatranscriptomics Data

    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.15.452586; this version posted July 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Exploring the tymovirids landscape through metatranscriptomics data 2 Nicolás Bejerman1,2, Humberto Debat1,2 3 4 1 Instituto de Patología Vegetal – Centro de Investigaciones Agropecuarias – Instituto Nacional de 5 Tecnología Agropecuaria (IPAVE-CIAP-INTA), Camino 60 Cuadras Km 5,5 (X5020ICA), Córdoba, 6 Argentina 7 2 Consejo Nacional de Investigaciones Científicas y Técnicas. Unidad de Fitopatología y Modelización 8 Agrícola, Camino 60 Cuadras Km 5,5 (X5020ICA), Córdoba, Argentina 9 10 Corresponding author: Nicolás Bejerman, [email protected] 11 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.15.452586; this version posted July 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 12 Abstract 13 Tymovirales is an order of viruses with positive-sense, single-stranded RNA genomes that mostly infect 14 plants, but also fungi and insects. The number of tymovirid sequences has been growing in the last few 15 years with the extensive use of high-throughput sequencing platforms. Here we report the discovery of 31 16 novel tymovirid genomes associated with 27 different host plant species, which were hidden in public 17 databases.
  • 2007.014-017P (To Be Completed by ICTV Officers)

    2007.014-017P (To Be Completed by ICTV Officers)

    Taxonomic proposal to the ICTV Executive Committee This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the separate document “Help with completing a taxonomic proposal” Code assigned: 2007.014-017P (to be completed by ICTV officers) Short title: New genus Botrexvirus for Botrytis virus X Modules attached 1 2 3 4 5 (please check all that apply): 6 7 Author(s) with e-mail address(es) of the proposer: Mike Adams ([email protected]) on behalf of the Flexiviridae SG and Jan Kreuze ([email protected]) If the proposal has been seen and agreed by the relevant study group(s) write “yes” in the box on the right YES ICTV-EC or Study Group comments and response of the proposer: The original (2007) proposals were to place the new genus within a new subfamily Alphaflexivirinae and to retain the existing families Flexiviridae and Tymoviridae in the new order Tymovirales. As a result of EC discussion and comments, the Study Group has agreed to split the Flexiviridae into three families and thus create an order with four families. Assignment is therefore to the new family Alphaflexiviridae. Date first submitted to ICTV: 08 June 2007 Date of this revision (if different to above): 20 Aug 2008 MODULE 2: NEW SPECIES Code 2007.014P (assigned by ICTV officers) To create 1 new species with the name(s): Botrytis virus X MODULE 3: NEW GENUS Code 2007.015P (assigned by ICTV officers) To create a new genus to contain
  • Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo

    Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo

    Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID-19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. November 2020 update This evidence synthesis was prepared for the Office of the Chief Dental Officer, based on a comprehensive review under contract by the following: Paul Allison, Faculty of Dentistry, McGill University Raphael Freitas de Souza, Faculty of Dentistry, McGill University Lilian Aboud, Faculty of Dentistry, McGill University Martin Morris, Library, McGill University November 30th, 2020 1 Contents Page Introduction 3 Project goal and specific objectives 3 Methods used to identify and include relevant literature 4 Report structure 5 Summary of update report 5 Report results a) Which patients are at greater risk of the consequences of COVID-19 and so 7 consideration should be given to delaying elective in-person oral health care? b) What are the signs and symptoms of COVID-19 that oral health professionals 9 should screen for prior to providing in-person health care? c) What evidence exists to support patient scheduling, waiting and other non- treatment management measures for in-person oral health care? 10 d) What evidence exists to support the use of various forms of personal protective equipment (PPE) while providing in-person oral health care? 13 e) What evidence exists to support the decontamination and re-use of PPE? 15 f) What evidence exists concerning the provision of aerosol-generating 16 procedures (AGP) as part of in-person
  • Virus De La Marchitez Del Tomate (Tomarv) En El Noroeste De México E Identificación De Hospedantes Alternos” TESIS

    Virus De La Marchitez Del Tomate (Tomarv) En El Noroeste De México E Identificación De Hospedantes Alternos” TESIS

    INSTITUTO POLITÉCNICO NACIONAL CENTRO INTERDISCIPLINARIO DE INVESTIGACIÓN PARA EL DESARROLLO INTEGRAL REGIONAL UNIDAD SINALOA “Presencia del Virus de la marchitez del tomate (ToMarV) en el Noroeste de México e identificación de hospedantes alternos” TESIS QUE PARA OBTENER EL GRADO DE MAESTRÍA EN RECURSOS NATURALES Y MEDIO AMBIENTE PRESENTA ROGELIO ARMENTA CHÁVEZ GUASAVE, SINALOA; MÉXICO DICIEMBRE, 2012 Agradecimientos a proyectos El trabajo de tesis se desarrolló en el Departamento de Biotecnología Agrícola del Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional (CIIDIR) Unidad Sinaloa del Instituto Politécnico Nacional (IPN). El presente trabajo fue apoyado económicamente por el IPN y recursos autogenerados. El alumno Rogelio Armenta Chávez fue apoyado con una beca CONACYT con clave 366650 y por el IPN a través de la beca PIFI dentro del proyecto Determinación de la importancia de hospedantes alternos en la dispersión de Ca. Liberibacter sp. en el Norte de México (Con número de registro 20120507). DEDICATORIA A mis padres A ellos por haberme dado la vida y haberse preocupado día a día por mi bienestar y futuro, a ellos les dedicó esta tesis, mi vida y mi ser. Gracias por ser mis padres. A mi novia A mi novia Karen quien siempre me ha apoyado en todo, sin condición alguna; por darme su amor y cariño, por eso gracias. A mi tía Soledad Armenta Por estar a mi lado en los momentos difíciles y haberme dado su apoyo y fuerza para salir adelante día con día. Gracias por eso y por todo lo que venga. A mi hermana Quien ha estado conmigo en las buenas y en las malas a lo largo de mi vida; gracias hermana por ese apoyo tan peculiar que me das.
  • 2007.018-020P (To Be Completed by ICTV Officers)

    2007.018-020P (To Be Completed by ICTV Officers)

    Taxonomic proposal to the ICTV Executive Committee This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the separate document “Help with completing a taxonomic proposal” Code assigned: 2007.018-020P (to be completed by ICTV officers) Short title: Creation of new family Alphaflexiviridae (e.g. 6 new species in the genus Zetavirus; re-classification of the family Zetaviridae etc.) Modules attached 1 2 3 4 5 (please check all that apply): 6 7 Author(s) with e-mail address(es) of the proposer: Mike Adams ([email protected]) on behalf of the Flexiviridae SG and Jan Kreuze ([email protected]) If the proposal has been seen and agreed by the relevant study group(s) write “yes” in the box on the right YES ICTV-EC or Study Group comments and response of the proposer: The original (2007) proposal was to create a new subfamily Alphaflexivirinae within the family Flexiviridae and to assign the families Flexiviridae and Tymoviridae in the new order Tymovirales. As a result of EC discussion and comments, the Study Group has agreed to split the Flexiviridae into three families and thus create an order with four families. This therefore becomes a proposal to create a new family Alphaflexiviridae. Date first submitted to ICTV: 08 June 2007 Date of this revision (if different to above): 20 Aug 2008 MODULE 5: NEW FAMILY Code 2007.018P (assigned by ICTV officers) To create a new family containing genera resembling:
  • A002 Methylobacterium Carri Sp. Nov., Isolated from Automotive Air

    A002 Methylobacterium Carri Sp. Nov., Isolated from Automotive Air

    A002 Methylobacterium carri sp. nov., Isolated from Automotive Air Conditioning System Jigwan Son and Jong-Ok Ka* Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, Seoul National University A bacterial strain, designated DB0501T, with Gram-stain-negative, aerobic, motile, and rod-shaped cell, was isolated from an automotive air conditioning system collected in the Republic of Korea. 16S rRNA gene sequence analysis indicated that the strain DB0501T grouped in the genus Methylobacterium and closely related to Methylobacterium platani PMB02T (98.8%), Methylobacterium currus PR1016AT (97.7%), Methylobacterium variabile DSM 16961T (97.7%), Methylobacterium aquaticum DSM 16371T (97.6%), Methylobacterium tarhaniae N4211T (97.4%) and Methylobacterium frigidaeris IER25-16T (97.2%). Genomic relatedness between strain DB0501T and its closest relatives was evaluated using average nucleotide identity, digital DNA-DNA hybridization and average amino acid identity with values of 86.4–90.8%, 39.3 ± 2.6–48.2 ± 5.0% and 87.8–89.5% respectively. The strain grew 15-30°C , pH 5.5-8.0 and in 0–1.0% w/v NaCl. Summed feature 3 (C16:1 7c and/or C16:1 6c) and summed feature 8 (C18:1 ω7c T and/or C18:1 ω6c) were the predominant cellular fatty acids in strain DB0501 . Q-10 was the major ubiquinone. The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol, and phosphatidylcholine. The DNA G+C content of strain DB0501T was 70.8 mol%. Based on phenotypic, genotypic and chemotaxonomic data, strain DB0501T represents a novel species of the genus Methylobacterium, for which the name Methylobacterium carri sp.
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al

    US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A.
  • WO 2015/173701 A2 19 November 2015 (19.11.2015) P O P C T

    WO 2015/173701 A2 19 November 2015 (19.11.2015) P O P C T

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2015/173701 A2 19 November 2015 (19.11.2015) P O P C T (51) International Patent Classification: Not classified HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, (21) International Application Number: MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PCT/IB2015/053373 PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 8 May 2015 (08.05.2015) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (30) Priority Data: TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, 61/991,754 12 May 2014 (12.05.2014) US TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, 62/149,893 20 April 2015 (20.04.2015) US DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, 62/15 1,013 22 April 2015 (22.04.2015) US LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, (71) Applicant: GLAXOSMITHKLINE INTELLECTUAL GW, KM, ML, MR, NE, SN, TD, TG).
  • A Study of the Interaction Between the Plant Pathogenic Fungus Botrytis Cinerea and the Filamentous Ssrna Mycoviruses Botrytis Virus X and Botrytis Virus F

    A Study of the Interaction Between the Plant Pathogenic Fungus Botrytis Cinerea and the Filamentous Ssrna Mycoviruses Botrytis Virus X and Botrytis Virus F

    A study of the interaction between the plant pathogenic fungus Botrytis cinerea and the filamentous ssRNA mycoviruses Botrytis virus X and Botrytis virus F Barbara Boine A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy in Biological Sciences. The University of Auckland, April 2012. i Abstract The ecological significance of mycoviruses is becoming increasingly recognised, not just for their potential as biocontrol agents but also as driving forces in the evolution and diversification of fungi. Therefore, it is important to understand how mycoviruses and fungi interact on the molecular and biochemical level. To this end the interaction between Botrytis cinerea and the mycoviruses Botrytis virus F and Botrytis virus X was studied. Relative and absolute real time PCR protocols were developed for monitoring the titres of BVX and BVF during transfection studies to monitor changes in virus titre in relation to phenotypic and metabolic changes in the fungal host. Phenotypic changes included severe phenotypical alterations, which were associated with extreme up regulation of carbohydrate, amino acid and lipid metabolism, and induction of stress responses (vacuolisation/cell lysis, increased pigmentation). To study the location and distribution of BVX in infected Botrytis the BVX coat protein was recombinantly expressed in E. coli, BVX specific polyclonal antibodies produced, and protocols developed for the serological detection and visualisation of BVX. Immuno-fluorescence microscopy was used to studying the distribution of BVX within growing Botrytis cultures indicated that the virus is present in aggregates located attached to the cell membrane, the septum, in spores, and in hyphal tips. A combination of light and electron microscopy showed that BVX is often closely associated with cell walls, suggesting that the virus may be moving across the cell wall by altering cell wall composition.
  • Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID- 19 Pandemic: A

    Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID- 19 Pandemic: A

    Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID- 19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. March 2021 update This evidence synthesis was prepared for the Office of the Chief Dental Officer, based on a comprehensive review under contract by the following: Raphael Freitas de Souza, Faculty of Dentistry, McGill University Paul Allison, Faculty of Dentistry, McGill University Lilian Aboud, Faculty of Dentistry, McGill University Martin Morris, Library, McGill University March 31, 2021 1 Contents Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID-19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. .................................................................................................................................. 1 Foreword to the second update ............................................................................................. 4 Introduction ............................................................................................................................. 5 Project goal............................................................................................................................. 5 Specific objectives .................................................................................................................. 6 Methods used to identify and include relevant literature ......................................................