Collagen Type I and Decorin Expression in Tenocytes Depend On

Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 http://www.biomedcentral.com/1471-2474/13/140

RESEARCH ARTICLE Open Access Collagen type I and decorin expression in tenocytes depend on the cell isolation method Markus U Wagenhäuser1†, Matthias F Pietschmann1*†, Birte Sievers1, Denitsa Docheva2, Matthias Schieker2, Volkmar Jansson1 and Peter E Müller1

Abstract Backround: The treatment of rotator cuff tears is still challenging. Tendon tissue engineering (TTE) might be an alternative in future. Tenocytes seem to be the most suitable cell type as they are easy to obtain and no differentiation in vitro is necessary. The aim of this study was to examine, if the long head of the biceps tendon (LHB) can deliver viable tenocytes for TTE. In this context, different isolation methods, such as enzymatic digestion (ED) and cell migration (CM), are investigated on differences in gene expression and cell morphology. Methods: Samples of the LHB were obtained from patients, who underwent surgery for primary shoulder arthroplasty. Using ED as isolation method, 0.2% collagenase I solution was used. Using CM as isolation method, small pieces of minced tendon were put into petri-dishes. After cell cultivation, RT-PCR was performed for collagen type I, collagen type III, decorin, tenascin-C, fibronectin, Scleraxis, tenomodulin, osteopontin and agreccan. Results: The total number of isolated cells, in relation to 1 g of native tissue, was 14 times higher using ED. The time interval for cell isolation was about 17 hours using ED and approximately 50 days using CM. Cell morphology in vitro was similar for both isolation techniques. Higher expression of collagen type I could be observed in tenocyte-like cell cultures (TLCC) using ED as isolation method (p < 0.05), however decorin expression was higher in TLCC using CM as isolation method (p < 0.05). Dedifferentiation potential seemed to be similar for both isolation techniques. Conclusion: In summary tenocyte-like cells can be obtained with both isolation methods (ED and CM) from the LHB. As no obvious disadvantage could be seen using ED, this method is more suitable for clinical use, as time for cell isolation is shorter and a remarkably higher number of cells can be obtained. However, both isolation methods can further be improved. Keywords: Tenocytes, Tissue engineering, Isolation method, Gene expression

Backround procedures. In Europe, allogenic tendons grafts are not Tendon and ligament injuries are common injuries in used routinely [2]. Moreover, in 2006 Moore et al. ad- Orthopedics. The most important injuries are ruptures vised not to use allogenic tendon grafts for rotator cuff of the anterior cruciate ligament in the knee, rotator cuff reconstruction, because the clinical outcome was com- tears in the shoulder and ruptures of the Achilles ten- parable to simple debridement and had an increased risk don [1]. of infection and host-versus-graft-reaction [3]. Up to date, the treatment of severe rotator cuff tears In future, an alternative approach for irreparable rota- remains challenging. The dimension of these ruptures tor cuff tears might be tendon tissue engineering (TTE). often does not allow a complete reconstruction. Only It tries to create tendon tissue of good quality in vitro specific groups of patients benefit from tendon transfer aiming to take over its specific function in situ after implantation. An important issue for the TTE is to find * Correspondence: [email protected] out which cell type is the most effective for in vitro cell †Equal contributors 1Department of Orthopaedic Surgery, Ludwig-Maximilians-University Munich - seeding. The ideal cell type should fulfill certain cri- Campus Grosshadern, Marchioninistr 15, 81377, Munich, Germany teria. Firstly, it should be possible to isolate cells from Full list of author information is available at the end of the article

© 2012 Wagenhäuser et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 2 of 8 http://www.biomedcentral.com/1471-2474/13/140

autologous tissue to avoid host-versus-graft reaction af- was performed by the senior author (P.E.M), an experi- ter implantation. Secondly, an adequate number of vital enced shoulder surgeon. The study was carried out fol- cells should be available after the cell isolation. Thirdly, lowing the regulations of the Medical Center Ethics these cells should have the ability to expand in vitro as Committee of the Ludwig-Maximilians-University of well as to maintain phenotypic stability throughout the Munich (ethical grant number: 063–09). passages [4]. Altogether, seven tissue samples of the LHB were col- So far, fibroblasts, mesenchymal stem cells and teno- lected from patients with an average age of 60 years cytes have been investigated [5-7]. Tenocytes might be (± 8.9 years). Tendon samples were carried to the la- the most suitable cells as no differentiation during boratory in cell culture medium (DMEM/HAM’s F12, in vitro cultivation is necessary. Tenocytes have been Biochrom, Berlin, Germany) where cell isolation was im- shown to grow in vitro without signs of senescence [8]. mediately performed. Under sterile conditions tendons There is also evidence that cell proliferation of tenocytes were washed three times with PBS buffer (Biochrom, in vitro is comparable to mesenchymal stem cells [9]. Berlin, Germany) and cut into small pieces. For the fol- In this context, the long head of the biceps tendon lowing cell isolation previously published methods were (LHB) seems to be promising for tenocyte isolation. A used [6,16,17]. Briefly, the sheath and surrounding para- (partial or complete) rupture of the LHB is often found tenon were removed and the tendons were minced into in association with rotator cuff tears [10,11]. For this small pieces. At this stage, slices from each sample were reason tenotomy of the LHB is performed regularly dur- randomly assigned to perform the following isolation ing rotator cuff reconstruction [12-14]. Donor side mor- procedure. bidity after tenotomy of the LHB is negligible and patient satisfaction is high [15]. ED method There are two different methods to isolate tenocytes One part of the tendon slices was incubated in 0.2% col- from tendon tissue. Tenocytes can be isolated using en- lagenase I solution (Sigma-Aldrich, Steinheim, Germany) zymatic digestion (ED) of the extracellular matrix com- for approximately 18 hours in 37°C, CO2 5%. After di- pounds [6,16]. Another alternative is to obtained tenocytes gestion, cells were filtered (100 μm) (BD Biosciences, by cell migration (CM) as cells migrate out of the tissue Erembodegem, Belgium), the suspension was washed explants after culturing in cell culture medium [17]. three times with PBS buffer and centrifuged (Heraeus, Tenocytes synthesize specific proteins of the extracellu- Hanau, Germany) at 300 g for 5 minutes. Before cell cul- lar matrix, which has a highly ordered composition [18]. tivation, tenocytes were counted using a heamocytometer Collagen type I, collagen type III, decorin, tenascin-C are and trypan blue staining to distinguish between dead and fundamental proteins in the extracellular matrix of ten- vital cells. dons. High expression levels of collagen type I and decorin seem to be essential for cells to be suitable for TTE appli- CM method cations, as they play an important role in tissue forma- The other part of the tendon slices were placed into tion [19,20]. Scleraxis and tenomodulin are commonly petri-dishes filled with 10 ml cell culture medium used as markers for tenogenic differentiation [21-23]. (DMEM/HAM’s F12), supplemented with 10% FCS, and Tenascin-C and fibronectin are two glycoproteins of were subcultivated (37°C, CO2 5%). Culture medium was the extracellular matrix, which are essential for cell-cell changed every second day. After a few days, the first col- and cell-matrix interactions [24]. Aggrecan and osteo- onies of migrating tenocytes around the slices could be pontin are located predominantly in the extracellular seen. After approximately 3 weeks, the tendon slices were matrix of cartilage and bone. carefully transferred into new petri-dishes. Altogether The aim of this study was to examine if the LHB is three migration cycles were performed. Before cell culti- suitable as cell source for TTE. Additionally, we com- vation the total number of cells was counted using a pared two different isolation methods, ED and CM. In haemocytometer and trypan blue. order to investigate the influence of these isolation methods on tenocyte-like cell cultures (TLCC), we analyzed Tendon cell cultures cell morphology and gene expression. We hypothesized The isolated tenocytes were placed in culture flask in that both isolation methods deliver similar cell yield and DMEM/HAM`s F12 (1:1) supplemented with 10% FCS, show no differences in gene expression. 2 mM L-Glutamin, ascorbic acid 1250 μg/ml, amino acids, Penicillin/Streptomycin 60 μg/ml and Amphoteri- Methods cin B 25 ng/ml (Biochrom, Berlin, Germany). The seed- Cell isolation procedure ing density for each isolation method was as follows: Tendon samples were obtained from patients, who under- CM-714 cells/cm2 and ED-2857 cells/cm2. As soon as went surgery for a primary shoulder arthroplasty. Surgery the cultured cells reached 80-90% confluence, they were Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 3 of 8 http://www.biomedcentral.com/1471-2474/13/140

treated with 0.05% trypsin/0.02% ethylenediaminetetra- minutes at 25°C, following incubation at 42°C for 60 aciticacid (EDTA) (Biochrom, Berlin, Germany) and sub- minutes. cDNA samples were stored at −20°C until fur- cultured. Osteoblasts (HOB lot: 540X130406) and ther use. fibroblasts (HFIB lot: 055 H170100) (Provitro, Berlin, RT-PCR was performed for collagen type I, decorin, Germany) were subcultured in DMEM cell culture me- collagen type III, tenascin-C, fibronectin, Scleraxis, teno- dium. Supplements were the same as for TLCCs but modulin, osteopontin and aggrecan. Sequences and without Amphotericin B. Chondrocytes were obtained product lengths are shown in Table 1 [17,26,27]. For the from patients, who underwent total knee replacement, RT-PCR, 1 μl of cDNA was mixed with 0,5 μl of forward as previously descibed by us [25]. Morphological cell as- and reverse primers (each 0.5 μM), 10x PCR buffer sessment was performed using a phase-contrast micro- (100 mM Tris–HCl, pH 8.8 at 25°C, 500 mM KCl, 0.8% scope (Zeiss, Munich, Germany). Total cell number was [v/v] Nonidet P40), 0,2 μl of Deoxynucleotidetripho- calculated after every cell passage. sphate (dNTP)-mix (each 2 mM), 1 μl MgCl2 (25 mM), 0,1 μl of taq-polymerase (5 u/μl) (Fermentas, St. Leon- RT-PCR Rot, Germany) and filled up to a final volume of 20 μl Tenocytes in the third passage were homogenized with with RNase free water. The reaction mixtures were incu- lysis buffer (Quiagen, Hilden, Germany) using a QIAsh- bated for 3 min at 95°C, followed by 30 sec at 95°C, redder (Quiagen) and a centrifuge at 8000 g for 3 min- 45 sec at 50-64° and 1 min at 72°C up to 35 cycles, and utes. For further purification of RNA, the RNeasy Mini then 10 min at 72°C. Products were analyzed by 2% gel- Kit (Quiagen) was used following the manufacturer’s electrophoresis. To control results, at least two indepen- manual. Leftovers of DNA were digested on-column dent experiments were performed for all seven samples. with RNAse-free DNase I Set (Quiagen) for 15 minutes. cDNA was synthesized by using Reverse Transcription qRT-PCR System Set (Promega, Mannheim, Germany) following The gene expression of collagen type I alpha I and decorin the manufacturer`s instruction. Briefly, 1 μg of RNA, was also determined by quantitative RT-PCR (qRT-PCR) 4 μl of MgCl2, 2 μl of 10x Reactionbuffer, 2 μl10mM using a light cycler instrument 2.0 (Roche Diagnostic, Deoxynucleotidetriphosphate (dNTP)-mix, 0.5 μlof Mannheim, Germany). Target sequences were amplified RNase-inhibitor, 0.6 μl Reverse Transcriptase, 0.5 μl using LightCycler Primer Sets (Search LC, Heidelberg, Randomprimer and RNase-free water were mixed up to Germany) with LightCycler-Fast Start DNA Master SYBR a final volume of 20 μl. Samples were incubated for 10 Green I Mix (Roche Applied Science, Mannheim, Table 1 RT-PCR primer sequences and product length Target gene Primer sequence Length 1. GAPDH [NM_002046] Sense: GAGTCCACTGGCGTCTCCAC 188 bp Antisense: GGTGCTAAGCAGTTGGTGGT 2. collagen Typ I, alpha 1 [NM_000088] Sense: GGCCCAGAAGAACTGGTACA 200 bp Antisense: GGCTGTTCTTGCAGTGGTAG 3. collagen Typ III, alpha 1 [NM_033150] Sense: CCAGGAGCTAACGGTCTCAG 103 bp Antisense. CAGGGTTTCCATCTCTTCCA 4. decorin [NM_001920] Sense: TGCTGTTGACAATGGCTCTC 192 bp Antisense: GCCTTTTTGGTGTTGTGTCC 5. fibronectin [NM_212475] Sense: ATGATGAGGTGCACGTGTGT 135 bp Antisense: CTCTTCATGACGCTTGTGGA 6. tenascin-C [NM_002160] Sense: TCAAGGCTGCTACGCCTTAT 230 bp Antisense: GTTCTGGGCTGCCTCTACTG 7. Scleraxis [17] Sense: CCTGAACATCTGGGAAATTTTAC 111 bp Antisense: CGCCAAGGCACCTCCTT 8. tenomodulin [NM_022144] Sense: CCATGCTGGATGAGAGAGGT 123 bp Antisense: CTCGTCCTCCTTGGTAGCAG 9. osteopontin [26] Sense: TTGCTTTTGCCTCCTAGGCA 430 bp Antisense: GTGAAAACTTCGGTTGCTGG 10. aggrecan [27] Sense: CACTGTTACCGCCACTTCCC 183 bp Antisense: ACCAGCGGAAGTCCCCTTCG Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 4 of 8 http://www.biomedcentral.com/1471-2474/13/140

Germany) following the manufacture`s manual. Reac- tions were performed in doublets. At least two independ- ent experiments were performed for all seven samples and difference in efficiency had to be less than 0.05. For relative quantification of the gene expression, samples were normalized to cyclophilin B. Primer sequences are property of Search LC, Heidelberg, Germany and cannot be mentioned in this paper. (Lot numbers: Cyclophilin B: 120906, 090408, collagen type I alpha 1: 290606, 020608, dcorin: 140508).

Statistics Data is shown as mean ± SD. Statistical analysis was performed using GraphPad Prism 3.0 (San Diego CA, USA). The Mann–Whitney test was used to analyze significant Figure 1 Yield of cells. Cell yield after both isolation methods and differences between the groups (ED and CM). For com- normalized to 1 g of native tendon tissue. Cells were counted using parison of multiple time points in one group, the Fried- a heamocytometer and trypan blue. The amount of cells after 1 day man test for multivariate analysis and Dunn’s multiple using ED is 14 times higher than using CM after 50 days. comparison tests were used. Both tests are designed for paired samples. Level of significance was set up p < 0.05. Gene expression analysis showed comparable results in both groups Results To explore differences between the two isolation methods, Cell yield was significantly higher with enzymatic the expression of main compounds of the extracellular digestion (ED) method matrix and tenogenic differentiation markers (Scleraxis For cell isolation using CM, 0.11 g ± 0.09 g of the LHB and tenomodulin) were analyzed using RT-PCR. Results was used. Respectively, for isolation using ED 0.337 g ± are shown in Figure 5. 0.19 g of tendon tissue was used. As we expected a The expression of collagen type I alpha I, collagen type higher loss of cells due to enzymatic treatment we used III and decorin could be detected in TLCCs of both isola- three times more tissue for ED compared to CM. After 3 tion methods. Cells of other musculoskeletal tissues also seven weeks, an average of 75x10 cells could be gener- showed positive results on these three genes (line 2–4). ated using CM. Using ED as isolation method an average 6 The expression of tenascin-C and fibronectin could be of 3.15x10 cells could be isolated with approximately seen in all TLCC (line 5–6). The expression of Scleraxis 17 hours. In relation to 1 g of the LHB, CM could gener- 5 6 was detected in all TLCC, too (line 7). Interestingly fibro- ate 6.70x10 cells while ED could generate 9.35x10 cells, blasts, chondrocytes and osteoblasts also showed Scler- meaning a ratio 1:14 (CM:ED). An overview over time axis expression. The expression of tenomodulin, could and cell yield gives Figure 1. not be detected in any TLCC. Here, tenomodulin expression could be detected in chondrocytes and osteoblasts Cell morphology was similar for both isolation methods (line 8). Osteopontin was not expressed in TLCC (line 9), First migrating cells could be seen around the tendon but could be seen in osteoblast cultures. Interestingly, the slices after one week. With increasing culture time these expression of aggrecan, could be observed in all TLCCs. colonies became denser and reached a confluence of Its expression was also seen in chondrocytes (line 10). about 90% after three weeks. Accelerated cell migration could be observed during the following cell migration qRT-PCR of collagen type I alpha I and decorin showed cycles (Figure 2). different expression in both groups Figure 3 shows TLCCs of the second and third pas- Our results showed that the expression of collagen type sage. Cell morphology was similar for both groups in- I alpha I was higher in TLCC using ED as isolation vestigated. Even in the fourth passage, cells exhibited method (≤0.05). In contrast, decorin showed higher ex- elongated shapes and several membrane protrusions. pression in TLCC using CM as isolation method (≤0.05) Over time, however, the amount of polygonal-shaped (Figure 6). Collagen type I expression and decorin ex- cells increased in both groups. Overall, the number of pression was about the same level in TLCC isolated by cells significantly increased from passage 1 to 3 (p < 0.001) ED. If TLCCs were gained using CM, decorin expres- in both groups. However yield of cell and proliferation sion was about five times higher than collagen type I seemed to be more variable for ED. (Figure 4). expression. Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 5 of 8 http://www.biomedcentral.com/1471-2474/13/140

Figure 2 Migrating tenocytes of the LHB. The tendon slices were put into petri-dishes, incubated (37°C, 5% CO2) in cell culture medium (DMEM/HAM’s F12) and analyzed by light microscopy. An increasing amount of spindle-like cells could be observed at different time points. A = after 8 days, B = after 11 days, C = after 16 days D = after 22 days.

Discussion it often causes inflammation and pain. The loss of func- It is important that TTE procedures, which aim to replace tion is still under debate but in most cases the removal of damaged tissue, only cause as little donor side morbidity this tendon is well tolerated by the patients [12-15,28]. as possible. The use of the LHB in TTE might be promis- Two different isolation methods can be used in TTE ing. It is removed regularly during shoulder operation as (ED and CM). The aim of this study was to compare

Figure 3 Cell morphology in TLCC. Tenocyte cell cultures at different time of subcultering. ED (enzymatic digestion) CM (cell migration). Cells of the second and third cell passage are shown. Cells show typical morpholpgy for tenocytes and no differences between both methods. Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 6 of 8 http://www.biomedcentral.com/1471-2474/13/140

using ED (1–2 weeks) [17]. In our study, a reasonable number of cells could be obtained only after three migration cycles which lasted 6–8 weeks altogether. Our results showed that in relation to 1 g of native tissue ED could generate 14 times more cells than CM. Since, cell yield and the isolation time are essential for clinical use, this isolation method will not be clinically appropri- ate in nearer future. It has been shown that tendons contain cells different from tenocytes. These cells are named tendon stem and progenitor cells (TSPC) [29-31]. We assumed that ED leads to obtaining both, tenocytes and TSPC, whereas cell migration tends to favor mature tenocytes. There- Figure 4 Cell proliferation. Absolute number of cells from passage 1 to 3 (n = 7). Proliferation was almost similar for TLCC of both fore, we think that this might be an explanation for isolation methods, however yield of cell and proliferation rate higher total number of cells in TLCCs isolated using ED seemed to be more variable for ED. Cell number significantly throughout the passages as well as for higher variability increases from passage 1 to 3 for both groups, ED and CM. of cell proliferation. Cell morphology seemed to be similar in TLCCs no these two methods with regards to the quality of gen- matter which isolation method was used. TLCCs of both erated TLCCs. ED uses the enzyme collagenase I to isolation methods showed a significant increase in total separate cells from their extracellular matrix. The pe- cell number during passaging, illustrating a comparable riod of time to obtain cells is quite short (17 hours). cell-viability and -function. Another advantage of this method is a higher cell yield All important structural compounds of the extracellu- compared to CM. This makes the method suitable for lar matrix in tendon such as collagen type I, collagen clinical use. CM is an alternative to isolate tenocytes type III, decorin, tenascin-C and fibronectin were ex- from the LHB. A clear disadvantage of this method is pressed continuously by all TLCC of the third cell pas- that cell yield is poor and takes remarkably longer than sage. No difference could be detected between the two different isolation methods. Importantly, the transcription factor Scleraxis was expressed by all TLCC. It has been shown to play an important role in coordinating the response to injury in the pathogenesis of tendon disorders [32]. In contrast, tenomodulin expression could not be detected in TLCCs demonstrating a loss of this marker during passaging. This is in line with other stud- ies by Yao, L. et al. [33] and Jelinsky et al. [34], which also showed a loss of tenomodulin expression in two- dimensional culture systems. The detection of aggrecan could be evidence for chondrogenic differentiation in TLCC [35]. In this study, we observed aggrecan expression in TLCC of both isolation methods. Former research could show that the use of collagenase type I has a negative effect on the differentiation of tenocytes. Lui, P. et al. could show, that the in- jection of collagenase I in the patellar tendon leads to ectopic ossifications and to a chondrogenic gene expression profile [36]. This might also explain the expression of aggrecan in TLCC in this study, as the same enzyme was used for ED. As this enzyme was not used for CM Figure 5 RT-PCR analysis. Cells in the third cell passage were used. isolation method we assume that aggrecan expression in cDNA from other musculoskeletal cell types such as f, fibroblasts these cultures might give evidence for a chondrogenic (passage 6), c, chondrocytes (passage 3) and o, osteoblasts drift during cell culturing. High expression of aggrecan (passage 2) were used for comparison. GAPDH was used for has been shown in degenerative tendons, which we used normalization. ED, enzymatic digestion, CM, cell migration. as a cell source. This could also be an explanation for Each band represents one patient/LHB (n = 7). our findings [37,38]. However, investigating aggrecan Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 7 of 8 http://www.biomedcentral.com/1471-2474/13/140

Figure 6 Quantitative RT-PCR. RT-PCR was performed for collagen type I and decorin. Relative gene expression was estimated against cyclophilin B. expression in at least two separate cell passages is neces- CM, increasing its clinical suitability. In addition to that, sary for clarification. The osteogenic marker osteopontin the high cell yield and collagen type I expression is an- could not be detected in any TLCC, no matter which other advantage of the ED isolation method. However, isolation method was used. Osteogenic differentiation both methods need further optimization. seemed unlikely. Collagen type I and decorin are both essential pro- Abbreviations CM: Cell migration; ED: Ezymatic digestion; LHB: Long head of the biceps teins in the tendon tissue [19,20], therefore we analyzed tendon; TSPC: Tendon stem and progenitor cells; TLCC: Tenocyte-like cell their expression levels by quantitative PCR. Our results culture; TTE: Tendon tissue engineering. showed that collagen type I expression was higher in TLCCs using ED. An influence on collagen type I expres- Competing interests sion by external applications, such as laser irradiation The authors declare that they have no competing interests. and shock waves was shown by Chen, C. H. et al. and Authors’ contributions Bosch, G. et al. [39,40]. Therefore, we assume that the MW and MP carried out the molecular experiments and drafted the use of collagenase type I, another external application, manuscript. BS and DD helped with the establishment of RT-PCR and during cell isolation might up-regulate collagen type I ex- participated in the design of the study. MS conceived of the study and helped with the study design. PM and VJ participated in the coordination pression. An increased expression of decorin could be and helped to draft the manuscript. All authors have read the manuscript. seen in TLCC using CM. Findings of Karousou, E. et al. and Corps, A. N. et al. [37,41] indicate that decorin is Acknowledgements up-regulated after tendon rupture. These findings were This study was supported by the “German Shoulder and Elbow Society” with € confirmed by Yokota et al., as they showed that the dec- 10.000 . Denitsa Docheva and Matthias Schieker were supported by the German Research Foundation (DFG grant DO 1414/1-1) and the Bavarian orin expression in ruptured supraspinatues tendons is Research Foundation (FORZEBRA, TP1/WP2). upregulated, too. This effect even aggravates during cell cultivation [38]. During the isolation process an artificial Author details 1Department of Orthopaedic Surgery, Ludwig-Maximilians-University Munich - tendon rupture was generated. This might explain the Campus Grosshadern, Marchioninistr 15, 81377, Munich, Germany. higher expression of decorin in TLCCs isolated using 2Experimental Surgery and Regenerative Medicine, Department of Surgery, – CM. Ratio of mature tenocytes and TSPC might differ Ludwig-Maximilians-University Campus Innenstadt, Nußbaumstr 20, 80336, Munich, Germany. using different isolation methods and could generally be a possible explanation for the differences in collagen Received: 6 November 2011 Accepted: 5 July 2012 I/decorin expression. Published: 8 August 2012

References Conclusion 1. Clayton RA, Court-Brown CM: The epidemiology of musculoskeletal In summary, it is possible to isolate cells from the LHB tendinous and ligamentous injuries. Injury 2008, 39:1338–1344. using both isolation methods (ED and CM). Since no 2. Nevasier JS, Nevasier RJ, Nevasier TJ: The repair of chronic massive rotator cuff of the shoulder by use of a freeze-dried rotator cuff. J Bone Joint obvious disadvantage could be seen in morphological Surg Am 1978, 60:681–684. cell assesment of cells isolated by ED, this method seems 3. Moore DR, Cain EL, Schwartz ML, Clancy WG Jr: Allograft reconstruction for to be more suitable for clinical use. The fact, that the massive, irreparable rotator cuff tears. Am J Sports Med 2006, 34:392–396. 4. Huang D, Balian G, Chhabra AB: Tendon tissue engineering and gene intervening period between tendon explantation and cell transfer: the future of surgical treatment. J Hand Surg [Am] 2006, seeding is remarkably shorter using ED compared to 31:693–704. Wagenhäuser et al. BMC Musculoskeletal Disorders 2012, 13:140 Page 8 of 8 http://www.biomedcentral.com/1471-2474/13/140

5. Ouyang HW, Goh JC, Thambyah A, Teoh SH, Lee EH: Knitted poly-lactide- 27. Gronthos S, Zannettino AC, Hay SJ, Shi S, Graves SE, Kortesidis A, Simmons co-glycolide scaffold loaded with bone marrow stromal cells in repair PJ: Molecular and cellular characterisation of highly purified stromal and regeneration of rabbit Achilles tendon. Tissue Eng 2003, 9:431–439. stem cells derived from human bone marrow. J Cell Sci 2003, 6. Cao Y, Liu Y, Liu W, Shan Q, Buonocore SD, Cui L: Bridging tendon defects 116:1827–1835. using autologous tenocyte engineered tendon in a hen model. 28. Wolf RS, Zheng N, Weichel D: Long head biceps tenotomy versus PlastReconstrSurg 2002, 110:1280–1289. tenodesis: a cadaveric biomechanical analysis. Arthroscopy 2005, 7. Liu W, Chen B, Deng D, Xu F, Cui L, Cao Y: Repair of tendon defect with 21:182–185. dermal fibroblast engineered tendon in a porcine model. Tissue Eng 2006, 29. Bi Y, Ehirchiou D, Kilts TM, Inkson CA, Embree MC, Sonoyama W, Li L, Leet 12:775–788. AI, Seo BM, Zhang L, et al: Identification of tendon stem/progenitor cells 8. Bernard-Beaubois K, Hecquet C, Houcine O, Hayem G, Adolphe M: Culture and the role of the extracellular matrix in their niche. Nat Med 2007, and characterization of juvenile rabbit tenocytes. Cell Biol Toxicol 1997, 13:1219–1227. 13:103–113. 30. Zhang J, Wang JH: Platelet-rich plasma releasate promotes differentiation 9. Kryger GS, Chong AK, Costa M, Pham H, Bates SJ, Chang J: A comparison of of tendon stem cells into active tenocytes. Am J Sports Med 2010, tenocytes and mesenchymal stem cells for use in flexor tendon tissue 38:2477–2486. engineering. J Hand Surg Am 2007, 32:597–605. 31. Zhu J, Li J, Wang B, Zhang WJ, Zhou G, Cao Y, Liu W: The regulation of 10. Berlemann U, Bayley I: Tenodesis of the long head of biceps brachii in the phenotype of cultured tenocytes by microgrooved surface structure. painful shoulder: improving results in the long term. J Shoulder Elbow Biomaterials 2010, 31:6952–6958. Surg 1995, 4:429–435. 32. Scott A, Sampaio A, Abraham T, Duronio C, Underhill TM: Scleraxis 11. Murthi AM, Vosburgh CL, Neviaser TJ: The incidence of pathologic expression is coordinately regulated in a murine model of patellar changes of the long head of the biceps tendon. J Shoulder Elbow Surg tendon injury. J Orthop Res 2010, 29(2):289–296. 2000, 9:382–385. 33. Yao L, Bestwick CS, Bestwick LA, Maffulli N, Aspden RM: Phenotypic drift in 12. Kelly AM, Drakos MC, Fealy S, Taylor SA, O'Brien SJ: Arthroscopic release of human tenocyte culture. Tissue Eng 2006, 12:1843–1849. the long head of the biceps tendon: functional outcome and clinical 34. Jelinsky SA, Archambault J, Li L, Seeherman H: Tendon-selective genes results. Am J Sports Med 2005, 33:208–213. identified from rat and human musculoskeletal tissues. J Orthop Res 2010, – 13. Gill TJ, McIrvin E, Mair SD, Hawkins RJ: Results of biceps tenotomy for 28:289 297. treatment of pathology of the long head of the biceps brachii. J Shoulder 35. de MM, Koevoet W, van Schie HT, Kops N, Jahr H, Verhaar JA, van Osch GJ: Elbow Surg 2001, 10:247–249. In vitro model to study chondrogenic differentiation in tendinopathy. – 14. Klepps S, Hazrati Y, Flatow E: Arthroscopic biceps tenodesis. Arthroscopy AmJ Sports Med 2009, 37:1214 1222. 2002, 18:1040–1045. 36. Lui PP, Fu SC, Chan LS, Hung LK, Chan KM: Chondrocyte phenotype and 15. Walch G, Edwards TB, Boulahia A, Nove-Josserand L, Neyton L, Szabo I: ectopic ossification in collagenase-induced tendon degeneration. – Arthroscopic tenotomy of the long head of the biceps in the treatment J Histochem Cytochem 2009, 57:91 100. of rotator cuff tears: clinical and radiographic results of 307 cases. 37. Corps AN, Robinson AH, Movin T, Costa ML, Hazleman BL, Riley GP: J Shoulder Elbow Surg 2005, 14:238–246. Increased expression of aggrecan and biglycan mRNA in Achilles – 16. Cao D, Liu W, Wei X, Xu F, Cui L, Cao Y: In vitro tendon engineering with tendinopathy. Rheumatology(Oxford) 2006, 45:291 294. avian tenocytes and polyglycolic acids: a preliminary report. Tissue Eng 38. Yokota A, Gimbel JA, Williams GR, Soslowsky LJ: Supraspinatus tendon 2006, 12:1369–1377. composition remains altered long after tendon detachment. J Shoulder – 17. Schulze-Tanzil G, Mobasheri A, Clegg PD, Sendzik J, John T, Shakibaei M: Elbow Surg 2005, 14:72S 78S. Cultivation of human tenocytes in high-density culture. Histochem Cell 39. Chen CH, Tsai JL, Wang YH, Lee CL, Chen JK, Huang MH: Low-level laser Biol 2004, 122:219–228. irradiation promotes cell proliferation and mRNA expression of type I 18. Silver FH, Freeman JW, Seehra GP: Collagen self-assembly and the collagen and decorin in porcine Achilles tendon fibroblasts in vitro. – development of tendon mechanical properties. J Biomech 2003, J OrthopRes 2009, 27:646 650. 36:1529–1553. 40. Bosch G, de MM, van BR, van Schie HT, van de Lest CH, van Weeren PR: The effect of focused extracorporeal shock wave therapy on collagen matrix 19. Zhang G, Ezura Y, Chervoneva I, Robinson PS, Beason DP, Carine ET, and gene expression in normal tendons and ligaments. Equine VetJ 2009, Soslowsky LJ, Iozzo RV, Birk DE: Decorin regulates assembly of collagen 41:335–341. fibrils and acquisition of biomechanical properties during tendon 41. Karousou E, Ronga M, Vigetti D, Passi A, Maffulli N: Collagens, development. J Cell Biochem 2006, 98:1436–1449. proteoglycans, MMP-2, MMP-9 and TIMPs in human achilles tendon 20. Chokalingam K, Juncosa-Melvin N, Hunter SA, Gooch C, Frede C, Florert J, rupture. ClinOrthopRelat Res 2008, 466:1577–1582. Bradica G, Wenstrup R, Butler DL: Tensile stimulation of murine stem cell- collagen sponge constructs increases collagen type I gene expression and linear stiffness. Tissue Eng Part A 2009, 15:2561–2570. doi:10.1186/1471-2474-13-140 21. Docheva D, Hunziker EB, Fassler R, Brandau O: Tenomodulin is necessary Cite this article as: Wagenhäuser et al.: Collagen type I and decorin expression in tenocytes depend on the cell isolation method. BMC for tenocyte proliferation and tendon maturation. MolCell Biol 2005, Musculoskeletal Disorders 2012 13:140. 25:699–705. 22. Shukunami C, Takimoto A, Oro M, Hiraki Y: Scleraxis positively regulates the expression of tenomodulin, a differentiation marker of tenocytes. DevBiol 2006, 298:234–247. 23. Docheva D, Padula D, Popov C, Weishaupt P, Pragert M, Miosge N, Hickel R, Bocker W, Clausen-Schaumann H, Schieker M: Establishment of Submit your next manuscript to BioMed Central immortalized periodontal ligament progenitor cell line and its and take full advantage of: behavioural analysis on smooth and rough titanium surface. Eur Cell Mater 2010, 19:228–241. • Convenient online submission 24. Martin D, Brown-Luedi M, Chiquet-Ehrismann R: Tenascin-C signaling through induction of 14-3-3 tau. J Cell Biol 2003, 160:171–175. • Thorough peer review 25. Mayer-Wagner S, Schiergens TS, Sievers B, Redeker JI, Schmitt B, Buettner A, • No space constraints or color ﬁgure charges Jansson V, Muller PE: Scaffold-free 3D cellulose acetate membrane-based cultures form large cartilaginous constructs. J Tissue Eng Regen Med 2011, • Immediate publication on acceptance 5(2):151–155. • Inclusion in PubMed, CAS, Scopus and Google Scholar 26. Crosby AH, Edwards SJ, Murray JC, Dixon MJ: Genomic organization of the • Research which is freely available for redistribution human osteopontin gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics 1995, 27:155–160. Submit your manuscript at www.biomedcentral.com/submit