Heterologous Murine and Bovine IVF Using Bottlenose Dolphin (Tursiops Truncatus) Spermatozoa

Accepted Manuscript

Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa

M.J. Sánchez-Calabuig, J. de la Fuente, R. Laguna-Barraza, P. Beltrán-Breña, E. Martínez-Nevado, S. Johnston, D. Rizos, A. Gutiérrez-Adán, J.F. Pérez-Gutiérrez

PII: S0093-691X(15)00306-4 DOI: 10.1016/j.theriogenology.2015.06.001 Reference: THE 13224

To appear in: Theriogenology

Received Date: 10 January 2015 Revised Date: 4 June 2015 Accepted Date: 4 June 2015

Please cite this article as: Sánchez-Calabuig M, Fuente Jdl, Laguna-Barraza R, Beltrán-Breña P, Martínez-Nevado E, Johnston S, Rizos D, Gutiérrez-Adán A, Pérez-Gutiérrez J, Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa, Theriogenology (2015), doi: 10.1016/j.theriogenology.2015.06.001.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. revised ACCEPTED MANUSCRIPT Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa

MJ. Sánchez-Calabuiga, J. de la Fuentea, 1, R. Laguna-Barrazaa, P. Beltrán-Breñaa, E. 5 Martínez-Nevadob, S. Johnstonc, D. Rizosa, A. Gutiérrez-Adána, JF. Pérez- Gutiérrezd*

aDepartment of Animal Reproduction, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain; bZoo-Aquarium, Madrid, Spain; cSchool 10 of Agriculture and Food Science, University of Queensland, Gatton, Australia; dSchool of Veterinary Medicine, Universidad Complutense de Madrid, Madrid, Spain.

*Corresponding author. Tel.: +34 91 3943798; fax. +34 91 3943808.

E-mail adress: [email protected] (J.F. Pérez-Gutiérrez)

15 1 Deceased.

Running head: Heterologous IVF using dolphin spermatozoa MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT Abstract 20 Assisted reproductive technologies (ARTs) are of great importance for increasing the genetic diversity in captive animals. The use of bovine or murine oocytes in heterologous IVF provide advantages compared to homologous IVF in non-domestic animals, such as the accessibility to oocytes and the availability of well-developed in 25 vitro maturation systems. The aim of this study was to determine the heterologous IVF parameters using cryopreserved dolphin spermatozoa and zona-intact bovine or murine oocytes, as well as to examine the nuclear chromatin status of the dolphin spermatozoa. All the processes involved in the fertilization including embryo cleavage were observed by confocal microscopy and hybrid embryo formation was confirmed by PCR. 30 Heterologous bovine IVF showed no polyspermy, lower percentages of pronuclear formation and a lower cleavage rate compared to homologous IVF group (34.8 vs. 89.3%). Heterologous murine IVF showed a lower cleavage rate than homologous IVF (9.6 vs. 77.1%). With respect to dolphin sperm chromatin, it was more stable, i.e. more resistant to EDTA-SDS decondensation than the bovine sperm chromatin. This study 35 revealed the stability of the dolphin sperm chromatin and the ability of the dolphin spermatozoa to penetrate zona-intact bovine andMANUSCRIPT murine oocytes, leading to hybrid embryo formation.

Keywords: heterologous IVF, bottlenose dolphin

ACCEPTED

ACCEPTED MANUSCRIPT 40 1. Introduction

Assisted reproductive technologies are of great importance for preserving endangered species and increasing the genetic diversity in captive animals without displacing them. The best indicator of sperm quality is the evaluation of fertilizing 45 capacity [1]. This parameter encompasses several physiological processes, such as sperm oocyte interaction, penetration and pronuclear formation. While the basic seminal parameters and chromatin sperm DNA fragmentation have been recently reported in the bottlenose dolphin (Tursiops truncatus) [2, 3], little information is available about sperm chromatin structure or the in vitro fertilizing capacity of this species. 50 The use of heterologous IVF in wild species has further advantages over homologous IVF, such as the accessibility to oocytes and the possibility of using well developed in vitro maturation systems. Due to the specificity of the zona pellucida, heterologous IVF application is generally limited to phylogenetically closely related 55 species. Heterologous IVF has been successful when co-incubating oocytes and spermatozoa from cat and tiger spermatozoa [4], bovine and goat, ram or antelope [5-7] and sheep and deer respectively [8]. Sometimes,MANUSCRIPT it has been necessary to remove the ZP to achieve heterologous IVF as in the case of dolphin spermatozoa and hamster oocytes [9]. The absence of ZP removes the species specificity and provides information on the 60 acrosome reacted spermatozoa’s ability to fuse with the vitelline membrane [9]. On the other hand, the ZP removal prevents obtaining information on basic sperm functions, such as the sperm-zona interaction and penetration. In addition, the cumulus oophorus cells are removed with the ZP, which can alter oocyte homeostasis and influence parameters such as polyspermy, pronuclear formation and embryo cleavage [10, 11]. 65 Despite the apparent advantages, heterologous IVF using zona-intact oocytes has never been conductedACCEPTED in the dolphin. Heterologous IVF is generally performed on cow or rodent oocytes due to their availability. The oocytes from these two species have different concentrations of gluthathione and different mechanisms of centrosome 70 inheritance, paternal and maternal respectively, that may lead to different male pronuclear formation dynamics when fertilized [12-14]. Indeed, bottlenose dolphin and

ACCEPTED MANUSCRIPT bovine species belong to the same taxonomic clade Cetartiodactyla [15], thus bottlenose dolphin species is more closely related to bovine species than rodent species.

75 Male pronuclei formation depends on the nature of the oocyte but also on the structural characteristics of the sperm nuclear chromatin. This process of condensation is initiated in the testis. During spermatogenesis, somatic histones -rich in lysine- are replaced by highly basic small proteins known as protamines that contain a large number of arginine and cysteine residues, the latter binding Zn2+ through their thiol 80 groups. As the sperm migrate through the epididymis, the cysteine thiol groups initially oxidize to disulphide bonds [16, 17]. This process is completed after ejaculation, when the zinc present in the seminal plasma is gradually depleted during the capacitation process, facilitating the formation of additional disulphide bonds and leading to a highly stable chromatin [18]. Certain degree of compactness is necessary for DNA transient 85 inactivation and protection. However, hyperstability may lead to a delay in pronuclear formation and early embryonic death [18, 19]. Examination of chromatin stability in the dolphin is of interest because this species possesses intra-abdominal testes and chromatin condensation may represent mechanisms to attenuate the oxidative stress effect, which is the major cause of DNA damageMANUSCRIPT in spermatozoa from testes that are not 90 exposed to below core body temperatures [20].

The sperm nuclear chromatin structural status or the possibility of performing heterologous IVF using zona intact oocytes has not been explored in the dolphin. The aim of this study was to provide information on these issues that can help to develop a 95 model for the study of dolphin spermatozoa. In this regard two specific objectives were raised: 1) to study the interaction and heterologous IVF parameters using dolphin spermatozoa and zona-intact cow and murine oocytes; and 2) to study sperm maturation, chromatin condensation and stability of dolphin spermatozoa. ACCEPTED 100 2. Materials and methods

All animal experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). All the experiments were performed in 4

ACCEPTED MANUSCRIPT 105 accordance to the Guide for Care and Use of Laboratory Animals as adopted by the Society for the Study of Reproduction and to the Animal Welfare Act for the care of Marine Mammals (University of Queensland Animal Ethics SAFS/133/11). All the chemicals used in this study were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. 110 2.1. Experiment 1: Heterologous zona intact bovine IVF using dolphin spermatozoa

2.1.1. Semen collection, cryopreservation

115 Twelve ejaculates were obtained from a healthy adult bottlenose dolphin with proven fertility (33 years old and 220 kg weight) housed at the Zoo Aquarium, (Madrid, Spain) and trained for voluntary semen collection [21, 22]. Immediately after collection, sperm samples were processed and analyzed for standard parameters. Ejaculates with total motility higher than 80%, normal morphology higher than 85% and sperm 120 concentration higher than 400×106 spermatozoa/mL were selected and frozen as previously described [22]. Bovine semen was collected by artificial vagina from a reproductive mature proven breeding bull (Asturgen,MANUSCRIPT Gijón, Spain). The ejaculates were routinely processed and cryopreserved using a commercial extender (Triladyl® Minitüb, Tiefenbach, Germany) in 0.25 mL straws containing 25×106 125 spermatozoa/straw [23, 24].

2.1.2. IVF

IVF was performed, as previously described [25]. A total of 12 replicates were 130 performed. Cumulus oocyte complexes (COCs) were obtained from ovaries at the slaughterhouse and matured in four-well dishes (Nunc, Roskilde, Denmark), in 500 µL maturation mediumACCEPTED (TCM-199) supplemented with 10 ng/mL epidermal growth factor (EGF) and 10% (v/v) fetal calf serum, for 24 h at 38.5 °C under an atmosphere of 5%

CO2 in air with maximum humidity. After 24 h, in vitro matured oocytes were washed 135 twice in FERT medium [FERT-TALP medium (Merck, Darmstadt, Germany) supplemented with 25 mM bicarbonate, 22 mM sodium lactate, 1 mM sodium pyruvate, 6 mg/mL fatty acid free BSA and 10 µg/mL heparin] and transferred to four-well dishes 5

ACCEPTED MANUSCRIPT (Nunc) (50 COCs in 250 µL of FERT medium) [26]. Frozen straws containing either dolphin or bovine spermatozoa were thawed in a water bath at 37 ºC for 50 s, and 140 aliquots (5 µL) were taken for motility analysis by Computer assisted sperm Analysis, (CASA, Projectes y Serveis R+D., Valencia, Spain) previously validated for these species [27, 28]. Motile sperm were separated by density gradient (BoviPure, Nidacon International, Mölndal, Sweden), centrifuged (5 min at 250×g) resuspended in FERT medium and 250 µL of this suspension were added to each fertilization well, obtaining a 145 final concentration of 1 x 106 spermatozoa/mL. Each 4 well plate contained one well for homologous IVF, one well for heterologous IVF and one well for a parthenogenetic control group containing only matured COCs. Gametes were incubated by placing the

plates at 38.5 °C under an atmosphere of 5% CO2 in air with maximum humidity. This experiment was repeated with the twelve ejaculates obtained from the dolphin or bull. 150 2.1.3. Assessment of attachment and IVF parameters

Sperm to zona attachment experiments were conducted as described previously [29] with some modifications. The number of attached spermatozoa was evaluated in 155 oocytes from the homologous and heterologousMANUSCRIPT IVF groups at 2.5 h of co-incubation time. This time was chosen in a preliminary experiment for testing the highest attachment (after 1, 2, 2.5 and 3 h of co-incubation). The number of attached spermatozoa was evaluated after vigorous pipetting that consisted of ten repeated aspirations of the oocytes through a narrow-bore Pasteur pipette. After removing the 160 loosely attached spermatozoa, oocytes were fixed and stained with Hoechst 33342 [30]. Spermatozoa attached were counted under a microscope equipped with phase contrast and epifluorescent optics (Nikon, Japan) with a 361-nm excitation filter at ×400 magnification.

165 IVF wasACCEPTED evaluated by assessing pronuclei formation and cleavage rate. Pronuclei formation and polyspermy were evaluated in the homologous and heterologous IVF groups at 18 h and 24 h of co-incubation respectively. These times were selected in a preliminary study as they showed the maximum number of pronuclei formation among co-incubation times of 12, 18, 20, 22, 24, 26 and 28 h. Polyspermy was determined by 170 the presence of more than two pronuclei respectively. Pronuclear formation was 6

ACCEPTED MANUSCRIPT evaluated under a phase contrast / epifluorescent microscope. The presumptive zygotes were transferred to a 15 mL centrifuge tube containing 2 mL of PBS, gently vortexed for 2 min to remove cumulus cells, washed twice in PBS, fixed and stained with Hoechst 33342 [31]. In 10 randomly chosen presumptive hybrid zygotes per sample, 175 pronuclear formation was confirmed under confocal laser scanning microscopy (MRC 1024, Bio-Rad, Hercules, CA, USA) at 488 nm argon laser excitation and 515-530 nm detection. Presumptive zygotes were optically sequentially sectioned (2 µm) and images were collected using the Bio Rad Laser Sharp 2000 4.3 imaging software and visualized using the Confocal Assistant 4.02 software package (Bio-Rad). 180 At the different incubation times (18 h in the parthenogenic control group, 18 h in the homologous or 24 h in the heterologous IVF group); the presumptive zygotes or COCs were washed four times in PBS and twice in synthetic oviduct fluid supplemented with 5% FCS (SOF). Then they were transferred in groups of 25 to 25 µL 185 of SOF culture droplets (i.e. 1 embryo per µL) and incubation was resumed and continued at 39 °C. At 48 h after the initiation of the co-incubation, cleavage was evaluated under a stereomicroscope by assessing the presence of two cells per embryo. MANUSCRIPT 2.1.4. Assessment of heterologous fertilization using PCR 190 After cleavage evaluation, embryos were washed in PBS and, in order to remove spermatozoa that could have remained attached, the zona pellucida was removed by transferring the embryos into a 5 mg/mL pronase solution [32]. Zona digestion was continuously observed under an inverted microscope and, when the zona was no longer 195 visible, embryos were washed 3 times in PBS individually, snap-frozen in liquid nitrogen in 0.2 µL eppendorf tubes and stored at −80 °C until analysis. To confirm heterologous fertilization a PCR analysis of the reference gene (housekeeping gene) that codifies for theACCEPTED dolphin 18 S ribosomal protein (DQ404537.1) was performed on day-2 embryos. Embryos were thawed at 4 ºC for 30 min and subsequently digested with 100 200 µg/mL proteinase K solution, 8 µL per 2-cell embryo, at 55 °C overnight. Then, proteinase K was inactivated at 95 °C for 10 min. The PCR primers for the dolphin ribosomal 18 S gene were R1: TTGGACACACCCACGGTGCGG and F2: CAGAAGGACGTGAAGGATGGA. The PCRs were conducted in a total volume of 25 7

ACCEPTED MANUSCRIPT µL containing: 8 µL of the proteinase K-digested sample, 5 µL of 1× Gotaq Flexi buffer 205 (Promega, Madison, WI, USA), 0.25 µL of dNTPs, 0.5 µL of each primer (R1 and F2), 0.25 µl of Taq Polymerase and 2 µL of MgCl2. The PCRs were run for 40 cycles of denaturation (94 ºC, 15 s), annealing (59 ºC, 25 s) and extension (72 ºC, 20 s). PCR products were visualized on an ethidium bromide-stained 2% agarose gel under ultraviolet illumination. Samples which exhibited a band at 190 bp were considered to 210 contain dolphin DNA. Six controls were used in each PCR: A positive control that corresponded to dolphin sperm DNA dilutions (the most diluted sample had a concentration of 0.4 ng/mL DNA that according to preliminary studies corresponded to the minimum amount of DNA necessary to detect the 18 S dolphin gene in 1 dolphin spermatozoa under the PCR conditions used in this study) and negative controls that 215 corresponded to bovine sperm DNA dilutions (4 and 40 ng/mL DNA), 2-cell bovine embryo and a blank control.

A preliminary study to determine the minimum amount of DNA necessary to detect the 18 S gene in a dolphin or in a bovine spermatozoa, was performed as follows. 220 Briefly, sperm samples were thawed and centrifuged for 10 min (250 x g). Samples containing dolphin or bovine spermatozoa wereMANUSCRIPT then digested with 30 µL of proteinase K and 5 µL of dithiothreitol (DTT) at 55 ºC overnight. Afterwards, 200 µL of ultrapure water was added, the sample briefly centrifuged and supernatant kept. The concentration of DNA was then determined with a biophotometer (Eppendorf, 225 Hamburg, Germany). Ten-fold serial dilutions of each sample were done until a concentration of DNA of 0.4 ng/mL was obtained. Finally, PCR was performed on the various dilutions to test if one single dotation of dolphin genomic DNA could be detected without interferences, and therefore, whether these PCR conditions could be applied to detect dolphin DNA in a single hybrid embryo. 230 2.2. ExperimentACCEPTED 2: Heterologous zona intact murine IVF using dolphin spermatozoa

2.2.1. Semen collection, cryopreservation

235 The dolphin semen doses were obtained and used as in experiment 1. Frozen dolphin spermatozoa were thawed the day of the experiment whereas murine 8

ACCEPTED MANUSCRIPT spermatozoa were obtained from fresh semen. Murine semen was collected from a total of five 9-month old B6D2F1 mice [33]. Mice were fed ad libitum with a standard diet (Harland Ibérica, Barcelona, Spain) and maintained in a temperature and light- 240 controlled room (23 °C; 14 hours light: 10 hours dark). Male mice were euthanized by cervical dislocation. Each epididymis was placed in a prewarmed 500 µL drop of M2 medium. Adipose tissue and blood vessels were carefully dissected away and the epididymis gently minced with fine scissors and placed into human tubular fluid (HTF, Irvine Scientific, Santa Ana, CA, USA) supplemented with 2 mg/mL bovine serum 245 albumin (BSA ) [34]. Semen samples were analyzed by CASA using previously validated parameters for this species [28].

2.2.2. IVF

250 A total of five replicates of this experiment were performed. Mature COCs were obtained from adult hybrid (C57BL/6J X CBA) 6 to 8 weeks old female mice by inducing superovulation. Mice were treated with an intraperitoneal injection of 7 IU of equine chorionic gonadotropin (eCG, Folligon 500, Intervet, The Netherlands) followed, 48 h later, by 5 UI of human chorionicMANUSCRIPT gonadotropin (hCG, Veterin Corion, 255 Equinvest, Spain). Approximately 13-15 h from the hCG injection, mice were euthanized by cervical dislocation and the oocytes collected from the ampulla [35]. Four experimental groups were used: a control group (in which no sperm was added for co- incubation), a homologous IVF group and two heterologous IVF groups, which included oocytes with and without cumulus cells respectively. Cumulus cells were 260 removed in the latter group by gently pipetting after 20 s incubation with 300 µg/mL hyaluronidase [35]. Approximately 35-40 oocytes or 2-3 clumps of COC’s were suspended into each Nunc dish well containing 500 µL of HTF supplemented with BSA and covered with mineral oil, for the parthenogenetic and homologous IVF groups, or into 500 µL bovineACCEPTED FERT media for the heterologous IVF group. In order to achieve 265 capacitation, murine spermatozoa were incubated in a 500 µL HTF drop supplemented

with BSA for 15 min at 37 °C in a 5 % CO2 atmosphere. Frozen dolphin spermatozoa were thawed, separated using the Bovipure gradient system as described in experiment 1. Oocytes were co-incubated for 6 or 22 h in the presence of either 1 × 106 spermatozoa/mL murine or dolphin spermatozoa respectively. After co-incubation, 9

ACCEPTED MANUSCRIPT 270 presumptive homologous zygotes or oocytes (parthenogenetic control) were transferred and incubated in culture drops of potassium simplex optimized medium (KSOM) with

amino acids at 37 ºC under an atmosphere of 5% CO2, in air with maximum humidity to complete a total of 24 h of incubation.

275 2.2.3. Assessment of attachment and IVF parameters

Sperm-zona attachment was assessed at 2.5 h of incubation, after vigorous pipetting of oocytes., Pronuclei formation and polyspermy in the homologous and heterologous IVF were evaluated by microscopy at 6 h and 22 h of co-incubation 280 respectively. These were selected in a preliminary study among co-incubation times of 6, 12, 18 and 22 h. Cleavage rate was evaluated in the IVF and parthenogenetic groups after 24 h of incubation. All procedures were used as described in experiment 1. (2.1.3.)

2.2.4. Assessment of heterologous fertilization using PCR. 285 After cleavage evaluation embryos were washed in M2 and, in order to remove spermatozoa that could have remained attached,MANUSCRIPT zona pellucida was removed by transferring the embryos into an acidic Tyrode´s solution (pH 3.1), [36]. Zona pellucida digestion was continuously observed under an inverted microscope and, when the zona 290 was no longer visible, embryos were washed 3 times in M2 individually, snap frozen and thawed on the day of PCR analysis as described in experiment 1 (2.1.4.).

Murine and dolphin sperm samples as well as ten-fold dilutions of the samples were prepared in order to determine if the PCR conditions were appropriate to detect a 295 single dolphin spermatozoa as described in experiment 1. Seven controls were used in each PCR: three positive controls corresponding to dolphin sperm DNA serial dilutions (the most dilutedACCEPTED sample correspond to a 0.4 ng/mL DNA), two negative controls corresponding to murine sperm DNA serial dilutions (4 and 40 ng/mL DNA), a 2-cell murine embryo and a blank control. 300 2.3. Experiment 3: Dolphin sperm chromatin maturation, condensation and stability

ACCEPTED MANUSCRIPT 2.3.1. Semen collection, cryopreservation

305 Four adult, proven breeding male bottlenose dolphins were used for semen collection. Male1 was housed at Zoo Aquarium, (Madrid, Spain) and males 2, 3 and 4 were housed at SeaWorld, (Gold Coast, Australia). Males 1, 2, 3 and 4 were 33, 9, 16 and 19 years old and weighted 220, 196, 209 and 203 kg, respectively. Two to three ejaculates were used from each of the dolphins. Bull ejaculates used were the same as 310 described in experiment 1 (2.1.1.).

2.3.2. Chromatin maturation

Chromatin maturation determined by the presence of histones was assessed by 315 aniline blue staining of frozen-thawed bovine and dolphin spermatozoa. Two ejaculates from each bull and dolphin were used for evaluation. After thawing, aniline blue staining was performed as previously described [37]. A thousand spermatozoa per dolphin ejaculate, 250 sperm cells per slide, were examined. Samples were evaluated by bright-field microscopy (40x). Spermatozoa showing intense and very intense blue stain 320 were considered as aniline-blue positive whereasMANUSCRIPT those weakly or not stained were considered as negative. The percentage of stained sperm heads was calculated.

2.3.3. Analysis of chromatin condensation and stability

325 Two different ejaculates from the same dolphin (male 1) and two different ejaculates from the same bull, both used as donors in experiment 1 (2.1.1.), were analyzed to determine chromatin condensation and stability. Samples were collected, processed, frozen and thawed as previously described [22]. The degree of chromatin condensation was evaluated by assessing propidium iodide (PI) uptake, a fluorescent 330 DNA intercalatingACCEPTED compound, according to Molina et al. [38] using the Cycle Test DNA (Becton Dickinson, Mountain View, CA, USA). The emitted fluorescence was measured by flow cytometry. Chromatin stability was evaluated by assessing the resistance of chromatin to decondensation by treatment with EDTA and SDS and subsequent determination of the chromatin condensation degree. For determining 335 chromatin condensation, samples were prepared by resuspending semen for 5 min in 11

ACCEPTED MANUSCRIPT capacitation medium to a concentration of 1-2 × 10-6 spermatozoa per sample. After centrifugation at 150 x g for 10 min, the supernatant was removed and the sperm membrane was permeated using trypsin (0.5%) in a spermine-tetrahydrochloride buffer for 10 min, at room temperature. Subsequently, trypsin inhibitor and ribonuclease A (12 340 mg/mL) were added, gently mixed and incubated for 10 min at room temperature. After incubation, ice-cold PI (50 mg/mL) and spermine-tetrahydrochloride in citrate buffer were added. Finally, samples were incubated for 1 h in the dark at 4 °C and analyzed by flow cytometry, using a FACscan flow cytometer (Becton Dickinson, S.A, CA, USA). PI was excited by an argon-ion laser at 488 nm and fluorescence was detected at 605 345 nm, using a 600/40 band-pass filter. For each sample, a total of 10,000 cells/min were counted. Data were analyzed using Cell Quest software (Becton Dickinson). The intensity of fluorescence was expressed as mean intensity fluorescence units (MIFU), related to the PI uptake by DNA. Chromatin stability was determined as previously described with some modifications [39, 40]. Briefly, aliquots of semen containing 2 350 X106 spermatozoa were diluted in borate buffer (0.05 M, pH= 9.0) containing different EDTA and SDS concentrations of (1) 0.0469 mM and 0.0078 %, (2) 0.0938 mM and 0.0156 %, (3) 0.1875 mM and 0.0313 %, (4) 0.375 mM and 0.0625 %, (5) 0.75 mM and 0.125 %, (6) 1.5 mM and 0.25 %, (7) 3 mM andMANUSCRIPT 0.5 %, (8) 6 mM and 1 %, (9) 12 mM and 1.5 % and (10) 18 mM and 3 % respectively. Samples were incubated for 5 min at 355 room temperature and then subjected to chromatin condensation analysis with PI and flow cytometry as described above.

2.4. Statistical analysis

360 Data are presented as mean ± SEM. In the attachment experiment, variables were analyzed with non-parametric ANOVA comparing the percentages over multiple replicates (Kruskal Wallis and Mann-Whitney’s test). A P value <0.001 revealed statistical signiﬁcance.ACCEPTED The percentage of oocyte penetration, male pronuclear formation, percentage of polyspermy, percentage of parthenogenetic cells and cleavage 365 rate were analyzed by parametric one-way ANOVA, z-test or t-test. When ANOVA revealed a significant effect, values were compared using Mann-Whitney’s test.

ACCEPTED MANUSCRIPT

3. Results

370 3.1. Experiment 1: Heterologous fertilization among bovine oocytes and dolphin spermatozoa

3.1.1. Sperm evaluation

375 The percentage of spermatozoa (mean ± SD) that showed total and progressive motility for frozen-thawed dolphin and bovine spermatozoa were 84.5 ± 5.3 and 66.3 ± 7.2,as well as 69.1 ± 5.1 and 33.9 ± 7.0, respectively.

3.1.2. Attachment and IVF parameters 380 The number of attached dolphin spermatozoa after 2.5 h of co-incubation, was higher than bovine spermatozoa co-incubated with zona intact bovine oocytes (P<0.001) (Table 1, Figs. 1A and 1B). Heterologous IVF showed that dolphin spermatozoa were capable of penetrating cow oocytes,MANUSCRIPT leading to pronuclear formation 385 as well as hybrid embryo cleavage (Table 1, Figs. 1 C, D, E and F). The pronuclei formation and cleavage rate determined by contrast / fluorescence and confirmed by confocal microscopy, was higher in the homologous than in the heterologous IVF group (Table 1). The polyspermy percentage, evaluated after 18 h of co-incubation was 11.0 ± 1.2 in the homologous IVF group, whereas no polyspermic oocytes were observed in 390 the heterologous IVF group.

The cleavage rate at 48 h post incubation in the heterologous IVF group was 34%, lower (P<0.001) than in the homologous IVF group, which led to a cleavage rate of close to 90%ACCEPTED (Table 1). A spontaneous parthenogenetic activation rate of 8.0% was 395 observed in bovine matured unfertilized oocytes at 48 h (Table 1).

3.1.3. Assessment of heterologous fertilization using PCR

ACCEPTED MANUSCRIPT The presence of dolphin genetic material in the hybrid embryos was confirmed 400 by PCR by evaluating the presence of a dolphin reference gene that encoded for the ribosomal 18 S protein that resulted in a 190 bp electrophoretic band (Fig.2). In a preliminary study, serial dilutions of DNA from dolphin spermatozoa were tested, in order to check the PCR conditions capable to detect the dolphin DNA present in one sperm cell, which is equivalent to the DNA present in a 2-cell hybrid embryo. Dolphin 405 sperm DNA concentrations of 40, 4 and 0.4 ng/mL, the latter corresponding to one dolphin sperm cell, all exhibited a positive 190 bp band. Serial dilutions of bovine sperm DNA showed a positive 190 bp band at concentrations of 4000 ng/mL and 400 ng/mL, but were no longer detected at lower concentrations (40 or 4 ng/mL). This indicates that dolphin DNA could be detected in a single spermatozoon (or a single 2- 410 cell hybrid embryo) under the PCR conditions used in this study and could be distinguished from the bovine DNA. Experimental 2-cell embryos presenting a 190 bp band were considered to be positive to the specific PCR product. Among the 30 embryos from heterologous IVF, 20 were positive, which represent a 66.7% of all embryo tested. None of the bovine 2-cell embryos showed the 190 bp band (Fig. 2). 415 3.2. Experiment 2: Heterologous fertilization amongMANUSCRIPT murine oocytes and dolphin spermatozoa

3.2.1 Semen evaluation

420

The percentage of spermatozoa (mean ± SD) that showed total and progressive motility for fresh murine spermatozoa were 65.8 ± 5.0 and 50.7 ± 0.6, respectively; frozen thawed dolphin spermatozoa were the same used in experiment 1.

425 3.2.2. Attachment and IVF parameters ACCEPTED The number (mean ± SEM) of attached murine or dolphin spermatozoa to zona pellucida after 2.5 h of co-incubation with murine oocytes were similar (0.83 ± 2.4 and 0.8 ± 1.8 spermatozoa /oocyte respectively) (P>0.05). The SEM showed a great 430 dispersion from the average (Table 2). Presumptive zygotes were evaluated for

ACCEPTED MANUSCRIPT pronuclear formation at 6 h of co-incubation with murine spermatozoa or 22 h of co- incubation with frozen / thawed dolphin spermatozoa and cleavage rate at 24 h of co- incubation (Fig. 3) and the results are shown in Table 2. Pronuclear formation was significantly higher (P<0.001) in the homologous IVF group. Cleavage rate in the 435 heterologous group was higher compared to the parthenogenetic group, but much lower than in the homologous IVF group (P<0.001). Interestingly, the heterologous IVF performed on cumulus free zona oocytes, showed similar cleavage rate than on oocytes that possessed cumulus cells (3.3 and 9.6%, respectively).

440 3.2.3. Assessment of heterologous fertilization using PCR

Embryos generated by heterologous IVF using dolphin spermatozoa and murine oocytes were identified by PCR. As described for heterologous IVF among bovine oocytes and dolphin sperm (Experiment 1, 2.1.4.), DNA ten-fold serial dilutions of 445 murine spermatozoa were prepared in order to determine if murine DNA for this specific PCR product could be detected for a single spermatozoa (0.4 ng/mL DNA), equivalent to a 2-cell hybrid embryo. Dolphin DNA had exhibited a positive 190 bp band at these two concentrations. Therefore, onMANUSCRIPT the PCR amplification of 2-cell hybrid embryo, the observation of a 190 bp band would correspond to the presence of dolphin 450 DNA. Results showed that the PCR product could not be detected in mice DNA at concentrations of 4 and 0.4 ng/mL. Figure 4 shows the experimental 2-cell embryos that presented a positive 190 bp band and were considered to be positive to the specific PCR product; 92.3% of the 2-cell embryo tested exhibited a positive 190 bp band (n=13), showed that they were murine-dolphin hybrid embryos. Control 2-cell embryos from 455 mice, homologous IVF did not show the 190 bp band.

3.3. Experiment 3: Nuclear dolphin sperm chromatin maturation, condensation and stability ACCEPTED

460 Three of the four dolphins showed positive aniline blue staining (Fig. 5), although the percentages of positively stained spermatozoa were very low, ranging from 0 to 3.7% (Table 3). Chromatin stability showed the same trend and was similar among ejaculates from the same species. The rate of PI uptake increased up to a maximum and 15

ACCEPTED MANUSCRIPT then, at higher concentrations EDTA and SDS, PI uptake decreased. The results of the 465 sperm chromatin stability investigation also showed that dolphin sperm chromatin was more stable than bovine, because at the same EDTA and SDS concentrations, there was a significantly higher (P<0.05) degree of decondensation observed in bovine spermatozoa (Fig. 6). In addition, higher concentrations of EDTA and SDS were necessary to induce the maximum sperm chromatin decondensation degree in the 470 dolphin spermatozoa (Fig. 6).

4. Discussion

This study revealed the ability of cryopreserved dolphin spermatozoa to 475 penetrate zona intact bovine and murine oocytes and generate hybrid embryos. Previous studies have described cross species fertilization of zona intact oocytes between phylogenetically related species, such as domestic and endangered felids [4, 41-43], or between bovine and equine [44], as well as between bovine and artiodactyls [5-8, 45]. However, the results obtained in this study were unexpected. Heterologous IVF success 480 among phylogenetically distant species, has never been reported up to our knowledge. MANUSCRIPT 4.1. Dolphin spermatozoa interact and penetrate both zona intact cow and murine oocytes

485 Dolphin spermatozoa were able to bind to both bovine and murine oocytes after 2.5 h of co-incubation. This result agrees the only study that described heterologous IVF using cryopreserved dolphin spermatozoa, in which maximum attachment and binding were achieved at 2 h of co-incubation with zona-free hamster oocytes [9]. Similar times are used in co-incubation studies of other species [46-49]. 490 The presenceACCEPTED of spermatozoa in the perivitelline space of bovine (Fig. 1C, D), as well as the presence of dolphin sperm head chromatin decondensing inside murine oocytes (Fig. 3B) confirmed that ZP from both species were able to recognize dolphin spermatozoa. It also suggests the AR was induced, that the ZP from both species were 495 sensitive to the dolphin acrosome enzymes and active binding was achieved. These results are in agreement with previous reports that indicate that the acrosome lytic 16

ACCEPTED MANUSCRIPT system is conserved among mammals [50]. Interestingly, the results obtained showed that the sperm-oocyte interaction was higher in the heterologous than in the homologous group when using bovine oocytes (Table 1; Fig. 1A, B). These results were unexpected, 500 as recognition among gametes from the same species is thought to increase interaction. However, they support the idea raised by Bedford [51, 52] which suggests that interaction and fertilization success does not only depend on recognition between the gamete receptors, which conserved regions are unlikely to be abundant among phylogenetically distant species, such as the ones involved in the present study. Bedford 505 [51, 52] suggests that other factors, such as physical thrust or those able to reduce specificity of the zona pellucida can facilitate the interaction. Among these, physical thrust seems the most obvious [51]. This factor is related to sperm motility [53]. In the course of performing the interaction experiments, it was observed that dolphin spermatozoa were more motile than bovine or even than fresh murine spermatozoa [54]. 510 This could be explained by the longer flagellum, characteristic of the dolphin spermatozoa, and their high mitochondrial activity [9, 55]. Another interesting feature of the dolphin spermatozoa described by Fleming et al. [9] that may help to explain the high interaction values obtained in the heterologous bovine fertilization is the small fusiform head and the presence of 14-16 elevatedMANUSCRIPT ridges. These ridges, which run in 515 parallel to the long axis, increasing the contact surface and providing stable interaction, have been suggested to participate in membrane penetration and fusion [9, 52].

Finally, the present study revealed an interesting feature that may also contribute to the higher interaction values observed in the heterologous IVF, the chromatin status. 520 Frozen-thawed dolphin sperm, which showed higher interaction values than frozen- thawed bovine spermatozoa when incubated with bovine oocytes (Table 1, Fig.1), also showed a more stable chromatin (Fig.6). This observation is in consonance with previous studies that suggest that the sperm chromatin status can influence sperm interaction andACCEPTED even penetration of the ZP. In this regard, it has been previously 525 reported [28, 56] that the spermatozoa attached to the ZP presented lower levels of DNA fragmentation and Bedford [52, 57] proposed that a stable chromatin structure provides the sperm with rigidity to facilitate interaction and penetration.

ACCEPTED MANUSCRIPT The ability of the dolphin spermatozoa to interact and penetrate oocytes from 530 other species could therefore be related to its physical characteristics. The flagellum length, the head elongation and rapid motility have been suggested to provide competitive advantages. Dolphins are a promiscuous species. The above sperm characteristics, can provide physical advantage and facilitate heterologous fertilization [58, 59]. 535 Nevertheless, it has to be considered that interaction does not only depend on sperm but also on the oocyte factors. The present study showed that murine oocytes were more restrictive to dolphin spermatozoa than bovine oocytes. This could be explained by differences in the ZP receptors [60-62] that can be influenced by the 540 oocyte maturation procedure. In the present study murine oocytes were obtained from the oviduct whereas the bovine oocytes were matured in vitro. The exposure to oviductal components could modify sperm and ZP glycoproteins as well as to create differences in the masking patterns of the ZP receptor by oviductal proteinss that could limit the sperm interaction, and may contribute to an explanation that accounts for the 545 reduced and high variability of attachment values observed in murine oocytes (Table 2, Fig.3) [48, 63]. MANUSCRIPT

4.2. Dolphin spermatozoa could induce the polyspermy blockage in cow and murine oocytes 550 The present study revealed that dolphin spermatozoa are very efficient in triggering the block of polyspermy specially in bovine, more than in murine oocytes. These species present relevant differences in the development of the polyspermy block; whereas in the murine oocyte the cortical granule exocytosis concur with increased resistance to 555 proteases ("ZP hardening"); bovine oocytes experience a pre-fertilization hardening process [31]. ACCEPTEDDespite these differences, the dolphin spermatozoa were highly efficient in inducing polyspermy block. No polyspermy was detected when co-incubating dolphin spermatozoa with bovine oocytes and only 1% was found in heterologous murine IVF; the polyspermy rates after homologous IVF where within the expected values, 5 to 45% 560 in bovine [64-66] and 0 to 4% in murine [67]. These results confirmed sperm penetration and revealed the extraordinary capacity of the dolphin spermatozoa to 18

ACCEPTED MANUSCRIPT induce the polyspermy block and even overcome conditions favorable for polyspermy, such as the lack of oviductal maturation in the case of bovine oocytes, or the absence of cumulus cells in the case of murine oocytes [63, 64, 68]. 565 The development of an efficient mechanism of polyspermy block in the dolphin may have some evolutionary significance. It has been suggested that enhanced competitiveness of spermatozoa may increase the risk to polyspermy [59]. Thus it is possible that the sperm from a competitive species, such as dolphin, may have been 570 naturally selected towards the development of an efficient mechanism to induce the polyspermy block.

4.3. Dolphin spermatozoa are able to fertilize cow and murine oocytes

575 In the present study, heterologous fertilization was shown by several events: vitelline membrane penetration, decondensation of the sperm head in the oocyte cytoplasm or presence of two extruded polar bodies and the presence of two pronuclei in the oocyte cytoplasm (Figs. 3 and 4). The presence of pronuclei and polar bodies suggest that the dolphin spermatozoa are able toMANUSCRIPT trigger events related to egg activation, 580 which include exit from the arrest at MII stage, completion of meiosis and pronuclei formation. Finally, fertilization was confirmed by determining hybrid embryo formation.

Regarding the chromatin structure, the bovine sperm chromatin condensation 585 and stability values obtained in the present study (Fig. 6) were similar to those reported previously [39] using the same conditions. Higher chromatin stability was observed in all the samples of dolphin sperm analyzed. From the evolutionary point of view, the higher chromatin stability may represent a mechanism of preserving the chromatin integrity fromACCEPTED the ROS generated by the high temperatures found in the internal testis of 590 the dolphin [69]. In contrast, in the Asian elephant, a terrestrial endorchid, it has been suggested that sperm chromatin is more susceptible to fragmentation than spermatozoa of other mammals [70]. The high chromatin stability found in the dolphin spermatozoa was consistent with the low percentage (0-4%) of dolphin spermatozoa that revealed with defective protamination (immature spermatozoa), as determined by staining with 19

ACCEPTED MANUSCRIPT 595 aniline blue, which is taken up by the abundant lysine residues present in the histones. A significant association between defective abnormal sperm chromatin protamination and male subfertility has been reported [71-73]. Relationship between chromatin stability, protamination and fertility would provide fundamental information on chromatin status, which is expected to have a strong prognostic value on sperm function [39, 74]. 600 Hybrid embryos were observed under the microscope by assessing equal sized blastomeres and prominent nucleus, and were further confirmed by the presence of genetic material from the dolphin by PCR. Parthenogenetic activation was within the expected levels [7, 75, 76]. Production of hybrid embryos among bovidae has been 605 reported [5-7]. Bovine oocytes reach the stage of embryo under a paternally centrosome inherited model. However, murine centrosomes are maternally inherited. The results obtained are surprising, because dolphin sperm was able to lead to embryo formation in both maternally and paternally centrosome inherited models. In general, hybrid embryo results were better when performing heterologous IVF in bovine than in murine, which 610 may be related to the fact that the cow is phylogenetically closer to the dolphin [15] than murine. On the other hand, the murine maternal inherited centrosome could confer higher instability, detrimental to hybrid embryoMANUSCRIPT formation.

The presence of cumulus cells had no effect on heterologous IVF murine model, as 615 blockage of polyspermy or embryo formation were not significantly increased in intact oocytes. These results differ from those reported after homologous IVF, which have shown that the cumulus oophorus plays a role in blocking polyspermy and increase embryo formation since they are able to transfer nutrients and regulatory signals to the oocyte [10, 68]. 620 In conclusion, this study revealed outstanding properties of dolphin spermatozoa that present aACCEPTED highly stable chromatin and being capable to fertilize both bovine and murine oocytes, leading to the production of hybrid embryo formation. Since the dolphin mate promiscuously it is possible that sperm competitiveness favors selective 625 pressure towards a dynamic morphology, improvement of the functional characteristics and chromatin stability. The latter can confer protection against the high levels of ROS to which endorchid species like dolphin might be subject to. These characteristics taken 20

ACCEPTED MANUSCRIPT together may help to explain the heterologous fertilizing ability of the dolphin spermatozoa. The results from this study open a new window for future tests of sperm 630 functionality in the dolphin and raise questions about the mechanisms of fertilization, which remains largely unanswered in these mammals.

Declaration of interest

635 There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported

Fundings

640 This work was supported by the Spanish Ministry of Science and Innovation (RTA2012-0026 and CC07-072).

Acknowledgements MANUSCRIPT

645 The authors wish to thank to Servicio de Microscopía confocal Luis Bru, Universidad Complutense de Madrid, for their assistance with the confocal microscopy analysis. We are grateful to the dolphin trainers at Zoo Aquarium of Madrid and at Sea World Gold Coast for dolphin sperm collection specially David Blyde for his collaboration. We are also grateful to Asturgen for providing bovine semen. 650 References

[1] Brahmkshtri BP, Edwin MJ, John MC, Nainar AM, Krishnan AR. Relative efficacy of conventional sperm parameters and sperm penetration bioassay to assess bull fertility in vitro. 655 Anim Reprod Sci.ACCEPTED 1999;54:159-68. [2] Montano GA, Kraemer DC, Love CC, Robeck TR, O'Brien JK. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 2012;143:799-813. [3] Sánchez-Calabuig MJ, López-Fernández C, Martínez-Nevado E, Pérez-Gutiérrez J, de la 660 Fuente J, Johnston SD, et al. Validation of a Field Based Chromatin Dispersion Assay to Assess Sperm DNA Fragmentation in the Bottlenose Dolphin (Tursiops truncatus). Reprod Domest Anim. 2014;49:761-8 21

ACCEPTED MANUSCRIPT [4] Donoghue AM, Johnston LA, Seal US, Armstrong DL, Simmons LG, Gross T, et al. Ability of thawed tiger (Panthera tigris) spermatozoa to fertilize conspecific eggs and bind and penetrate 665 domestic cat eggs in vitro. J Reprod Fertil. 1992;96:555-64. [5] Cox JF, Avila J, Saravia F, Santa Maria A. Assessment of fertilizing ability of goat spermatozoa by in vitro fertilization of cattle and sheep intact oocytes. . Theriogenology USA. 1994;41:1621-9. [6] García-Alvarez O, Maroto-Morales A, Martínez-Pastor F, Fernández-Santos MR, Esteso MC, 670 Pérez-Guzmán MD, et al. Heterologous in vitro fertilization is a good procedure to assess the fertility of thawed ram spermatozoa. Theriogenology. 2009;71:643-50. [7] Kouba AJ, Atkinson MW, Gandolf AR, Roth TL. Species-specific sperm-egg interaction affects the utility of a heterologous bovine in vitro fertilization system for evaluating antelope sperm. Biol Reprod. 2001;65:1246-51. 675 [8] Soler AJ, Poulin N, Fernández-Santos MR, Cognie Y, Esteso MC, Garde JJ, et al. Heterologous in vitro fertility evaluation of cryopreserved Iberian red deer epididymal spermatozoa with zona-intact sheep oocytes and its relationship with the characteristics of thawed spermatozoa. Reprod Domest Anim. 2008;43:293-8. [9] Fleming AD, Yanagimachi R, Yanagimachi H. Spermatozoa of the Atlantic bottlenosed 680 dolphin, Tursiops truncatus. J Reprod Fertil. 1981;63:509-14. [10] Tanghe S, Van Soom A, Nauwynck H, Coryn M, de Kruif A. Minireview: Functions of the cumulus oophorus during oocyte maturation, ovulation, and fertilization. Mol Reprod Dev. 2002;61:414-24. [11] Tanihara F, Nakai M, Kaneko H, Noguchi J, Otoi T, Kikuchi K. Evaluation of zona pellucida 685 function for sperm penetration during in vitro fertilization in pigs. J Reprod Dev. 2013;59:385- 92. [12] Calvin HI, Grosshans K, Blake EJ. Estimation and manipulation of glutathione levels in prepuberal mouse ovaries and ova: relevance to sperm nucleus transformation in the fertilized egg. Gamete Res 1986;14:265-75. 690 [13] de Matos DG, Furnus CC, Moses DF, Martinez MANUSCRIPTAG, Matkovic M. Stimulation of glutathione synthesis of in vitro matured bovine oocytes and its effect on embryo development and freezability. Mol Reprod Dev. 1996;45:451-7. [14] Schatten G, Simerly C, Schatten H. Maternal inheritance of centrosomes in mammals? Studies on parthenogenesis and polyspermy in mice. Proc Natl Acad Sci U S A. 1991;88:6785-9. 695 [15] Mc Donald DW. The encyclopedia of mammals. University of Oxford 2006. [16] Bedford JM, Calvin HI. The occurrence and possible functional significance of -S-S- crosslinks in sperm heads, with particular reference to eutherian mammals. J Exp Zool. 1974;188:137-55. [17] Marushige Y, Marushige K. Enzymatic unpacking of bull sperm chromatin. Biochim Biophys 700 Acta. 1975;403:180-91. [18] Oliva R. Protamines and male infertility. Hum Reprod Update. 2006;12:417-35. [19] Córdova A, Pérez-Gutiérre JF, Lleó B, García-Artiga C, Alvarez A, Drobchak V, et al. In vitro fertilizing capacity and chromatin condensation of deep frozen boar semen packaged in 0.5 and 5 ml straws. Theriogenology. 2002;57:2119-28. 705 [20] Kim B, Park K, Rhee K. Heat stress response of male germ cells. Cell Mol Life Sci. 2013;70:2623-36.ACCEPTED [21] Keller KV. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. International Association of Aquatic Animal Medicine. 1986;14:22-4. [22] Robeck TR, O'Brien JK. Effect of cryopreservation methods and precryopreservation 710 storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 2004;70:1340-8.

ACCEPTED MANUSCRIPT [23] Christensen P, Boelling D, Pedersen KM, Korsgaard IR, Jensen J. Relationship between sperm viability as determined by flow cytometry and nonreturn rate of dairy bulls. J Androl. 2005;26:98-106. [24] Dumont P. Adjusting the number of spermatozoa in mini-straws by determination of the 715 operative volume of bovine semen. Theriogenology. 2002;57:1743-54. [25] Rizos D, Lonergan P, Boland MP, Arroyo-Garcia R, Pintado B, de la Fuente J, et al. Analysis of differential messenger RNA expression between bovine blastocysts produced in different culture systems: implications for blastocyst quality. Biology of reproduction. 2002;66:589-95. [26] Parrish JJ, Susko-Parrish J, Winer MA, First NL. Capacitation of bovine sperm by heparin. 720 Biol Reprod. 1988;38:1171-80. [27] Sánchez-Calabuig M, Beltran-Breña P, Martínez-Nevado E, de las Parras C, de la Fuente J. CASA analysis of chilled and thawed dolphin sperm. European Association for Aquatic Mammals. Barcelona2011. [28] Hourcade JD, Pérez-Crespo M, Fernández-González R, Pintado B, Gutiérrez-Adán A. 725 Selection against spermatozoa with fragmented DNA after postovulatory mating depends on the type of damage. Reprod Biol Endocrinol. 2010;8:9. [29] Canovas S, Coy P, Gomez E. First steps in the development of a functional assay for human sperm using pig oocytes. J Androl. 2007;28:273-81. [30] Latt SA. Analysis of human chromosome structure, replication of repair using BrdU-33258 730 Hoechst techniques. J Reprod Med. 1976;17:41-52. [31] Coy P, Grullon L, Canovas S, Romar R, Matas C, Aviles M. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 2008;135:19-27. [32] Diez C, Bermejo-Alvarez P, Trigal B, Caamano JN, Munoz M, Molina I, et al. Changes in 735 testosterone or temperature during the in vitro oocyte culture do not alter the sex ratio of bovine embryos. J Exp Zool A Ecol Genet Physiol. 2009;311:448-52. [33] Perez-Crespo M, Moreira P, Pintado B, Gutierrez-Adan A. Factors from damaged sperm affect its DNA integrity and its ability to promote embryoMANUSCRIPT implantation in mice. J Androl. 2008;29:47-54. 740 [34] Pérez-Cerezales S, Miranda A, Gutiérrez-Adán A. Comparison of four methods to evaluate sperm DNA integrity between mouse caput and cauda epididymidis. Asian J Androl. 2012;14:335-7. [35] Nagy A, Gertsenstein M, Vintersten K, R. BR. Manipulating the Mouse Embryo: A Laboratory Manual. United States: Cold Spring Harbor Laboratory Press,U.S. 764 p.; 2002. 745 [36] Fan ZQ, Wang YP, Yan CL, Suo L, Zhu SE. Positive effect of partial zona pellucida digestion on in vitro fertilization of mouse oocytes with cryopreserved spermatozoa. Lab Anim. England2009. p. 72-7. [37] Dadoune J, Mayaux M, Guihard-Moscato M. Correlation between defects in chromatin condensation of human spermatozoa stained by aniline blue and semen characteristics. 750 Andrologia. 1988;20:211-7. [38] Molina J, Castilla JA, Gil T, Hortas ML, Vergara F, Herruzo A. Influence of incubation on the chromatin condensation and nuclear stability of human spermatozoa by flow cytometry. Hum Reprod. 1995;10:1280-6. [39] Madrid-BuryACCEPTED N, Perez-Gutierrez JF, Perez-Garnelo S, Moreira P, Pintado Sanjuanbenito B, 755 Gutierrez-Adan A, et al. Relationship between non-return rate and chromatin condensation of deep frozen bull spermatozoa. Theriogenology. 2005;64:232-41. [40] Huret JL. Variability of the chromatin decondensation ability test on human sperm. Arch Androl. 1983;11:1-7.

ACCEPTED MANUSCRIPT [41] Andrews JC, Howard JG, Bavister BD, Wildt DE. Sperm capacitation in the domestic cat 760 (Felis catus) and leopard cat (Felis bengalensis) as studied with a salt-stored zona pellucida penetration assay. Mol Reprod Dev. 1992;31:200-7. [42] Gañán N, González R, Sestelo A, Garde JJ, Sánchez I, Aguilar JM, et al. Male reproductive traits, semen cryopreservation, and heterologous in vitro fertilization in the bobcat (Lynx rufus). Theriogenology. 2009;72:341-52. 765 [43] Gañán N, González R, Garde JJ, Martínez F, Vargas A, Gomendio M, et al. Assessment of semen quality, sperm cryopreservation and heterologous IVF in the critically endangered Iberian lynx (Lynx pardinus). Reprod Fertil Dev. 2009;21:848-59. [44] Sessions-Bresnahan DR, Graham JK, Carnevale EM. Validation of a heterologous fertilization assay and comparison of fertilization rates of equine oocytes using in vitro 770 fertilization, perivitelline, and intracytoplasmic sperm injections. Theriogenology. 2014;82:274- 82. [45] Roth TL, Bush LM, Wildt DE, Weiss RB. Scimitar-horned oryx (Oryx dammah) spermatozoa are functionally competent in a heterologous bovine in vitro fertilization system after cryopreservation on dry ice, in a dry shipper, or over liquid nitrogen vapor. Biol Reprod. 775 1999;60:493-8. [46] Naz RK, Sacco AG, Yurewicz EC. Human spermatozoal FA-1 binds with ZP3 of porcine zona pellucida. J Reprod Immunol. 1991;20:43-58. [47] Canovas S. Interacciones homólogas y heterólogas in vitro de gametos porcinos, bovinos y humanos y sus aplicaciones en el estudio de la fecundación. Murcia, Spain2007. 780 [48] Sinowatz F, Wessa E, Neumüller C, Palma G. On the species specificity of sperm binding and sperm penetration of the zona pellucida. Reprod Domest Anim. 2003;38:141-6. [49] Clulow JR, Evans G, Maxwell WM, Morris LH. Evaluation of the function of fresh and frozen-thawed sex-sorted and non-sorted stallion spermatozoa using a heterologous oocyte binding assay. Reprod Fertil Dev. 2010;22:710-7. 785 [50] Adham IM, Kremling H, Nieter S, Zimmermann S, Hummel M, Schroeter U, et al. The structures of the bovine and porcine proacrosin genesMANUSCRIPT and their conservation among mammals. Biol Chem Hoppe Seyler. 1996;377:261-5. [51] Bedford JM. Enigmas of mammalian gamete form and function. Biol Rev Camb Philos Soc. 2004;79:429-60. 790 [52] Bedford JM. Singular features of fertilization and their impact on the male reproductive system in eutherian mammals. Reproduction. 2014;147:R43-52. [53] Stauss CR, Votta TJ, Suarez SS. Sperm motility hyperactivation facilitates penetration of the hamster zona pellucida. Biol Reprod. 1995;53:1280-5. [54] Sánchez-Calabuig MJ, López-Fernández C, Johnston SD, Blyde D, Cooper J, Harrison K, et 795 al. Effect of Cryopreservation on the Sperm DNA Fragmentation Dynamics of the Bottlenose Dolphin (Tursiops truncatus). Reprod Domest Anim. 2015;50:227-35. [55] Sánchez-Calabuig M. Desarrollo de métodos alternativos de valoración y criopreservación seminal en el delfín mular (Tursiops truncatus). Madrid, Spain: Universidad Complutense de Madrid; 2014. 800 [56] Liu DY, Baker HW. Human sperm bound to the zona pellucida have normal nuclear chromatin as assessed by acridine orange fluorescence. Hum Reprod. 2007;22:1597-602. [57] Bedford JM.ACCEPTED Mammalian fertilization misread? Sperm penetration of the eutherian zona pellucida is unlikely to be a lytic event. Biol Reprod. 1998;59:1275-87. [58] Tourmente M, Gomendio M, Roldan ER. Sperm competition and the evolution of sperm 805 design in mammals. BMC Evol Biol. 2011;11:12. [59] Gomendio M, Martin-Coello J, Crespo C, Magaña C, Roldan ER. Sperm competition enhances functional capacity of mammalian spermatozoa. Proc Natl Acad Sci U S A. 2006;103:15113-7.

ACCEPTED MANUSCRIPT [60] Goudet G, Mugnier S, Callebaut I, Monget P. Phylogenetic analysis and identification of 810 pseudogenes reveal a progressive loss of zona pellucida genes during evolution of vertebrates. Biol Reprod. 2008;78:796-806. [61] Nakano M, Yonezawa N, Hatanaka Y, Noguchi S. Structure and function of the N-linked carbohydrate chains of pig zona pellucida glycoproteins. J Reprod Fertil Suppl. 1996;50:25-34. [62] Töpfer-Petersen E. Carbohydrate-based interactions on the route of a spermatozoon to 815 fertilization. Hum Reprod Update. 1999;5:314-29. [63] Coy P, Cánovas S, Mondéjar I, Saavedra MD, Romar R, Grullón L, et al. Oviduct-specific glycoprotein and heparin modulate sperm-zona pellucida interaction during fertilization and contribute to the control of polyspermy. Proc Natl Acad Sci U S A. 2008;105:15809-14. [64] Wang WH, Hosoe M, Shioya Y. Induction of cortical granule exocytosis of pig oocytes by 820 spermatozoa during meiotic maturation. J Reprod Fertil. 1997;109:247-55. [65] Coy P, Romar R, Payton RR, McCann L, Saxton AM, Edwards JL. Maintenance of meiotic arrest in bovine oocytes using the S-enantiomer of roscovitine: effects on maturation, fertilization and subsequent embryo development in vitro. Reproduction. 2005;129:19-26. [66] Iwata H, Shiono H, Kon Y, Matsubara K, Kimura K, Kuwayama T, et al. Effects of 825 modification of in vitro fertilization techniques on the sex ratio of the resultant bovine embryos. Anim Reprod Sci. 2008;105:234-44. [67] Depypere HT, McLaughlin KJ, Seamark RF, Warnes GM, Matthews CD. Comparison of zona cutting and zona drilling as techniques for assisted fertilization in the mouse. J Reprod Fertil. 1988;84:205-11. 830 [68] Bagis H, Keskintepe L, Sagirkaya H, Odaman H, Cetin S. Influences of cumulus cells during in vitro fertilization of mousee oocytes in different mouse strains. Turk J Vet Anim Sci. 2001:777-82 [69] Pabst DA, Rommel SA, McLellan WA, Williams TM, Rowles TK. Thermoregulation of the intra-abdominal testes of the bottlenose dolphin (Tursiops truncatus) during exercise. J Exp 835 Biol. 1995;198:221-6. [70] Imrat P, Hernandez M, Rittem S, Thongtip N, MahasawangkulMANUSCRIPT S, Gosálvez J, et al. The dynamics of sperm DNA stability in Asian elephant (Elephas maximus) spermatozoa before and after cryopreservation. Theriogenology. 2012;77:998-1007. [71] Bach O, Glander HJ, Scholz G, Schwarz J. Electrophoretic patterns of spermatozoal 840 nucleoproteins (NP) in fertile men and infertility patients and comparison with NP of somatic cells. Andrologia. 1990;22:217-24. [72] Foresta C, Zorzi M, Rossato M, Varotto A. Sperm nuclear instability and staining with aniline blue: abnormal persistence of histones in spermatozoa in infertile men. Int J Androl. 1992;15:330-7. 845 [73] Hammadeh ME, Al-Hasani S, Gauss C, Rosenbaum P, Georg T, Diedrich K, et al. Predictive value of chromatin decondensation in vitro on fertilization rate after intracytoplasmic sperm injection (ICSI). Int J Androl. 2001;24:311-6. [74] Lewis SE, Aitken RJ. DNA damage to spermatozoa has impacts on fertilization and pregnancy. Cell Tissue Res. 2005;322:33-41. 850 [75] Méo SC, Leal CL, Garcia JM. Activation and early parthenogenesis of bovine oocytes treated with ethanol and strontium. Anim Reprod Sci. 2004;81:35-46. [76] Downs SM.ACCEPTED Stimulation of parthenogenesis in mouse ovarian follicles by inhibitors of inosine monophosphate dehydrogenase. Biol Reprod. 1990;43:427-36.

855

ACCEPTED MANUSCRIPT Tables

Table 1. Rates of attachment, polyspermy, pronuclear formation and cleavage following 860 homologous and heterologous co-incubation with bovine oocytes and bovine or dolphin spermatozoa, respectively. Values are expressed as mean ± SEM (range) of twelve replicates; n = total number of oocytes or presumptive zygotes examined.

Pronuclear Sperm attached Polyspermy Cleavage rate formation Time of co-incubation 2.5 h 18* / 24** h 18* / 24** h 48 h n Number of sperm/oocyte n % % N % 56.7 ± 5.3a Homologous IVF 24 132 11.0 ± 4.2a * 75.9 ± 12.9 a * 371 89.3 ± 5.9c (22-89)

b 220.7 ± 18.1 d Heterologous 62 158 0.0 ± 0.0b ** 25.2 ± 7.4 b ** 832 34.8± 18.5 (24-489)

Parthenogenetic 201 8.0 e control group * Evaluated after 18 h of co-incubation. 865 ** Evaluated after 24 h of co-incubation. Within a column, values with different superscripts are significantly different, a vs b (P<0.05), c vs d vs e (P<0.001).

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Table 2. Rates of attachment, polyspermy, pronuclear formation and cleavage following 870 homologous and heterologous co-incubation with cumulus intact murine oocytes or oocytes devoid of cumulus oophorus cells (CCs) and murine or dolphin spermatozoa, respectively. Values are expressed as mean ± SEM (range) of five replicates; n = total number of oocytes or presumptive zygotes examined.

Pronuclear Sperm attached Cleavage rate Polyspermy formation Time of co- 2.5 h 6*/22** h 6*/22** h 24 h incubation Number of n n % % n % sperm/oocyte

Homologous 82.0 ± 77.1 ± 35 0.83 ± 2.4 173 0.0* 173 IVF 5.1a* 3.9a (0-2) Heterologous 7.6 ± 3.3 ± - - 73 1.4** 120 IVF (CCs free) 1.7b** 0.03b Heterologous 0.8 ± 1.8 (0- 6.4 ± 9.6 ± 45 108 0.9** 119 IVF 17) 2.1b** 3.1b Parthenogenetic - - 81 - 1.7 ± 0.7b* 73 0.0c control group 875 * Evaluated after 6 h of co-incubation. ** Evaluated after 22h of co-incubation. Within a column, values with different superscripts are significantly differentMANUSCRIPT a vs b (P<0.001)

880

ACCEPTED

ACCEPTED MANUSCRIPT Table 3. Percentage of spermatozoa nuclei expressed as mean± SD that stained positively with aniline blue, from each of the 4 dolphins studied.

Dolphin Age N Mean (±SD) D1 38 1000 1.7 ± 0.1a D2 16 1500 0.7 ± 0.4b D3 9 1200 3.7 ± 1.4c D4 19 1500 0.0 ± 0.0d a vs b vs c vs d, P<0.001; ANOVA. 885

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Figure legends

Fig. 1. Attached dolphin (A) and bovine (B) spermatozoa after 2.5 h of co-incubation 890 with zona intact bovine oocytes, gametes were stained with Hoechst 33342 and visualized under phase-contrast microscope (40x magnification). A dolphin spermatozoa in the perivitelline space of a bovine oocyte (C, D), decondensing dolphin sperm head in the bovine oocyte cytoplasm (E), images were captured under a confocal microscope and correspond to the equatorial plane of the presumptive zygote ( Hoechst 895 33342 staining), (40X magnification). Two pronuclei (F) observed under a phase contrast microscope after heterologous IVF at 24 h of co-incubation of dolphin spermatozoa with zona-intact bovine oocytes (Hoechst 33342 staining) (40x magnification).

900 Fig. 2. Representative electrophoresis (2% agarose gel ethidium bromide stained) showing the PCR amplification results, for the 18 S dolphin gene. Lanes 1 to 30 presumptive dolphin/bovine hybrid embryos, lanes S1 and S2: 4ng /mL and 0.4 ng/mL dolphin sperm DNA, lanes C1 to C5: two-cell bovineMANUSCRIPT embryos and H2O: blank control. Arrow: Indicates the 190 bp band corresponding to the amplified 18 S rDNA

905 Fig. 3. Attached dolphin spermatozoa after 2.5 h of co-incubation with zona intact murine oocytes (A). Pronuclei formation evaluation after 22 h of co-incubation of dolphin spermatozoa with zona intact murine oocytes. Decondensing dolphin sperm head chromatin (B), two pronuclei (C) and three pronuclei (D) in murine oocytes 910 stained with Hoechst 33342 and visualized under phase-contrast microscope (40 x magnifications).

Fig. 4. RepresentativeACCEPTED electrophoresis (2% agarose gel ethidium bromide stained) showing the PCR amplification results, for the 18 S dolphin gene. Lane M: molecular 915 weight marker (100bp DNA ladder); lanes D1 to D3: serial dolphin sperm DNA dilutions ( D1:400 ng/mL, D2: 4 ng/mL, D3: 0.4 ng/mL); lanes C1 and C2 murine sperm DNA concentrations 40 ng/mL and 4 ng/mL respectively; C3: two-cell murine

ACCEPTED MANUSCRIPT embryo and C4: murine blastocyst; Lanes1 to 13 presumptive dolphin/murine embryos, all embryos were considered positive except embryo in lane 6 since the band at 190 bp 920 was not detected.

Fig. 5. Dolphin spermatozoa positively stained with aniline blue (arrow), showing an intense blue stain (bright-field microscopy, 40x).

925 Fig. 6. Nuclear sperm chromatin stability after treatment with different concentrations of EDTA+SDS in spermatozoa from two different ejaculates from the same dolphin and two different ejaculates from the same bull. UIMF: mean intensity fluorescence units.

930

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT Highlights

This study revealed the ability of the dolphin spermatozoa to penetrate zona-intact bovine and murine oocytes.

MANUSCRIPT

ACCEPTED