DOCSLIB.ORG

Biomarker Discovery for Asthma Phenotyping: from Gene Expression to the Clinic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biomarker Discovery for Asthma Phenotyping: from Gene Expression to the Clinic UvA-DARE (Digital Academic Repository) Biomarker discovery for asthma phenotyping: From gene expression to the clinic Wagener, A.H. Publication date 2016 Document Version Final published version Link to publication Citation for published version (APA): Wagener, A. H. (2016). Biomarker discovery for asthma phenotyping: From gene expression to the clinic. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:25 Sep 2021 CHAPTER 3 Supporting Information File The impact of allergic rhinitis and asthma on human nasal and bronchial epithelial gene expression methods Primary epithelial cell culture Primary cells were obtained by first digesting the biopsies and brushings with collage- nase 4 (Worthington Biochemical Corp., Lakewood, NJ, USA) for 1 hour in Hanks’ bal- anced salt solution (Sigma-Aldrich, Zwijndrecht, The Netherlands). Subsequently cells were washed with Hanks’ balanced salt solution (HBSS) and resuspended in bronchial epithelial growth medium (BEGM) (Invitrogen, Breda, The Netherlands) and seeded in one well of a 6 wells plate. Cells were grown in fully humidified air containing 5% CO2 at 37°C, and culture medium was replaced every other day. Cells were cultured to 80% confluence and were pre-incubated with bronchial epithelial basal medium (BEBM) for 48 hours prior to the removement of supernatant and RNA extraction. For bronchial epithelial cells it took 14 days on average, and for nasal epithelial cells it took 24 days on average to grow to 80% confluence. There was no difference in time of culture between the three subject groups. rnA extraction Total RNA from each sample was extracted using Trizol (Life Technologies Inc., Gaiters- burg, MD, USA) using manufacturer’s protocol, followed by purification by nucleospin RNA II (Machery-Nagel, Düren, Germany). RNA concentration of all samples was measured on the nanodrop ND-1000 (NanoDrop Technologies Inc., Wilmington, DE, USA). The quality of the RNA was checked by using Agilent 2100 bio-analyser (Agilent Technologies, Palo Alto, CA, USA). All RIN scores were ≥9.5. microarray Affymetrix U133+ mP Human Genome U133+ PM Genechip Array (Affymetrix inc., Santa Clara, CA, USA) representing more than 47,000 transcripts and variants, including over 33,000 well- characterized genes, was used in the analysis of the genes. The MicroArray Department (MAD) of the University of Amsterdam, a fully licensed microarray technologies centre for Affymetrix Genechip® platforms, performed the technical handling and the quality control of the microarray experiments. The quality of the images was checked by visual inspection and all raw data passed quality criteria based on borderplots, pseudocolor slide images, RNA degradation plots, box and density plots, RI plots (against a pseudore- ference), correlation and PCA plots. nlP network discovery Network analysis was performed on the same set of genes using NLP Network Discovery (GeneSpring GX12, Agilent Technologies, Amstelveen, The Netherlands) that derives its relations from PubMed. A direct interaction network was built that captures relations Gene Expression of Airway Epithelium 55 based on regulation, connecting the genes entered into the programme. In more detail, the majority of relations in the GeneSpring Interaction database are derived using a Natural Language Processing (NLP) algorithm that runs on published Medline abstracts. NLP is based on a ‘‘deep parsing” method and is driven by an elaborate sentence gram- mar that maximizes accuracy and has control over different aspects of a sentence with- out compromising recall. The NLP system operates on a sentence-by-sentence manner and extracts only those relations that are completely within a sentence. There are four main phases: 1) Entity recognition by consulting entity dictionaries, taking into account that there are variations in how terms appear in literature. 2) Using a set of rules, the syntactic tree structure of the sentence is derived using context free grammar rules for English, breaking up the sentence into its underlying linguistic constituents and capturing the functional roles of different parts of the sentence. 3) A semantic analysis mapping all words of interest to semantic concepts and iden- tifying which entity regulates another entity using the sentence structure imposed by the syntax tree. The relationships captured by the semantic tree are only direct relationships (finds relations that connect the selected entities by the previous NLP system). 4) Semantic interference: the semantic tree captures specific concepts from a sentence after which GeneSpring has to make inferences across these semantic concepts, using agents in one relationship to fill the missing holes in other relationships. GeneSpring extracts relations by searching the resulting semantic network for rela- tion nodes that contain all the required arguments. A signature is created for each relation depending upon the participants, their roles, and their mechanisms, and references to the relation are added. The relationships captured by the semantic tree are only direct relationships, which find relations that connect the selected entities by the NLP system that was previously explained. The relation represents molecular interactions between the entities and is characterized by a set of participating entities. We used Regulation as relation, which is the most basic relation type. In GeneSpring an entity A ‘‘regulates” another entity B, if A has some influ- ence on B. The participant entities in the Regulation relation are ‘‘regulator”, ‘‘target”, and ‘‘modulator”. Each participant either has a positive, negative, or unknown effect. Depending on the source of the relation information, each relation is assigned a Rela- tion score. This property indicates a confidence matrix on the quality of relations in the Interaction Database in GeneSpring. NLP-derived relations are graded on a scale of 1-9, the best being 9 and the weakest being 1. The score properties are internally calculated 56 Chapter 3 based on the number of references and the syntax of the sentences. We used 9 as Rela- tion score for our network discovery. real-time polymerase chain reaction and analysis Quantitative real-time PCR was used to validate the differential expression of selected genes. We chose a set of genes that represent a complete range of fold change values, capturing genes that were either higher expressed in the upper or lower airways. PCR was performed on Bio-Rad CFX96 real-time PCR detection system (Bio-Rad, Veenendaal, The Netherlands). SYBR® Green primer sequences for IL13-Rα2, EREG, PDE4D, IL1-β, IP-10, TIMP2, IL8, β –actin and GAPDH were obtained from Sigma-Aldrich (Sigma-Aldrich, Zwi- jndrecht, The Netherlands). The following primers were used: IL13-Rα2; sense: TGC-TCA- GAT-GAC-GGA-ATT-TGG, antisense: TGG-TAG-CCA-GAA-ACG-TAG-CAA-AG, EREG; sense: ATC-CTG-GCA-TGT-GCT-AGG-GT, antisense: GTG-CTC-CAG-AGG-TCA-GCC-AT, PDE4D; sense: GGC-CTC-CAA-CAA-GTT-TAA-AA, antisense: ACC-AGA-CAA-CTC-TGC-TAT-TCT, IL1-β; sense: GGA-TAT-GGA-GCA-ACA-AGT-GG, antisense: ATG-TAC-CAG-TTG-GGG-AAC- TG, IP-10; sense: TGA-AAT-TAT-TCC-TGC-AAG-CCA-AT, antisense: CAG-ACA-TCT-CTT- CTC-ACC-CTT-CTT-T, TIMP2; sense: ATA-AGC-AGG-CCT-CCA-ACG-C, antisense: GAG- CTG-GAC-CAG-TCG-AAA-CC, IL8; sense: CCA-CAC-TGC-GCC-AAC-ACA-GAA-ATT-ATT-G, antisense: GCC-CTC-TTC-AAA-AAC-TTC-TCC-ACA-ACC-C, β –actin; sense: TGA-GCG-CGG- CTA-CAG-CTT, antisense: TCC-TTA-ATG-TCA-CGC-ACG-ATT-T, GAPDH; sense: GAA-GGT- GAA-GGT-CGG-AGT-C, antisense: GAA-GAT-GGT-GAT-GGG-ATT-TC. For ATF3 and DUSP1 we used TaqMan® gene expression assays from Applied Biosystems (Nieuwerkerk a/d IJssel, The Netherlands) with the following assay IDs: ATF3; HS00231069_M1, DUSP1; HS006102757_G1. Correlations between fold changes (FC) within the microarray data and the real-time PCR data were determined using Pearson’s correlation. resUlts validation of microarray data The results of this microarray experiment were validated by independent real time PCR on the same starting material used for the microarray analysis. We first determined the expression of the housekeeping genes (ACTB and GAPDH) which was not affected by type of tissue (upper or lower airway) or condition (healthy, asthma or rhinitis). A random selection of 9 genes was used that showed a significant different expression between upper and lower airways in at least one of the subject groups. Table S1 shows the ratios calculated from the microarray data and the real-time PCR-derived expression. Statistical analysis revealed a high level of correspondence (R=0.92, P<0.0001), pointing Gene Expression of Airway Epithelium 57 towards a correlation of 85% (R2=0.85) between the microarray data and the real-time PCR (Figure S1). differential gene expression in nasal and bronchial epithelium There were substantial differences in gene expression between the epithelia from up- per and lower airways of healthy individuals. These differences were smaller in patients with allergic rhinitis and even smaller in those with concomitant allergic asthma. Using a cut-off of adjusted p < 0.05 we identified 2705 out of 41976 probe sets that were statistically differentially expressed between healthy nasal and healthy bronchial epi- thelium.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Human Recombinant Protein – TP305600
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP305600 ZNF165 (NM_003447) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human zinc finger protein 165 (ZNF165) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 55.6 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_003438 Locus ID: 7718 UniProt ID: P49910, Q53Z40 RefSeq Size: 2411 Cytogenetics: 6p22.1 RefSeq ORF: 1455 Synonyms: CT53; LD65; ZSCAN7 Summary: This gene encodes a member of the Kruppel family of zinc finger proteins. Members of this DNA-binding protein family act as transcriptional regulators. This gene is located within a cluster of zinc finger family members. The encoded protein may play a role in spermatogenesis. [provided by RefSeq, Jul 2008] Protein Families: Stem cell - Pluripotency, Transcription Factors This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 ZNF165 (NM_003447) Human Recombinant Protein – TP305600 Product images: Coomassie blue staining of purified ZNF165 protein (Cat# TP305600).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Molecular Pathways Associated with the Nutritional Programming of Plant-Based Diet Acceptance in Rainbow Trout Following an Early Feeding Exposure Mukundh N
    Molecular pathways associated with the nutritional programming of plant-based diet acceptance in rainbow trout following an early feeding exposure Mukundh N. Balasubramanian, Stéphane Panserat, Mathilde Dupont-Nivet, Edwige Quillet, Jérôme Montfort, Aurélie Le Cam, Françoise Médale, Sadasivam J. Kaushik, Inge Geurden To cite this version: Mukundh N. Balasubramanian, Stéphane Panserat, Mathilde Dupont-Nivet, Edwige Quillet, Jérôme Montfort, et al.. Molecular pathways associated with the nutritional programming of plant-based diet acceptance in rainbow trout following an early feeding exposure. BMC Genomics, BioMed Central, 2016, 17 (1), pp.1-20. 10.1186/s12864-016-2804-1. hal-01346912 HAL Id: hal-01346912 https://hal.archives-ouvertes.fr/hal-01346912 Submitted on 19 Jul 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Balasubramanian et al. BMC Genomics (2016) 17:449 DOI 10.1186/s12864-016-2804-1 RESEARCH ARTICLE Open Access Molecular pathways associated with the nutritional programming of plant-based diet acceptance in rainbow trout following an early feeding exposure Mukundh N. Balasubramanian1, Stephane Panserat1, Mathilde Dupont-Nivet2, Edwige Quillet2, Jerome Montfort3, Aurelie Le Cam3, Francoise Medale1, Sadasivam J. Kaushik1 and Inge Geurden1* Abstract Background: The achievement of sustainable feeding practices in aquaculture by reducing the reliance on wild-captured fish, via replacement of fish-based feed with plant-based feed, is impeded by the poor growth response seen in fish fed high levels of plant ingredients.
    [Show full text]
  • Supplementary Table 2A. Proband-Specific Variants Proband
    Supplementary table 2A. Proband-specific variants Proband Gene Gene full name Chr Position RefSeqChange Function ESP6500 1000 Genome SNP137 PolyPhen2 Nucleotide Amino acid Score Prediction 1 AGAP5 ArfGAP with GTPase domain, ankyrin repeat and PH domain 5 chr10 75435178 NM_001144000 c.G1240A p.V414M exonic . 0.99 D 1 REXO1L1 REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 1 chr8 86574465 NM_172239 c.A1262G p.Y421C exonic . 0.98 D 1 COL4A3 collagen, type IV, alpha 3 (Goodpasture antigen) chr2 228169782 NM_000091 c.G4235T p.G1412V exonic . 1.00 D 1 KIAA1586 KIAA1586 chr6 56912133 NM_020931 c.C44G p.A15G exonic . 0.99 D 1 KIAA1586 KIAA1586 chr6 56912176 NM_020931 c.C87G p.D29E exonic . 0.99 D 1 JAKMIP3 Janus kinase and microtubule interacting protein 3 chr10 133955524 NM_001105521 c.G1574C p.G525A exonic . 1.00 D 1 MPHOSPH8 M-phase phosphoprotein 8 chr13 20240685 NM_017520 c.C2140T p.L714F exonic . 0.97 D 1 SYNE1 spectrin repeat containing, nuclear envelope 1 chr6 152783902 NM_033071 c.A2242T p.N748Y exonic . 0.97 D 1 CAND2 cullin-associated and neddylation-dissociated 2 (putative) chr3 12858835 NM_012298 c.C2125T p.H709Y exonic . 0.95 D 1 TDRD9 tudor domain containing 9 chr14 104460909 NM_153046 c.T1289G p.V430G exonic . 0.96 D 2 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila)chr1 197091625 NM_001206846 c.G3491A p.R1164H exonic . 0.99 D 2 ADAM29 ADAM metallopeptidase domain 29 chr4 175896951 NM_001130705 c.A275G p.D92G exonic . 1.00 D 2 BCO2 beta-carotene oxygenase 2 chr11 112087019 NM_001256398 c.G1373A p.G458E exonic .
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • A Database of Gene Regulatory Network Models Across Human Conditions
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.18.448997; this version posted June 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. GRAND: A database of gene regulatory network models across human conditions Marouen Ben Guebila1†, Camila M Lopes-Ramos1†, Deborah Weighill1,7, Abhijeet Rajendra Sonawane2, Rebekka Burkholz1, Behrouz Shamsaei3, John Platig4, Kimberly Glass1,4, Marieke L Kuijjer5,6, John Quackenbush1,4,*. 1Department of Biostatistics, Harvard School of Public Health, Boston, MA, USA. 2Center for Interdisciplinary Cardiovascular Sciences, Cardiovascular Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts 02115, USA. 3Division of Biostatistics and Bioinformatics, Department of Environmental and Public Health Sciences, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA. 4Channing Division of Network Medicine, Department of Medicine, Harvard Medical School and Brigham and Women’s Hospital 5Center for Molecular Medicine Norway, Faculty of Medicine, University of Oslo, Norway 6Leiden University Medical Center, Leiden, the Netherlands 7Current address: UNC Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA † Joint Authors. * To whom correspondence should be addressed. Email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.18.448997; this version posted June 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • CDH12 Cadherin 12, Type 2 N-Cadherin 2 RPL5 Ribosomal
    5 6 6 5 . 4 2 1 1 1 2 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 A A A A A A A A A A A A A A A A A A A A C C C C C C C C C C C C C C C C C C C C R R R R R R R R R R R R R R R R R R R R B , B B B B B B B B B B B B B B B B B B B , 9 , , , , 4 , , 3 0 , , , , , , , , 6 2 , , 5 , 0 8 6 4 , 7 5 7 0 2 8 9 1 3 3 3 1 1 7 5 0 4 1 4 0 7 1 0 2 0 6 7 8 0 2 5 7 8 0 3 8 5 4 9 0 1 0 8 8 3 5 6 7 4 7 9 5 2 1 1 8 2 2 1 7 9 6 2 1 7 1 1 0 4 5 3 5 8 9 1 0 0 4 2 5 0 8 1 4 1 6 9 0 0 6 3 6 9 1 0 9 0 3 8 1 3 5 6 3 6 0 4 2 6 1 0 1 2 1 9 9 7 9 5 7 1 5 8 9 8 8 2 1 9 9 1 1 1 9 6 9 8 9 7 8 4 5 8 8 6 4 8 1 1 2 8 6 2 7 9 8 3 5 4 3 2 1 7 9 5 3 1 3 2 1 2 9 5 1 1 1 1 1 1 5 9 5 3 2 6 3 4 1 3 1 1 4 1 4 1 7 1 3 4 3 2 7 6 4 2 7 2 1 2 1 5 1 6 3 5 6 1 3 6 4 7 1 6 5 1 1 4 1 6 1 7 6 4 7 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m
    [Show full text]