Leeds Thesis Template

Total Page:16

File Type:pdf, Size:1020Kb

Load more

- i - Burkitt lymphoma classification and MYC-associated non- Burkitt lymphoma investigation based on gene expression Chulin Sha Submitted in accordance with the requirements for the degree of Doctor of Philosophy The University of Leeds Faculty of Biology School of Molecular and Cellular Biology April 2015 - ii - Intellectual Property and Publication Statements 1st Authored, used in this thesis, Transferring genomics to the clinic: distinguishing Burkitt and diffuse large B cell lymphomas. Accepted for publication in Genome Medicine. The candidate confirms that the work submitted is her own and that appropriate credit has been given where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Chulin Sha to be identified as Author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. © 2015 The University of Leeds and Chulin Sha - iii - Acknowledgements I would like to give my sincerest gratitude to my supervisor, David Westhead, for introducing me to Bioinformatics and Lymphoma research area and offering me guidance and care whenever I get confused or frustrated, particularly for his patience and encouragement when the project is going slow and for always considering my benefit where I am short of experience. Being honest, I feel so lucky to pursue my study here that I couldn‟t possibly have a better supervisor. I also want to thank to my collaborators from Leeds St. James Hospital Sharon, Andrew and Reuben for providing the data, advice and help on how to be involved in a project and cooperate with others. My dear lab mates, past and present, thanks for their companionship and providing a fantastic research atmosphere. Especially a big thank to Matt and Vijay, who help me along my whole Phd study, offering valuable ideas, encouragement and friendship. I hope I can grow to a good bioinformatician like them in the near future. Thank to my close friends for sharing my feelings so that I don‟t feel so lonely and isolated. Thank to my parents and my boyfriend for their unconditional support and endless love, which make me believe I can accomplish my objectives. At last, thank to China Scholarship Council and University of Leeds for the financial support, and to anyone who has helped me in any way during my Phd study period. - iv - Abstract Burkitt lymphoma and diffuse large B-cell lymphoma are two closely related types of lymphoma that are managed differently in clinical practice and the accurate diagnosis is a key point in treatment decisions. However based on current criteria combined with morphological, immunophenotypic and genetic characteristics, a significant number of cases exhibit overlapping features where diagnosis and treatment decisions are difficult to make. Especially, the prognosis have been reported significantly unfavourable in a subset of cases that are initially diagnosed as diffuse large B-cell lymphoma but bear MYC gene translocation, which is a defining feature of Burkitt lymphoma however can also be found in other lymphomas. Despite the adverse effect of MYC in aggressive lymphomas other than Burkitt lymphoma, the underlying mechanism and effective treatment is still unclear. Recent technological advances have made it possible to simultaneously investigate an enormous number of bio-molecules, and the scientific fields associated with measuring molecular data in such a high-throughput way are usually called “omics”. For example, genomics assesses thousands of DNA sequences and transcriptomics assays large numbers of transcripts in a single experiment. These techniques together with the rapidly emerging analytical methods in bioinformatics have introduced cancer research into a new era. The growing amount of omics data have significantly influenced the understanding of lymphomas and hold great promise in classifying subtypes, predicting treatment responses that will eventually lead to personalized therapy. Here in this study, we investigate the discrimination of Burkitt lymphoma and diffuse large B-cell lymphoma based on DNA microarray gene expression data, which has contributed most in molecular classification of lymphoma subtypes in the last decade. On the basis of two previous research level gene expression profiling classifiers, we developed a robust classifier that works effectively on different platforms and formalin fixed paraffin-embedded samples commonly used in routine clinic. The validation of the classifier on - v - the samples from clinical patients achieves a high agreement with diagnosis made in a central haematopathology laboratory, and leads to a potential outcome indication in the patients presenting intermediate features. In addition, we explore the role of MYC in the above lymphomas. Our investigation emphasizes the inferior impact of high level MYC mRNA expression on patients‟ outcome, and the functional analysis of MYC high expression associated genes show significantly enriched molecular mechanisms of proliferation and metabolic process. Moreover, the gene PRMT5 is found to be highly correlated with MYC expression which opens a possible therapeutic target for the treatment. - vi - Table of Contents Intellectual Property and Publication Statements .................................... ii Acknowledgements .................................................................................... iii Abstract ....................................................................................................... iv List of Abbreviations ................................................................................... x List of Tables ............................................................................................ xiii List of Figures ........................................................................................... xv Chapter 1 Introduction ................................................................................ 1 1.1 Burkitt lymphoma and diffuse large B-cell lymphoma .................... 2 1.1.1. Burkitt lymphoma .......................................................... 2 1.1.2. Diffuse large B-cell lymphoma....................................... 4 1.1.3. Cases with features intermediate between BL and DLBCL .................................................................................. 5 1.2 MYC in BCLU ................................................................................ 7 1.2.1. MYC translocation ......................................................... 8 1.2.2. MYC prognostic implication ........................................... 9 1.2.3. MYC potential mechanism in B-cell lymphoma ........... 10 1.3 High-throughput data in cancer research .................................... 13 1.3.1. New methods and techniques ..................................... 14 1.3.2. Omics-based tests translation from research to clinic 16 1.4 Microarray gene expression profiling .......................................... 17 1.4.1. DNA microarray technology ........................................ 18 1.4.2. General analysis of DNA microarray data ................... 20 1.4.3. Reality in DNA microarray GEP analysis .................... 22 1.5 Research overview ...................................................................... 23 1.5.1. Study design ............................................................... 23 1.5.2. Developing environment and tools .............................. 26 1.5.3. Data collection and collaboration ................................ 27 Chapter 2 Methods .................................................................................... 29 2.1 Low level analysis ....................................................................... 29 2.1.1. Quality check............................................................... 29 2.1.2. Preprocessing ............................................................. 30 2.1.3. Cross-platform normalization ...................................... 31 - vii - 2.2 Feature selection ......................................................................... 32 2.2.1. Introduction ................................................................. 33 2.2.2. SAM ............................................................................ 34 2.2.3. Smyth moderated t-statistic ......................................... 35 2.3 Classification methods ................................................................ 36 2.3.1. Introduction ................................................................. 37 2.3.2. Support vector machines ............................................ 38 2.3.3. Evaluation of classifier ................................................ 40 2.4 Survival analysis ......................................................................... 41 2.4.1 Introduction ......................................................................... 42 2.4.2 Kaplan-Meier survival estimate ........................................... 43 2.4.3 The cox proportional hazard model ..................................... 44 2.5 Mechanism analysis .................................................................... 45 2.5.1. Gene set enrichment analysis tool .............................. 45 2.5.2. DAVID functional annotation tool ................................ 47 Chapter 3 Development of a Burkitt lymphoma classifier .................... 49 3.1 Datasets summary .....................................................................
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By

    UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By

    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
  • GTF3A (NM 002097) Human Tagged ORF Clone Product Data

    GTF3A (NM 002097) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC225554 GTF3A (NM_002097) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GTF3A (NM_002097) Human Tagged ORF Clone Tag: Myc-DDK Symbol: GTF3A Synonyms: AP2; TFIIIA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC225554 representing NM_002097 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC CTGGATCCGCCGGCCGTGGTCGCCGAGTCGGTGTCGTCCTTGACCATCGCCGACGCGTTCATTGCAGCCG GCGAGAGCTCAGCTCCGACCCCGCCGCGCCCCGCGCTTCCCAGGAGGTTCATCTGCTCCTTCCCTGACTG CAGCGCCAATTACAGCAAAGCCTGGAAGCTTGACGCGCACCTGTGCAAGCACACGGGGGAGAGACCATTT GTTTGTGACTATGAAGGGTGTGGCAAGGCCTTCATCAGGGACTACCATCTGAGCCGCCACATTCTGACTC ACACAGGAGAAAAGCCGTTTGTTTGTGCAGCCAATGGCTGTGATCAAAAATTCAACACAAAATCAAACTT GAAGAAACATTTTGAACGCAAACATGAAAATCAACAAAAACAATATATATGCAGTTTTGAAGACTGTAAG AAGACCTTTAAGAAACATCAGCAGCTGAAAATCCATCAGTGCCAGCATACCAATGAACCTCTATTCAAGT GTACCCAGGAAGGATGTGGGAAACACTTTGCATCACCCAGCAAGCTGAAACGACATGCCAAGGCCCACGA GGGCTATGTATGTCAAAAAGGATGTTCCTTTGTGGCAAAAACATGGACGGAACTTCTGAAACATGTGAGA GAAACCCATAAAGAGGAAATACTATGTGAAGTATGCCGGAAAACATTTAAACGCAAAGATTACCTTAAGC AACACATGAAAACTCATGCCCCAGAAAGGGATGTATGTCGCTGTCCAAGAGAAGGCTGTGGAAGAACCTA TACAACTGTGTTTAATCTCCAAAGCCATATCCTCTCCTTCCATGAGGAAAGCCGCCCTTTTGTGTGTGAA CATGCTGGCTGTGGCAAAACATTTGCAATGAAACAAAGTCTCACTAGGCATGCTGTTGTACATGATCCTG
  • Integrative Bulk and Single-Cell Profiling of Premanufacture T-Cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-Cell Therapy

    Integrative Bulk and Single-Cell Profiling of Premanufacture T-Cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-Cell Therapy

    Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 RESEARCH ARTICLE Integrative Bulk and Single-Cell Profiling of Premanufacture T-cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-cell Therapy Gregory M. Chen1, Changya Chen2,3, Rajat K. Das2, Peng Gao2, Chia-Hui Chen2, Shovik Bandyopadhyay4, Yang-Yang Ding2,5, Yasin Uzun2,3, Wenbao Yu2, Qin Zhu1, Regina M. Myers2, Stephan A. Grupp2,5, David M. Barrett2,5, and Kai Tan2,3,5 Downloaded from cancerdiscovery.aacrjournals.org on October 1, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 ABSTRACT The adoptive transfer of chimeric antigen receptor (CAR) T cells represents a breakthrough in clinical oncology, yet both between- and within-patient differences in autologously derived T cells are a major contributor to therapy failure. To interrogate the molecular determinants of clinical CAR T-cell persistence, we extensively characterized the premanufacture T cells of 71 patients with B-cell malignancies on trial to receive anti-CD19 CAR T-cell therapy. We performed RNA-sequencing analysis on sorted T-cell subsets from all 71 patients, followed by paired Cellular Indexing of Transcriptomes and Epitopes (CITE) sequencing and single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) on T cells from six of these patients. We found that chronic IFN signaling regulated by IRF7 was associated with poor CAR T-cell persistence across T-cell subsets, and that the TCF7 regulon not only associates with the favorable naïve T-cell state, but is maintained in effector T cells among patients with long-term CAR T-cell persistence.
  • Download Special Issue

    Download Special Issue

    BioMed Research International Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data Guest Editors: Julia Tzu-Ya Weng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data BioMed Research International Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data Guest Editors: Julia Tzu-Ya Weng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Copyright © 2014 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data,JuliaTzu-YaWeng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Volume2014,ArticleID814092,3pages Evolution of Network Biomarkers from Early to Late Stage Bladder Cancer Samples,Yung-HaoWong, Cheng-Wei Li, and Bor-Sen Chen Volume 2014, Article ID 159078, 23 pages MicroRNA Expression Profiling Altered by Variant Dosage of Radiation Exposure,Kuei-FangLee, Yi-Cheng Chen, Paul Wei-Che Hsu, Ingrid Y. Liu, and Lawrence Shih-Hsin Wu Volume2014,ArticleID456323,10pages EXIA2: Web Server of Accurate and Rapid Protein Catalytic Residue Prediction, Chih-Hao Lu, Chin-Sheng
  • Pseudotime Ordering of Single Human Β-Cells Reveals States Of

    Pseudotime Ordering of Single Human Β-Cells Reveals States Of

    Diabetes Volume 67, September 2018 1783 Pseudotime Ordering of Single Human b-Cells Reveals States of Insulin Production and Unfolded Protein Response Yurong Xin, Giselle Dominguez Gutierrez, Haruka Okamoto, Jinrang Kim, Ann-Hwee Lee, Christina Adler, Min Ni, George D. Yancopoulos, Andrew J. Murphy, and Jesper Gromada Diabetes 2018;67:1783–1794 | https://doi.org/10.2337/db18-0365 Proinsulin is a misfolding-prone protein, making its bio- misfolded protein load. This puts pressure on the endo- synthesis in the endoplasmic reticulum (ER) a stressful plasmic reticulum (ER) and results in accumulation of event. Pancreatic b-cells overcome ER stress by acti- misfolded proinsulin and cellular stress. The large demand vating the unfolded protein response (UPR) and reducing for proinsulin biosynthesis and folding makes b-cells insulin production. This suggests that b-cells transition highly susceptible to ER stress (7–9). between periods of high insulin biosynthesis and UPR- b-Cells are metabolically active, relying on oxidative mediated recovery from cellular stress. We now report phosphorylation for ATP generation (10). This generates ISLET STUDIES b the pseudotime ordering of single -cells from humans reactive oxygen species (ROS) and can result in oxidative without diabetes detected by large-scale RNA sequenc- stress. b-Cells have low antioxidant defense, further in- ing. We identified major states with 1) low UPR and low creasing their susceptibility to stress (11,12). ER stress and insulin gene expression, 2) low UPR and high insulin gene oxidative stress can enhance each other, because protein expression, or 3) high UPR and low insulin gene expres- misfolding results in the production of ROS, and these sion.
  • 1 Santa Cat.No Cloud-Clone Cat.No. Cloud-Clone Product Name

    1 Santa Cat.No Cloud-Clone Cat.No. Cloud-Clone Product Name

    Santa Cloud -Clone Cloud -Clone Product Name Cat.No Cat.No. sc -130253 PAS477Hu01 PAB to RIO Kinase 1 (RIOK1) sc -50485 PAS446Ra01 PAB to A Disintegrin And Metalloprotease 5 (ADAM5) sc -50487 PAS445Ra01 PAB to A Disintegrin And Metalloprotease 6 (ADAM6) sc -25588 PAS444Ra01 PAB to A Disintegrin And Metalloprotease 1 (ADAM1) sc -87719 PAR758Mu01 PAB to Family With Sequence Similarity 135, Member B (FAM135B) sc -67296 PAR493Hu01 PAB to Coenzyme Q10 Homolog B (COQ10B) sc -67048 PAQ981Hu01 PAB to S100 Calcium Binding Protein A15 (S100A15) sc -130269 PAQ342Hu01 PAB to SRSF Protein Kinase 3 (SRPK3) sc -98582 PAQ207Hu01 PAB to A Disintegrin And Metalloprotease 20 (ADAM20) sc -20711 PAQ164Hu01 PAB to BMX Non Receptor Tyrosine Kinase (BMX) sc -9147 PAQ127Hu01 PAB to Cluster Of Differentiation 8b (CD8b) sc -130184 PAQ124Hu01 PAB to Cell Division Cycle Protein 25B (CDC25B) sc -98790 PAQ118Hu01 PAB to Cell Adhesion Molecule With Homology To L1CAM (CHL1) sc -25361 PAQ116Hu01 PAB to Clock Homolog (CLOCK) sc -98937 PAQ089Hu01 PAB to Cytochrome P450 3A7 (CYP3A7) sc -25519 PAQ088Hu01 PAB to Dickkopf Related Protein 4 (DKK4) sc -28778 PAP797Hu01 PAB to Pim-2 Oncogene (PIM2) sc -33626 PAP750Hu01 PAB to RAD51 Homolog (RAD51) sc -8333 PAP694Mu01 PAB to SH2 Domain Containing Protein 1A (SH2D1A) sc -25524 PAP553Hu01 PAB to Wingless Type MMTV Integration Site Family, Member 10B (WNT10B) sc -50360 PAP552Hu01 PAB to Wingless Type MMTV Integration Site Family, Member 11 (WNT11) sc -87368 PAP332Hu01 PAB to PR Domain Containing Protein 14 (PRDM14) sc -25583 PAP226Hu01
  • (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano Et Al

    US 20090269772A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano et al. (43) Pub. Date: Oct. 29, 2009 (54) SYSTEMS AND METHODS FOR Publication Classification IDENTIFYING COMBINATIONS OF (51) Int. Cl. COMPOUNDS OF THERAPEUTIC INTEREST CI2O I/68 (2006.01) CI2O 1/02 (2006.01) (76) Inventors: Andrea Califano, New York, NY G06N 5/02 (2006.01) (US); Riccardo Dalla-Favera, New (52) U.S. Cl. ........... 435/6: 435/29: 706/54; 707/E17.014 York, NY (US); Owen A. (57) ABSTRACT O'Connor, New York, NY (US) Systems, methods, and apparatus for searching for a combi nation of compounds of therapeutic interest are provided. Correspondence Address: Cell-based assays are performed, each cell-based assay JONES DAY exposing a different sample of cells to a different compound 222 EAST 41ST ST in a plurality of compounds. From the cell-based assays, a NEW YORK, NY 10017 (US) Subset of the tested compounds is selected. For each respec tive compound in the Subset, a molecular abundance profile from cells exposed to the respective compound is measured. (21) Appl. No.: 12/432,579 Targets of transcription factors and post-translational modu lators of transcription factor activity are inferred from the (22) Filed: Apr. 29, 2009 molecular abundance profile data using information theoretic measures. This data is used to construct an interaction net Related U.S. Application Data work. Variances in edges in the interaction network are used to determine the drug activity profile of compounds in the (60) Provisional application No. 61/048.875, filed on Apr.
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards

    Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards

    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
  • Evolving Neoantigen Profiles in Colorectal Cancers with DNA Repair

    Evolving Neoantigen Profiles in Colorectal Cancers with DNA Repair

    Rospo et al. Genome Medicine (2019) 11:42 https://doi.org/10.1186/s13073-019-0654-6 RESEARCH Open Access Evolving neoantigen profiles in colorectal cancers with DNA repair defects Giuseppe Rospo1†, Annalisa Lorenzato1,2†, Nabil Amirouchene-Angelozzi3, Alessandro Magrì1,2, Carlotta Cancelliere1, Giorgio Corti1, Carola Negrino1,2, Vito Amodio1,2, Monica Montone1, Alice Bartolini1, Ludovic Barault1,2, Luca Novara1, Claudio Isella1, Enzo Medico1,2, Andrea Bertotti1,2, Livio Trusolino1,2, Giovanni Germano1,2, Federica Di Nicolantonio1,2 and Alberto Bardelli1,2* Abstract Background: Neoantigens that arise as a consequence of tumor-specific mutations can be recognized by T lymphocytes leading to effective immune surveillance. In colorectal cancer (CRC) and other tumor types, a high number of neoantigens is associated with patient response to immune therapies. The molecular processes governing the generation of neoantigens and their turnover in cancer cells are poorly understood. We exploited CRC as a model system to understand how alterations in DNA repair pathways modulate neoantigen profiles over time. Methods: We performed whole exome sequencing (WES) and RNA sequencing (RNAseq) in CRC cell lines, in vitro and in vivo, and in CRC patient-derived xenografts (PDXs) to track longitudinally genomic profiles, clonal evolution, mutational signatures, and predicted neoantigens. Results: The majority of CRC models showed remarkably stable mutational and neoantigen profiles; however, those carrying defects in DNA repair genes continuously diversified. Rapidly evolving and evolutionary stable CRCs displayed characteristic genomic signatures and transcriptional profiles. Downregulation of molecules implicated in antigen presentation occurred selectively in highly mutated and rapidly evolving CRC. Conclusions: These results indicate that CRCs carrying alterations in DNA repair pathways display dynamic neoantigen patterns that fluctuate over time.
  • MOL #82305 TITLE PAGE Title: Induced CYP3A4 Expression In

    MOL #82305 TITLE PAGE Title: Induced CYP3A4 Expression In

    Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 28, 2021 1 This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
  • A Novel Role for the Chromatin Remodeling Atpase Brg1 During Zygotic Genome Activation

    A Novel Role for the Chromatin Remodeling Atpase Brg1 During Zygotic Genome Activation

    A novel role for the chromatin remodeling ATPase Brg1 during zygotic genome activation in Xenopus Dissertation Zur Erlangung des akademischen Grades Doctor rerum naturalis (Dr. rer.nat.) Vorgelegt der Fakultät für Biologie der Ludwigs-Maximilians-Universität zu München Gabriele Maria Wagner aus Heidelberg München 2014 Tag der Einreichung: 20. Mai 2014 Tag der mündlichen Prüfung: 31. Juli 2014 Erstgutachter: Prof. Dr. Peter Becker Zweitgutachter: Prof. Dr. Hans Straka Drittgutachter: Prof. Dr. Angelika Böttger Viertgutachter: Prof. Dr. John Parsch Eidesstattliche Erklärung Ich versichere hiermit an Eides statt, dass die vorgelegte Dissertation von mir selbständig und ohne unerlaubte Hilfe angefertigt ist. München, den …………………. ............................................................ -Unterschrift- Table of contents Zusammenfassung ............................................................................................................. I Summary ......................................................................................................................... III 1 Introduction ........................................................................................................... 1 1.1 Xenopus as a model organism ................................................................................................. 1 1.1.1 Life cycle of Xenopus ........................................................................................................... 1 1.1.2 The zygotic genome activation ...........................................................................................