Proc. Nati. Acad. Sci. USA Vol. 88, pp. 1511-1515, February 1991 Genetics Inducer-dependent conditional-lethal mutant animal viruses (lac operator/lac repressor protein/vaccinia virus) YIFAN ZHANG AND BERNARD MOSS Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892 Contributed by Bernard Moss, November 26, 1990

ABSTRACT Regulatory elements of the Escherichia coli can regulate the expression of transfected and integrated lac operon were used to construct an inducer-dependent con- reporter genes in mammalian cells (11-14). This system also ditional-lethal mutant animal virus. The gene encoding the has been shown to regulate gene expression in recombinant repressor protein of the lac operon was integrated into the vaccinia virus-infected cells (15-17). To construct a condi- vaccinia virus genome so that it was expressed constitutively, tional-lethal mutant virus, we started with a recombinant and the lac operator was inserted next to the promoter ofa gene vaccinia virus that constitutively expresses lacI and then that encodes an 11-kDa virion-associated protein of unknown used a procedure designed to carry out precise site-directed function. The addition of inducer to the cell culture medium mutagenesis of large viral genomes (18) to insert the lac provided permissive conditions for isolation of a conditional- operator just downstream of the natural promoter regulating lethal mutant virus. Under nonpermissive conditions, the iso- expression of an 11-kDa protein component of the vaccinia lated virus did not form plaques, and the yield was decreased virion. The general scheme is illustrated in Fig. 1. As de- by at least 1000-fold under one-step growth conditions. Tran- scribed below, the isolated mutant was absolutely dependent scription of the operator-controlled gene was inducer- upon the addition of IPTG for induction of infectious virus dependent and necessary for synthesis of the 11-kDa protein. formation under single-step growth conditions and for plaque Application of this mutagenesis strategy to other viruses is formation. In the absence of IPTG, transcription of the discussed. operator-controlled gene was blocked, and synthesis of the 11-kDa protein did not occur. Adaptations ofthis strategy for Conditional-lethal mutants are invaluable for defining the the isolation ofconditional-lethal mutants ofother viruses are biological roles of individual genes in microbial systems. For discussed. animal viruses, the majority of such mutants are of the temperature-sensitive (ts) type (1). Typically, ts mutants are MATERIALS AND METHODS produced by missense mutations that alter the nucleotide sequence of a gene so that the resulting protein products are Virus and Cells. Vaccinia virus (strain WR) was propagated unable to assume or maintain their proper conformation at an in HeLa cells and purified as described (19) except that 5 mM elevated or lowered nonpermissive temperature. Commonly, IPTG was added to the culture medium of recombinant virus ts mutants are obtained by random mutagenesis of the entire vROllk. BS-C-1 and CV-1 cells were grown in minimal genome followed by tedious screening and mapping proce- essential medium supplemented with 10o (vol/vol) fetal dures. However, a complete set of mutants is rarely if ever bovine serum. obtained. Furthermore, some mutant viruses may not be Construction ofVectors and Isolation ofRecombinant Virus. useful for biochemical experiments because they produce An EcoRI-EcoRI fragment containing the bacterial gpt gene low-titer stocks even at the permissive temperature, have a encoding guanine/hypoxanthine phosphoribosyltransferase very narrow temperature range, are "leaky," or give complex (20) regulated by the vaccinia virus P7.5 promoter was phenotypes because of protein misfolding. Host range pro- excised from plasmid ptkgpt-61 (21) and ligated to EcoRI-cut vides an alternative to temperature sensitivity for isolation of pUC18 to create pUC-gpt (Fig. 2). The transfer vector conditional-lethal mutants but requires the production of pgpt-op-llk contains the F18R gene ofvaccinia virus with the specific permissive cell lines that express viral genes (2-4). A lac operator inserted three bases downstream of the RNA general conditional-lethal system, based on suppression of start site and with the E. coli gpt gene under control of the polypeptide chain termination by tRNAs with altered anti- vaccinia virus P7.5 promoter and was generated as described codons, has been widely exploited with bacterial viruses (5, in the legend to Fig. 2. 6). Recently mammalian cell lines with amber-suppressing To generate recombinant virus, CV-1 cells (2.5 x 106) were tRNAs have been constructed and used to isolate mutants of infected with 0.05 plaque-forming units of vlacl (15) per cell poliovirus and vesicular stomatitis virus (7-9). In this report, and then transfected with S ,ug of calcium phosphate- we describe the use of the Escherichia coli lac repressor precipitated pgpt-op-llk as described (23). Selection for system for isolation of conditional-lethal mutants of animal recombinant viruses containing the bacterial gpt gene was viruses. accomplished by two successive rounds of plaque formation In E. coli, genes of the lac operon are under the negative on BS-C-1 cells in the presence of25 Ag ofmycophenolic acid control of a repressor protein consisting of four identical (MPA; Calbiochem) per ml (18, 21). The gpt' viruses ob- 38.6-kDa subunits encoded by the lad gene (10). Binding of tained were then plated on BSC-1 cells without MPA, and the repressor to the unique lac operator DNA sequence, DNA from isolated viral plaques were analyzed by polymer- which overlaps the lac promoter, inhibits transcription. Al- ase chain reaction (PCR) and agarose gel electrophoresis for lolactose or analogues such as isopropyl P3-D-thiogalactoside the inserted sequence. (IPTG) can bind repressor and thereby induce expression of Analysis of Radioactively Labeled Polypeptides. BS-C-1 the lac operon. The inducible lac operator-repressor system cells (2.5 x 106) infected with vROllk were pulse-labeled in

The publication costs of this article were defrayed in part by page charge Abbreviations: IPTG, isopropyl /B-D-thiogalactoside; MPA, myco- payment. This article must therefore be hereby marked "advertisement" phenolic acid; PCR, polymerase chain reaction; ts, temperature in accordance with 18 U.S.C. §1734 solely to indicate this fact. sensitive; ORF, open reading frame; wt, wild type.

1511 Downloaded by guest on September 24, 2021 1512 Genetics: Zhang and Moss Proc. Natl. Acad. Sci. USA 88 (1991) - Inducer TGTTTTCTAGGGTTATTAATTCTCTCGCATCTG- GACGGGGACGAAGGTCTTCTCTCACACGCGGGCG. For screening of recombinant viruses, single plaques were resuspended in 100 pA of 1 mM Tris (pH 9.0). After mixing, 13 Al was transferred to a 0.5-ml PCR tube containing 7 1.l of i~~~~~~ 50 mM KCl/10 mM Tris HCI, pH 8.3/1.5 mM MgCl2/0.2 mM ASnII IXI each dNTP/1 AM each primer/0.01% gelatin/0.5 unit of iv Thermus aquaticus (Taq) polymerase. After 40 cycles, the ReitcnI-t>, Ir nIltNA PCR product was fractionated by electrophoresis on a 2% agarose gel.

Proltein RESULTS + Inducer Construction of an IPTG-Dependent Mutant Virus. Our Pro Iawi Iro tactF) OREr1 G objective was to construct a recombinant vaccinia virus that I' // .I O_ constitutively expressed lad and that contained an essential vaccinia virus gene with an appropriately placed lac operator I Inilndeer sequence (Fig. 1). A recombinant vaccinia virus, vlacI, that n - _ ~~~I contains lacI stably integrated into the tk locus under control c Ii~ve III R .A ofthe vaccinia virus early/late P7.5 promoter was made in an RepreNSoar earlier study (15). Repressor synthesized in cells infected I I1a; I(tis with vlacI and related recombinants was functionally active Repressor and inhibited the expression ofa vaccinia virus promoter-lac operator-lacZ gene fusion by up to 99.9%. For the present ProteiII study, we chose a gene designated F18R, encoding an abun- FIG. 1. Inducer-dependent conditional-lethal mutant animal vi- dant 11-kDa phosphorylated protein component of the ma- rus. The virus genome contains the E. coli lacI gene under control of ture vaccinia virus particle (26) to be controlled by the lac a viral promoter (Pro). The lac operator (1acO) is inserted between operator. The function of this protein is unknown, and no ts the viral promoter (Pro) and the open reading frame (ORF) of the mutations have been described. target gene. In the absence ofinducer IPTG (Upper), repressor binds The optimal site for placement of synthetic lac operator to the lac operator and blocks transcription ofthe target gene. In the sequences, relative to a vaccinia virus promoter, was previ- presence of IPTG (Lower), the repressor is inactivated and the ously determined by using the lacZ reporter gene (15). PCR transcription of the target gene occurs. protocols were used to place a synthetic lac operator se- quence three bases downstream of the RNA start site of a 1.5 ml of methionine-free medium containing 50 (1 ,uCi = ,Ci copy of the F18R gene (Fig. 2). The mutated gene was then 37 kBq) of [35S]methionine (1000 Ci/mmol; Amersham) for 1 ligated to a plasmid that contained the selectable E. coli gpt hr. The cells were then scraped into 0.3 ml of lysis buffer gene under control of the vaccinia virus P7.5 promoter. The containing 20 mM Tris (pH 6.8), 10% 2-mercaptoethanol, 4% resulting transfer vector, pgpt-op-llk, was transfected into SDS, 5 mM EDTA, 20% (vol/vol) glycerol, and 0.5 mg of cells that were infected with recombinant vaccinia virus bromophenol blue per ml and were heated at 100TC for 5 min. vlacI. In this and all succeeding steps, 5 mM IPTG was The cell lysates were analyzed on a 20% polyacrylamide gel present to allow expression of the mutated F18R gene in the as described (24). presence of repressor. Positive selection with MPA was Nuclease S1 Analysis of RNA. Total RNA was isolated by applied for plaque isolation of an intermediate recombinant the RNAzol procedure (Cinna/Biotecx Laboratories, virus resulting from a single cross-over between the plasmid Friendswood, TX) from BS-C-1 cells 9 hr after infection. vector and the virus genome and that consequently had the RNA (20 gg) and 2 x 105 cpm of a single-stranded DNA probe gpt gene interposed between wt and mutated F18R genes. labeled at the 5' end with 32p were hybridized (see the legend Because of the tandem arrangement of the two F18R genes, to Fig. 5) and digested with 400 units of nuclease S1 essen- a second recombination event led to stable gpt- recombinant tially as described (25). The nuclease-resistant material was vaccinia viruses that contained either the wt or mutated gene. analyzed by electrophoresis on a 7 M urea/6% polyacrylam- MPA selection was discontinued, and plaques containing ide gel. The gel was dried and exposed to x-ray film. stable viruses were isolated. Appropriate primers were used, PCR. All reagents and enzyme were purchased from Per- in conjunction with PCR, to screen individual plaques for kin-Elmer/Cetus. The reactions were carried out by the those with the 33-bp insertion between the promoter and manufacturer's with modifications depending on the coding sequence of the F18R gene. One such recombinant protocol virus, named vROllk, was plaque-purified three times, and length and G+C content ofprimers and length ofthe product. were grown in the presence of 5 mM IPTG. the recom- high-titer stocks The DNA sequences of the primers for screening vROllk Is an Inducer-Dependent Conditional-Lethal Mu- binant virus vROllk were GAAACTGAATAGATGCGTC- tant. To ensure permissive conditions for the isolation of a TAGAA and CGGCTTllAGAACCAGATATCTTCC. The potentially conditional-lethal mutant, all steps in the gener- primers referred to in Fig. 2 for generating plasmid pgpt-op-llk ation of vROllk had been carried out in the presence of were GATCGAGCTCGCGATAGTAATGCATCAACGC IPTG. The need for IPTG was determined subsequently by (primer a), TATTTATAGCATAGAAAAAAACAAA- analyzing vROllk plaque formation under a range of IPTG ATGAAATTCTACTATATTTTTAGCTAGCCATA- concentrations. As shown in Fig. 3, no plaques formed after CATATATTCTAAATATG (primer b), CATTTTGTT- 2 days at IPTG concentrations of 0 and 2.5 jxM, and only tiny TTTTTCTATGCTATAAATAGAATTGTGAGCGCTCA- plaques appeared at 10 ,uM IPTG. With 20 ,.M IPTG, the CAATTCTCGAGATGAATTCTCATTTTGCATC (primer plaques were clearly visible and increased to a maximum size c), and CTAGGCATGCGTGCCAGAGGTTTATGTGCAC with 80 pLM. Although no virus-induced cytopathic effects (primer d). were observed when the infected cell monolayers were For the nuclease S1 analysis probe, primer 1 was GAAAC- incubated for 6 days without IPTG, they appeared promptly TGAATAGATGCGTCTAGAA and primer 2 was GGAACT- because of virus spread upon addition of IPTG (data not Downloaded by guest on September 24, 2021 Genetics: Zhang and Moss Proc. Natl. Acad. Sci. USA 88 (1991) 1513

FIG. 2. Recombinant virus construction. Wild Tvpm Viral F18R (A) The 1085-base-pair (bp) DNA fragment DNA TemC11plIC ORF containing the vaccinia virus F18R promot- A er-E. coli lac operator-FJ8R ORF was as- a b Sacl--- sembled from PCR products as indicated and is diagrammed on the right. The filled box in the fragment represents the DNA regions vlac I Viral DNA with insertions not found in the vaccinia :...:.:..... a::t .-. 2ff genome. The final PCR product was cut with Sac I and Sph I, gel-purified, and ligated to x pUC-gpt that had been cut with Sac I and ,,,,,,,,..,.... Sph I. The resulting plasmid, transfer vector pgpt-op-llk, was transfected into CV-1 cells that were infected with recombinant vac- cinia virus vlacl in the presence of IPTG. A diagram of the intermediate recombinant Sph I DNA resulting from a single cross-over (l)CV-l event between the plasmid and genomic (2) BSC-I, + MPA Ilntermediatc i DNA molecules is shown. Intermediate re- Recombinant combinant virus plaques were isolated in EcoR BS-C-1 cells with gpt selection (+ MPA). Genomes containing either wild-type (wt) or lac operator-modified F18R genes resulted BSC-I,-MPA from a second cross-over. Plaques with virus containing stable genomes resulting from this second cross-over were isolated in BS-C-1 cells in the absence of selection (-MPA). (B) The sequence around the pro- moter region ofthe F18R gene in the wt virus Recombinant Wild type is displayed above that of the recombinant virus vROllk. The G of the boxed transla- tion initiation codon that abuts the vaccinia virus late promoter element TAAAT was B changed to an A (underlined), which was FM- F18R ORF followed by the 22-base synthetic lac oper- -50 -10 +1 ator sequence (22) and a new translation WT TGTATGTAAAAATATAGTAGAATTTCAYEI IGITITLICTATGCTATAAEDAAT initiation codon. The additional nucleotides vRO11K TGTATGTAAAAATATAGTAGAATTTCATITGTLTITICTATGCTATAAATAAAT flanking the F18R promoter/operator are restriction endonuclease sites that were in- troduced to allow possible future promoter A __ and operator substitutions. The position rel- GCTAGC ative to the translation initiation site (+1) is NhcI GAATTGTGAGCGCTCACAAT7CTCGAGATG marked in the sequence of wt virus. The '-~------lac operator - | indicated lac operator/Xho I and Nhe I se- XhoI quences were inserted at the upward arrows. shown). IPTG had no effect on plaque formation by the no increase in vRO11k infectivity was detected even after 35 parental wt (strain WR) vaccinia virus (data not shown). hr (Fig. 4). By contrast, IPTG increased the titer of vROllk The effect ofIPTG on infectious virus yield under one-step by 1000-fold, and the yield approached that ofwt virus. When growth conditions was determined. In the absence of IPTG, infection with vROllk was initiated in the absence of in- ducer, the addition of IPTG 10 hr later led to the rapid 5000 80 20 induction of infectious virus formation (Fig. 4). In large-scale preparations, virus stocks with titers comparable with that of wt virus were usually obtained in the presence of5 mM IPTG. Transcription of the lac Operator-F18R Gene Is IPIG- Dependent. In E. coli, binding of the lac repressor to the lac operator prevents transcription of the lac operon (10). To determine whether the repressor has a similar effect on transcription in mammalian cells infected with vROllk, the steady-state level ofmRNA from the lac operator-FJ8R gene was determined by nuclease S1 analysis. Total RNA, isolated from cells at 9 hr after infection with vROllk in the presence or absence ofIPTG, was hybridized with a 32P-5'-end-labeled single-stranded DNA probe (Fig. 5A) and treated with nu- clease S1. The nuclease-resistant RNADNA hybrids were resolved on a denaturing polyacrylamide gel. Properly initi- ated RNA was predicted to protect a 262-nucleotide single- stranded DNA segment of the probe. An intense band of the 0 2.5 10 latter size was detected by autoradiography with RNA from FIG. 3. IPTG-dependent plaque formation. Confluent BS-C-1 cells infected with vROllk in the presence of IPTG but not cells (1 x 106 per well) were infected with a total of80 plaque-forming in its absence (Fig. 5B). Quantitation with a Betascope 603 units of vROllk in the presence of the indicated micromolar con- blot analyzer (Betagen, Waltham, MA) revealed that the centrations of IPTG. The cells were stained with crystal violet 48 hr amount of radioactive material in the -IPTG lane was <5% after infection. of that present in the +IPTG lane at the position of the Downloaded by guest on September 24, 2021 1514 Genetics: Zhang and Moss Proc. Natl. Acad. Sci. USA 88 (1991)

10o a RNA Start Site A vRO11K DNA ATG 1 2 los I 380 nt 04 * Full Length Probe

._ /.0 Ho~~~~~~~~~~~0 262 nt Protected Fragment a -<-----*

O*- /WR B

106 .*'-"**E +IPTG 1/-O**' *'0 IPTG } vROllk

- k- IPTGI *I Induction 621 -l- io] 0, 1 Tis 74

10 20 30 40 . -i ') '! ` N

Hours post infection ')() Om ... :I q(" FIG. 4. Effect of IPIG on virus yield under one-step growth conditions. BS-C-1 cells (5 x 105) were infected with wt (WR) vaccinia virus or vROllk at 10 plaque-forming units per cell in the presence or absence of 5 mM IPTG. After 1 hr, the inoculum was washed off with phosphate-buffered saline, and the cells were incubated with medium with or without IPTG. Cells were harvested at the indicated times after infection, and the virus yield was FIG. 5. Effect of IPTG on transcription of the F18R gene. (A) determined by plaque assay in the presence of 5 mM IPTG. In the Synthesis of the single-stranded DNA probe used for nuclease S1 induction experiment, IPTG was added at 10 hr after infection with analysis. The RNA start site, lac operator (circle), and translation vROllk. initiation codon of the F18R gene in vROllk are shown. Two unlabeled PCR primers (1 and 2) were used to generate double- 262-nucleotide band. However, 95% repression based on this stranded DNA, which then served as the template for an asymmetric estimate is a minimal one, since no discrete RNA band was PCR using 5'-32P-labeled primer 2. The 380-nucleotide single- actually seen on the autoradiograph. stranded full-length probe and the 262-nucleotide segment expected Is to hybridize to mRNA and be protected from nuclease S1 digestion Synthesis of the 11-kDa Protein IPTG-Dependent. The are shown. (B) Analysis of nuclease Si-resistant RNADNA hybrid. inhibition ofhost protein synthesis that follows vaccinia virus Total RNA isolated 9 hr after infection with vROilk in the presence infection makes it possible to assess viral protein synthesis by (lane +1) or absence (lane -I) of IPTG or control tRNA (lane t) were polyacrylamide gel electrophoresis of polypeptides that are hybridized with the 32P-labeled single-stranded DNA probe, digested pulse-labeled with radioactive amino acids. In cells infected with S1 nuclease, and resolved by electrophoresis on a 7 M urea/6% with vRO11k, synthesis of the =11-kDa polypeptide was polyacrylamide gel. Other lanes: P, probe alone; M, radioactively dependent on IPTG (Fig. 6). Note that only the sharp lower labeled marker DNA fragments with sizes in nucleotides on right. band ofthe =11-kDa doublet in the +I lane ofFig. 6 is clearly The position of the specific nuclease-protected fragment is indicated visible in the -I lane. by an arrow. A nuclease-resistant band corresponding to the full- length probe was found in all sample lanes, including controls, as a result oftrace amounts of double-stranded DNA by-product from the DISCUSSION symmetric PCR used to generate the template for the asymmetric PCR that formed the single-stranded DNA probe. We have used the regulatory elements of the E. coli lac operon to construct an inducible conditional-lethal mutant expressed a protein likely to be required in stoichiometric animal virus (Fig. 1). The success of this method evidently rather than catalytic amounts in case repression was incom- depended on: (i) the timely synthesis of adequate amounts of plete. In addition, a gene with a well-characterized promoter lac repressor in infected cells, (ii) tight binding of the lac would help in the placement of the lac operator sequence. repressor to a copy ofthe lac operator integrated into the viral Finally, we wanted a gene for which little functional infor- genome, (iii) placement of the lac operator into the viral mation was available and for which no ts mutants had been target gene so that transcription was stringently regulated by isolated. The F18R gene, known to express an abundant repressor binding, and (iv) the ability of exogenous inducer virion protein of 11 kDa, seemed to meet these requirements IPTG to diminish repressor binding so that expression of the (26, 27). We considered it preferable to retain the target gene target gene was highly inducible. in its original site and to insert the lac operator immediately The present work started with vlacI, a recombinant vac- downstream ofthe natural promoter. A procedure for making cinia virus containing an integrated copy oflacIunder control such site-directed mutations in large virus genomes has been of a vaccinia virus early/late promoter so that the repressor developed (18). If desired, this transient dominant selection is synthesized constitutively in infected cells (15). Our ob- method that we used can be reapplied to the same virus so jective was to place an essential viral gene of vlacl under that multiple genes are placed under operator control. operator control. To make conditions favorable for this initial The essentiality of the F18R gene was demonstrated by the study, we wanted a gene that is expressed late in infection to IPTG dependence of the mutant virus. Without inducer, no allow time for the repressor to accumulate and one that plaques were produced, and no increment in virus yield Downloaded by guest on September 24, 2021 Genetics: Zhang and Moss Proc. Natl. Acad. Sci. USA 88 (1991) 1515 +I -I line. With small viruses, it might be more practical to construct stable cell lines that express lacd (11-13). In all cases, the amount of repressor made should be in excess of the number ofcopies ofthe viral genome. Addition ofnuclear localization signals to the repressor (28) might also be nec- essary for nuclear viruses. Inducer dependence may have some inherent advantages over temperature sensitivity for the construction and analysis of conditional-lethal mutant 30 ---_ viruses. The phenotype of the inducer-dependent virus is FIG. 6. Effect ofIPTG on syn- thesis of the 11-kDa polypeptide. determined by the amount of target protein expressed in the BS-C-1 cells were infected with cells, which can be varied over a wide range by titrating vROllk in the presence (+) or repressor with inducer. In contrast, the phenotype of a ts 21.5- - absence (-) of 5 mM IPTG and mutant is dependent on the altered protein configuration at pulse-labeled with [355]methio- the nonpermissive temperature. nine between 7 and 8 hr after in- fection. The cell lysates were We thank N. Cooper for tissue culture cells and virus preparations, 12.512 Ax ~ treated with SDS and analyzed on N. Cole and J. Sisler for oligonucleotides, and members of the U ~ a 20%o polyacrylamide gel. The laboratory for discussions and critical reading of the manuscript. position ofthe 11-kDa polypeptide 6.5 only in the +1 lane is indicated by 1. Ramig, R. F. (1990) in Virology, eds. Fields, B. N. & Knipe, an arrow. D. M. (Raven, New York), Vol. 1, pp. 95-122. 2. Benjamin, T. L. (1970) Proc. Natl. Acad. Sci. USA 67, 394- occurred in one-step growth experiments. Elsewhere, we will 399. show that the block occurs in virus maturation and affects the 3. Jones, N. & Shenk, T. (1979) Proc. Natl. Acad. Sci. USA 76, proteolytic cleavage of precursors of the major structural 3665-3669. proteins ofthe virion (unpublished data). However, addition of 4. DeLuca, N. A., McCarthy, A. M. & Schaffer, P. A. (1985) J. IPTG led to wt-size and normal of Virol. 56, 558-570. plaques nearly yields virus, 5. Benzer, S. & Champe, S. P. (1962) Proc. Natl. Acad. Sci. USA which were 3 orders ofmagnitude above the background in the 48, 1114-1121. absence of inducer. The defect in virus growth was rapidly 6. Epstein, R. H., Bolle, A., Steinberg, C. M., Kellenberger, E., reversed by addition ofIPTG. After low-multiplicity infection Boy de la Tour, E., Chevalley, R., Edgar, R. S., Slisman, M., ofmonolayers with vROllk, no signs ofinfection were evident Denhardt, G. H. & Lielasusis, A. (1963) Cold Spring Harbor for at least 6 days (the longest time tested), at which time Symp. Quant. Biol. 28, 375-392. addition of IPTG still led to virus induction. We have grown 7. Hudziak, R. M., Laski, F. A., RajBhandary, U. L., Sharpe, large stocks ofmutant virus in the presence ofinducer, and the P. A. & Capecchi, M. R. (1982) Cell 31, 137-146. IPTG dependency appears relatively stable, asjudged by virus 8. Sedivy, J. M., Capone, J. P., RajBhandary, U. L. & Sharp, formation. we have not at- P. A. (1987) Cell 50, 379-389. plaque Although specifically 9. White, B. T. & McGeoch, D. J. (1987) J. Gen. Virol. 68, tempted to isolate IPTG-independent mutants, we would 3033-3044. expect them to occur at low frequency by spontaneous mu- 10. Miller, J. H. & Reznikoff, W. S. (1980) The Operon (Cold tation of the repressor or operator. Spring Harbor Lab., Cold Spring Harbor, NY). The stringency of the defect in vRO1lk was demonstrated 11. Hu, M. C.-T. & Davidson, N. (1987) Cell 48, 555-666. by our inability to detect mRNA and protein products of the 12. Brown, M., Figge, J., Jeang, K.-T., Khoury, G., Livingston, lac operator-FJ8R gene in the absence of IPTG. Previously, D. M. & Roberts, T. M. (1987) Cell 49, 603-612. with more sensitive and quantitative assays, we found that up 13. Figge, J., Wright, C., Collins, C. J., Roberts, T. M. & Living- to 99.9o repression occurred using the same promoter/ ston, D. M. (1988) Cell 52, 713-722. to of If 14. Deuschle, U., Pepperkok, R., Wang, F., Giordano, T. J., operator regulate expression ,3-galactosidase (15). McAllister, W. T., Ansorge, W. & Bujard, H. (1989) Proc. necessary, a still higher degree ofrepression may be obtained Natl. Acad. Sci. USA 86, 5400-5404. by using multiple copies of the operator (ref. 16; Y.Z., 15. Fuerst, T. R., Fernandez, M. P. & Moss, B. (1989) Proc. Natl. unpublished data) and possibly by increasing expression of Acad. Sci. USA 86, 2549-2553. repressor. For gene products required in low amounts, it is 16. Rodriguez, J. F. & Smith, G. L. (1990) Virology 177, 239-250. also feasible to weaken the promoter by single nucleotide 17. Rodriguez, J. F. & Smith, G. L. (1990) Nucleic Acids Res. 18, substitutions. 5347-5351. Although we have stressed the use of the elements of the 18. Falkner, F. G. & Moss, B. (1990) J. Virol. 64, 3108-3111. lac operon for constructing conditional-lethal mutants, sim- 19. Mackett, M., Smith, G. L. & Moss, B. (1985) in DNA Cloning, ilar be used for eds. Rickwood, D. & Hames, B. D. (IRL, Oxford), Vol. 2, pp. approaches may regulating nonessential viral 191-211. genes. Rodriguez and Smith (17) used a multistep procedure 20. Mulligan, R. & Berg, P. (1981) Proc. Natl. Acad. Sci. USA 78, that consisted of first inserting an operator-modified viral 2072-2076. gene encoding a 14-kDa protein into the thymidine kinase 21. Falkner, F. G. & Moss, B. (1988) J. Virol. 62, 1849-1854. DNA locus, isolating the recombinant virus, insertionally 22. Sadler, J. R., Sasmor, H. & Betz, J. L. (1983) Proc. Natl. inactivating the original 14-kDa protein gene, and then iso- Acad. Sci. USA 80, 6785-6789. lating the final recombinant virus. Studies with the mutant 23. Mackett, M., Smith, G. L. & Moss, B. (1984) J. Virol. 49, virus obtained in this manner indicated that repression of 857-864. synthesis ofthe 14-kDa protein did not prevent the formation 24. Fling, S. P. & Gregerson, D. (1986) Anal. Biochem. 155, 83-88. of infectious virions but inhibited their from cells. 25. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular egress Cloning:A Laboratory Manual (Cold Spring Harbor Lab., Cold In principle, our protocol can be used to regulate genes of Spring Harbor, NY). other poxviruses and, with appropriate modifications, of 26. Wittek, R., Hanggi, M. & Hiller, G. (1984)J. Virol. 49, 371-378. members of many different virus families. The vaccinia virus 27. Hiller, G. & Weber, K. (1982) J. Virol. 44, 647-657. genome accommodated the lacI gene, thereby allowing the 28. Labow, M. A., Baim, S. B., Shenk, T. & Levine, A. J. (1990) system to be self-contained and usable in any permissive cell Mol. Cell. Biol. 10, 3343-3356. Downloaded by guest on September 24, 2021