Localization of Upstream Silencer Elements Involved in the Expression of Cone Transducin a-Subunit (GNAT2)
T. Allen Morris*^ Wei-Bao Fong,* Melissa J. Ward,* Hu Hu,% and Shao-LingFong*%
Purpose. To localize as-acting elements involved in the expression of the cone-specific G- protein, cone transducin a-subunit (GNAT2). Methods. In this study, the authors used a genomic clone, HGLG3, to sequence 3139 base pairs of the upstream region of the GNAT2 gene and to localize as-acting elements involved in the expression of GNAT2. Upstream elements were localized functionally by transfection of chloramphenicol acetyltransferase gene constructs containing nested deletions of this up- stream region into WERI-Rbl cells. Cell specificity of the localized elements was determined by transfection of the HeLa cells. Transacting factor-binding sites to functional as-acting elements were determined by DNasel footprinting. Cell specificity of protein interaction with footprinted regions was tested by electrophoretic mobility shifts with nuclear extracts from WERI-Rbl and HeLa cells. Results. Transfection of WERI-Rbl and HeLa cells revealed the presence of a strong, noncell- specific silencer region between —1130 and —23, a weak, cell-specific promoter between — 151 and —10, and a stronger, noncell-specific element between +143 and +167. DNasel footprinting showed three major footprints (SI, S2, and S3) between —807 and —176, indicat- ing the binding sites for putative negative trans-acting factors. Individual footprinted sequences had similar electrophoretic mobility shifts when they were incubated with nuclear extracts from either WERI-Rbl or HeLa cells, suggesting that these cells express the same negative factors. Conclusions. The expression of the GNAT2 gene is controlled by a strong silencer region, a weak upstream cell-specific promoter, and a strong downstream element. The silencer region interacts with similar proteins from retina- and nonretina-derived cell lines. Invest Ophthalmol Vis Sci. 1997;38:196-206.
J. ransducin, a G protein, plays an important role as units from cGMP-PDE. The activated cGMP-PDE a liaison in the visual transduction cascade in photore- rapidly lowers the concentration of cGMP in the outer ceptors. During interaction with a light-activated pho- segment of the photoreceptor, causing the closure of topigment, the a-subunit of transducin is stimulated cGMP-dependent cation channels and hyperpolariza- to exchange bound guanosine diphosphate for guano- tion of the plasma membrane.1'2 sine triphosphate and is released from its /?y-subunits. For the most part, the biochemistry for the verte- The guanosine triphosphate-bound a-subunit then ac- brate visual cascade has been elucidated using pro- tivates cyclic guanosine monophosphate-phosphodi- teins purified from rod photoreceptors.1 Cone photo- esterase (cGMP-PDE) by removing inhibitory y-sub- receptors appear to use a similar phototransduction mechanism.3'4 For example, cones and rods each have their own homologous visual pigments,5'6 transduc- From the Departments of * Ophthalmology and %Biochemistry and Molecular Biology, s Indiana University, Indianapolis, and the ^Department of Biological Sciences, ins, and cGMP-PDEs. Although many of the Purdue University, West Lafayette, Indiana. Supported by National Institutes of Health grant EY08562 and supported in part genes encoding these proteins have been character- by an unrestricted grant from Research to Prevent Blindness (New York, Neiu York) ized, there is much to be learned about the regulatory and by the Department of Ophthalmology, Indiana University School of Medicine. Received for publication March 21, 1996; revised August 16, 1996; accepted mechanisms involved in their expression. Recently, we August 16, 1996. began using transient transfections of a human retino- h-oprietary interest category: N. Reprint requests: Shao-Ling Fong, Department of Ophthalmology, 702 Rotary blastoma cell line, WERI-Rbl, as a model for studying Circle, Indiana University, Indianapolis, IN 46202. photoreceptor-specific transcriptional regulation.11
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1 196 Copyright © Association for Research in Vision and Ophthalmology
Downloaded from iovs.arvojournals.org on 09/26/2021 Upstream Elements for the Human GNAT2 Gene 197
We have characterized the genes for human rod out as previously described11 using a cationic lipo- (GNAT112) and cone (GNAT213) transducin a-sub- some, Lipofectin (GIBCO BRL), with some modifica- units and have demonstrated that GNAT2 is expressed tions. For each WERI-Rbl transfection, 3.3 X 10° in WERI-RB1 cells. Studies of as-acting elements and WERI-Rbl cells were pelleted and then mixed with 18 transacting factors for these two homologous genes fig of GNAT2-CAT plasmid, 1 //g of a cytomegalovirus will provide knowledge about the similarities and dif- promoter-driven luciferase internal control plasmid, ferences in transcriptional regulation between rods CMV.LUC, and 10 /il of Lipofectin in 1 ml of Opti- and cones. In this article, we report the initial localiza- Meml medium (GIBCO BRL) and were plated imme- tion and characterization of ds-elements within the diately in a 35-mm well. After 16 hours, 1 ml of culture upstream region of the human GNAT2 gene. medium with 20% fetal bovine serum was added. Twenty-four hours later, cells were replated in 1.7 ml of fresh culture medium and were grown for 2 more MATERIALS AND METHODS days before they were harvested. DNA Sequencing and Comparison Adherent HeLa cells (ATCC no. CCL 2) were grown in Dulbecco's modified Eagle's medium The upstream sequence of GNAT2 gene was charac- (GIBCO BRL) with high glucose and the same supple- terized using a Pstl fragment of a previously character- 13 ments used for WERI-Rbl cells. HeLa cells were trans- ized human genomic clone, HGLG3. The complete fected at approximately 80% confluency in 35-mm sequence for both strands of this fragment was ob- wells by the immediate addition of a mixture of 10 //g tained using Sanger dideoxy-chain termination14 and 15 CAT construct DNA, 0.5 //g CMV.LUC DNA (used as the method of Dale et al. Overlapping sequences an internal control), and 10 /xl Lipofectin in 1 ml were aligned using Beckman (Palo Alto, CA) Micro- Opti-Meml. After 6 hours, the medium was replaced genie software. Functional regulatory sequences were with 1.6 ml of fresh, supplemented Dulbecco's modi- compared to a exacting element data base, tfsites, fied Eagle's medium and was incubated for 36 addi- by GCG Package (Genetics Computing Group, Inc, tional hours before it was harvested. Madison, WI). Harvested WERI-Rbl and HeLa cells were resus- pended in 0.1 M KPO4 (pH 7.8) and 0.1 mM dithio- Plasmid Constructions threitol (70 fi\ for WERI-Rbl and 60 fu.\ for HeLa Because no convenient restriction sites were available cells). One third of the WERI-Rbl and HeLa cytosols between the transcription ( + 1 to +31) and translation 13 were used for CAT assays as described by Gorman et (+214) start sites, an insert-containing sequence al.17 [14C]-labeled chloramphenicol (Amersham, Ar- from —3139 to +167 in M13mpl9 was generated ac- 15 lington Heights, IL) and its derivatives were separated cording to the Dale method and was used for plas- by thin-layer chromatography and quantitated by a mid constructions. This fragment was removed by Pstl two-dimensional /^-scanner (Ambis, San Diego, CA). and EcoKL digestion, subcloned into the Pstl site of Luciferase assays were carried out using a Luciferase pUC19, and directionally ligated into the Sphl and Pstl Assay System (Promega). sites immediately upstream of the chloramphenicol acetyltransferase (CAT) reporter gene in pCAT.basic Nuclear Extract Preparation (Promega, Madison, WI). Nested deletions from both Nuclear extracts for DNasel footprinting and mobility- the upstream and the downstream ends of this insert shift assays were prepared from WERI-Rbl and HeLa in pCAT.basic were created using the Erase-a-Base sys- 18 16 cells by the method of Dignam et al and were stored tem (Promega) and available restriction endonucle- in liquid nitrogen. Protein concentrations were deter- ase sites within the insert. Plasmid preparations were mined by the Bradford assay19 (BioRad, Hercules, banded twice by CsCl-ethidium bromide density gra- CA). dient centrifugation. WERI-Rbl and HeLa cells were transfected with two independent preparations of DNasel Footprinting Analysis each construct. DNasel footprinting was performed by the method of Dynan20 with some modifications. Briefly, two geno- Cell Transfection and CAT Assays mic fragments containing upstream sequences from The retinoblastoma cell line, WERI-Rbl (ATCC no. -807 to -553 and -546 to -176 were end-labeled HTB 169), was grown in suspension in a culture me- with [y-32P]ATP (7000 Ci/mmol; ICN, Costa Mesa, dium made up of RPMI 1640 supplemented with 10% CA) and T4 polynucleotide kinase (GIBCO BRL) on fetal bovine serum, 2 mg/ml sodium bicarbonate, 0.29 the 5'-end of either the coding or the noncoding mg/ml L-glutamine, 100 U/ml penicillin, and 100 strand and were purified by polyacrylamide gel elec- mg/ml streptomycin (GIBCO BRL, Gaithersburg, trophoresis followed by DE52 ion exchange chroma- MD) at 37°C and 5% CO2. Transfections were carried tography. A 50-//1 mixture containing 10 mM Tris (pH
Downloaded from iovs.arvojournals.org on 09/26/2021 198 Investigative Ophthalmology 8c Visual Science, January 1997, Vol. 38, No. 1
8), 5 mM MgCl2, 5 mM CaCl2, 50 mM KC1, 500 nM of exon 1. The region used for plasmid construction dithiothreitol, 0.05 mg/ml bovine serum albumin, is shown in Figure 1. This sequence was compared and 40.5 ng///l poly(dldC) (Boehringer Mannheim, to the as-acting element database, tfsites, using the Indianapolis, IN) was incubated on ice for 15 minutes Genetics Computing Groups program. As expected in the presence or absence of 75 /ig WERI-Rbl nu- for such a large sequence, many matching sequences clear extract. The mixture was incubated for an addi- were found spanning the entire fragment. In Table tional 45 minutes on ice with 20,000 CPM of DNA I,22"30 we show only the consensus sequences that re- probe before DNasel digestion for 2 minutes at 24°C side within the promoter region or within footprints in with variable amounts of DNasel. The DNasel diges- the silencer region determined by DNase footprinting tion was stopped with 50 (A of stop buffer (0.2 M NaCl, analysis. 30 mM ethylenediaminetetraacetic acid, 1% sodium dodecyl sulfate, and 0.1 mg/ml yeast tRNA). Digested Transient Transfection of WERI-Rbl Cells DNA probes were purified by phenol extraction and With GNAT2-CAT Gene Constructs ethanol precipitation and were separated on both 8% A fragment of the human GNAT2 upstream region and 6.5% denaturing polyacrylamide gels. Dried gels from —3139 to +167 was subcloned into pCAT.- were exposed to Kodak XAR film (Eastman Kodak, basic. Figure 2 shows that this large fragment drove Rochester, NY) with intensifying screens for 2 days comparable CAT expression in WERI-Rbl cells as at —80°C. G and G + A sequencing reactions21 were the pCAT.basic vector alone. Progressive deletions performed to determine the positions of the protected of upstream sequence from —1130 down to —23 regions. produced incremental increases in CAT expres- sion. Removal of the sequence between —1130 and Gel Mobility-Shift Assays — 151 produced a 9.7-fold increase in CAT expres- Oligonucleotide probes OligoSl (-736 to -694), sion. These deletions appeared to remove silencer OligoS2 (-523 to -461), and OligoS3 (-344 to elements between —1130 and —23. —305) were synthesized to overlap footprints SI, S2, High levels of CAT expression were still observed and S3, respectively, in the —807 to —176 fragment. with deletion of the sequence down to +143 (Fig. 2). These oligonucleotides were end labeled with [y-32P]- The +143 to +167 fragment could drive CAT expres- ATP, annealed with the complementary oligonucleo- sion in either orientation relative to the CAT gene tide, and purified by DE52 column chromatography (data not shown). This positive element was cloned (0.5 ml bed volume). Labeled double-stranded oligo- at the 3' end of the CAT gene in pCAT.Promoter nucleotides (20,000 CPM) were incubated in 10 (A at (Promega), in which CAT expression was driven by 24°C for 15 minutes in 12 mM HEPES (pH 7.9), 10% the SV40 promoter. When this construct was trans- glycerol, 4 mM Tris (pH 8), 1 mM ethylenediaminetet- fected into WERI-Rbl cells, no significant increase raacetic acid, 0.3 mg/ml bovine serum albumin, 1 mM in CAT activity was seen in comparison to pCAT.Pro- dithiothreitol, 0.1 /ig//il poly(dAdT) (Boehringer moter without the positive element (16.0% ± 5.2% Mannheim), optimized amounts of WERI-Rbl or conversion and 15.8% ± 6.1% conversion, respec- HeLa crude nuclear extracts, and optimized concen- tively). All the transfected constructs containing +143 trations of KC1 (see the legend to Fig. 5 for the actual to +167 of the GNAT2 gene also contained the clon- amount of nuclear extract and KC1 used for each ing sequence (GGGGGAATT, Fig. 1) created in 15 probe). Each labeled probe was competed with an M13mpl9 by the Dale deletion method. A double- excess of the same unlabeled probe as well as an unre- stranded synthetic oligonucleotide that overlapped lated, double-stranded synthetic oligomer. Binding this region ( + 138 to +172), but did not contain the mixtures were separated on a nondenaturing 5% poly- sequence added by the Dale method, was subcloned acrylamide gel and exposed to Kodak XAR film. into pCAT.basic and transfected into WERI-Rbl cells. This construct resulted in CAT expression equivalent to that of the +143 to +167 construct (Fig. 2). These RESULTS data indicate that the downstream-positive sequence was not created by the added cloning sequence. Sequence Analysis of the Upstream Region for The upstream GNAT2 promoter was localized by Human GNAT2 Gene making exonuclease III deletions from the down- We used a PstI restriction fragment of the human ge- stream end of the —151 to +167 pCAT construct. De- nomic clone, HGLG3, that we had previously used leting to +126 removed the activity of the downstream to characterize the gene for human GNAT2.13 This element but left weak promoter activity. Further dele- fragment was sequenced on both strands and was tion of the sequence to —10, which included the re- found to contain 3139 bp of sequence upstream of gion of the endogenous transcription initiation sites the first transcription initiation site, as well as 280 bp but not the TATA box consensus sequence, still re-
Downloaded from iovs.arvojournals.org on 09/26/2021 Upstream Elements for the Human GNAT2 Gene 199
-3139 CTGCAi -3039 GCACA •2939 AACAA ACTAG^ -2839 AOGGC -2739
-2639 CTCCCGGCTTCAACCCATTCTCATGCCTCrrATCTCCCAAGTACCTOCGTO^ -2539 kTCTKXTICR7ITGCCCAG -1839 TTrOUUVGaGACTCTCCTGTTTTTCCTTAAGTCAATAAGGACT^ -1739 -1639 *pPf^jY7ft^f^*pTCCCAGTCCCAACTQGCCACT^C near the transcription initia- -339 S3 tion sites (ATTGC at -38, CCACCCTATGGTAAACCAGTATGCTTftaTACCCTOVA«:CCTT^ ATTGG at -56, ATTGA at -239 GCCACTAATCTCTAGCTCTATGATGaUVATAAATCTAAGGAAGCAAGAGACTT^^ -72, and ATTTG at -96) -139 also are underlined. Foot- CTTCCGTCAGAACCCAGCAGATCATTTCCCTAGTTATAGAAACAXnX^GTCTTTACCCCTTGCC^TAXI^C^^ .39 * * * * * * * prints SI, S2, and S3 found CAJ3aCrAGAlAIAMGGCTACAATCCCTAGACTAAGAAGTAQGTCTCCAGTK5AAGTAOGGAGTCTC^ within a portion of the si- +62 CCTGCTCTCTCACCTGCCATCX3TACAGACCAGCTTTTAGGGCAGCCAACrrTGGGATACTCAATC^ lencer region are double • 167 underlined. tained weak activity. The activity of this promoter was GNAT2 promoter and the downstream element. Fig- significantly greater than that of pCAT.basic (P < ure 3 shows that the —807 to —176 fragment signifi- 0.025, independent Z-test). These results localize a cantly reduced CAT activity of the promoter region minimal promoter element for human GNAT2 to be by 2.0- to 2.1-fold in WERI-Rbl cells (P < 0.005, between —151 and —10. independent /-test). However, a similar fragment (—807 to —152), when positioned immediately up- Activity of the Silencer Region stream of the promoter region, resulted in a 2.7-fold To determine whether the silencer region had any reduction (Fig. 2, compare constructs —807 to +167 distance, orientation, or promoter specificities, a frag- and -151 to +167). The -807 to -176 fragment also ment of this region (—807 to —176) was first cloned could reduce significantly the activity of a heterolo- in both orientations at the 3'-end of the CAT gene, gous promoter (SV40 promoter) by 2.4-fold. In with the —151 to +167 region acting as the promoter. WERI-RB1 cells, pCAT.Promoter produced 19.1% ± This promoter region contained both the upstream 3.2% CAT substrate conversion. However, with the Downloaded from iovs.arvojournals.org on 09/26/2021 200 Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1 TABLE l. Consensus Sequences for the Regulatory Regions of Human GNAT2 and the Putative Factors That Might Bind to Them* Position in GNAT2 GNAT2 Sequence Function Putative Factors -714 AAGTGA Silencer-footprint SI IRF-1 and 222 -508 TACGTCAT (NC) Silencer-footprint (S2) E4TF123 ATF25 -493 AAGTGA Silencer-footprint S2 IRF-1 and 222 -340 TAGGCTGGT(NC) Silencer-footprint S3 Spl26 -58 AGCCAATTA (NC) Promoter CTF/NF-127 H2B28 -29 TATAAA Promoter TBP/TFIID29 +21 GGGAGTCTC Promoter NFKB30 * The position of the sequence is given relative to the first transcription initiation site for GNAT2. The GNAT2 sequence in the coding or noncoding (NC) orientations and the function for the region in GNAT2 expression, in which the consensus sequence resides, are given. Trans-acting factors, which have been demonstrated for other genes to interact with these sequences, are listed with references. negative fragment cloned at the 3'-end of the CAT show any enhancer activity in WERI-Rbl cells (data gene in pGAT.Promoter, it produced only 7.9% ± not shown). Instead, the enhancer we used, which is 2.0% substrate conversion. not cell specific (manuscript in preparation), was Our results show that the upstream GNAT2 pro- taken from the upstream region, —1622 to -1409 rela- moter element within —151 to +126 drives expression tive to the transcription initiation sites,11'31 of another only slightly higher than pCAT.basic. To test the abil- photoreceptor-specific gene, the human interstitial re- ity of the silencer region to inhibit transcription of tinoid-binding protein (IRBP) gene. This particular this promoter without the downstream element, its enhancer was able to boost the expression of the weak activity was increased by the addition of a heterologous GNAT2 promoter element by 2.6-fold (Fig. 3). When enhancer at the 3'-end of the CAT gene. We were the silencer fragment (—807 to —176) was cloned in unable to use the SV40 enhancer because it did not both orientations immediately upstream of the en- WERI-RBl Cells -3139 to+167 - 0 HeLa Cells •2820 lo+167» - -248410+167 - -2161 to +167 - -1897 to +167 - -1668to+167 - -1130 to+167 - -807 to +167 •550 to +167 -241 to +167 -151 to+167 •2310+167 +69 to +167 +143 to +167 +138 to +J72* •151 to +126 -lSlto+109 -151 to -10 pCAT.Bask SO 20 30 40 % Conversion % Conversion FIGURE 2. Transfection of WERI-Rbl and HeLa cells with constructs containing nested deletions of GNAT2 flanking sequences cloned upstream of the CAT gene. Construct names in the center of the two bar graphs indicate the 5' and 3' ends of inserted GNAT2 flanking sequence relative to the most upstream transcription initiation site, [filled bars) WERI- Rbl transfections. (hatched bars) HeLa transfections. Constructs names (asterisks) were not transfected into HeLa cells. Data were collected from at least three independent transfections using two different preparations of each construct. CAT activity is represented as percent conversion from nonacetylated to acetylated derivatives of chloramphenicol. Cytomegalovi- rus promoter-driven luciferase activity in transfected WERI-Rbl and HeLa cells was used to normalize the CAT activity for each transfected construct. Error bars = standard deviation. Downloaded from iovs.arvojournals.org on 09/26/2021 Upstream Elements for the Human GNAT2 Gene 201 -151 to+167- DNasel Footprinting Analysis of Protein -151 to+167(3'-807 Co-176)- I " Binding Within the Silencer Region -151 to +167(3' -176 to -807)- 1 > • WERIRbl Cel The -807 to -176 silencer fragment was cleaved into -151 to+126*- 0 HeLa Cells two fragments, -807 to -553 and -546 to -176, with 32 •151to+126(3'ENH)»- d • 1 Ssll. Each fragment was end labeled with P on the (51 -807 to -176) -151 to +126 (3'ENH)- 5' end of the coding or noncoding strand, incubated (5'-176 to -807) -151 to +126 (3'ENH) - with nuclear extract prepared from WERI-Rbl cells, pCAT.BasIc*- and digested with DNasel. Figure 4 shows the results 0 20 40 60 of the DNasel digestion for both fragments in the % Conversion absence and presence of the nuclear extract. The FIGURE 3. Activity of the silencer region and cell specificity —807 to —553 fragment in Figure 4A shows a clear, of the upstream GNAT2 promoter. Constructs transfected protected region on the coding strand from —731 to into both WERI-Rbl {filled bars) and HeLa cells {hatched —698 and on the noncoding strand from —731 to bars) are denoted by asterisks. In the top part of the graph, -703. We have named this footprint SI. The -546 to the —151 to +167 fragment was used to promote CAT ex- — 176 fragment shows two clear footprints, which we pression. The main activity of this fragment is derived pri- have named S2 and S3. S2 is protected on die coding marily from the downstream element and not the upstream GNAT2 promoter element. A portion of the silencer region strand from —516 to —469 and on the noncoding (—807 to —176) was cloned in both orientations at the down- strand from —517 to —469. The S3 footprint lies be- Stream end of the CAT gene. In the lower part of the graph, tween —335 and* —311 on the coding strand and —334 an enhancer (3'ENH) from the upstream region of the hu- and —307 on the noncoding strand. Weaker footprints man IRBP gene was cloned at the 3' end of the CAT gene may be noted in Figure 4, but, for this study, we chose in a construct containing the upstream GNAT2 promoter to characterize further the three stiongest and most (-151 to +126) and transfected into WERI-Rbl and HeLa reproducible protected regions. cells. The silencer region was cloned immediately upstream of this promoter in both orientations and transfected into Electrophoretic Mobility-Shift Analysis WERI-Rbl cells. Data were collected from at least three independent transfections using two different preparations Footprints SI, S2, and S3 of each construct. CAT activity, which was normalized by Double-stranded oligonucleotides synthesized to over- luciferase activity, is represented as percent conversion from lap footprinted regions SI, S2, and S3 (OligoSl, S2, chloramphenicol to its acetylated derivatives. Error bars = and S3) all showed shifted bands in the presence of standard deviation. WERI-Rbl or HeLa nuclear extracts. Competition with an excess of the same unlabeled oligonucleotide using WERI-Rbl nuclear extract showed one specific, hancer-driven promoter, it resulted in a 3.5- to 4.3-fold shifted band for OligoSl and S2, and it showed three reduction in activity, effectively negating the increased specific, shifted bands for OligoS3 (left panels of Figs. expression caused by the IRBP enhancer. 5A, 5B, 5C). Similar specific, shifted bands were identi- fied for all three oligos when HeLa nuclear protein Cell Specificity of GNAT2 CwActing Elements was used (right panels of Figs. 5A, 5B, 5C), except OligoS3, which appeared to have one less specific, Nested deletion constructs also were transfected to shifted band with the HeLa protein. HeLa cells to test for cell specificity. Removal of the silencer region caused approximately a 5-fold increase in CAT expression, demonstrating that the silencer is DISCUSSION as effective in HeLa cells as it is in WERI-Rbl cells (Fig. 2). The constructs -151 to +126 and -151 to To date, the transcriptional regulation of only a few — 10, which contained the upstream promoter but not photoreceptor-specific genes has been studied. Some the downstream-positive element, produced CAT ex- as-acting elements for the rhodopsin,32"34 rod trans- pressions less than that of pCAT.basic in HeLa cells, ducin a-subunit,35 arresting,36 IRBP,37-39 and /3-PDE40 and the IRBP enhancer was unable to increase signifi- genes have been localized by using transgenic mice candy the expression by the upstream promoter and by homology comparisons of the upstream re- (-151 to +126) above that of pCAT.basic (Fig. 3). In gions of these genes from different mammalian WERI-Rbl cells, this enhancer increased the up- species. No cone-specific ra-elements have been char- stream promoter activity by 2.6-fold (Fig. 3). However, acterized. Retinoblastoma tumors are thought to be the downstream element ( + 143 to +167) was active in derived from the embryonic precursors of photore- HeLa cells, demonstrating that it was not cell specific. ceptors in the developing retina. Cells in these tumors Based on these results, only the upstream promoter sometimes exhibit a morphology similar to that of of the GNAT2 gene was cell specific. photoreceptors.41 Bogenmann et al42 showed that 7 Downloaded from iovs.arvojournals.org on 09/26/2021 202 Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1 of 7 retinoblastoma cell lines they tested expressed line is ideal for the study of the cell-specific expression mRNAs for the cone transducing a-subunit (GNAT2) of human GNAT2. and red or green photopigment, but not for the rod Transfection of the WERI-Rbl cells with chimeric transducing a-subunit (GNAT1) or rhodopsin. How- reporter gene constructs, containing portions of the ever, Di Polo and Farber'13 demonstrated the presence human GNAT2 upstream sequence at the 5'-end of of rod-specific mRNAs in a retinoblastoma cell line, the CAT gene, revealed the presence of several cis- Y79, using reverse transcription-polymerase chain re- elements. A region between —1130 and —23 con- action. Retinoblastoma cell lines, therefore, would tained elements that lowered CAT expression. A weak serve as a useful model system for studying cone-spe- upstream promoter activity was localized between cific and, perhaps, rod-specific gene regulation. We -151 and -10. This promoter produced only a 2.4- have previously shown the usefulness of a retinoblas- fold higher expression than did pCAT.basic. A con- toma cell line, WERI-Rbl, for localizing CODING NONCODING 15 -i- Zm> FIGURE 4. DNasel footprinting of the silencer region from —807 to —176 using WERI-Rbl nuclear extract. (A) Coding and noncoding end-labeled -807 to -553 probes were digested by increasing amounts of DNasel (6, 10, 14, 200, 400, 600, 7, 14, 300, 500 ng DNasel for lanes 1 to 10, respectively) in the absence (lanes 1, 2, 3, 7, 8) and in the presence (lanes 4, 5, 6, 9, 10) of 75 /j,g WERI-Rbl nuclear extract. (B) Coding and noncoding end-labeled —546 to —176 probes were digested by increasing amounts of DNasel (10, 20, 200, 400, 600, 7, 14, 300, 500 ng DNasel for lanes 1 to 9, respectively) in the absence (lanes 1, 2, 6, 7) and in the presence (lanes 3, 4, 5, 8, 9) of 75 fig WERI-Rbl nuclear extract. A short- run gel (left) and a long-run gel (right) were carried out on all probes to visualize footprints alone the entire length of the fragments. The lone-run eel for the coding strand of the -807 to —553 is not shown because no clear footprints were evident. The footprints seen in these fragments were named SI, S2, and S3. Downloaded from iovs.arvojournals.org on 09/26/2021 Upstream Elements for the Human GNAT2 Gene 203 A. Comp. Comp SI DNA S1 DNA' B. Comp. womComep "X X X X X X IU XX X X X X S2 DNA Zoo o o o o 2 oo o o o o S2 DNA I o o o o o o I oo o o o o J CM Tf 00 NS NS NS *• FIGURE 5. (A to C) Mobility-shift analysis of the silencer ele- C. ments using nuclear extracts from WERI-Rbl and HeLa Comp Comp cells. Oligonucleotide probes were synthesized according to S3 DNA S3 DNA* the sequences in footprints SI, S2, and S3 and were incu- bated under conditions described in Materials and Methods. £ X X X X ?X X O XX O x x o x x o Mobility shifts for oligomers SI, S2, and S3 are shown. Mobil- I O O O OO O o o o o o o ity shifts with WERI-Rbl nuclear extract (W-NE) are shown ,- m T- i- m i- in the left panels, and HeLa nuclear extract (H-NE) is shown in the right panels. Variable concentrations of KCI and nu- clear extract were used for each oligomer (A) for OligoSl, s 400 mM KCI, 5 /xg WERI-Rbl, and 6 /xg HeLa nuclear s i& m extracts; (B) for OligoS2, 150 mM KCI, 4 /xg WERI-Rbl, m and 6 /xg HeLa nuclear extracts; and (C) for OligoS3, 150 s mM KCI, 2 /xg WERI-Rbl, 6 fig HeLa nuclear extracts. The NS "hot" oligomers were competed with a molar excess of the same unlabeled oligomer (SI, S2, and S3) and with the same molar excess of an unrelated synthetic oligomer (Compet- ing DNA). Specifically bound (S) and nonspecifically bound (NS) probes are indicated by arrows. stream promoter but did depend on proximity to the did not increase the promoter's activity above that of promoter region because it did not function when the vector alone. placed at the 3' end of the CAT gene. These data indicate that the silencer region plays The cell specificities of the silencer and promoter a key role in the control of GNAT2 expression. We elements were investigated by transfecting HeLa cells, chose to characterize further a portion of this silencer a nonretina-derived cell line. The silencer (-1130 to region, —807 to —176, and found that it did not have —23) decreased activity of the promoter region as well any major distance, orientation, or promoter specific- in the HeLa cells as it did in the WERI-Rbl cells, ities. This result is expected for most positive and neg- indicating that it was not cell specific. The downstream ative (silencers) enhancers. Combined with the incre- positive element also was not cell specific; it drove mental increases in CAT expression seen with nested strong expression in HeLa cells in the presence or deletions in the silencer region, these data indicate absence of the upstream promoter. The upstream that this region is composed of multiple silencer ele- GNAT2 promoter did show cell specificity. In WERI- ments. Protein interaction with DNA sequences within Rbl cells, the upstream promoter activity was in- the silencer was investigated using DNasel foot- creased by the addition of a noncell-specific, heterolo- printing. Several protected regions were evident on gous enhancer. However, in HeLa cells, the enhancer both strands using nuclear extract from WERI-Rbl Downloaded from iovs.arvojournals.org on 09/26/2021 204 Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. cells. The three best-defined footprints were charac- using RNA from human retinas and WERI-RB1 cells, terized further by mobility-shift assays using synthetic that the human GNAT2 gene has multiple transcrip- oligonucleotides that overlapped these footprints and tion initiation sites even though it has a correctly posi- nuclear extracts from WERI-Rbl and HeLa cells. As tioned TATA box.13 These seven initiation sites are expected for noncell-specific elements, the bands located between 29 and 59 bp downstream of the showing specific interaction with proteins from TATA box (Fig. 1). The TATA box and the TFIID WERI-Rbl or HeLa cells have the same mobility, with factor that binds it are important core promoter ele- the exception of OligoS3, which lacked one of the ments involved in correctly positioning RNA polymer- three specific, shifted bands when HeLa nuclear ex- ase II for initiation of transcription at a single site.47 tract was used. It is likely that these two cell lines have No transcription initiation sites were evident 3' of the similar or identical negative frvms-acting factors that downstream positive element. At the time of this writ- bind to these silencer elements. This leads to an im- ing, we do not know whether the TATA box functions portant question regarding the cell-specific expression in the GNAT2 promoter. If it does, it may be possible of GNAT2: How is GNAT2 expression by the weak that the downstream positive element is acting as a cell-specific promoter possible in WERI-Rbl cells in promoter element that plays a role in the positioning the presence of a strong noncell-specific silencer re- of the multiple transcription initiation sites of GNAT2. gion? Perhaps there is a cell-specific element located We are investigating this question and characterizing outside the —3139 to +167 fragment studied in this protein-binding sites to the cell-specific promoter re- work that would directly override the silencer activity. gion. Chromatin structure has been shown to play a role in 44 45 the expression of genes. ' Chromatin structure of Key Words the upstream region of GNAT2 in WERI-Rbl cells and in cones might decrease the activity of the silencer cones, G protein, gene expression, photo receptor-trans- region or increase the activity of the promoter. These duction, transducin effects would not be seen with transient transfections using circular plasmids. Another possibility is that Acknowledgment these negative elements might be inducible to allow The sequence reported in this article has been deposited in higher levels of expression by the promoter. the GenBank database under accession number U66698. Table 1 shows exacting element consensus se- quences that match sequences within the promoter References region or DNasel-protected sequences SI, S2, and S3. 1. Hargrave PA, Hamm HE. Regulation of visual trans- In the silencer region, the sequence TATGAAGTGA duction. In: Sibley DR, Houslay MD, eds. Regulation of is repeated in footprints S2 and S3. This repeated Cellular Signal Transduction Pathiuays by Desensitization sequence contains the consensus sequence AAGTGA, and Amplification. New York: John Wiley & Sons; which has been shown to be a viral or a double- 1994:25-67. stranded RNA-inducible element involved in inter- 2. Stryer L. Visual excitation and recovery. J Biol Client. feron gene expression.22 This consensus sequence is 1991;266:107ll-10714. capable of being bound by either IRF-1, a positive 3. Yau K-W. Phototransduction mechanism in retinal regulatory factor, or IRF-2, a negative regulatory fac- rods and cones: The Friedenwald lecture. Invest Oph- 46 thalmol Vis Sci. 1994;35:9-32. tor. Kuhl et al have demonstrated that this element 4. Lolley RN, Lee RH. Cyclic GMP and photoreceptor acts as a silencer in the absence of an inducer. Al- function. FASEBJ. 1990;4:3001-3008. though we do not expect that GNAT2 is induced by 5. Nathans J, Hogness DS. Isolation and nucleotide se- viral infection of photoreceptors, there may be some quence of the gene encoding human rhodopsin. Proc other inducer that would upregulate GNAT2 expres- NatlAcadSci USA. 1984; 81:4851-4855. sion through interaction with this repeated consensus 6. NathansJ, Thomas D, Hogness DS. Molecular genetics sequence. The effect of potential inducing agents on of human color vision: The genes encoding blue, GNAT2 expression in WERI-Rbl cells, as well as po- green and red pigments. Science. 1986;232:193-202. tential binding by the transcription factors listed in 7. Lerea CL, Somers DE, Hurley JB, Klock IB, Bunt- Table 1 to GNAT2 sequences, are under investigation. Milam AH. Identification of specific transducin alpha subunits in retinal rod and cone photoreceptors. Sci- The CCAAT and TATA box consensus sequences ence. 1986; 234:77-80. found within the GNAT2 promoter region are im- 8. Lee R, Lieberman B, Yamane HyBok D, Fung B. Iden- portant promoter elements for the expression of many tification and purification of the /3 subunits of trans- genes. The CCAAT box is involved in the constitutive ducin and the phosducin//?y-transducin complex in promoter activity of many eukaryotic promoters. It is retinal cone photoreceptors. ARVO Abstracts. Invest interesting to note that we have shown previously, by Ophthalmol Vis Sci. 1992; 33:873. primer extension and SI nuclease protection assays 9. Yau K-Y, Peng Y-W, Robishaw JD. Retinal rods and Downloaded from iovs.arvojournals.org on 09/26/2021 Upstream Elements for the Human GNAT2 Gene 205 cones have distinct G-protein y subunits. ARVO Ab- specific transcription factor, Spl. Science. 1986; stracts. Invest Ophthalmol Vis Sci. 1992; 33:1004. 234:47-52. 10. Gillespie PG, BeavoJA. Characterization of a bovine 27. Chodosh LA, Baldwin AS, Carthew RW, Sharp PA. cone photoreceptor phosphodiesterase purified by cy- Human CCAAT-binding proteins have heterologous clic GMP-sepharose chromatography. / Biol Chem. subunits. Cell. 1988;53:ll-24. 1988;263:8133-8141. 28. Wells DE. Compilation analysis of histones and his- 11. Fong S-L, Morris TA, Lee C-H, Donoso LA, Fong W- tone genes. Nucl Acids Res. 1986;14:rll9-rl49. B. Transfection of retinoblastoma cells: Localization 29. Dynlacht BD, Hoey T, Tjian R. Isolation of coactivators of cis-acting elements for interstitial retinoid-binding associated with the TATA-binding protein that medi- protein gene. Meth. Neurosci. 1993; 15:322-330. ate transcriptional activation. Cell. 1991;66:563-576. 12. Fong SL. Characterization of the human rod trans- 30. Sen R, Baltimore D. Multiple nuclear factors interact ducin alpha-subunit gene. Nucl Acids Res. 1992; with the immunoglobulin enhancer sequences. Cell. 20:2865-2870. 1986; 46:705-716. 13. Morris TA, Fong SL. Characterization of the gene en- 31. Fong SL, Fong WB, Morris TA, Kedzie KM, Bridges coding human cone transducin alpha-subunit CD. Characterization and comparative structural fea- (GNAT2). Genomics. 1993; 17:442-448. tures of the gene for human interstitial retinol-bind- 14. Sanger F, Nicklen S, Coulson AR. DNA sequencing ing protein. JBiol Chem. 1990;265:3648-3653. with chain-terminating inhibitors. Proc Natl Acad Sci 32. Zack DJ, Bennett J, Wang Y, et al. Unusual topography USA. 1977; 74:5463-5467. of bovine rhodopsin promoter-lacZ fusion gene ex- 15. Dale RM, McClure BA, Houchins JP. A rapid single- pression in transgenic mouse retinas. Neuron. stranded cloning strategy for producing a sequential 1991;6:187-199. series of overlapping clones for use in DNA sequenc- 33. Morabito MA, Yu X, Barnstable CJ. Characterization ing: Application to sequencing the corn mitochon- of developmentally regulated and retina-specific nu- drial 18 rDNA. Plasmid. 1985; 13:31-40. clear protein binding to a site in the upstream region 16. Henikoff S. Unidirectional digestion with exonuclease of the rat opsin gene. J Biol Chem. 1991; 266:9667- III creates targeted breakpoints for DNA sequencing. 9672. Gene. 1984; 28:351-359. 34. Yu X, Chung M, Morabito MA, Barnstable CJ. Shared 17. Gorman CM, Moffat LF, Howard BH. Recombinant ge- nuclear protein binding sites in the upstream region nomes which express chloramphenicol acetyltransferase of the rat opsin gene. Biochem Biophys Res Commun. in mammalian cells. Mol Cell Biol. 1982;2:1044-1051. 1993; 191:76-82. 18. Dignam JD, Lebovitz RM, Roeder RG. Accurate tran- 35. Ahmad I, Yu X, Barnstable CJ. A cis-acting element, scription initiation by RNA polymerase II in a soluble T alpha-1, in the upstream region of rod alpha-trans- extract from isolated mammalian nuclei. Nucl Acids ducin gene that binds a developmentally regulated Res. 1983; 11:1475-1489. retina-specific nuclear factor. J Neurochem. 1994; 19. Bradford MM. A rapid and sensitive method for the 62:396-399. quantitation of microgram quantities of protein utiliz- 36. Kikuchi T, Raju K, Breitman ML, Shinohara T. The ing the principle of protein-dye binding. Anal Biochem. proximal promoter of the mouse arrestin gene directs 1976; 72:248-254. gene expression in photoreceptor cells and contains 20. Dynan WS. Dnasel footprinting as an assay for mam- an evolutionarily conserved retinal factor-binding site. malian gene regulatory proteins. Genet Eng. 1987; Mol Cell Biol. 1993; 13:4400-4408. 9:75-87. 37. Liou GI, Geng L, al-Ubaidi MR, et al. Tissue-specific 21. Maxam AM, Gilbert W. A new method for sequencing expression in transgenic mice directed by the 5'- DNA. Proc Natl Acad Sci USA. 1977; 74:560-564. flanking sequences of the human gene encoding in- 22. Fujita T, Shibuya H, Hotta H, Yamanishi K, Taniguchi terphotoreceptor retinoid-binding protein. / Biol T. Interferon-beta gene regulation: Tandemly re- Chem. 1990; 265:8373-8376. peated sequences of a synthetic 6 bp oligomer func- 38. Liou GI, Matragoon S, Yang J, Geng L, Overbeek PA, tion as a virus-inducible enhancer. Cell. 1987;49:357- Ma DP. Retina-specific expression from the IRBP pro- 367. moter in transgenic mice is conferred by 212 bp of 23. Lee KAW, Green MR. A cellular transcription factor the 5'-flanking region. Biochem Biophys Res Commun. E4F1 interacts with an Ela-inducible enhancer and 1991;181:159-165. mediates constitutive enhancer function in vitro. 39. Bobola N, Hirsch E, Albini A, Altruda F, Noonan D, EMBOJ. 1987;6:1345-1353. Ravazzolo R. A single cis-acting element in a short 24. Lee KA, Masson N. Transcriptional regulation by promoter segment of the gene encoding the interpho- CREB and its relatives. Biochim Biophys Ada. 1993; toreceptor retinoid-binding protein confers tissue-spe- 1174:221-233. cific expression. J Biol Chem. 1995;270:1289-1294. 25. Lin Y-S, Green MR. Interaction of a common cellular 40. Di Polo A, Rickman CB, Farber DB. Isolation and transcription factor, ATF, with regulatory elements in initial characterization of the 5' flanking region of the both El a- and cyclic AMP-inducible promoters. Proc human and murine cyclic guanosine monophosphate- Natl Acad Sci USA. 1988;85:3396-3400. phosphodiesterase /?-subunit genes. Invest Ophthalmol 26. Briggs MR, Kadonaga JT, Bell SP, Tjian R. Purification Vis Sci. 1996; 37:551-560. and biochemical characterization of the promoter- 41. Ts'o MOM, Zimmerman LE, Fine BS. The nature of Downloaded from iovs.arvojournals.org on 09/26/2021 206 Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1 retinoblastoma: I: Photoreceptor differentiation: A nucleosomes and regulatory factors in transcription. clinical and histopathologic study. Am J Ophthalol. Trends Biochem Sci. 1993; 18:90-95. 1970; 69:339-349. 45. Kornberg RD, Lorch Y. Chromatin structure and tran- 42. Bogenmann E, Lochrie MA, Simon MI. Cone cell- scription. Annu Rev Cell Biol. 1992;8:563-587. specific genes expressed in retinoblastoma. Science. 46. Kuhl D, de la Fuente J, Chaturvedi M, et al. Reversible 1988; 240:76-78. silencing of enhances by sequences derived from the 43. Di Polo A, Farber DB. Rod photoreceptor-specific human IFN-alpha promoter. Cell. 1987;50:1057-1069. gene expression in human retinoblastoma cells. Proc 47. Breathnach R, Chambon P. Organization and expres- NatlAcadSci USA. 1995;92:4016-4020. sion of eucaryotic split genes coding for proteins. 44. Workman JL, Buchman AR. Multiple functions of Annu Rev Biochem. 1981;50:349-383. Announcements Post-doctoral Fellowship: Retina Notice of Intent The Retina Panel of the American Academy of Oph- The Fondation Paulette Darty (an affiliate of Fonda- thalmology's Preferred Practice Patterns (PPPs) Com- tion de France) for Research in A.M.D. is expanding mittee is planning to revise its PPPs on Diabetic Retinop- its research in the following areas: athy, Precursors of Rhegmatogenous Retinal Detachment, and Age-Related Macular Degeneration. PPPs identify cellular and molecular biology of the retina, with characteristics and components of quality eye care and an emphasis on angiogenic growth factor inhibi- are based on the best available evidence-based scien- tors and their receptors; tific data. In addition, the Academy's Committee on Oph- liposome delivery and pharmacology of molecules thalmic Procedures Assessment is planning to develop related to angiogenesis; assessments on Corneal Topography, Excimer Laser in situ bioengineering of laser technology. Keratomileusis (LASIK), Excimer Laser/Photorefractive Ker- atectomy (PRK), Indocyanine Green Angiography (IGC), Op- tic Nerve Head Analysis, and Skin Resurfacing with Laser. Candidates must have a PhD, a background in re- Assessments evaluate new and existing ophthalmic search, and consistent publications in the relevant procedures, tests, and devices for their safety and clini- area. Applications for a fellowship starting in January cal effectiveness and are based on the best available or April 1997 for a 1-year period will be accepted until evidence and scientific data. March 30, 1997. The scholarship amount ranges from Assessments and PPPs are developed and revised $20,000 to $40,000 per year. by Panels usually comprised of subspecialty ophthal- Successful candidates will be attached to the IN- mologists and a methodologist, and are reviewed by SERM, Unit 450, Developpement, vieillissement et Pa- and receive input from the Academy's Education thologie de la Retine (INSERM; National French Insti- Committees, practicing general ophthalmologists, the tute for Research in Medicine), in Paris, France. Board of Trustees, and legal counsel, as well as sub- Applicants should send curriculum vitae, state- specialty societies. ment of research interest, representative publications, If you are interested in bringing to the Academy's and three letters of reference to: attention pertinent, scientifically sound, and evidence- based reports, references, and articles (other than Gabriel Coscas, MD, Professor and Chairman those readily available in the scientific literature) for Eye University Clinic of Creteil these PPPs or assessments, please forward this infor- mation to Becky Anderson in the Quality and Clinical Hospital of Creteil 40 Care Department of the American Academy of Oph- Avenue de Verdun thalmology, 655 Beach Street, San Francisco, CA 94010 Creteil, France 94109. The Academy requests the receipt of any infor- Tel: (33) 1 45 17 52 25 mation by Friday, February 28, 1997, for timely consider- Fax: (33) 1 45 17 52 27 ation. Downloaded from iovs.arvojournals.org on 09/26/2021