DOCSLIB.ORG

Identification of Potential Target Genes for the Neuron-Restrictive Silencer Factor CHRISTOPHER J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Potential Target Genes for the Neuron-Restrictive Silencer Factor CHRISTOPHER J Proc. Natl. Acad. Sci. USA Vol. 93, pp. 9881-9886, September 1996 Neurobiology Identification of potential target genes for the neuron-restrictive silencer factor CHRISTOPHER J. SCHOENHERR*t, ALICE J. PAQUETTE*, AND DAVID J. ANDERSON*0§ *Division of Biology 216-76 and tHoward Hughes Medical Institute, California Institute of Technology, Pasadena, CA 91125 Communicated by Melvin I. Simon, California Institute of Technology, Pasadena, CA, June 6, 1996 (received for review March 13, 1996) ABSTRACT The neuron-restrictive silencer factor to most positive regulators of neuronal genes, NRSF activity, (NRSF) represses transcription of several neuronal genes in protein, and mRNA are not present in the majority ofneuronal nonneuronal cells by binding to a 21-bp element called the cells but are instead found in most nonneuronal cell types (18, neuron-restrictive silencer element (NRSE). We have per- 19, 21, 22). Thus, NRSF appears to prevent expression of formed data base searches with a composite NRSE to identify certain neuronal genes in nonneuronal cells. In addition, additional candidate NRSF target genes. Twenty-two more NRSF mRNA is expressed in undifferentiated neural precur- genes, 17 of which are expressed mainly in neurons, were sors (21, 22), suggesting that it may prevent precocious ex- found to contain NRSE-like sequences. Many ofthese putative pression of the neuronal phenotype during neurogenesis. NRSEs bound NRSF in vitro and repressed transcription in A further understanding of NRSF function would be aided vivo. Most of the neuronal genes identified contribute to the by the identification of additional target genes. In this report, basic structural or functional properties of neurons. However, we provide evidence that there are many neuronal genes that two neuronal transcription factor genes contain NRSEs, contain NRSE-like sequences and that these sequences are suggesting that NRSF may repress neuronal differentiation likely to act as NRSF-mediated silencer elements. Further- both directly and indirectly. Functional NRSEs were also more, these genes are involved in a wide range of neuronal found in several nonneuronal genes, implying that NRSF may functions and include two transcription factors that may be play a broader role than originally anticipated. positive regulators of neuronal differentiation. Potential NRSEs are also found in some nonneuronal genes, suggesting Transcriptional regulation of gene expression is an important that NRSF may regulate nonneuronal as well as neuronal mechanism in the development of neurons. Genes encoding genes. transcriptional regulatory proteins have been revealed by many of the mutations affecting neuronal development in MATERIALS AND METHODS organisms such as Drosophila and Caenorhabditis elegans (1, 2). Overexpression oftranscription factors inXenopus oocytes and DNA Data Base Searching. A composite NRSE was derived targeted mutagenesis oftranscription factor genes in mice have from the NRSE sequences in the rat SCG10, rat type II sodium also shown the importance of transcriptional regulation during channel, human synapsin I, and rat BDNF genes, all of which vertebrate neuronal determination and differentiation (3-7). have been shown to bind NRSF (22). A single nucleotide was In parallel to these genetic studies, molecular analyses have assigned to a given position if it occurred in at least three of identified transcription factors common to subsets of neurons these four NRSE sequences, and more variable positions were that may be important for establishing and maintaining a assigned an N. This sequence (TTCAGCACCNCGGA- particular neuronal phenotype (8-12). CAGNGCC) was used to search the GenBank DNA sequence To understand the biological role of a transcription factor, data base using the FASTA search program (23). The param- it is important to determine the complement of genes it eters used were: word size, 1 and 3; gap penalty, 12.0; and gap regulates. For example, in pituitary cells, Pit-1 is essential for extension penalty, 4.0. Sequences in GenBank are divided proper pituitary development and is known to activate its own into four different sections (rodents, primates, other mam- gene as well as other pituitary-specific genes, such as prolactin mals, and other vertebrates), and each of these sections was (8, 13). Similarly, a target for mec-3 and unc-86, two proteins searched separately. The top 300 sequences were retrieved necessary for neurogenesis in C. elegans, is the mec-3 gene from each search. Alignments were not considered further if itself (1, 14) as well as the mec-7 tubulin gene (15). For the they contained gaps or two mismatches at the adjacent G most part, however, target genes for other transcriptional residues known to be necessary for NRSF binding (18). regulators implicated in neural development have not yet Sequences were also removed from consideration if they been identified. were located in genes of unknown expression pattern or While most transcription factors thought to be involved in function (such as sequence tagged sites or pseudogenes). In neurogenesis act positively, the importance of negative regu- determining the number of distinct genes identified, homol- lation in this process is becoming increasingly clear (16, 17). ogous genes from different species were counted as one. One of the first negative-acting transcriptional regulators to be Similarly, members of closely related multigene families, implicated in vertebrate neuronal development is the neuron- such as olfactory receptors and cytochrome P450s, were restrictive silencer factor (NRSF; also known as REST). NRSF counted as single genes, even if several members contained was originally defined as a silencer-binding protein for the potential NRSEs. neuron-specific gene, SCGlO (18). NRSF also negatively reg- Electrophoretic Mobility-Shift Assays (EMSAs) and Tran- ulates the type II sodium channel and synapsin I genes (19, 20). sient Transfections. EMSAs were performed using native NRSF is a zinc-finger transcription factor (21, 22) that binds to a conserved element known as the neuron-restrictive silencer Abbreviations: NRSF, neuron-restrictive silencer factor; NRSE, neu- element (NRSE) or repressor element-1 (18, 19). In contrast ron-restrictive silencer element; EMSA, electrophoretic mobility-shift assay. tPresent address: Department of Molecular Biology, Princeton Uni- The publication costs of this article were defrayed in part by page charge versity, Princeton, NJ 08544. payment. This article must therefore be hereby marked "advertisement" in §To whom reprint requests should be addressed. e-mail: andersond@ accordance with 18 U.S.C. §1734 solely to indicate this fact. starbasel.caltech.edu. 9881 9882 Neurobiology: Schoenherr et al. Proc. Natl. Acad. Sci. USA 93 (1996) NRSF and in vitro-translated, truncated human NRSF (AHi) RESULTS in the essentially as described (18, 22), except that, experiments Potential NRSF Target Genes. A search of the GenBank shown, Klenow-labeled, double-stranded oligonucleotides DNA sequence data base using a 21-bp composite NRSE (see were used as probes. Oligonucleotides were inserted into the Materials and Methods) revealed a large set of genes containing Hindlll site of the SCG1O promoter reporter construct, CAT3 sequences with substantial similarity to the composite. This set (26). Cell culture, transient transfections of 1OT1/2 cells, and included 25 distinct genes containing presumptive NRSEs with chloramphenicol acetyltransferase assays were performed as two or fewer mismatches to the test sequence. As expected, the described (18, 22). three original genes with functionally defined NRSEs (SCG10, NRSE Oligonucleotides. Oligonucleotides were generated type II sodium channel, and synapsin I; refs. 18-20) were from the NRSE-like sequences listed in Table 1. In addition to among them. To assess the specificity of this data base search, the core NRSE-like sequence, the oligos contained an addi- control searches were performed with five randomly shuffled tional 5 bp from the endogenous gene on either side and versions of the composite NRSE, as well as the composite HindlIl-compatible ends to facilitate subcloning. Precise se- NRSE entered backwards. Only two genes with three or fewer quences are available on request. mismatches from their respective test sequences were identi- Table 1. Genes with NRSE-like sequences Binding Silencing Gene Sequence comparison activity* activity* Locationt Consensust TTCAGCACCACGGACAGCGCC Neuronal genes Rat SCG1O --------------G--T--- + + 5'-Reg Rat type II sodium channel§ -----A------------A-- + 5'-Reg Human synapsin§ ---------G-------T--- + ± 5'-Reg Rat BDNF§ ---------TT------A--- + Intron Rat NMDA rec. 1 ---------T--------AT- + + 5'-UTR Human nicotinic ACh rec. f325 + + 5'-UTR Chicken ,B4-tubulin ---------G----------- ± + Intron Chicken middle neurofilament ________-----------T-- ± 5'-Reg Human glycine rec. --------------G----T- + + 5'-UTR Rat glycine rec. ---------T-A------T-- + 5'-UTR Rat synaptophysin -C-------GT------A--- + + Intron Human L1l ----------G--------AA + Intron Rat atrial natriuretic peptide -----------------ACG- + 3'-UTR Mouse calbindinl AG-------G----------- + 5'-UTR Rat GABA-A rec. 8 subunit ---------GA----G---GA + Intron Rat nicotinic ACh rec. a7 AG----G-G-G----C- --A-- - 5'-UTR Mouse P-Lim ---------G----------- 5'-UTR Mouse Hes-3 GG------------------- Coding Human CRF ---------G----------- Intron Human olfactory rec. G--------CA---------- Coding Mouse synaptotagmin IV ---------T-------A--A 5'-UTR Mouse
Load more

Recommended publications
  • Involvement of REST Corepressor 3 in Prognosis of Human Hepatitis B
    Acta Pharmacologica Sinica (2011) 32: 1019–1024 npg © 2011 CPS and SIMM All rights reserved 1671-4083/11 $32.00 www.nature.com/aps Original Article Involvement of REST corepressor 3 in prognosis of human hepatitis B Ji-hua XUE, Min ZHENG, Xiao-wei XU, Shan-shan WU, Zhi CHEN, Feng CHEN* State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, the First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China Aim: To examine the potential correlation between serum REST corepressor 3 (RCOR3) level and the outcome of patients with hepa-­­ titis B. Methods: Concanavalin A (ConA)-induced mouse hepatitis model was used. The mRNA level of RCOR3 in mouse liver was measured using GeneChip array and real-time PCR. One hundred seventy-seven patients with hepatitis B and 34 healthy individuals were catego- rized into six groups including mild chronic hepatitis, moderate chronic hepatitis B, severe hepatitis B (SHB), cirrhosis, hepatocellular carcinoma (HCC) and healthy control. Serum levels of human RCOR3 were measured using ELISA. Results: In the mouse hepatitis model, the mRNA level of RCOR3 in liver was reduced early after exposure to ConA, then increased after 6 h of exposure. There was no significant difference in the serum RCOR3 level between the mild chronic hepatitis B and the con- trol groups. The serum RCOR3 level was significantly increased in the moderate chronic hepatitis B group, but significantly reduced in SHB, cirrhosis and HCC groups, as compared with the control group. Moreover, the serum RCOR3 levels in SHB, cirrhosis and liver cancer patients were significantly lower than those in the patients with moderate chronic hepatitis B and with mild chronic hepatitis B.
    [Show full text]
  • Silencer Elements Controlling the B29 (Ig␤) Promoter Are Neither Promoter- Nor Cell-Type-Specific
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 12314–12319, November 1997 Biochemistry Silencer elements controlling the B29 (Igb) promoter are neither promoter- nor cell-type-specific CINDY SUE MALONE*, SIDNE A. OMORI*†, AND RANDOLPH WALL*‡ *Molecular Biology Institute and Department of Microbiology and Immunology, University of California, Los Angeles, School of Medicine, Los Angeles, CA 90095 Communicated by David S. Eisenberg, University of California, Los Angeles, CA, July 11, 1997 (received for review May 9, 1997) ABSTRACT The murine B29 (Igb) promoter is B cell combinatorial activities of this cassette of different transcrip- specific and contains essential SP1, ETS, OCT, and Ikaros tion factors (11, 20). motifs. Flanking 5* DNA sequences inhibit B29 promoter The current study focuses on the B29 regulatory region 59 of activity, suggesting this region contains silencer elements. the murine minimal B29 promoter. Deletion analyses of the Two adjacent 5* DNA segments repress transcription by the B29 gene 59 flanking region revealed two adjacent regions with murine B29 promoter in a position- and orientation- significantly lower transcriptional activity than the minimal independent manner, analogous to known silencers. Both promoter, suggesting the presence of silencer elements. Si- these 5* segments also inhibit transcription by several heter- lencers are functionally defined cis-acting regulatory DNA ologous promoters in B cells, including mb-1, c-fos, and human elements that down-regulate gene transcription. They gener- B29. These 5* segments also inhibit transcription by the c-fos ally exhibit activity in either orientation, may be either posi- promoter in T cells suggesting they are not B cell-specific tion-dependent or -independent, and may or may not affect elements.
    [Show full text]
  • Robijn Bruinsma
    Opportunities for Theory in Biological Physics. 1) Chromosome Control. 2) The Polyglutamine Problem. 3) Transcription Initiation Complex. 4) Ribosomal Proofreading. 5) Focal Adhesion Sites. *DNA/DNA interaction: Aqueous electrostatics beyond mean-field theory. (Oosawa) *DNA/nucleosome interaction: electrostatic attraction versus bending stiffness. (Manning) *Micromechanics (M.Wang) Nucleus: 23 chromosomes (1m DNA in micron-sized nucleus) Gene regulation by compaction. “Chromosome painting”: 3D-FISH Statics: 3-D Reconstruction of Nucleus. DNA-DNA mean spacing: 30-40 Angstrom. Close-packing is close (Cremer) Expanded Chromosome Condensed Loop (active genes) inactive genes Decondensed, active genes Inter-chromatin Compartment Active gene: on surface. Late replicating gene Nucleus is fully accessible to protein transport. 3-D Fish: Chromosome Dynamics (20 minute intervals) Chromosomal “Diffusion” Chromosomal Volume and Surface Area vs time. Statics: How is the “open” architecture of the nucleus maintained and controlled under the osmotic pressure of de-condensed, active DNA sections. Equation of State of DNA bundles is known. Dynamics: Chromosome dynamics driven by DNA condensation/de-conden- sation events triggered by local gene expression:”gene noise”. *Can we deduce temporal and spatial correlation functions for gene noise from the motion of the chromosomes by fluctuation analysis and relate it to gene activity? *Chromosome “micro-rheology”? The Polyglutamine Problem Nine neuro-degenerative diseases are associated with (CAG)N triplet repeats: Huntingdon’s, spinal dystrophy, ataxia …. CAG is the code for the amino-acid glutamine. C. Elegans worm GFP (CAG)N N=19 Homogeneous N=82: Toxic Aggregates Impaired motility Proteosome action N=82 (x 40) inhibited. Aggregates: N > 35-40 In vitro polyglutamine homopolymer aggregation (N=37) Aggregation Kinetics (Wetzel): Chen, Songming et al.
    [Show full text]
  • UNIT 6 from DNA to Protein: Gene Expression PART 2 Hillis Textbook
    UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of all, There is a difference between regulation in a prokaryote and a eukaryote…. OPERONS - PROKARYOTES Prokaryotes conserve energy by making proteins only when needed. The most efficient gene regulation is at the level of transcription. A gene cluster with a single promoter is an operon. An operator is a short stretch of DNA near the promoter that controls transcription of the structural genes. 1. Inducible operon—turned off unless needed In inducible systems—a metabolic substrate (inducer) interacts with a regulatory protein (repressor); the repressor cannot bind and allows transcription. Usually control CATABOLIC REACTIONS 2. Repressible operon—turned on unless not needed In repressible systems—a metabolic product (co-repressor) binds to regulatory protein, which then binds to the operator and blocks transcription. Usually control ANABOLIC REACTIONS. LAC OPERON - INDUCIBLE A compound that induces protein synthesis is an inducer. When the enzymes are induced, metabolism will take place. LAC OPERON – INDUCIBLE E. coli must adapt quickly to supply of food (lactose is a dissacharide example) Uptake and metabolism of lactose involves three important -galactoside enzymes -galactoside is a type of glycosidic bond between monosaccharides… if this is present, LACTOSE is present. If E. coli is grown with glucose but no lactose present, no enzymes for lactose conversion are produced. If lactose is predominant and glucose is low, E. coli synthesizes all three enzymes. If lactose is removed, synthesis stops.
    [Show full text]
  • The Neuron-Restrictive Silencer Element: a Dual Enhancer͞silencer Crucial for Patterned Expression of a Nicotinic Receptor Gene in the Brain
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 5906–5911, May 1997 Neurobiology The neuron-restrictive silencer element: A dual enhancerysilencer crucial for patterned expression of a nicotinic receptor gene in the brain ALAIN BESSIS*, NICOLAS CHAMPTIAUX,LAURENT CHATELIN, AND JEAN-PIERRE CHANGEUX† Neurobiologie Mole´culaire,UA CNRS D1284, De´partementdes Biotechnologies, Institut Pasteur 25y28 rue du Dr Roux, 75724 Paris Cedex 15 Contributed by Jean-Pierre Changeux, March 24, 1997 ABSTRACT The neuron-restrictive silencer element transcriptional repressing activity on promoters that carry the (NRSE) has been identified in several neuronal genes and NRSE sequence (15, 21, 23). confers neuron specificity by silencing transcription in non- In this work, we have analyzed the function of NRSE in the neuronal cells. NRSE is present in the promoter of the promoter of the mouse gene encoding the nAChR b2-subunit neuronal nicotinic acetylcholine receptor b2-subunit gene as well as the importance of its location within the promoter. that determines its neuron-specific expression in the nervous In transgenic mice, we show that upon mutation of NRSE, the system. Using transgenic mice, we show that NRSE may either pattern of expression of the b2-subunit gene promoter dra- silence or enhance transcription depending on the cellular matically changes but remains restricted to the nervous system. context within the nervous system. In vitro in neuronal cells, We confirm that NRSE in vitro can behave either as an NRSE activates transcription of synthetic promoters when enhancer or as a silencer depending both on the primary located downstream in the 5* untranslated region, or at less structure of the promoter and the type of cell line.
    [Show full text]
  • Transcription in Archaea
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 8545–8550, July 1999 Evolution Transcription in Archaea NIKOS C. KYRPIDES* AND CHRISTOS A. OUZOUNIS†‡ *Department of Microbiology, University of Illinois at Urbana-Champaign, B103 Chemistry and Life Sciences, MC 110, 407 South Goodwin Avenue, Urbana, IL 61801; and †Computational Genomics Group, Research Programme, The European Bioinformatics Institute, European Molecular Biology Laboratory, Cambridge Outstation, Wellcome Trust Genome Campus, Cambridge CB10 1SD, United Kingdom Edited by Norman R. Pace, University of California, Berkeley, CA, and approved May 11, 1999 (received for review December 21, 1998) ABSTRACT Using the sequences of all the known transcrip- enzyme was found to have a complexity similar to that of the tion-associated proteins from Bacteria and Eucarya (a total of Eucarya (consisting of up to 15 components) (17). Subsequently, 4,147), we have identified their homologous counterparts in the the sequence similarity between the large (universal) subunits of four complete archaeal genomes. Through extensive sequence archaeal and eukaryotic polymerases was demonstrated (18). comparisons, we establish the presence of 280 predicted tran- This discovery was followed by the first unambiguous identifica- scription factors or transcription-associated proteins in the four tion of transcription factor TFIIB in an archaeon, Pyrococcus archaeal genomes, of which 168 have homologs only in Bacteria, woesei (19). Since then, we have witnessed a growing body of 51 have homologs only in Eucarya, and the remaining 61 have evidence confirming the presence of key eukaryotic-type tran- homologs in both phylogenetic domains. Although bacterial and scription initiation factors in Archaea (5, 20). Therefore, the eukaryotic transcription have very few factors in common, each prevailing view has become that Archaea and Eucarya share a exclusively shares a significantly greater number with the Ar- transcription machinery that is very different from that of Bac- chaea, especially the Bacteria.
    [Show full text]
  • An Auxiliary Silencer and a Boundary Element Maintain High Levels of Silencing Proteins at HMR in Saccharomyces Cerevisiae
    Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.109.113100 An Auxiliary Silencer and a Boundary Element Maintain High Levels of Silencing Proteins at HMR in Saccharomyces cerevisiae Patrick J. Lynch and Laura N. Rusche1 Institute for Genome Sciences and Policy and Department of Biochemistry, Duke University, Durham, North Carolina, 27708 Manuscript received December 14, 2009 Accepted for publication February 19, 2010 ABSTRACT Heterochromatin is notable for its capacity to propagate along a chromosome. The prevailing model for this spreading process postulates that silencing proteins are first recruited to silencer sequences and then spread from these sites independently of the silencers. However, we found that in Saccharomyces cerevisiae silencers also influence the extent of silenced chromatin domains. We compared the abilities of two different silencers, HMR-E and a telomeric repeat, to promote silencing and found that the HMR-E silencer contributed to an increased steady-state association of Sir proteins over a region of several kilo- base pairs compared to the telomeric repeat, even though both silencers recruited similar levels of Sir proteins. We also discovered that, although the HMR-E silencer alone was sufficient to block transcription of the HMR locus, a secondary silencer, HMR-I, boosted the level of Sir proteins at HMR, apparently beyond the level necessary to repress transcription. Finally, we discovered that a tRNAThr gene near HMR-I helped maintain silenced chromatin and transcriptional repression under conditions of reduced deacetylase activity. This study highlights the importance of auxiliary elements, such as HMR-I and the tRNAThr gene, in enhancing the association of Sir silencing proteins with appropriate genomic locations, thereby buffering the capacity of silenced chromatin to assemble under suboptimal conditions.
    [Show full text]
  • Evolution of a Tissue-Specific Silencer Underlies Divergence in the Expression of Pax2 and Pax8 Paralogues
    ARTICLE Received 4 Oct 2011 | Accepted 18 Apr 2012 | Published 22 May 2012 DOI: 10.1038/ncomms1851 Evolution of a tissue-specific silencer underlies divergence in the expression of pax2 and pax8 paralogues Haruki Ochi1,2, Tomoko Tamai1, Hiroki Nagano1, Akane Kawaguchi1, Norihiro Sudou1,2 & Hajime Ogino1,2 Recent studies underscore a role for the differential degeneration of enhancers in the evolutionary diversification of paralogue expression. However, no one has reported evidence for the involvement of innovative cis-regulatory changes. Here we show that silencer innovation diversified expression of the vertebrate paralogues, pax2 and pax8. pax2 shows multi-tissue expression, as does the ancestral amphioxus orthologue, pax2/5/8, whereas pax8 expression localizes to a subset of pax2-expressing tissues. We reveal that both pax2 and pax8 retain ancestral enhancers capable of directing pax2-like, multi-tissue expression. However, a silencer within the pax8 proximal promoter suppresses pleiotropic enhancer activity outside the pax8- expressing tissues. In contrast, the combination of the pax2 proximal promoter with either the pax8 or pax2 enhancer recapitulates pax2-like expression, as in the amphioxus pax2/5/8 promoter. We propose that silencer innovation, rather than enhancer degeneration, was crucial for the divergent expression of paralogues with pleiotropic enhancers inherited from their common progenitor. 1 Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5, Takayama, Ikoma, 630-0192, Japan. 2 JST, CREST, Japan. Correspondence and requests for materials should be addressed to H. Ogino (email: [email protected]). NATURE COMMUNICATIONS | 3:848 | DOI: 10.1038/ncomms1851 | www.nature.com/naturecommunications © 2012 Macmillan Publishers Limited.
    [Show full text]
  • Mir-22 As a Metabolic Silencer and Liver Tumor Suppressor
    UC Davis UC Davis Previously Published Works Title MiR-22 as a metabolic silencer and liver tumor suppressor. Permalink https://escholarship.org/uc/item/6jn2b8z9 Journal Liver research, 4(2) ISSN 2096-2878 Authors Wang, Lijun Wang, Yu-Shiuan Mugiyanto, Eko et al. Publication Date 2020-06-09 DOI 10.1016/j.livres.2020.06.001 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Liver Research xxx (xxxx) xxx Contents lists available at ScienceDirect Liver Research journal homepage: http://www.keaipublishing.com/en/journals/liver-research Review Article MiR-22 as a metabolic silencer and liver tumor suppressor Lijun Wang a, b, Yu-Shiuan Wang c, Eko Mugiyanto c, Wei-Chiao Chang c, d, * Yu-Jui Yvonne Wan a, a Department of Pathology and Laboratory Medicine, University of California Davis, Sacramento, CA b The College of Life Science, Yangtze University, Jingzhou, Hubei c PhD Program in Clinical Drug Development of Chinese Herbal Medicine, College of Pharmacy, Taipei Medical University, Taipei d Department of Clinical Pharmacy, School of Pharmacy, Taipei Medical University, Taipei article info abstract Article history: With obesity rate consistently increasing, a strong relationship between obesity and fatty liver disease Received 1 April 2020 has been discovered. More than 90% of bariatric surgery patients also have non-alcoholic fatty liver Received in revised form diseases (NAFLDs). NAFLD and non-alcoholic steatohepatitis (NASH), which are the hepatic manifesta- 21 May 2020 tions of metabolic syndrome, can lead to liver carcinogenesis. Unfortunately, there is no effective Accepted 1 June 2020 medicine that can be used to treat NASH or liver cancer.
    [Show full text]
  • Short-Range Repression Permits Multiple Enhancers to Function Autonomously Within a Complex Promoter
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Short-range repression permits multiple enhancers to function autonomously within a complex promoter Susan Gray, Paul Szymanski, and Michael Levine Department of Biology, Center for Molecular Genetics, University of California at San Diego, La Jolla, California 92093-0322 USA Transcriptional repressors play a key role in establishing localized patterns of gene expression in the early Drosophila embryo. Several different modes of repression have been implicated in previous studies, including competition and direct interference with the transcription complex. Here, we present evidence for "quenching," whereby activators and repressors co-occupy neighboring sites in a target promoter, but the repressor blocks the ability of the activator to contact the transcription complex. This study centers on a zinc finger repressor, snail (sna), which represses the expression of neuroectodermal regulatory genes in the presumptive mesoderm. We show that sna can mediate efficient repression when bound 50-100 bp from upstream activator sites. Repression does not depend on proximity of sna-binding sites to the transcription initiation site. sna is not a dedicated repressor but, instead, appears to block disparate activators. We discuss the importance of quenching as a means of permitting separate enhancers to function autonomously within a complex promoter. [Key Words: Transcriptional repressors; gene expression; Drosophila embryo; quenching; enhancers; complex promoter] Received May 16, 1994; revised version accepted June 15, 1994. Transcriptional repression is essential for the establish- to "silencing" (Ip et al. 1991; Huang et al. 1993; Jiang et ment of localized patterns of gene expression in the al.
    [Show full text]
  • From Sequence to Information
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 22 November 2019 doi:10.20944/preprints201911.0252.v1 From Sequence to Information 1 1 1;2 Ovidiu Popa , Ellen Oldenburg and Oliver Ebenh¨oh 1 Institute of Quantitative and Theoretical Biology, Heinrich-Heine University Dusseldorf¨ 2 Cluster of Excellence on Plant Sciences, CEPLAS Abstract: Today massive amounts of sequenced metagenomic and transcriptomic data from different ecological niches and environmental locations are available. Scientific progress depends critically on methods that allow extracting useful information from the various types of sequence data. Here, we will first discuss types of information contained in the various flavours of biological sequence data, and how this information can be interpreted to increase our scientific knowledge and understanding. We argue that a mechanistic understanding is required to consistently interpret experimental observations, and that this understanding is greatly facilitated by the generation and analysis of dynamic mathematical models. We conclude that, in order to construct mathematical models and to test mechanistic hypotheses, time-series data is of critical importance. We review diverse techniques to analyse time-series data and discuss various approaches by which time-series of biological sequence data was successfully used to de-rive and test mechanistic hypotheses. Analysing the bottlenecks of current strategies in the extraction of knowledge and understanding from data, we conclude that combined experimental and theoretical efforts should be implemented as early as possible during the planning phase of individual experiments and scientific research projects. Keywords: data; sequence; information; entropy; genome; gene; proteins; time-series; modeling; meta-genomics; transcriptomics; proteomics; bioinformatics; DNA 1 Introduction When discussing the process of generating useful information from sequences, it is helpful to agree on some basic definitions.
    [Show full text]
  • Transcriptional Activators and Activation Mechanisms
    Protein Cell 2011, 2(11): 879–888 Protein & Cell DOI 10.1007/s13238-011-1101-7 REVIEW Transcriptional activators and activation mechanisms ✉ Jun Ma Division of Biomedical Informatics, Division of Developmental Biology, Cincinnati Children's Research Foundation, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA ✉ Correspondence: [email protected] Received July 11, 2011 Accepted August 22, 2011 ABSTRACT and in which direction. RNAP itself does not have the ability to recognize specific DNA sequences including the promoter Transcriptional activators are required to turn on the sequences. Instead, a group of proteins, called general expression of genes in a eukaryotic cell. Activators transcription factors (GTFs), help RNAP to find promoter bound to the enhancer can facilitate either the recruit- sequences (Orphanides et al., 1996; Hampsey, 1998; ment of RNA polymerase II to the promoter or its Nechaev and Adelman, 2011). One of these GTFs is the elongation. This article examines a few selected issues TATA-box binding protein (TBP), which directly binds to the in understanding activator functions and activation TATA sequence of the promoter. The protein complex mechanisms. assembled at the promoter is often referred to as the preinitiation complex or transcription machinery (or appara- KEYWORDS activator, transcription, co-activator, tus). This complex contains GTFs and RNAP. It also contains enhancer, promoter, signal transduction, development co-factors and chromatin modifying/remodeling factors that are part of the RNAP holoenzyme. Many of these additional INTRODUCTION factors play important roles in mediating transcription regula- tion by responding to regulatory proteins (Naar et al., 2001; Transcription is the process of copying (transcribing) the Narlikar et al., 2002; Levine and Tjian, 2003; Malik and information from one strand of DNA into RNA by the enzyme Roeder, 2000, 2010; Weake and Workman, 2010).
    [Show full text]