Proc. Natl. Acad. Sci. USA Vol. 93, pp. 9881-9886, September 1996 Neurobiology Identification of potential target genes for the neuron-restrictive silencer factor CHRISTOPHER J. SCHOENHERR*t, ALICE J. PAQUETTE*, AND DAVID J. ANDERSON*0§ *Division of Biology 216-76 and tHoward Hughes Medical Institute, California Institute of Technology, Pasadena, CA 91125 Communicated by Melvin I. Simon, California Institute of Technology, Pasadena, CA, June 6, 1996 (received for review March 13, 1996) ABSTRACT The neuron-restrictive silencer factor to most positive regulators of neuronal genes, NRSF activity, (NRSF) represses transcription of several neuronal genes in protein, and mRNA are not present in the majority ofneuronal nonneuronal cells by binding to a 21-bp element called the cells but are instead found in most nonneuronal cell types (18, neuron-restrictive silencer element (NRSE). We have per- 19, 21, 22). Thus, NRSF appears to prevent expression of formed data base searches with a composite NRSE to identify certain neuronal genes in nonneuronal cells. In addition, additional candidate NRSF target genes. Twenty-two more NRSF mRNA is expressed in undifferentiated neural precur- genes, 17 of which are expressed mainly in neurons, were sors (21, 22), suggesting that it may prevent precocious ex- found to contain NRSE-like sequences. Many ofthese putative pression of the neuronal phenotype during neurogenesis. NRSEs bound NRSF in vitro and repressed transcription in A further understanding of NRSF function would be aided vivo. Most of the neuronal genes identified contribute to the by the identification of additional target genes. In this report, basic structural or functional properties of neurons. However, we provide evidence that there are many neuronal genes that two neuronal transcription factor genes contain NRSEs, contain NRSE-like sequences and that these sequences are suggesting that NRSF may repress neuronal differentiation likely to act as NRSF-mediated silencer elements. Further- both directly and indirectly. Functional NRSEs were also more, these genes are involved in a wide range of neuronal found in several nonneuronal genes, implying that NRSF may functions and include two transcription factors that may be play a broader role than originally anticipated. positive regulators of neuronal differentiation. Potential NRSEs are also found in some nonneuronal genes, suggesting Transcriptional regulation of gene expression is an important that NRSF may regulate nonneuronal as well as neuronal mechanism in the development of neurons. Genes encoding genes. transcriptional regulatory proteins have been revealed by many of the mutations affecting neuronal development in MATERIALS AND METHODS organisms such as Drosophila and Caenorhabditis elegans (1, 2). Overexpression oftranscription factors inXenopus oocytes and DNA Data Base Searching. A composite NRSE was derived targeted mutagenesis oftranscription factor genes in mice have from the NRSE sequences in the rat SCG10, rat type II sodium also shown the importance of transcriptional regulation during channel, human synapsin I, and rat BDNF genes, all of which vertebrate neuronal determination and differentiation (3-7). have been shown to bind NRSF (22). A single nucleotide was In parallel to these genetic studies, molecular analyses have assigned to a given position if it occurred in at least three of identified transcription factors common to subsets of neurons these four NRSE sequences, and more variable positions were that may be important for establishing and maintaining a assigned an N. This sequence (TTCAGCACCNCGGA- particular neuronal phenotype (8-12). CAGNGCC) was used to search the GenBank DNA sequence To understand the biological role of a transcription factor, data base using the FASTA search program (23). The param- it is important to determine the complement of genes it eters used were: word size, 1 and 3; gap penalty, 12.0; and gap regulates. For example, in pituitary cells, Pit-1 is essential for extension penalty, 4.0. Sequences in GenBank are divided proper pituitary development and is known to activate its own into four different sections (rodents, primates, other mam- gene as well as other pituitary-specific genes, such as prolactin mals, and other vertebrates), and each of these sections was (8, 13). Similarly, a target for mec-3 and unc-86, two proteins searched separately. The top 300 sequences were retrieved necessary for neurogenesis in C. elegans, is the mec-3 gene from each search. Alignments were not considered further if itself (1, 14) as well as the mec-7 tubulin gene (15). For the they contained gaps or two mismatches at the adjacent G most part, however, target genes for other transcriptional residues known to be necessary for NRSF binding (18). regulators implicated in neural development have not yet Sequences were also removed from consideration if they been identified. were located in genes of unknown expression pattern or While most transcription factors thought to be involved in function (such as sequence tagged sites or pseudogenes). In neurogenesis act positively, the importance of negative regu- determining the number of distinct genes identified, homol- lation in this process is becoming increasingly clear (16, 17). ogous genes from different species were counted as one. One of the first negative-acting transcriptional regulators to be Similarly, members of closely related multigene families, implicated in vertebrate neuronal development is the neuron- such as olfactory receptors and cytochrome P450s, were restrictive silencer factor (NRSF; also known as REST). NRSF counted as single genes, even if several members contained was originally defined as a silencer-binding protein for the potential NRSEs. neuron-specific gene, SCGlO (18). NRSF also negatively reg- Electrophoretic Mobility-Shift Assays (EMSAs) and Tran- ulates the type II sodium channel and synapsin I genes (19, 20). sient Transfections. EMSAs were performed using native NRSF is a zinc-finger transcription factor (21, 22) that binds to a conserved element known as the neuron-restrictive silencer Abbreviations: NRSF, neuron-restrictive silencer factor; NRSE, neu- element (NRSE) or repressor element-1 (18, 19). In contrast ron-restrictive silencer element; EMSA, electrophoretic mobility-shift assay. tPresent address: Department of Molecular Biology, Princeton Uni- The publication costs of this article were defrayed in part by page charge versity, Princeton, NJ 08544. payment. This article must therefore be hereby marked "advertisement" in §To whom reprint requests should be addressed. e-mail: andersond@ accordance with 18 U.S.C. §1734 solely to indicate this fact. starbasel.caltech.edu. 9881 9882 Neurobiology: Schoenherr et al. Proc. Natl. Acad. Sci. USA 93 (1996) NRSF and in vitro-translated, truncated human NRSF (AHi) RESULTS in the essentially as described (18, 22), except that, experiments Potential NRSF Target Genes. A search of the GenBank shown, Klenow-labeled, double-stranded oligonucleotides DNA sequence data base using a 21-bp composite NRSE (see were used as probes. Oligonucleotides were inserted into the Materials and Methods) revealed a large set of genes containing Hindlll site of the SCG1O promoter reporter construct, CAT3 sequences with substantial similarity to the composite. This set (26). Cell culture, transient transfections of 1OT1/2 cells, and included 25 distinct genes containing presumptive NRSEs with chloramphenicol acetyltransferase assays were performed as two or fewer mismatches to the test sequence. As expected, the described (18, 22). three original genes with functionally defined NRSEs (SCG10, NRSE Oligonucleotides. Oligonucleotides were generated type II sodium channel, and synapsin I; refs. 18-20) were from the NRSE-like sequences listed in Table 1. In addition to among them. To assess the specificity of this data base search, the core NRSE-like sequence, the oligos contained an addi- control searches were performed with five randomly shuffled tional 5 bp from the endogenous gene on either side and versions of the composite NRSE, as well as the composite HindlIl-compatible ends to facilitate subcloning. Precise se- NRSE entered backwards. Only two genes with three or fewer quences are available on request. mismatches from their respective test sequences were identi- Table 1. Genes with NRSE-like sequences Binding Silencing Gene Sequence comparison activity* activity* Locationt Consensust TTCAGCACCACGGACAGCGCC Neuronal genes Rat SCG1O --------------G--T--- + + 5'-Reg Rat type II sodium channel§ -----A------------A-- + 5'-Reg Human synapsin§ ---------G-------T--- + ± 5'-Reg Rat BDNF§ ---------TT------A--- + Intron Rat NMDA rec. 1 ---------T--------AT- + + 5'-UTR Human nicotinic ACh rec. f325 + + 5'-UTR Chicken ,B4-tubulin ---------G----------- ± + Intron Chicken middle neurofilament ________-----------T-- ± 5'-Reg Human glycine rec. --------------G----T- + + 5'-UTR Rat glycine rec. ---------T-A------T-- + 5'-UTR Rat synaptophysin -C-------GT------A--- + + Intron Human L1l ----------G--------AA + Intron Rat atrial natriuretic peptide -----------------ACG- + 3'-UTR Mouse calbindinl AG-------G----------- + 5'-UTR Rat GABA-A rec. 8 subunit ---------GA----G---GA + Intron Rat nicotinic ACh rec. a7 AG----G-G-G----C- --A-- - 5'-UTR Mouse P-Lim ---------G----------- 5'-UTR Mouse Hes-3 GG------------------- Coding Human CRF ---------G----------- Intron Human olfactory rec. G--------CA---------- Coding Mouse synaptotagmin IV ---------T-------A--A 5'-UTR Mouse