fmicb-07-01947 December 1, 2016 Time: 17:16 # 1

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Frontiers - Publisher Connector

ORIGINAL RESEARCH published: 05 December 2016 doi: 10.3389/fmicb.2016.01947

Correlation of rpoB Mutations with Minimal Inhibitory Concentration of Rifampin and Rifabutin in Mycobacterium tuberculosis in an HIV/AIDS Endemic Setting, South Africa

Ivy Rukasha1*, Halima M. Said1,2, Shaheed V. Omar2, Hendrik Koornhof2,3, Andries W. Dreyer2,3, Alfred Musekiwa4, Harry Moultrie5, Anwar A. Hoosen1, Gilla Kaplan6, Dorothy Fallows7 and Nazir Ismail2,8

1 Department of Medical Microbiology, Faculty of Health Sciences, University of the Free State, Bloemfontein, South Africa, Edited by: 2 Centre for Tuberculosis, National Institute for Communicable Diseases, Sandringham, South Africa, 3 Department of Miguel Cacho Teixeira, Medical Microbiology, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa, 4 Centre for University of Lisbon, Portugal Evidence-based Health Care, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa, 5 Medical Research Council, Respiratory and Meningeal Pathogens Research Unit, School of Pathology, University of the Reviewed by: Witwatersrand, Johannesburg, South Africa, 6 The Bill and Melinda Gates Foundation, Seattle, WA, USA, 7 Public Health Sarah-Jane Haig, Research Institute, New Jersey Medical School, The State University of New Jersey, Rutgers University, Newark, NJ, USA, University of Michigan, USA 8 Department of Medical Microbiology, Faculty of Health Sciences, University of Pretoria, Pretoria, South Africa Pramod Kumar, National Centre for Disease Control, India Treatment of tuberculosis (TB) and HIV co-infections is often complicated by drug- *Correspondence: to-drug interactions between anti-mycobacterial and anti-retroviral agents. Rifabutin Ivy Rukasha [email protected]; (RFB) is an alternative to rifampin (RIF) for TB regimens and is recommended for HIV [email protected] patients concurrently receiving protease inhibitors because of reduced induction of CYP3A4. This study sought to determine the proportion of RFB susceptible isolates Specialty section: This article was submitted to among RIF-resistant strains in a high HIV prevalence setting in South Africa. In Antimicrobials, Resistance addition, the study explored the association between rpoB mutations and minimum and Chemotherapy, a section of the journal inhibitory concentrations (MIC) of RIF and RFB. A total of 189 multidrug resistant (MDR) Frontiers in Microbiology Mycobacterium tuberculosis isolates from the Centre for Tuberculosis repository were Received: 21 August 2016 analyzed. The MICs were determined using a MYCOTB Sensititre plate method and the Accepted: 21 November 2016 rpoB gene was sequenced. Of the 189 MDR isolates, 138 (73%) showed resistance Published: 05 December 2016 to both RIF and RFB, while 51 (27%) isolates were resistant to RIF but retained Citation: Rukasha I, Said HM, Omar SV, susceptibility to RFB. The S531L was the most frequent rpoB point mutation in 105/189 Koornhof H, Dreyer AW, (56%) isolates, followed by H526Y in 27/189 (14%) isolates. Resistance to both RIF Musekiwa A, Moultrie H, Hoosen AA, Kaplan G, Fallows D and Ismail N and RFB was found predominantly in association with mutations S531L (91/105, 87%), (2016) Correlation of rpoB Mutations H526Y (20/27, 74%), and H526D (15/19, 79%), while D516V (15/17, 88%), and L533P with Minimal Inhibitory Concentration (3/4, 75%) were found in RIF-resistant, RFB-susceptible isolates. This study has shown of Rifampin and Rifabutin in Mycobacterium tuberculosis in an that up to 27% of MDR-TB patients in South Africa may benefit from a treatment regimen HIV/AIDS Endemic Setting, that includes RFB. South Africa. Front. Microbiol. 7:1947. Keywords: Mycobacterium tuberculosis, rpoB, rifampicin, rifabutin, minimum inhibitory concentration, HIV/AIDS, doi: 10.3389/fmicb.2016.01947 South Africa, point mutation

Frontiers in Microbiology | www.frontiersin.org 1 December 2016 | Volume 7 | Article 1947 fmicb-07-01947 December 1, 2016 Time: 17:16 # 2

Rukasha et al. Rifampin and Rifabutin MIC for M. tuberculosis

INTRODUCTION concentrations (MIC) of RIF and RFB among clinical MDR-TB isolates. Tuberculosis (TB) is responsible for 25% of HIV/AIDS related mortality worldwide, with sub-Saharan Africa accounting for 79% of HIV-associated TB cases (WHO, 2015). In South Africa, MATERIALS AND METHODS 65% of TB patients are HIV-positive, and TB remains the leading cause of death among HIV-infected individuals. Treatment of TB Clinical Isolates and Ethics in the context of HIV co-infection is challenging, due to the high A total of 211 MDR-TB isolates available from the Centre for potential for drug-drug interactions in combined antimicrobial Tuberculosis (CTB) repository were included. These isolates were and anti-retroviral (ARV) chemotherapy. There is an urgent collected over the first 6 months of 2010 at the National Health need to harmonize TB and HIV treatment through development Laboratory Services (NHLS) Central TB diagnostics laboratory in of compatible ARV regimens. Moreover, multidrug-resistant Braamfontein, Johannesburg from confirmed MDR-TB cases and (MDR) TB, defined by resistance to rifampin (RIF) and isoniazid submitted for analysis to the CTB, as described (Said et al., 2016). (INH), is emerging, particularly within high burden countries, Ethics approval for this study was obtained from the Research such as South Africa (WHO, 2015). MDR-TB is associated with Ethics Committee of the Faculty of Health Sciences, University of poor treatment outcomes and greatly elevated health costs. the Free State (Ref: 230408-011). Due to its sterilizing capacity, the inclusion of RIF in TB treatment regimens is crucial for achievement of high cure rates Minimal Inhibitory Concentration coupled with low relapse rates (CDC, 2013). However, RIF is a Determination of M. tuberculosis Isolates potent inducer of CYP3A4 and other cytochrome P450 enzymes, Minimum inhibitory concentrations were determined using leading to reduced serum levels of protease inhibitors, used in a commercially available Sensititre MYCOTB plate (TREK treatment of HIV/AIDS (CDC, 2013). Rifabutin (RFB) is an Diagnostics, Cleveland, OH, USA), following the manufacturer’s alternative rifamycin, which has less impact on CYP3A4 activity instructions. The MIC test range for both RIF and RFB was from and improved pharmacokinetics compared to RIF (Regazzi et al., 0.12 to 16 mg/L. Resistance and sensitivity to RIF were defined 2014). Although the activity of RFB is comparable to that of as MIC > 1 and MIC ≤ 1 mg/L, respectively, and to RFB as RIF for treatment of drug-susceptible TB, current guidelines MIC > 0.5 and MIC ≤ 0.5 mg/L, respectively, based on laboratory recommend limited use of RFB only in drug-susceptible adult standards (CLSI, 2011). TB patients with HIV/AIDS or adults experiencing intolerance to RIF. Widespread use of RFB has also been limited by its cost and absence from most commercial susceptibility testing systems DNA Extraction, PCR, and Sanger (Horne et al., 2011). However, RFB costs have been lowered by its Sequencing addition to the WHO Essential Medicines List, while the recently All isolates were grown on Löwenstein–Jensen agar; genomic validated MYCOTB Sensititre plate method includes RFB in its DNA was extracted using the phenol-chloroform (CTAB) drug panel (Lee et al., 2014). method (van Embden et al., 1993). Six primer sets were used Resistance to both RIF and RFB is largely associated with for PCR amplification of the entire rpoB gene (Table 1). The mutations in an 81-bp RIF resistance determining region (RRDR) PCR amplification protocol consisted of a 5 min denaturation ◦ ◦ ◦ within the rpoB gene of Mycobacterium tuberculosis (Jamieson step at 95 C, followed by 35 cycles of 30 s at 95 C, 30 s at 62 C ◦ ◦ et al., 2014). Although high-level cross-resistance between the and 50 s at 72 C and a final extension step at 72 C for 2 min. two rifamycins is reported, some studies have shown RFB Following Sanger sequencing of amplicons, mutations in rpoB susceptibility in RIF-resistant strains of M. tuberculosis in were identified by alignment to H37Rv reference strain (NCBI association with specific rpoB mutations (Cavusoglu et al., 2004; Accession number AL123456; Cole, 2002) using ClustalW2 (Li Yoshida et al., 2010; Jamieson et al., 2014; ElMaraachli et al., et al., 2015). 2015). Thus, it has been argued that knowing the type of rpoB mutation may have clinical implications for guiding rifamycin- Statistical Analysis based therapeutic regimens (Sirgel et al., 2013; Berrada et al., Kruskal–Wallis tests were used to determine whether mutations 2016). were associated with differences in RIF and RFB MICs. A Dunn Studies from low HIV settings have reported that 13–26% test incorporating the Benjamini–Hochberg false discovery rate of MDR-TB isolates show sensitivity to RFB (Chen et al., correction was performed to identify pairwise differences in RFB 2012; Jo et al., 2013; Schon et al., 2013). However, there is MICs. limited information on the frequency of RFB susceptibility among MDR-TB isolates in an HIV endemic region. This study aimed to determine the proportion of MDR strains RESULTS with RFB susceptibility in Gauteng Province, South Africa. Gauteng is the economic hub of South Africa, with a Of the 211 MDR isolates in the collection, MIC and sequencing large migrant workforce, where 73% of TB patients are co- data were available for 189 (90%). The remaining 22 (10%) infected with HIV. In addition, we examined correlations isolates were excluded from analysis due to RIF resistance not between specific rpoB mutations and the minimum inhibitory confirmed on MIC testing, contamination, or loss of viability.

Frontiers in Microbiology| www.frontiersin.org 2 December 2016| Volume 7| Article 1947 fmicb-07-01947 December 1, 2016 Time: 17:16 # 3

Rukasha et al. Rifampin and Rifabutin MIC for M. tuberculosis

TABLE 1 | rpoB primers used to amplify RRDR region.

Primer set Forward primers (50-30) Reverse primers (50-30) Amplicon size (nt)

rpoB-RRDR GGGAGCGGATGACCACCCA GCGGTACGGCGTTTCGATGAAC 350 rpoB-2 ATGACGTACGCGGCTCCACTGTTCG GGTGGTCATCCGCTCCCGGACCAC 840 rpoB-3 CGCGGCGAACGGGCCCGTGGGCA CGGGATCACCTTGACGCTGTGCAG 675 rpoB-4 CTGTCGGTGTACGCGCGGGTCAA GGGACCGTCGGCGATCACCTGACC 621 rpoB-5 CCACGGCACTTGCGCCAACCAG CATCCGTCGCGGCACGCCGTGGGT 742 rpoB-6 CCGGTTGAGGACATGCCGTTC TCCCTTTCCCCTAACGGGTTTAGT 879

Among the 189 MDR isolates analyzed, S531L was the M. tuberculosis retained sensitivity to RFB. This is in agreement most frequently observed rpoB RRDR mutation, found in with previous studies conducted in countries with relatively 105/189 (56%) isolates, followed by H526Y in 27 (14%), low HIV prevalence, including Turkey, Canada, Bangladesh, H526D in 19 (10%), D516V in 17 (9%), L533P in four and Taiwan, where RFB susceptibility was found in 13–28% (2%), and D516G_L533P in three (2%) isolates (Table 2). Of of RIF-resistant clinical isolates (Cavusoglu et al., 2004; van the 189 isolates, 138 (73%) showed resistance to both RIF Ingen et al., 2011; Jamieson et al., 2014; Heysell et al., 2015). and RFB, while 51 (27%) were RIF-resistant but exhibited Moreover, the strong association, we observed between levels of RFB susceptibility. Resistance to both RIF and RFB was resistance to RIF and RFB is consistent with other published predominantly associated with S531L (91/105, 87%), H526Y reports (Sirgel et al., 2013; Jamieson et al., 2014). In our (20/27, 74%), and H526D (15/19, 79%) mutations. Rifabutin MDR isolate collection, the mutations S531L, H526Y, and susceptibility was most commonly observed for isolates carrying H526D were primarily associated with resistance to both drugs, D516V (15/17, 88%) and L533P (3/4, 75%), although two of while D516V and L533P mutations were mainly associated three isolates with the double mutation D516G_L533P were with RFB-susceptible isolates. Similar MICs for both RIF and moderately resistant to RFB. Nine (5%) RIF-resistant isolates RFB have been reported for these mutations present among had no mutations in the RRDR. However, three of the nine clinical M. tuberculosis isolates from Turkey, the Netherlands, had a mutation outside the RRDR. Two of these (V276L and and South Africa (Cavusoglu et al., 2004; van Ingen et al., V276F) were RFB susceptible, while one (V252E) was RFB- 2011; Sirgel et al., 2013). In our study, RFB MICs for D516V resistant; the remaining six had no mutations in rpoB outside the isolates were significantly lower than those associated with RRDR. the most common RRDR mutations (S531L and D526Y) and The Kruskal–Wallis test showed significant association were consistent with RFB MICs reported elsewhere for this between mutations and MICs for both RIF and RFB (Kruskal– mutation (Cavusoglu et al., 2004; Jamieson et al., 2014). Wallis statistic for RIF: H = 67.699, p = 0.0001; for RFB: Moreover, no significant differences were found between RFB H = 42.988, p = 0.0003). Dunn’s pairwise comparison with MICs of isolates with D516V or L533P mutations and those Benjamini–Hochberg false discovery rate correction showed that with wild type rpoB sequences. Interestingly, a double mutation RFB MICs in D516V and L533P isolates were not significantly at positions D516V-L533P was found in isolates with lower different from wild type (q = 0.1317), nor from each other levels of RFB resistance. The treatment option may need to (q = 0.4118), although the numbers were small (WT n = 9; be investigated since increased RIFB concentration are not L533P n = 4; D516V n = 17). The RFB MICs for H526D currently recommended due to possible toxicity issues (Sirgel H526Y and S531L were not significantly different from each et al., 2013). other. However, there were significant differences between RFB All of the rpoB mutations identified in our study collection MICs in D516V isolates and those in H526D, H526Y, and have been previously described and are reported in the TB S531L (all q < 0.0001). Among isolates with the most common Drug Resistance Mutation Database (Sandgren et al., 2009). RRDR mutations, there was a significantly lower median MIC Moreover, the mutations that, we found most frequently were for RFB compared to RIF, with at least a threefold lower similar to those reported from other surveys of M. tuberculosis median MIC for S531L, H526Y, and H526D; and 5- and 7-fold clinical isolates. The S531L mutation is most often associated lower medians for D516V and L533P, respectively (Figure 1). with RIF-resistance, ranging from 62 to 35% of clinical Additionally, higher levels of resistance to RIF correlated with isolates surveyed (Cavusoglu et al., 2004; Campbell et al., higher resistance to RFB (Spearman’s correlation coefficient 2011; Jamieson et al., 2014). Nonetheless, some variations r = 0.4511, p < 0.000001). in the relative proportions of specific rpoB mutations have been noted in different populations. For example, while we only found single representatives of S531R and S531W, DISCUSSION these mutations were found to comprise up to 10% of clinical isolates in studies conducted in the United States This study sought to determine the potential usefulness of and Turkey (Cavusoglu et al., 2004; Campbell et al., 2011). RFB for MDR-TB patients in a high HIV prevalence setting. It is notable that all of the most common rpoB mutations In our study population, 27% of MDR clinical isolates of seen in clinical isolates occur spontaneously in in vitro

Frontiers in Microbiology| www.frontiersin.org 3 December 2016| Volume 7| Article 1947 fmicb-07-01947 December 1, 2016 Time: 17:16 # 4

Rukasha et al. Rifampin and Rifabutin MIC for M. tuberculosis

TABLE 2 | Mutations in rpoB RRDR and MICs of RIF and RFB for all MDR isolates.

Mutation Sequence change Total number of isolates Number of RFB-S (% total) MIC (ug/ml) Number of Median MIC isolates

RIF RFB RIF RFB

S531L TCG > TTG 105 14 (13) 16 16 4 16 2 16 8 5 4 8 1 16 4 21 16 2 31 8 2 1 16 1 28 16 0.5 10 16 0.25 2 8 0.12 1 4 0.5 1 H526Y CAG > TAC 27 7 (26) 16 16 5 16 2 16 8 2 16 4 3 16 2 6 16 1 4 16 0.5 5 16 0.25 2 H526D CAC > GAC 19 4 (21) 16 16 2 16 2 16 8 4 16 4 2 16 2 5 16 1 2 16 0.5 4 D516V GAC > GTC 17 15 (88) 16 4 1 4 0.12 16 1 1 16 0.25 1 8 0.25 1 2 0.25 1 16 0.12 1 8 0.12 3 4 0.12 5 2 0.12 3 L533P CTG > CCC 4 3 (75) 16 1 1 16 0.31 16 0.5 1 16 0.12 2 D516G_L533P GAC_CTG > GGC_CCC 3 1 (33) 16 4 1 16 1 16 1 1 16 0.5 1 S531Q TCG > CAG 1 0 16 2 1 H526P CAC > CCC 1 0 16 4 1 H526R CAC > CGC 1 0 16 4 1 H526L CAC > CTC 1 1 4 0.12 1 Ins F at 514 Ins-3 bp TTC 1 1 8 0.5 1 WT∗ 9 5 (56) 16 4 1 16 0.5 16 1 3 16 0.5 1 16 0.25 2 4 0.25 1 4 0.12 1 Total 189

∗WT, wild type – no mutations in rpoB RRDR.

Frontiers in Microbiology| www.frontiersin.org 4 December 2016| Volume 7| Article 1947 fmicb-07-01947 December 1, 2016 Time: 17:16 # 5

Rukasha et al. Rifampin and Rifabutin MIC for M. tuberculosis

FIGURE 1 | Comparison of RIF and RIFB MIC ranges and medians by rpoB mutations. A kruskal-Wallis test was used to show the association of MIC levels of RIF and RIFB with the rpoB mutations. The eclplot was constructed with Stata 14.

selected RIF-resistant strains of M. tuberculosis, indicating a low HIV-TB prevalence setting have both suggested that the that the evolution of resistance is significantly constrained by current breakpoint of 0.5 mg/L may be in need of revision structural requirements of the RNA polymerase (Morlock et al., (Schon et al., 2013; Crabol et al., 2016). In addition, as our 2000). study was focused on MDR-TB, our population of clinical isolates Current guidelines recommend RFB for treatment of TB did not include any RIF-susceptible strains. Finally, as clinical patients with HIV co-infection or poor tolerance to RIF, only data and patient demographics were not available for this study, after safety and efficacy of the drug has been demonstrated we were not able to determine the HIV status of individual (Nettles et al., 2004; Li et al., 2005; Horne et al., 2011). cases. However, despite the known sterilizing properties of rifamycins, The study identified three novel mutations outside of the no randomized controlled trials have investigated the use of RRDR (V276L, V252E, and V276F) in RIF-resistant isolates, RFB in treatment of MDR-TB. The results of our study show supporting inclusion of the 50-end of rpoB in molecular that a proportion of MDR-TB cases may potentially benefit testing for RIF/RFB resistance, as previously suggested (Tan from the inclusion of RFB in chemotherapeutic regimens. et al., 2012). Moreover, the wide range of MICs seen in Relevant clinical studies are needed to establish appropriate isolates with the same rpoB mutations suggests that other, as RFB-based regimens for achieving improved clinical outcome, yet unidentified, genes may be contributing to the observed particularly in HIV endemic regions. Our findings additionally resistance levels. The presence of other genes that can confer support an association between specific rpoB mutations and resistance to rifamycins is also supported by our finding that RFB susceptibility, which can have implications for expanding 5% of clinical MDR isolates in the collection contained a wild therapeutic options in MDR-TB. For example, while rpoB type rpoB gene, two of which showed low level resistance mutations would not provide definitive classification of RFB to RBT. This observation is consistent with other studies, susceptibility, molecular assays could be used as a basis for showing up to 5% of RIF-resistance in clinical isolates is not targeted susceptibility testing in MDR-TB patients. explained by mutations in rpoB (Ramaswamy and Musser, 1998; The limitations of our study include the use of CLSI Sandgren et al., 2009) and by a recent report identifying a recommended clinical breakpoints for susceptibility testing of phosphotransferase in M. tuberculosis capable of inactivating RFB (CLSI, 2011). However, a recent review and a study from RIF (Qi et al., 2016). The use of whole genome sequencing of

Frontiers in Microbiology| www.frontiersin.org 5 December 2016| Volume 7| Article 1947 fmicb-07-01947 December 1, 2016 Time: 17:16 # 6

Rukasha et al. Rifampin and Rifabutin MIC for M. tuberculosis

clinical isolates of M. tuberculosis would be helpful in expanding FUNDING our understanding molecular mechanisms of drug resistance. The research was funded by a grant from the NIH (ROI A180737) to GK which was transferred to DF. AUTHOR CONTRIBUTIONS

IR, DF, and HS performed the experiments analyzed results, ACKNOWLEDGMENT drafted the manuscript. AM and HM analyzed the data and edited the manuscript. GK, SO, HK, and AD edited and drafted The authors would like to thank the staff members of the manuscript. NI conceived the study, analyzed results, and the Centre for Tuberculosis, of the National Institute of drafted manuscript. All authors read and approved the final Communicable Diseases for their assistance during specimen manuscript. collection.

REFERENCES Li, J., Munsiff, S. S., Driver, C. R., and Sackoff, J. (2005). Relapse and acquired rifampin resistance in HIV-infected patients with tuberculosis treated with Berrada, Z. L., Lin, S. Y., Rodwell, T. C., Nguyen, D., Schecter, G. F., Pham, L., et al. rifampin- or rifabutin-based regimens in New York City, 1997–2000. Clin. (2016). Rifabutin and rifampin resistance levels and associated rpoB mutations Infect. Dis. 41, 83–91. doi: 10.1086/430377 in clinical isolates of Mycobacterium tuberculosis complex. Diagn. Microbiol. Li, W., Cowley, A., Uludag, M., Gur, T., McWilliam, H., Squizzato, S., et al. Infect. Dis. 85, 177–181. doi: 10.1016/j.diagmicrobio.2016.01.019 (2015). The EMBL-EBI bioinformatics web and programmatic tools framework. Campbell, P. J., Morlock, G. P., Sikes, R. D., Dalton, T. L., Metchock, B., Starks, Nucleic Acids Res. 43, W580–W584. doi: 10.1093/nar/gkv279 A. M., et al. (2011). Molecular detection of mutations associated with first- and Morlock, G. P., Plikaytis, B. B., and Crawford, J. T. (2000). Characterization second-line drug resistance compared with conventional drug susceptibility of spontaneous, In vitro-selected, rifampin-resistant mutants of testing of Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 55, 2032– Mycobacterium tuberculosis strain H37Rv. Antimicrob. Agents Chemother. 44, 2041. doi: 10.1128/AAC.01550-10 3298–3301. Cavusoglu, C., Karaca-Derici, Y., and Bilgic, A. (2004). In-vitro activity of rifabutin Nettles, R. E., Mazo, D., Alwood, K., Gachuhi, R., Maltas, G., Wendel, K., against rifampicin-resistant Mycobacterium tuberculosis isolates with known et al. (2004). Risk factors for relapse and acquired rifamycin resistance rpoB mutations. Clin. Microbiol. Infect. 10, 662–665. doi: 10.1111/j.1469-0691. after directly observed tuberculosis treatment: a comparison by HIV 2004.00917.x serostatus and rifamycin use. Clin. Infect. Dis. 38, 731–736. doi: 10.1086/38 CDC (2013). Managing Drug Interactions in the Treatment of HIV-Related 1675 Tuberculosis. Atlanta, GA: Centers for Disease Control and Prevention. Qi, X., Lin, W., Ma, M., Wang, C., He, Y., He, N., et al. (2016). Chen, H. Y., Yu, M. C., Huang, W. L., Wu, M. H., Chang, Y. L., Che, C. R., Structural basis of rifampin inactivation by rifampin phosphotransferase. et al. (2012). Molecular detection of rifabutin-susceptible Mycobacterium Proc. Natl. Acad. Sci. U.S.A. 113, 3803–3808. doi: 10.1073/pnas.152361 tuberculosis. J. Clin. Microbiol. 50, 2085–2088. doi: 10.1128/JCM.00652-12 4113 CLSI (2011). Susceptibility Testing of Mycobacteria, Nocardiae, and Other Ramaswamy, S., and Musser, J. M. (1998). Molecular genetic basis of antimicrobial Aerobic Actinomycetes. Approved Standard M24-A2. Wayne, PA: Clinical and agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber. Lung Dis. Laboratory Standards Institute. 79, 3–29. doi: 10.1054/tuld.1998.0002 Cole, S. T. (2002). Comparative and functional genomics of the Mycobacterium Regazzi, M., Carvalho, A. C., Villani, P., and Matteelli, A. (2014). tuberculosis complex. Microbiology 148(Pt 10), 2919–2928. doi: 10.1099/ Treatment optimization in patients co-infected with HIV and 00221287-148-10-2919 Mycobacterium tuberculosis infections: focus on drug-drug interactions Crabol, Y., Catherinot, E., Veziris, N., Jullien, V., and Lortholary, O. (2016). with rifamycins. Clin. Pharmacokinet. 53, 489–507. doi: 10.1007/s40262-014-0 Rifabutin: where do we stand in 2016? J. Antimicrob. Chemother. 71, 1759–1771. 144-3 doi: 10.1093/jac/dkw024 Said, H. M., Kushner, N., Omar, S. V., Dreyer, A. W., Koornhof, H., Erasmus, L., ElMaraachli, W., Slater, M., Berrada, Z. L., Lin, S. Y., Catanzaro, A., et al. (2016). A novel molecular strategy for surveillance of multidrug resistant Desmond, E., et al. (2015). Predicting differential rifamycin resistance in clinical tuberculosis in high burden settings. PLoS ONE 11:e0146106. doi: 10.1371/ Mycobacterium tuberculosis isolates by specific rpoB mutations. Int. J. Tuberc. journal.pone.0146106 Lung Dis. 19, 1222–1226. doi: 10.5588/ijtld.14.0936 Sandgren, A., Strong, M., Muthukrishnan, P., Weiner, B. K., Church, G. M., and Heysell, S. K., Ahmed, S., Ferdous, S. S., Khan, M. S., Rahman, S. M., Murray, M. B. (2009). Tuberculosis drug resistance mutation database. PLoS Gratz, J., et al. (2015). Quantitative drug-susceptibility in patients treated Med. 6:e2. doi: 10.1371/journal.pmed.1000002 for multidrug-resistant tuberculosis in Bangladesh: implications for Schon, T., Jureen, P., Chryssanthou, E., Giske, C. G., Kahlmeter, G., Hoffner, S., regimen choice. PLoS ONE 10:e0116795. doi: 10.1371/journal.pone.011 et al. (2013). Rifampicin-resistant and rifabutin-susceptible Mycobacterium 6795 tuberculosis strains: a breakpoint artefact? J. Antimicrob. Chemother. 68, 2074– Horne, D. J., Spitters, C., and Narita, M. (2011). Experience with rifabutin replacing 2077. doi: 10.1093/jac/dkt150 rifampin in the treatment of tuberculosis. Int. J. Tuberc. Lung Dis 15, 1485–1489. Sirgel, F. A., Warren, R. M., Bottger, E. C., Klopper, M., Victor, T. C., and van doi: 10.5588/ijtld.11.0068 Helden, P. D. (2013). The rationale for using rifabutin in the treatment of MDR Jamieson, F. B., Guthrie, J. L., Neemuchwala, A., Lastovetska, O., Melano, R. G., and XDR tuberculosis outbreaks. PLoS ONE 8:e59414. doi: 10.1371/journal. and Mehaffy, C. (2014). Profiling of rpoB mutations and MICs for rifampin pone.0059414 and rifabutin in Mycobacterium tuberculosis. J. Clin. Microbiol. 52, 2157–2162. Tan, Y., Hu, Z., Zhao, Y., Cai, X., Luo, C., Zou, C., et al. (2012). The beginning of the doi: 10.1128/JCM.00691-14 rpoB gene in addition to the rifampin resistance determination region might Jo, K. W., Ji, W., Hong, Y., Lee, S. D., Kim, W. S., Kim, D. S., et al. (2013). The be needed for identifying rifampin/rifabutin cross-resistance in multidrug- efficacy of rifabutin for rifabutin-susceptible, multidrug-resistant tuberculosis. resistant Mycobacterium tuberculosis isolates from Southern China. J. Clin. Respir. Med. 107, 292–297. doi: 10.1016/j.rmed.2012.10.021 Microbiol. 50, 81–85. doi: 10.1128/JCM.05092-11 Lee, J., Armstrong, D. T., Ssengooba, W., Park, J. A., Yu, Y., Mumbowa, F., et al. van Embden, J. D., Cave, M. D., Crawford, J. T., Dale, J. W., Eisenach, K. D., (2014). Sensititre MYCOTB MIC plate for testing Mycobacterium tuberculosis Gicquel, B., et al. (1993). Strain identification of Mycobacterium tuberculosis by susceptibility to first- and second-line drugs. Antimicrob. Agents Chemother. 58, DNA fingerprinting: recommendations for a standardized methodology. J. Clin. 11–18. doi: 10.1128/AAC.01209-13 Microbiol. 31, 406–409.

Frontiers in Microbiology| www.frontiersin.org 6 December 2016| Volume 7| Article 1947 fmicb-07-01947 December 1, 2016 Time: 17:16 # 7

Rukasha et al. Rifampin and Rifabutin MIC for M. tuberculosis

van Ingen, J., Aarnoutse, R., de Vries, G., Boeree, M. J., and van Soolingen, D. Conflict of Interest Statement: The authors declare that the research was (2011). Low-level rifampicin-resistant Mycobacterium tuberculosis strains raise conducted in the absence of any commercial or financial relationships that could a new therapeutic challenge. Int. J. Tuberc. Lung Dis. 15, 990–992. doi: 10.5588/ be construed as a potential conflict of interest. ijtld.10.0127 WHO (2015). Global Tuberculosis Report 2015. Geneva: World Health Copyright © 2016 Rukasha, Said, Omar, Koornhof, Dreyer, Musekiwa, Moultrie, Organisation. Hoosen, Kaplan, Fallows and Ismail. This is an open-access article distributed Yoshida, S., Suzuki, K., Iwamoto, T., Tsuyuguchi, K., Tomita, M., Okada, M., et al. under the terms of the Creative Commons Attribution License (CC BY). The use, (2010). Comparison of rifabutin susceptibility and rpoB mutations in multi- distribution or reproduction in other forums is permitted, provided the original drug-resistant Mycobacterium tuberculosis strains by DNA sequencing and the author(s) or licensor are credited and that the original publication in this journal line probe assay. J. Infect. Chemother. 16, 360–363. doi: 10.1007/s10156-010- is cited, in accordance with accepted academic practice. No use, distribution or 0057-5 reproduction is permitted which does not comply with these terms.

Frontiers in Microbiology| www.frontiersin.org 7 December 2016| Volume 7| Article 1947