Journal of Biomedicine and Biotechnology

Cytogenetics Cytogenetics Journal of Biomedicine and Biotechnology

Cytogenetics Copyright © 2011 Hindawi Publishing Corporation. All rights reserved.

This is a focus issue published in volume 2011 of “Journal of Biomedicine and Biotechnology.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board

The editorial board of the journal is organized into sections that correspond to the subject areas covered by the journal.

Agricultural Biotechnology

Guihua H. Bai, USA Hari B. Krishnan, USA B. C. Saha, USA Christopher P. Chanway, Canada Carol A. Mallory-Smith, USA Mariam B. Sticklen, USA Ravindra N. Chibbar, Canada Dennis P. Murr, Canada Chiu-Chung Young, Taiwan Ian Godwin, Australia Rodomiro Ortiz, Mexico

Animal Biotechnology

E. S. Chang, USA Thomas A. Hoagland, USA Lawrence Reynolds, USA Hans H. Cheng, USA Tosso Leeb, Switzerland Lawrence B. Schook, USA Bhanu P. Chowdhary, USA James D. Murray, USA Mari A. Smits, The Netherlands Noelle E. Cockett, USA Anita M. Oberbauer, USA Leon Spicer, USA Peter Dovc, Slovenia Jorge A. Piedrahita, USA J. Verstegen, USA Scott C. Fahrenkrug, USA Daniel Pomp, USA Matthew B. Wheeler, USA Dorian J. Garrick, USA Kent M. Reed, USA Kenneth L. White, USA

Biochemistry

Robert Blumenthal, USA Hicham Fenniri, Canada Richard D. Ludescher, USA David Ronald Brown, UK Nick V. Grishin, USA George Makhatadze, USA Saulius Butenas, USA J. Guy Guillemette, Canada Leonid Medved, USA Vittorio Calabrese, Italy Paul W. Huber, USA Susan A. Rotenberg, USA F. Castellino, USA Chen-Hsiung Hung, Taiwan Jason Shearer, USA Roberta Chiaraluce, Italy Michael Kalafatis, USA Andrei Surguchov, USA D. M. Clarke, Canada B. E. Kemp, Australia John B. Vincent, USA Francesca Cutruzzola,` Italy Phillip E. Klebba, USA Yujun George Zheng, USA Paul W. Doetsch, USA Wen-Hwa Lee, USA

Bioinformatics

T. Akutsu, Japan Stavros J. Hamodrakas, Greece Florencio Pazos, Spain Miguel A. Andrade, Germany Paul Harrison, USA Zhirong Sun, China Mark Y. Borodovsky, USA George Karypis, USA Ying Xu, USA Rita Casadio, Italy Jack A. Leunissen, The Netherlands A. Zelikovsky, USA Artem Cherkasov, Canada Guohui Lin, Canada Albert Zomaya, Australia David Corne, UK Satoru Miyano, Japan Sorin Draghici, USA Zoran Obradovic, USA Biophysics

Miguel Castanho, Portugal Ali A. Khraibi, Saudi Arabia S. B. Petersen, Denmark P. Bryant Chase, USA Rumiana Koynova, USA Peter Schuck, USA Kuo-Chen Chou, USA Serdar Kuyucak, Australia Claudio M. Soares, Portugal Rizwan Khan, India Jianjie Ma, USA

Cell Biology

Omar Benzakour, France Xudong Huang, USA Michael Sheetz, USA Sanford I. Bernstein, USA Anton M. Jetten, USA JamesL.Sherley,USA Phillip I. Bird, Australia Seamus J. Martin, Ireland G. S. Stein, USA Eric Bouhassira, USA Manuela Martins-Green, USA Richard Tucker, USA Mohamed Boutjdir, USA Shoichiro Ono, USA Thomas van Groen, USA Chung-Liang Chien, Taiwan George Perry, USA Andre Van Wijnen, USA Richard Gomer, USA M. Piacentini, Italy Steve Winder, UK Paul J. Higgins, USA George E. Plopper, USA Chuanyue Wu, USA Pavel Hozak, Czech Republic Lawrence Rothblum, USA Bin-Xian Zhang, USA

Genetics

Adewale Adeyinka, USA J. Spencer Johnston, USA Raj S. Ramesar, South Africa Claude Bagnis, France M. Ilyas Kamboh, USA Elliot D. Rosen, USA J. Birchler, USA Feige Kaplan, Canada Dharambir K. Sanghera, USA Susan Blanton, USA Manfred Kayser, The Netherlands Michael Schmid, Germany BarryJ.Byrne,USA Brynn Levy, USA Markus Schuelke, Germany R. Chakraborty, USA Xiao Jiang Li, USA Wolfgang Arthur Schulz, Germany Domenico Coviello, Italy Thomas Liehr, Germany Jorge Sequeiros, Portugal Sarah H. Elsea, USA JamesM.Mason,USA Mouldy Sioud, Norway Celina Janion, Poland Mohammed Rachidi, France Rongjia Zhou, China

Genomics

Vladimir Bajic, Saudi Arabia Vladimir Larionov, USA Yasushi Okazaki, Japan Margit Burmeister, USA Thomas Lufkin, Singapore Gopi K. Podila, USA Settara Chandrasekharappa, USA Joakim Lundeberg, Sweden Momiao Xiong, USA Yataro Daigo, Japan John L. McGregor, France J. Spencer Johnston, USA John V. Moran, USA Immunology

Hassan Alizadeh, USA James D. Gorham, USA Kanury V. S. Rao, India Peter Bretscher, Canada Silvia Gregori, Italy Yair Reisner, Israel Robert E. Cone, USA Thomas Griffith, USA HarryW.Schroeder,USA Terry L. Delovitch, Canada Young S. Hahn, USA Wilhelm Schwaeble, UK Anthony L. DeVico, USA DorothyE.Lewis,USA Nilabh Shastri, USA Nick Di Girolamo, Australia Bradley W. McIntyre, USA Yufang Shi, China Don Mark Estes, USA R. Mosley, USA Piet Stinissen, Belgium Soldano Ferrone, USA Marija Mostarica-Stojkovic,´ Serbia Hannes Stockinger, Austria Jeffrey A. Frelinger, USA Hans Konrad Muller, Australia J. W. Tervaert, The Netherlands John Robert Gordon, Canada Ali Ouaissi, France Graham R. Wallace, UK

Microbial Biotechnology

Jozef Anne,´ Belgium Peter Coloe, Australia Angela Sessitsch, Austria Yoav Bashan, Mexico Daniele Daffonchio, Italy Effie Tsakalidou, Greece Marco Bazzicalupo, Italy Han de Winde, The Netherlands J. Wiegel, USA Nico Boon, Belgium Yanhe Ma, China Luca Simone Cocolin, Italy Bernd H. A. Rehm, New Zealand

Microbiology

D. Beighton, UK Gad Frankel, UK Isabel Sa-Correia,´ Portugal Steven R. Blanke, USA Roy Gross, Germany P. L. C. Small, USA Stanley Brul, The Netherlands Hans-Peter Klenk, Germany Lori Snyder, UK IsaacK.O.Cann,USA Tanya Parish, UK Michael Thomm, Germany Peter Dimroth, Switzerland Gopi K. Podila, USA H. C. van der Mei, The Netherlands Stephen K. Farrand, USA Frederick D. Quinn, USA Schwan William, USA Alain Filloux, UK Didier A. Raoult, France

Molecular Biology

Rudi Beyaert, Belgium Noel F. Lowndes, Ireland Yeon-Kyun Shin, USA Michael Bustin, USA Wuyuan Lu, USA William S. Trimble, Canada Douglas Cyr, USA Patrick Matthias, Switzerland Lisa Wiesmuller, Germany K. Iatrou, Greece John L. McGregor, France Masamitsu Yamaguchi, Japan Lokesh Joshi, Ireland S. L. Mowbray, Sweden David W. Litchfield, Canada Elena Orlova, UK Oncology

Colin Cooper, UK Steve B. Jiang, USA P. J. Oefner, Germany F. M. J. Debruyne, The Netherlands Daehee Kang, Republic of Korea Allal Ouhtit, USA Nathan Ames Ellis, USA Abdul R. Khokhar, USA Frank Pajonk, USA Dominic Fan, USA Rakesh Kumar, USA Waldemar Priebe, USA Gary E. Gallick, USA Macus Tien Kuo, USA F. C. Schmitt, Portugal DailaS.Gridley,USA Eric W. Lam, UK Sonshin Takao, Japan Xin-yuan Guan, Hong Kong Sue-Hwa Lin, USA Ana Maria Tari, USA Anne Hamburger, USA Kapil Mehta, USA Henk G. Van Der Poel, The Netherlands Manoor Prakash Hande, Singapore Orhan Nalcioglu, USA Haodong Xu, USA Beric Henderson, Australia Vincent C. O. Njar, USA David J. Yang, USA

Pharmacology

Abdel A. Abdel-Rahman, USA Ayman El-Kadi, Canada Kennerly S. Patrick, USA M. Badr, USA Jeffrey Hughes, USA Vickram Ramkumar, USA Stelvio M. Bandiera, Canada Kazim Husain, USA Michael J. Spinella, USA Ronald E. Baynes, USA Farhad Kamali, UK Quadiri Timour, France R. Keith Campbell, USA Michael Kassiou, Australia Todd W. Vanderah, USA Hak-Kim Chan, Australia Joseph J. McArdle, USA Val J. Watts, USA Michael D. Coleman, UK Mark J. McKeage, New Zealand David J. Waxman, USA J. Descotes, France Daniel T. Monaghan, USA Dobromir Dobrev, Germany T. Narahashi, USA

Plant Biotechnology

P. L. Bhalla, Australia Liwen Jiang, Hong Kong Ralf Reski, Germany J. R. Botella, Australia Pulugurtha Bharadwaja Kirti, India Sudhir Kumar Sopory, India Elvira Gonzalez De Mejia, USA Yong Pyo Lim, Republic of Korea H. M. Haggman,¨ Finland Gopi K. Podila, USA

Toxicology

M. Aschner, USA Youmin James Kang, USA Kenneth Turteltaub, USA Michael L. Cunningham, USA M. Firoze Khan, USA Brad Upham, USA Laurence D. Fechter, USA Pascal Kintz, France Hartmut Jaeschke, USA R. S. Tjeerdema, USA Virology

Nafees Ahmad, USA Fred Kibenge, Canada Ralf Wagner, Germany Edouard Cantin, USA Fenyong Liu, USA Jianguo Wu, China Ellen Collisson, USA Eric´ Rassart, Canada Decheng Yang, Canada Kevin M. Coombs, Canada Gerald G. Schumann, Germany Jiing-Kuan Yee, USA Norbert K. Herzog, USA Y.-C. Sung, Republic of Korea Xueping Zhou, China Tom Hobman, Canada Gregory Tannock, Australia Wen-Quan Zou, USA Shahid Jameel, India Contents

Cytogenetic Instability in Childhood Acute Lymphoblastic Leukemia Survivors,Mar´ıa Sol Brassesco, Danilo Jordao˜ Xavier, Marjori Leiva Camparoto, Ana Paula Montaldi, Paulo Roberto D’Auria Vieira de Godoy, Carlos Alberto Scrideli, Luiz Gonzaga Tone, and Elza Tiemi Sakamoto-Hojo Volume 2011, Article ID 230481, 8 pages Sperm DNA Integrity and Meiotic Behavior Assessment in an Infertile Male Carrier of a 9qh+++ Polymorphism,A.Garc´ıa-Peiro,M.Oliver-Bonet,J.Navarro,C.Abad,M.Guitart,M.J.Amengual,´ and J. Benet Volume 2011, Article ID 730847, 8 pages Contributions of Cytogenetics and Molecular Cytogenetics to the Diagnosis of Adipocytic Tumors, Jun Nishio Volume 2011, Article ID 524067, 9 pages Enhancement of 2,3-Butanediol Production by Klebsiella oxytoca PTCC 1402,MaesomehAnvariand Mohammad Reza Safari Motlagh Volume 2011, Article ID 636170, 7 pages Cytogenetics of Premature Ovarian Failure: An Investigation on 269 Affected Women, Simona Baronchelli, Donatella Conconi, Elena Panzeri, Angela Bentivegna, Serena Redaelli, Sara Lissoni, Fabiana Saccheri, Nicoletta Villa, Francesca Crosti, Elena Sala, Emanuela Martinoli, Marinella Volonte,` Anna Marozzi, and Leda Dalpra` Volume 2011, Article ID 370195, 9 pages Genetics, Cytogenetics, and Epigenetics of Colorectal Cancer, Lucia Migliore, Francesca Migheli, Roberto Spisni, and Fabio Coppede` Volume 2011, Article ID 792362, 19 pages MYC, TP53, and Chromosome 17 Copy-Number Alterations in Multiple Gastric Cancer Cell Lines and in Their Parental Primary Tumors, Mariana Ferreira Leal, Danielle Queiroz Calcagno, Joana de Fatima´ Ferreira Borges da Costa, Tanielly Cristina Raiol Silva, Andre´ Salim Khayat, Elizabeth Suchi Chen, Paulo Pimentel Assumpc¸ao,˜ Mar´ılia de Arruda Cardoso Smith, and Rommel Rodr´ıguez Burbano Volume 2011, Article ID 631268, 8 pages Chromosomal Rearrangements in Post-Chernobyl Papillary Thyroid Carcinomas: Evaluation by Spectral Karyotyping and Automated Interphase FISH, Ludwig Hieber, Reinhard Huber, Verena Bauer, Quirin Scha¨ffner, Herbert Braselmann, Geraldine Thomas, Tatjana Bogdanova, and Horst Zitzelsberger Volume 2011, Article ID 693691, 7 pages Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses, Uedson Pereira Jacobina, Marcelo de Bello Cioffi, Luiz Gustavo Rodrigues Souza, Leonardo Luiz Calado, Manoel Tavares, Joao˜ Manzella Jr., Luiz Antonio Carlos Bertollo, and Wagner Franco Molina Volume 2011, Article ID 218231, 8 pages Acute Myeloid Leukemia with the t(8;21) Translocation: Clinical Consequences and Biological Implications,Hakon˚ Reikvam, Kimberley Joanne Hatfield, Astrid Olsnes Kittang, Randi Hovland, and Øystein Bruserud Volume 2011, Article ID 104631, 23 pages Employment of Oligodeoxynucleotide plus Interleukin-2 Improves Cytogenetic Analysis in Splenic Marginal Zone Lymphoma, Antonella Bardi, Francesco Cavazzini, Gian Matteo Rigolin, Elisa Tammiso, Eleonora Volta, Elisa Pezzolo, Luca Formigaro, Olga Sofritti, Giulia Daghia, Cristina Ambrosio, Lara Rizzotto, Awad E. Abass, Fiorella D’Auria, Pellegrino Musto, and Antonio Cuneo Volume 2011, Article ID 691493, 7 pages Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 230481, 8 pages doi:10.1155/2011/230481

Review Article Cytogenetic Instability in Childhood Acute Lymphoblastic Leukemia Survivors

Marıa´ Sol Brassesco,1, 2 Danilo Jordao˜ Xavier,2 Marjori Leiva Camparoto,2 Ana Paula Montaldi,2 Paulo Roberto D’Auria Vieira de Godoy,2 Carlos Alberto Scrideli,1 Luiz Gonzaga Tone,1 and Elza Tiemi Sakamoto-Hojo2, 3

1 Departamento de Puericultura e Pediatria, Faculdade de Medicina de Ribeirao˜ Preto, Universidade de Sao˜ Paulo, 14040-901 Sao˜ Paulo, Brazil 2 Departamento de Gen´etica, Faculdade de Medicina de Ribeirao˜ Preto, Universidade de Sao˜ Paulo, 14040-901 Sao˜ Paulo, Brazil 3 Departamento de Biologia, Faculdade de Filosofia Ciˆencias e Letras de Ribeirao˜ Preto (FFCLRP-USP), Universidade de Sao˜ Paulo, Avenida Bandeirantes 3900, 14040-901 Ribeirao˜ Preto, SP, Brazil

Correspondence should be addressed to Mar´ıa Sol Brassesco, [email protected] and Elza Tiemi Sakamoto-Hojo, [email protected]

Received 2 June 2010; Accepted 11 August 2010

Academic Editor: Hans Konrad Muller

Copyright © 2011 Mar´ıa Sol Brassesco et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Contemporary anticancer therapies have largely improved the outcome for children with cancer, especially for Acute Lymphoblastic Leukemia (ALL). Actually, between 78% and 85% of patients achieve complete remission and are alive after 5 years of therapy completion. However, as cure rates increase, new concerns about the late effects of genotoxic treatment emerge, being the risk of developing secondary neoplasias, the most serious life-threatening rising problem. In the present paper, we describe and review the cytogenetic findings in peripheral lymphocytes from ALL survivors, and discuss aspects associated to the occurrence of increased chromosome rearrangements in this growing cohort.

1. Introduction [6–8]. There is compelling evidence that specific exposure to radiation and chemotherapy are etiologic agents of Acute lymphoblastic leukemia (ALL) is the most common secondary neoplasia [9]. malignancy in childhood and is associated with excellent Chromosomal aberrations, sister chromatid exchanges outcomes [1]. Currently, 80% of children with ALL treated and micronuclei, which can be detected by cytogenetic anal- in modern centers are alive and disease-free at 5 years ysis, have been used as important biomarkers of genotoxic [2]. The major contributors to this long-term survival are exposure; moreover, the relevance of increased frequency the improvements in anticancer therapies. However, they of chromosome alterations as indicator of malignancy risk have implied the exposure of patients to combinations is supported by epidemiological studies suggesting that a of chemotherapy and, in some instances, preventive cra- high frequency of chromosomal aberrations is predictive of nial irradiation, which are well-recognized DNA-damaging an increased likelihood of cancer [10, 11]. The genotoxicity agents [3, 4]. Although most ALL survivors are at a lower of anticancer treatment has been evaluated by somatic cell risk of developing a late effect of therapy when compared mutation assays, immediately or shortly after completion with survivors of other pediatric cancers, these children are of therapy. However, second malignancies in children usu- almost four times more likely than their siblings to develop ally occur several years after treatment [12]. Thus, the a severe or life-threatening chronic medical condition [5]. cytogenetic analysis in peripheral lymphocytes from cancer Recently, the number of patients with second malignancies survivors, who have been exposed to chemotherapy, provides has increased among long-term survivors of pediatric ALL an opportunity to investigate the in vivo induction and 2 Journal of Biomedicine and Biotechnology persistence of genomic instability in humans, as well as to Table 1: Mean frequency of ETV6/RUNX1 translocations and extra evaluate the long-term effects of cancer therapy. signals obtained for ALL survivors, healthy individuals, and patients In general, hematological malignancies are characterized at the time of initial diagnosis [20]. by recurrent chromosomal aberrations that lead to the Translocations Extra Signals formation of gene fusions and the subsequent expression Groups of individuals n % % of chimeric proteins with unique properties [13]. Various (mean ± SD) (mean ± SD) gene fusions thought to be solely associated with leukemias ∗ ALL survivors 12 3.20 ± 1.19 0.76 ± 0.68 and lymphomas, such as t(12;21) ETV6/RUNX1, t(9;22) . ± . . ± . BCR/ABL, t(14;18) IGH/BCL2,t(2;5)NPM-ALK, and MLL Healthy individuals 12 1 02 0 40 0 44 0 43 duplications have been detected in normal individuals with ALL patients at diagnosis 8 0.57 ± 2.17 0.53 ± 1.71 negative history of hematologic disorders [14, 15]. These ∗Statistically different, P<.05. and other findings suggested that the measurement of gene fusions in peripheral blood lymphocytes within a study group may be used as a sensitive assay for the detection of Table 2: Translocation frequency for chromosome 12 obtained for genomic instability, and may contribute to risk estimation controls and childhood ALL survivors. Peripheral blood lympho- for the development of lymphoid malignancies [16, 17]. cyte samples were collected from the patients at variable periods During the last years, our group has investigated the after therapy conclusion. existence of chromosome instability in peripheral lym- Groups of individuals n Translocations % (mean ± SD) phocytes from ALL survivors by means of fluorescent in ∗ situ hybridization (FISH) and molecular biology using ALL survivors 16 3.58 ± 2.77 leukemia/lymphoma associated gene fusions as putative Healthy individuals 13 1.57 ± 1.65 markers. The proband group comprised 49 individuals aged ∗Statistically different, P<.05. 5to22years(average= 12), diagnosed and previously treated for childhood ALL at the University Hospital (Faculty of Medicine, Ribeirao˜ Preto, University of Sao˜ Paulo, Brazil) with combined modality treatment according to the Brazil- survivors (n = 12) presented significantly higher frequency ian Group of Pediatric Leukemia Treatment (GBTLI) [18]. In of ETV6/RUNX1 fusions (mean ± SD = 3.2 ± 1.19) than this protocol, children were treated with a polychemother- those obtained for the control group (n = 12) (mean ± apeutic regimen that includes vincristine, dexamethasone, SD = 1.02 ± 0.40). Extra signals were also detected for daunorrubicin, L-asparaginase, prednisone, methotrexate, both groups although frequencies were similar [20]. Gene cytosine arabinoside, cyclophosphamide, folinic acid, etopo- fusions incidence in lymphocytes from the group of patients side (VP-16), teniposide (VM-26), and 6 mercaptopurine. In collected months or years after completion of therapy were some cases prophylactic cranial and/or neuroaxis irradiation then compared with those obtained retrospectively for fixed was also included. The median event-free survival was 3.8 bone marrow samples collected at the time of diagnosis. years (range 5 months to 16 years) and there were no relapses. Two out of ten samples studied were positive for the The characterization of patients was described in the work by t(12;21) at diagnosis, however, when these samples were Brassesco et al. [19]. excluded from the statistical analysis, it was observed that Frequency of chromosomal aberrations were compared the frequency of aberrations obtained for treated patients to that observed for control nonsmoking healthy young were significantly higher than those in the untreated bone subjects, aged 18 to 22 years (average = 19.9), who were marrow samples (mean ± SD = 0.57 ± 2.17) (Table 1). not occupationally exposed, and had no history of prior More interesting, the fusion gene frequency in bone marrow or concurrent malignancy. The study was approved by the samples was similar to that observed for the control samples, local Ethics Committee (HC-FMRP Ethics committee Proc. suggesting an influence of previous exposure to anticancer 1135/2000). drugs [20]. The results obtained for the different markers are pooled Also, sequential FISH was performed on lymphocytes and described in the following subsections. from ALL survivors, using chromosome specific library probes for chromosome 12. For one thousand metaphases scored, the frequency of translocations varied between zero 1.1. ETV6/RUNX1 Fusions. FISH for t(12;21) ETV6/RUNX1 and 7.6 (mean ± SD = 3.58 ± 2.77) for the group of was carried out using the LSI TEL/AML1 ES probe (Vysis, patients while for the control group, the frequency was Abbott Diagnostics, Maidenhead, United Kingdom) accord- between zero and 5.5/1000 metaphases (mean ± SD = 1.57 ± ing to the manufacturers’ instructions: 1000 interphase 1.65) (Table 2). The statistical analysis revealed a significant nuclei were scored for each sample to determine the degree difference (P = .02) between the patients and the control of positivity for the fusion and the interphase signal patterns group, in accordance with the previous results using locus of different cell populations. Numbers of red-green fusion specific probes for ETV6/RUNX1, providing further evidence signals were recorded corresponding to numbers of copies that chemotherapy had induced an increase in genomic ETV6/RUNX1, while numerous red and green signals corre- instability manifested as de novo chromosome aberrations sponding to RUNX1 and ETV6, respectively, were collectively in peripheral blood lymphocytes sampled over years (most considered as “extra signals.” Our study showed that ALL cases) after therapy completion. Journal of Biomedicine and Biotechnology 3

Table 3: Mean frequency of MLL translocations and extra signals flanking a known DNA sequence [22]. Individual PCR obtained for ALL survivors and healthy individuals (taken from products were cut, extracted from gels, and subsequently [19]). cloned into the pGEM-T vector, further sequencing of PCR Translocations Extra Signals products was achieved in order to confirm the veracity of Groups of individuals n % % the rearrangements. Eighty-one percent of patients (35 out (mean ± SD) (mean ± SD) of 43) presented putative translocations; from those, 91% Patients Treated with corresponded with t(4;11)(q21;q23), while the other 9% topoisomerase II 15 0.13 ± 0.14∗ 0.28 ± 0.28 corresponded with t(X;11), t(8;11)(q23;q23), and t(11;16). inhibitors The control group was also analyzed by this technique n = Patients Treated without ( 100), showing putative MLL rearrangements in 49% topoisomerase II 31 0.09 ± 0.117∗ 0.16 ± 0.168 of individuals. The presence of two or three putative inhibitors translocations was statistically higher in the group of patients P<. Healthy individuals 49 0.04 ± 0.065 0.18 ± 0.198 ( 05) when compared with the control group. The results ∗ were also analyzed regarding the time in complete clinical Statistically different, P<.05. remission, which did not influence the results. Similarly, the analysis considering other variables (sex, risk of relapse, and inclusion of radiotherapy) did not influence the number of For both types of probes the role of other covariates translocations between patients [19]. such as age at initial diagnosis, inclusion of prophylac- tic irradiation, and time passed after therapy conclusion were statistically analyzed, showing that neither of these 1.3. IGH/CCND1 Fusions. Locus-specific identifier dual- parameters influenced the incidence of chromosomal aber- color directly labeled IGH(spectrum Green)/CCND1 rations. (Spectrum-Orange) (Vysis) probes were used for detecting the t(11;14)(q13;q32) originated by the juxtaposition of the 1.2. MLL Fusions. FISH assessment for the presence of immunoglobulin gene (IGH) at 14q32 with the CCND1 aberrations involving the MLL gene (11q23) was performed gene (cyclin D1, BCL1,orPRAD1), localized at 11q13. The using the commercially available probes LSI MLL Break expected signal pattern for a nucleus with t(11;14) is one Apart Rearrangement according to the protocol of the green (normal IGH), one red (normal CCND1), and two manufacturer (Vysis). The expected signal pattern for a red(yellow)green signals (1G1R2Y), due to the fact that the normal cell nucleus is two green(yellow)orange signals. In break usually occurs in the middle of the probe marked cells harboring MLL translocations, the green and orange region, resulting in two fragments of each gene, however, signals appear separated without the yellow intersection these fragments can be lost, or extra signals of each gene allowing detection of any translocation at 11q23 irrespec- can be detected, resulting in different patterns of signals tively of the partner involved. One thousand metaphases (2G1R1Y, 1G2R1Y; or 3G2R, 2G3R, in the case of an extra from 49 ALL long-term survivors and the same number from signal). At least 1000 interphase nuclei were analyzed per control individuals were analyzed. Since MLL aberrations individual. The group of patients in complete remission are characteristic of secondary leukemias associated with (n = 14) presented frequency of fusions varying between therapy with topoisomerase II inhibitors [21], the group 0.09 and 0.49/100 cells. These values were significantly of patients was divided into two subgroups depending on higher (P = .0126) compared with those observed for the inclusion or omission of VP-16 and/or VM-26 in the the control group (n = 15), which varied from 0 to 0.29 treatment protocol. Our results showed significant (P = fusions/100 cells. The probes also allowed the detection of .007) differences between the frequency of translocations extra signals for both genes, with frequency varying from observed for the groups of patients and controls. These 0.09 to 0.69 signals/100 cells for patients and from 0 to differences were also significant (P = .006) when the groups 0.48 signals/100 cells for controls. As seen for IGH/CCND1 of patients (independently of the inclusion of VP-16 and/or fusions, the frequency of extra signals presented by the group VM-26) and controls were compared, indicating that higher of patients in complete remission were significantly higher frequency in the patients cohort might be associated with (P = .0282) than those presented by healthy individuals. the therapy with antitumoral drugs, independently of the When the inclusion of preventive cranial irradiation was inclusion of topoisomerase II inhibitors. Extra signals were considered no differences in IGH/CCND1 fusions frequency also scored, however, their frequency did not differ between and extra signals were observed between of patients in groups of patients and controls (Table 3)[19]. complete remission and the control group. In parallel, MLL translocations were analyzed by Inverse- A retrospective analysis was also carried out with PCR and identified by subsequent cloning and sequencing. sequential bone marrow samples collected at the moment This methodology is specifically applicable for the identifica- of diagnosis from nine of the fourteen ALL patients, with tion of rearrangements with known 5 sequence, but whose the aim of determining whether the fusion IGH/CCND1 was 3 end could be represented by a myriad of translocation already present before treatment. The fusion appeared with partners as is the case of MLL fusions. Basically, DNA is frequency varying from 0 to 0.41 IGH/CCND1 fusions/100 digested by proper restriction enzymes, circularized and then cells and from 0 to 2.6 extra signals/100 cells. Interest- amplified with divergent primers, detecting any segment ingly, among these samples, only one patient showed high 4 Journal of Biomedicine and Biotechnology

Table 4: Mean frequency of IGH/CCND1 translocations and extra 2. Discussion signals obtained for ALL survivors, healthy individuals, and patients at the time of initial diagnosis. Since 1970, the number of cancer survivors in developed countries has tripled and is growing by 2% each year [23]. Translocations Extra Signals Groups of individuals n % % Cancer treatments have become much more aggressive as (mean ± SD) (mean ± SD) new agents and better supportive therapies are in constant ∗ development. The long-term consequences of cancer cure ALL survivors 14 0.19 ± 0.10 0.29 ± 0.17 may be significant for the patients who often experience . ± . . ± . Healthy individuals 15 0 09 0 06 0 19 0 15 physical or physiological late effects secondary to their ALL patients at diagnosis 9 0.19 ± 0.18 0.39 ± 0.77 previous cancer treatment [4]. Many of these effects may ∗Statistically different, P<.05. not occur or become clinically symptomatic until many years after completion of therapy, though, the development of a second malignant neoplasm can be the most devastating late Table 5: Mean frequency of BCR/ABL translocations and extra ff signals obtained for ALL survivors, healthy individuals, and patients e ect of cancer treatment. at the time of initial diagnosis. Childhood-cancer survivors present a higher risk of developing secondary malignancies [24] which characterize Translocations Extra Signals the leading cause of death among this cohort [25]. The n Groups of individuals % % time of occurrence has not been established, but in gen- (mean ± SD) (mean ± SD) eral between 3 and 12 percent of the patients develop a ALL survivors 8 0.99 ± 0.55 1.19 ± 0.97 subsequent cancer within the first 20 years after therapy Healthy individuals 8 0.49 ± 0.53 0.25 ± 0.27 conclusion. The most widely recognized treatment-related ALL patients at diagnosis 4 1.20 ± 0.26∗ 1.80 ± 6.18 risk factors are alkylating agents and topoisomerase II ∗Statistically different, P<.05. inhibitors (epipodophyllotoxins and anthracyclines). The magnitude of the risk associated with these factors depends on several variables such as initial diagnosis, age at diagnosis, the administration schedule, concomitant medications, and frequency of extra signals (2.6/100 cells), which might genetic predisposition among others [26]. Exposure to represent rearrangements of the IGH gene with another alkylating agents or topoisomerase inhibitors during therapy partner (Table 4). has also been associated with higher risk of developing The analysis of other variables such as risk of relapse and secondary leukemia among ALL cured patients [27]. inclusion of radiotherapy did not show differences in the Treatment of pediatric ALL consists of several doses of frequency of IGH/CCND1 translocations between patients. anticancer drugs given weekly or daily for 2-3 years [28]. These drugs cause DNA breaks, facilitating the formation 1.4. BCR/ABL1 Fusions. FISH for t(9;22) that juxtaposes the of chromosome rearrangements [4, 29]. Thus, like de ABL gene at 9q34 and the BCR gene at 22q11.2 was carried novo leukemias, therapy-related hematological disorders are out using the LSI BCR/ABL ES probe (Vysis) according to the commonly associated with recurrent aberrations [7]. Chro- manufacturers’ instructions. The hybridization pattern for mosome(s) 7 and/or 5 monosomies or deletions are typical these probes is two orange and two green signals for normal of alkylating agent-induced AML, while balanced translo- cells (2O2G). Cells with t(9;22) involving the M-bcr show cations involving chromosome bands 11q23 and 21q22 are one large orange, one smaller orange (ES), and one fused associated to previous therapy with DNA-topoisomerase II orange/green signal (2O1G1F), while for translocations inhibitors [23] which usually lead to the formation of gene involving the minor breakpoint (m-bcr) appear as one fusions involving MLL [21]andRUNX1 [30], respectively. orange, one green, and two fusion signals (1O1G2F) are Translocations involving the latter have been identified observed. In this case, samples from 8 ALL survivors and the in therapy-related secondary leukemias [31]withpartners same number of control individuals were analyzed. The cyto- such as ETO (Eight Twenty One) and EVI1 (Ecotropic genetic analysis of 1000 metaphases showed translocation Viral Integration site 1 oncogene) [32]. Other numerical frequency varying from 0.236 to 1.627 for treated patients and structural rearrangements have also been described in (mean±SD = 0.99±0.55) and between zero and 1.30 for the different secondary therapy-related neoplasms although at control group (mean ± SD = 0.49 ± 0.53). Extra signals were lower frequency, including t(3;21) [33], t(9;22) BCR-ABL1 also detected with frequency varying from 0.59 to 3.69 and [34], t(1;21), t(3;21), t(14;21), t(15;21), and t(17;21) [35]. zero to 0.9 for patients and controls, respectively. However, In the present paper, we pooled a screening for structural the statistical analysis was unable to detect differences for aberrations (ETV6/RUNX1, MLL fusions, IGH/CCND1, and translocations and extra signals between the studied groups BCR/ABL1) in ALL long-term survivors, compared with con- (P>.05). A retrospective analysis with sequential samples trol individuals, as evaluated by FISH on interphase nuclei obtained at the time of diagnosis was also performed (n = 4). using a specific commercial DNA probes. As shown in Fig- Translocation incidence varied from 0.8 to 1.54, while extra ure 1, all the markers studied showed higher frequency when signals varied from 1.10 to 15.56; however, this group was compared to the control group, thus providing evidence that not big enough to establish comparisons with the frequency chemotherapy could have induced an increase in genomic observed the other groups (Table 5). instability manifested as de novo chromosome aberrations Journal of Biomedicine and Biotechnology 5

5 ∗ double strand breaks occurs by the action of complex DNA repair mechanisms, mainly nonhomologous end joining 4 (NHEJ) [39]. 3 Other mechanisms such as illegitimate recombination mediated by Alu repeats and long interspersed nuclear 2 elements (LINEs) have been proposed to participate in gene fusions the formation of gene fusions [40, 41]. Illegitimate V(D)J

Mean frequency of 1 ∗ ∗ ∗ recombination have also been described, with site-specific 0 DNA cleavage at heptamer/nonamer signal sequences with ETV6/RUNX1 MLL IGH/CCND1 BCR/ABL the IGH variable region or the TCR binding region arranged Figure 1: Mean frequency of gene fusions in peripheral lympho- in juxtaposition with other tumor suppressors genes or cytes from ALL survivors analyzed months or year(s) after therapy oncogenes like MYC or CCND1 in lymphoid malignancies completion (black boxes) and healthy donors (white boxes). In the [42, 43]; besides several studies have demonstrated that the case of MLL fusions the group of survivors was subdivided into exposure to DNA-damaging agents in vitro increase V(D)J patients treated with topoisomerase II inhibitors (grey box) and rearrangements frequency at cryptic signal sequences other patients treated without the inclusion of such drugs in the treatment than IGH and TCR loci [44, 45]. ∗P<. protocol (black box). 05. Data for ETV6/RUNX1 and MLL In addition, the induction of leukemia-associated fusion was taken from Brassesco et al. [20] and [19], respectively. genessuchast(8;21)AML1/ETO, t(9;22) BCR/ABL,and t(6;9) DEK/CAM (associated with AML and CML) by high doses of ionizing radiation has been reported in vitro [46] in peripheral blood lymphocytes sampled over years (most and in patients accidentally exposed to ionizing radiation cases) after therapy completion. The differences between [47, 48]. groups were statistically different for the ETV6/RUNX1, MLL According to the literature, the inclusion of radio- fusions, and IGH/CCND1 markers. In the case of BCR/ABL1, therapy in different treatment regimens is associated with although the rearrangement appeared at higher frequency an increase (2-3 times) in the risk of developing solid in ALL survivors, the study groups analyzed were not big tumors [49]. Among the ALL survivors analyzed in the enough for the proper comparison. present study, 13 (28%) were submitted to different doses Mutational studies at the FMS proto-oncogene demon- of cranial or neuroaxis γ-radiation. However, these patients strated the acquisition of mutation in patients treated did not show increased translocation frequency (for any with alkylating agents and radiation [3]. The absence of marker) compared with patients who were only treated with such mutations in biopsies at initial diagnosis suggested chemotherapy. that they were somatically acquired after treatment and Several authors have demonstrated that the production they appeared with increased frequency in relation to the of unstable aberrations (rings and dicentrics) after radiother- normal population not exposed to cytotoxic drugs. Similarly, apy decreases with time, and sequential cytogenetic studies studies of HRPT (hypoxanthine phosphoribosyltransferase) performed on peripheral lymphocytes taken from patients mutations demonstrated significantly elevated frequency in treated for different cancers showed a constant decline patients treated for pre-B ALL, even two years after therapy in chromosomal aberrations [50]. M’kacher et al. [51] completion [12]. demonstrated by chromosome painting that after an initial Furthermore, rearrangements at 11q23 have been found decrease for up to 6 months after treatment, the frequency of during treatment of primary cancer, as observed in case of complex rearrangements remained constant for up to 2 years t(11;17) MLL/GASP [36]. Other chromosomal rearrange- during the follow-up of Hodgkin’s lymphoma survivors. In mentssuchasPML-RARA, CBFB-MYH11, MLL-MLLT1, our study, the period after therapy conclusion varied between and BCR-ABL1 have also been observed in Non-Hodgkin 5 and 192 months (median event-free survival was 3.8 years), Lymphoma patients after high-dose therapy [37]demon- however, the statistical analysis did not show any significant strating the susceptibility of specific genes to mutagenic or relationship between the frequency of translocations for any carcinogenic agents [38]. of the markers and time passed after therapy conclusion. Indeed, although translocations might be formed by In the last years, the treatment directed to the central different mechanisms, several studies have mapped specific nervous system has suffered modifications with a tendency of chromatin structural elements, such as in vivo topoisomerase lowering doses and the irradiated area, using dose rationing II (topo II) cleavage sites, DNAse I hypersensitive sites regimens [52]. In general, protocols have eliminated radi- and scaffold attachment regions (SARs) in the breakpoint ation to the spine, decreased cranial irradiation doses or regions of relevant genes (including MLL, AF4, AF9, AML1, replaced them with intrathecal and/or systemic drugs such ETO, CBFB, MYHI1, PML, RARA, TEL, E2A, PBX1, BCR, as high-dose methotrexate [5]. Currently, ALL patients at our and ABL) that are probably associated with preferential service are submitted to doses of 18 Gy (classified as standard breakage after exposure to damage including topoisomerase risk of relapse) and 24 Gy (higher risk of relapse), according II inhibitors [39]. In most cases, the breakpoints do not to the GBTLI protocol [18]. Nonetheless, several epidemio- colocalize exactly with topoisomerase II cleavage sites, but logical studies have demonstrated that the risk of t-LMAs or map close to or at a variable distance from them. After the t-MDSs is predominantly associated with chemotherapy and induction of DNA cleavage at these sites, the religation of the not to radiotherapy, principally emphasizing the relationship 6 Journal of Biomedicine and Biotechnology between specific drugs and chromosome rearrangements evolving genomic aberrations to the potential risk of sec- [53], as verified for topoisomerase II inhibitors associated to ondary malignancies in this cohort. 11q23 aberrations. When considering the MLL aberrations, the group of Acknowledgment patients presented significantly higher aberration frequency when compared to control individuals, although such differ- This work was supported by FAPESP (Grant nos. 01/11225- ences were independent of the inclusion of VP-16 or VM-26 3, 02/13317-8, and 03/01915-0), CAPES, and CNPq. in the treatment protocol. Some studies have demonstrated that concomitant adjuvant chemotherapy (such as asparag- References inase, doxorubicin, cyclophosphamide) or antimetabolites [1] A. Baccichet, S. K. Qualman, and D. Sinnett, “Allelic loss in (such as mercaptopurine or methotrexate) administration, childhood acute lymphoblastic leukemia,” Leukemia Research, increase the risk of secondary leukemia [26]. vol. 21, no. 9, pp. 817–823, 1997. Also, individual predisposing factors, including poly- [2] C.-H. Pui, L. L. Robison, and A. T. Look, “Acute lymphoblastic morphisms of detoxification and DNA-repair enzymes that, leukaemia,” The Lancet, vol. 371, no. 9617, pp. 1030–1043, for instance, reduce the enzymatic activity of thiopurine 2008. methyltransferase, a variant of CYP3A that affects pro- [3]A.Baker,P.Cachia,S.Ridgeetal.,“FMSmutationsin duction of a DNA-damaging metabolite of epipodophyl- patients following cytotoxic therapy for lymphoma,” Leukemia lotoxin. Other polymorphisms in glutathione S-transferase Research, vol. 19, no. 5, pp. 309–318, 1995. ff and NAD(P)H:quinine oxidoreductase (NQO1)areaswell [4] J. Byrne, “Long-term genetic and reproductive e ects of associated with increased risk of secondary leukemia after ionizing radiation and chemotherapeutic agents on cancer patients and their offspring,” Teratology, vol. 59, no. 4, pp. 210– chemotherapy [23]. 215, 1999. Since strategies in cancer treatment are continuously [5] P. C. Nathan, K. Wasilewski-Masker, and L. A. Janzen, “Long- evolving, the investigation of rearrangements that could term outcomes in survivors of childhood acute lymphoblastic represent a risk factor for the development of secondary leukemia,” Hematology/Oncology Clinics of North America, vol. neoplasias is important for cancer survivors. Individuals with 23, no. 5, pp. 1065–1082, 2009. a history of childhood cancer have 10–20 fold greater risk [6] M. A. Smith, L. Rubinstein, and R. S. Ungerleider, “Therapy- of developing a secondary malignant neoplasm within the related acute myeloid leukemia following treatment with first 20 years after treatment [54] turning therapy-related epipodophyllotoxins: estimating the risks,” Medical and Pedi- neoplasias a worldwide problem of major proportions [55, atric Oncology, vol. 23, no. 2, pp. 86–98, 1994. 56]. [7] C. A. Felix, “Secondary leukemias induced by topoisomerase- Between 10% and 20% of acute leukemia patients targeted drugs,” Biochimica et Biophysica Acta, vol. 1400, no. 1–3, pp. 233–255, 1998. reported in various series have developed a secondary cancer [8] S. Bhatia, H. N. Sather, O. B. Pabustan, M. E. Trigg, P. S. following previous therapy, and considering cured ALL Gaynon, and L. L. Robison, “Low incidence of second neo- patients, a greater frequency of neoplasias has been observed plasms among children diagnosed with acute lymphoblastic when compared to normal individuals [8, 57, 58]. None leukemia after 1983,” Blood, vol. 99, no. 12, pp. 4257–4264, of our patients developed a secondary cancer over 5 years 2002. of clinical follow-up. Yet, even though the chromosome [9] E. J. Dann and J. M. Rowe, “Biology and therapy of secondary aberrations detected in this study appear at low frequency leukaemias,” Best Practice and Research, vol. 14, no. 1, pp. 119– in ALL survivors, there were significant differences when 137, 2001. compared to the control group. [10] S. Bonassi, L. Hagmar, U. Stromberg¨ et al., “Chromosomal Although some studies have demonstrated that some of aberrations in lymphocytes predict human cancer indepen- these fusion genes can lead to a greater cellular proliferation, dently of exposure to carcinogens,” Cancer Research, vol. 60, no. 6, pp. 1619–1625, 2000. like BCR/ABL, ETV6/RUNX1, IGH/BCL-2, among others, [11] H. Norppa, “Cytogenetic biomarkers and genetic polymor- such alterations by themselves are not enough for tumori- phisms,” Toxicology Letters, vol. 149, no. 1-3, pp. 309–334, genesis, and secondary multiple genetic alterations are 2004. necessary [59–61]. Recent studies have also demonstrated the [12] S. Koishi, M. Kubota, M. Sawada et al., “Biomarkers in long presence of leukemia-related chromosomal translocations in survivors of pediatric acute lymphoblastic leukemia patients: normal individuals, such as t(14;18) IGH/BCL2 [62–64]and late effects of cancer chemotherapy,” Mutation Research, vol. t(9;22) [65], t(12;21) ETV6/RUNX1 [14], t(11;14)(p13;q11) 422, no. 2, pp. 213–222, 1998. LMO2/TCR and t(7;14)(q34;q11) TCR/TAL2 [42], t(15;17) [13] M. Greaves, “Molecular genetics, natural history and the PML/RARA [66], and MLL partial duplications [15, 67], demise of childhood leukaemia,” European Journal of Cancer, indicating that the presence of such translocations per se does vol. 35, no. 2, pp. 173–185, 1999. not define an apparent clinical disease. [14] M. Eguchi-Ishimae, M. Eguchi, E. Ishii et al., “Breakage and fusion of the TEL (ETV6) gene immature B lymphocytes Although, it cannot be assumed that the observed induced by apoptogenic signals,” Blood, vol. 97, no. 3, pp. 737– therapy-induced genetic damage in the group of ALL 743, 2001. survivors is predictive of an increased risk of developing [15] J. Basecke,¨ F. Griesinger, L. Trumper,¨ and G. Brittinger, secondary neoplasias, cytogenetic surveillance should be “Leukemia- and lymphoma-associated genetic aberrations in considered to evaluate the occurrence of persistent genome healthy individuals,” Annals of Hematology,vol.81,no.2,pp. instability in these patients, as well as to associate particular 64–75, 2002. Journal of Biomedicine and Biotechnology 7

[16] S. Lipkowitz, V. F. Garry, and I. R. Kirsch, “Interlocus V- region is a specific event which occurs as part of higher- J recombination measures genomic instability in agriculture order chromatin fragmentation during the initial stages of workers at risk for lymphoid malignancies,” Proceedings of the apoptosis,” Molecular and Cellular Biology, vol. 17, no. 7, pp. National Academy of Sciences of the United States of America, 4070–4079, 1997. vol. 89, no. 12, pp. 5301–5305, 1992. [31] J. D. Rowley, “The role of chromosome translocations in [17] I. R. Kirsch and F. Lista, “Lymphocyte-specific genomic leukemogenesis,” Seminars in Hematology,vol.36,no.4,pp. instability and risk of lymphoid malignancy,” Seminars in 59–72, 1999. Immunology, vol. 9, no. 3, pp. 207–215, 1997. [32] M. L. Loh, L. B. Silverman, M. L. Young et al., “Incidence [18] S. Brandalise, V. Odone, W. Pereira, M. Andrea, M. Zanichelli, of TEL/AML1 fusion in children with relapsed acute lym- and V. Aranega, “Treatment results of three consecutive phoblastic leukemia,” Blood, vol. 92, no. 12, pp. 4792–4797, Brazilian cooperative childhood ALL protocols: GBTLI-80, 1998. GBTLI-82 and -85,” Leukemia, vol. 7, supplement 2, pp. S142– [33] S. W. Hiebert, W. Sun, J. N. Davis et al., “The t(12;21) translo- S145, 1993. cation converts AML-1B from an activator to a repressor of [19] M. S. Brassesco, A. P. Montaldi, D. E. Gras et al., “Cytogenetic transcription,” Molecular and Cellular Biology, vol. 16, no. 4, and molecular analysis of MLL rearrangements in acute pp. 1349–1355, 1996. lymphoblastic leukaemia survivors,” Mutagenesis, vol. 24, no. [34] M. Hattori, M. Tanaka, Y. Yamazaki, Y. Nakahara, K. Tsushita, 2, pp. 153–160, 2009. and M. Utumi, “Detection of major and minor bcr/abl fusion ff [20] M. S. Brassesco, M. L. Camparoto, L. G. Tone, and E. gene transcripts in a patient with acute undi erentiated T. Sakamoto-Hojo, “Analysis of ETV6/RUNX1 fusions for leukemia secondary to treatment with an alkylating agent,” evaluating the late effects of cancer therapy in ALL (acute Leukemia Research, vol. 19, no. 6, pp. 389–396, 1995. lymphoblastic leukemia) cured patients,” Cytogenetic and [35] D. Roulston, R. Espinosa III, G. Nucifora, R. A. Larson, M. M. Genome Research, vol. 104, no. 1-4, pp. 346–351, 2004. Le Beau, and J. D. Rowley, “CBFA2(AML1) translocations with [21] P. D. Aplan, D. S. Chervinsky, M. Stanulla, and W. C. Burhans, novel partner chromosomes in myeloid leukemias: association “Site-specific DNA cleavage within the MLL breakpoint cluster with prior therapy,” Blood, vol. 92, no. 8, pp. 2879–2885, 1998. region induced by topoisomerase II inhibitors,” Blood, vol. 87, [36] M. D. Megonigal, N.-K. V. Cheung, E. F. Rappaport et al., no. 7, pp. 2649–2658, 1996. “Detection of leukemia-associated MLL-GAS7 translocation early during chemotherapy with DNA topoisomerase II [22] C. J. Betti, M. J. Villalobos, M. O. Diaz, and A. T. M. inhibitors,” Proceedings of the National Academy of Sciences of Vaughan, “Apoptotic triggers initiate translocations within the the United States of America, vol. 97, no. 6, pp. 2814–2819, MLL gene involving the nonhomologous end joining repair 2000. system,” Cancer Research, vol. 61, no. 11, pp. 4550–4555, 2001. [37] J. Basecke, M. Podleschny, A. Becker et al., “Therapy- [23] G. Leone, L. Fianchi, L. Pagano, and M. T. Voso, “Incidence associated genetic aberrations in patients treated for non- and susceptibility to therapy-related myeloid neoplasms,” Hodgkin lymphoma,” British Journal of Haematology, vol. 141, Chemico-Biological Interactions, vol. 184, no. 1-2, pp. 39–45, no. 1, pp. 52–59, 2008. 2010. [38] K. Seeger, H.-P. Adams, D. Buchwald et al., “TEL-AML1 [24] A. C. MacArthur, J. J. Spinelli, P. C. Rogers, K. J. Goddard, fusion transcript in relapsed childhood acute lymphoblastic N. Phillips, and M. L. McBride, “Risk of a second malignant leukemia,” Blood, vol. 91, no. 5, pp. 1716–1722, 1998. neoplasm among 5-year survivors of cancer in childhood and [39] Y. Zhang and J. D. Rowley, “Chromatin structural elements adolescence in British Columbia, Canada,” Pediatric Blood and and chromosomal translocations in leukemia,” DNA Repair, Cancer, vol. 48, no. 4, pp. 453–459, 2007. vol. 5, no. 9-10, pp. 1282–1297, 2006. [25] S. C. W. Lawless, P. Verma, D. M. Green, and M. C. [40] M. P. Strout, G. Marcucci, C. D. Bloomfield, and M. A. Mahoney, “Mortality experiences among 15+ year survivors Caligiuri, “The partial tandem duplication of ALL1 (MLL) is of childhood and adolescent cancers,” Pediatric Blood and consistently generated by Alu-mediated homologous recombi- Cancer, vol. 48, no. 3, pp. 333–338, 2007. nation in acute myeloid leukemia,” Proceedings of the National [26]N.Hijiya,K.K.Ness,R.C.Ribeiro,andM.M.Hudson, Academy of Sciences of the United States of America, vol. 95, no. “Acute leukemia as a secondary malignancy in children and 5, pp. 2390–2395, 1998. adolescents: current findings and issues,” Cancer, vol. 115, no. [41] S. P. Whitman, M. P. Strout, M. Guido et al., “The partial 1, pp. 23–35, 2009. nontandem duplication of the MLL (ALL1) gene is a novel [27] L. F. Lopes, B. Camargo, and A. Bianchi, “Late effects of rearrangement that generates three distinct fusion transcripts childhood cancer treatment,” Revista da Associacao Medica in B-cell acute lymphoblastic leukemia,” Cancer Research, vol. Brasileira, vol. 46, no. 3, pp. 277–284, 2000. 61, no. 1, pp. 59–63, 2001. [28] J. G. Blanco, T. Dervieux, M. J. Edick et al., “Molecular [42] R. Marculescu, T. Le, P. Simon, U. Jaeger, and B. Nadel, emergence of acute myeloid leukemia during treatment for “V(D)J-mediated translocations in lymphoid neoplasms: a acute lymphoblastic leukemia,” Proceedings of the National functional assessment of genomic instability by cryptic sites,” Academy of Sciences of the United States of America, vol. 98, no. Journal of Experimental Medicine, vol. 195, no. 1, pp. 85–98, 18, pp. 10338–10343, 2001. 2002. [29]Y.-H.Han,M.J.F.Austin,Y.Pommier,andL.F.Povirk, [43] A. K. Abbas, A. H. Lichtman, and J. S. Pober, Cellular and “Small deletion and insertion mutations induced by the Molecular Immunology, W. B. Saunders, Philadelphia, Pa, USA, topoisomerase II inhibitor teniposide in CHO cells and 5th edition, 2003. comparison with sites of drug-stimulated DNA cleavage in [44] C.-L. Chen, J. C. Fuscoe, Q. Liu, and M. V. Relling, “Etoposide vitro,” Journal of Molecular Biology, vol. 229, no. 1, pp. 52–66, causes illegitimate V(D)J recombination in human lymphoid 1993. leukemic cells,” Blood, vol. 88, no. 6, pp. 2210–2218, 1996. [30] M. Stanulla, J. Wang, D. S. Chervinsky, S. Thandla, and P. [45] R. L. Pinsonneault, P. M. Vacek, J. P. O’Neill, and B. A. D. Aplan, “DNA cleavage within the MLL breakpoint cluster Finette, “Induction of V(D)J-mediated recombination of an 8 Journal of Biomedicine and Biotechnology

extrachromosomal substrate following exposure to DNA- [61] D. De Jong, “Molecular pathogenesis of follicular lymphoma: damaging agents,” Environmental and Molecular Mutagenesis, a cross talk of genetic and immunologic factors,” Journal of vol. 48, no. 6, pp. 440–450, 2007. Clinical Oncology, vol. 23, no. 26, pp. 6358–6363, 2005. [46] M. W. N. Deininger, S. Bose, J. Gora-Tybor, X.-H. Yan, J. M. [62] Y. Liu, A. M. Hernandez, D. Shibata, and G. A. Cortopassi, Goldman, and J. V. Melo, “Selective induction of leukemia- “BCL2 translocation frequency rises with age in humans,” associated fusion genes by high-dose ionizing radiation,” Proceedings of the National Academy of Sciences of the United Cancer Research, vol. 58, no. 3, pp. 421–425, 1998. States of America, vol. 91, no. 19, pp. 8910–8914, 1994. [47] R. Hromas, R. Shopnick, H. G. Jumean, C. Bowers, M. Varella- [63] M. Yasukawa, S. Bando, G. Dolken¨ et al., “Low frequency of Garcia, and K. Richkind, “A novel syndrome of radiation- BCL-2/JH translocation in peripheral blood lymphocytes of associated acute myeloid leukemia involving AML1 gene healthy Japanese individuals,” Blood, vol. 98, no. 2, pp. 486– translocations,” Blood, vol. 95, no. 12, pp. 4011–4013, 2000. 488, 2001. [48] R. Hromas, T. Busse, A. Carroll et al., “Fusion AML1 transcript [64]K.E.Summers,L.K.Goff,A.G.Wilson,R.K.Gupta,T. in a radiation-associated leukemia results in a truncated A. Lister, and J. Fitzgibbon, “Frequency of the Bcl-2/IgH inhibitory AML1 protein,” Blood, vol. 97, no. 7, pp. 2168–2170, rearrangement in normal individuals: implications for the 2001. monitoring of disease in patients with follicular lymphoma,” [49] K. Kawai and H. Akaza, “Treatment of testicular and second Journal of Clinical Oncology, vol. 19, no. 2, pp. 420–424, 2001. cancer,” Gan to Kagaku Ryoho, vol. 26, no. 13, pp. 2021–2028, [65] S. Bose, M. Deininger, J. Gora-Tybor, J. M. Goldman, and 1999. J. V. Melo, “The presence of typical and atypical BCR-ABL [50] E. J. Tawn, C. A. Whitehouse, and F. A. Martin, “Sequential fusion genes in leukocytes of normal individuals: biologic chromosome aberration analysis following radiotherapy— significance and implications for the assessment of minimal no evidence for enhanced genomic instability,” Mutation residual disease,” Blood, vol. 92, no. 9, pp. 3362–3367, 1998. Research, vol. 465, no. 1-2, pp. 45–51, 2000. [66] A. S. Quina, P. Gameiro, M. S. D. Costa, M. Telhada, and [51] R. M’kacher, T. Girinsky, S. Koscielny et al., “Baseline and L. Parreira, “PML-RARA fusion transcripts in irradiated and treatment-induced chromosomal abnormalities in peripheral normal hematopoietic cells,” Genes Chromosomes and Cancer, blood lymphocytes of Hodgkin’s lymphoma patients,” Inter- vol. 29, no. 3, pp. 266–275, 2000. national Journal of Radiation Oncology Biology Physics, vol. 57, [67] S. Schnittger, B. Wormann,¨ W. Hiddemann, and F. Griesinger, no. 2, pp. 321–326, 2003. “Partial tandem duplications of the MLL gene are detectable [52] J. Nachman, H. N. Sather, J. M. Cherlow et al., “Response of in peripheral blood and bone marrow of nearly all healthy children with high-risk acute lymphoblastie leukemia treated donors,” Blood, vol. 92, no. 5, pp. 1728–1734, 1998. with and without cranial irradiation: a report from the Children’s Cancer Group,” Journal of Clinical Oncology, vol. 16, no. 3, pp. 920–930, 1998. [53] M. K. Andersen, B. Johansson, S. O. Larsen, and J. Pedersen- Bjergaard, “Chromosomal abnormalities in secondary MDS and AML. Relationship to drugs and radiation with specific emphasis on the balanced rearrangements,” Haematologica, vol. 83, no. 6, pp. 483–488, 1998. [54] L. Loning,¨ M. Zimmermann, A. Reiter et al., “Secondary neoplasms subsequent to Berlin-Frankfurt-Munster therapy of acute lymphoblastic leukemia in childhood: significantly lower risk without cranial radiotherapy,” Blood,vol.95,no.9, pp. 2770–2775, 2000. [55] L. L. Robison and S. Bhatia, “Late-effects among survivors of leukaemia and lymphoma during childhood and adolescence,” British Journal of Haematology, vol. 122, no. 3, pp. 345–359, 2003. [56] J. Jazbec, P. Ecimovi´ c,andB.Jereb,“Secondneoplasmsafter´ treatment of childhood cancer in Slovenia,” Pediatric Blood and Cancer, vol. 42, no. 7, pp. 574–581, 2004. [57]S.Bhatia,L.L.Robison,O.Oberlinetal.,“Breastcancerand other second neoplasms after childhood Hodgkin’s disease,” New England Journal of Medicine, vol. 334, no. 12, pp. 745– 751, 1996. [58] R. Mody, S. Li, D. C. Dover et al., “Twenty-five-year follow-up among survivors of childhood acute lymphoblastic leukemia: a report from the Childhood Cancer Survivor Study,” Blood, vol. 111, no. 12, pp. 5515–5523, 2008. [59] K. F. Wong, “11q13 is a cytogenetically promiscuous site in hematologic malignancies,” Cancer Genetics and Cytogenetics, vol. 113, no. 1, pp. 93–95, 1999. [60] F. Bernardin, Y. Yang, R. Cleaves et al., “TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia, induces acute leukemia in mice,” Cancer Research, vol. 62, no. 14, pp. 3904–3908, 2002. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 730847, 8 pages doi:10.1155/2011/730847

Research Article Sperm DNA Integrity and Meiotic Behavior Assessment in an Infertile Male Carrier of a 9qh+++ Polymorphism

A. Garcıa-Peir´ o,´ 1, 2 M. Oliver-Bonet,1, 3 J. Navarro,1 C. Abad,4 M. Guitart,5 M. J. Amengual,5 and J. Benet1

1 Unitat de Biologia Cel-lular i Gen`etica M`edica, Facultat de Medicina, Universitat Aut`onoma de Barcelona, 08193 Bellaterra, Spain 2 C`atedra de Recerca Eugin-UAB, Universitat Aut`onoma de Barcelona, 08193 Bellaterra, Spain 3 Unitat d’Investigaci´o Hospital Universitari Son Dureta, 07014 Palma de Mallorca, Spain 4 Servei d’Urologia, Consorci Hospitalari Parc Taul´ı, 08208 Sabadell, Spain 5 UDIAT, Consorci Hospitalari Parc Taul´ı, 08208 Sabadell, Spain

Correspondence should be addressed to A. Garcıa-Peir´ o,´ [email protected] and J. Benet, [email protected]

Received 5 August 2010; Revised 29 October 2010; Accepted 1 November 2010

Academic Editor: Paul W. Doetsch

Copyright © 2011 A. Garcıa-Peir´ o´ et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Although several reports on male infertility suggest a relationship between chromosome 9 polymorphisms and infertility, the effects on the phenotype have not been extensively reported. In this study, an infertile patient was found to carry a 9qh+++ chromosome. The flow cytometric TUNEL assay and SCD test have been applied to characterize sperm DNA integrity. In order to assess its meiotic behaviour, synapsis, recombination, and aneuploidy, analyses have been also performed. Sperm DNA fragmentation (SDF) was 77.81% and 87% for the TUNEL and SCD tests, respectively. Ninety-two percent of pachytene cells analyzed showed meiotic abnormalities. The mean number of MLH1 foci per pachytene in the control group was higher (49) than the mean found in the 9qh+++ patient (38) (P<.0001). In spermatozoa, significant increases of disomy rates were observed for chromosome 18 and for the sex chromosomes (P<.0001). These disturbances could be present in other male carriers of a less marked 9qh+.

1. Introduction transmission of paternal genetic information. This could disturb both the fertilization and embryo-development pro- In the last few years, some papers have reported a high cesses [5, 6]. While recent data about sperm DNA integrity incidence of heterochromatin variants in infertile men in balanced chromosomes rearranged carriers have been [1–3]. Paracentric heterochromatin variants usually occur published [7, 8], no data from carriers of heterochromatin on the long arms of chromosomes 1, 9, 16, and distal polymorphism have been published to-date so, consequently, heterochromatin of the Y chromosome [1]. In particular, a lack of information about the effects on the phenotype is the heterochromatin polymorphism of chromosome 9 is the still present. In order to fill, at least in part, this gap, meiotic, structural variant most frequently present in infertile men aneuploidy, and sperm DNA integrity analyses have been [2, 3]. In this respect, some authors have suggested that performed in a carrier of the polymorphic 9qh+++ variant. the presence of some heterochromatin polymorphisms may make synapsis difficult, delaying or even preventing it and, as a consequence, may cause the reduction in both sperm 2. Material and Methods number and quality, impairing the fertility of the patient [4]. More recently, several studies have shown that sperm 2.1. Donor and Sample Treatment. The donor is a 36-year- DNA integrity is a highly limiting factor for the correct old infertile male with severe oligoasthenoteratozoospermia. 2 Journal of Biomedicine and Biotechnology

qh+++

(a) (b)

Figure 1: Karyotype analysis shows a 9qh+++ heterozygous state. (a) G-banding of homologous 9 chromosomes. Abnormal chromosome 9 (right) showing an increased length in the q arm compared to its homologous chromosome (left). Horizontal line indicates centromere position. (b) C-banding shows an increase in the heterochromatin region of chromosome 9. Horizontal lines set the limits of the qh region.

Physical examination showed testes with a slightly dimin- slide was washed in 0.04% (v/v) Photo-Flo (Eastman Kodak ished volume and consistency. Hormonal assays showed SA; Geneve,` Switzerland) for 4 min at room temperature and FSH and LH within normal levels. According to World air-dried. Health Organization recommendations [9], sperm count was estimated to be 2.8 million per mL. No sperm with progressive motility was observed and only 3% of sperm 2.2. TUNEL Assay. For terminal transferase dUTP nick- showed nonprogressive motility. Standard protocols for G- end labeling (TUNEL), the in situ cell death detection kit, and C-banding analysis were performed on lymphocyte from Roche (Ref. 11684795910, Roche Diagnostic GmbH; metaphases showing the presence of a 9qh+++ chromosome Penzberg, Germany), was used as previously described in which the pericentromeric heterochromatin block tripled [12]. This assay quantifies, by flow cytometer or fluores- the normal length (Figure 1). cent microscopy, the incorporation of labeled deoxyuridine For synapsis and recombination analyses, a testicular triphosphate (dUTP) at the sites of DNA breaks in a reac- biopsy was obtained from the patient and five control men, tion catalyzed by the enzyme deoxynucleotidyl transferase undergoing vasectomy or reversal vasectomy, under a local enzyme. Semen samples from the patient and three fertile anaesthesia [10]. To perform DNA integrity tests and the and chromosomally normal donors were washed twice in aneuploidy study, a semen sample from the patient and three PBS and the concentration was adjusted to 20 × 106 cells/mL. control men of proven fertility was obtained by masturbation Two-hundred microliters of this sperm suspension were fixed after three days of sexual abstinence. Written consent was an equal volume of 4% (w/v) paraformaldehyde for 1 hour given by all patients, and the study was approved by the at room temperature and then washed in PBS supplemented Institutional Ethics Committee. with 1% (v/v) bovine serum albumin (BSA; Sigma Chemi- Fresh ejaculate was allowed to liquefy, mixed 1 : 1 with cals). Sperm cells were permeabilized using 0.1% (v/v) Triton cryopreservation medium (14% (v/v) glycerol, 30% (v/v) egg X-100 in 0.1% (w/v) sodium citrate for 2 minutes in ice and yolk, 1.98% (w/v) glucose, and 1.72% (w/v) sodium citrate), then washed twice in PBS supplemented with 1% BSA. The aliquoted and incubated overnight at 80◦C in an isopropanol pellet was incubated in 50 µL of a mix containing 45 µLof bath and then plunged directly into liquid nitrogen until the the label solution plus 5 µL of the terminal deoxynucleotidyl experiment was performed. transferase (TdT) enzyme for 1 hour at 37◦Cinthedark. For synapsis and recombination analyses, a modification The sample was then washed twice using 1% BSA in ofthedrying-downtechnique[11]wasusedtoobtain PBS. The negative control was incubated without the TdT meiotic cells from the testicular tissue. Briefly, the tissue was enzyme and the positive control was prepared before the incubated for an hour at room temperature in a hypotonic labeling reaction with an additional treatment with DNAse I solution (sodium citrate 1% (w/v)). After incubation, 20 µlof (Roche Diagnostic GmbH; Penzberg, Germany), 100 IU, for 0.1 M sucrose solution were added to the tissue and testicular 10 minutes at 37◦C. tubules were shredded using two fine watchmaker forceps In order to perform flow cytometry analysis, the final until a cell suspension was obtained. This cell suspension pellet from the sperm sample was resuspended in a final was then recovered and spread on a slide previously soaked volume of 1 mL PBS. Green fluorescence (TUNEL-positive in 1% (w/v) paraformaldehyde. The slide was placed in a cells) was measured using a 530 nm ± 30 nm band-pass filter. humid chamber and allowed to dry overnight. Finally, the A total of 10 000 events were measured at a flow rate of Journal of Biomedicine and Biotechnology 3

Negative control Positive control Fertile Donor 1000 1000 1000

800 800 800

600 600 600

400 400 400 SSC-height SSC-height SSC-height

200 200 200

0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 Green fluorescence-FITC Green fluorescence-FITC Green fluorescence-FITC (a) (b) (c) Negative control Positive control 9qh+++ 1000 1000 1000

800 800 800

600 600 600

400 400 400 SSC-height SSC-height SSC-height

200 200 200

0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 Green fluorescence-FITC Green fluorescence-FITC Green fluorescence-FITC (d) (e) (f)

Figure 2: Cytogram for TUNEL. (a, d) The negative control was incubated without the TdT enzyme. (b, e) Positive control was prepared before the labeling reaction with an additional treatment with DNAse I. (c, f) The TUNEL-positive cell in the fertile donor and patient sample was measured, respectively, with respect to the negative-control sperm population using a 530 nm ± 30 nm band-pass filter. A total of 10 000 events were measured at a flow rate of 200–300 cells/s on a flow cytometer.

200–300 cells/s on a flow cytometer (FACSCalibur; Becton distilled water, and incubated in 10 mL of the lysing solution Dickinson, NJ, USA). Data were processed by CELLQUEST for 25 min. After washing, the slides were dehydrated in analysis software (Becton Dickinson). 70%, 90%, and 100% ethanol for 2 min each and then air-dried. Slides were stained for fluorescence microscopy using DAPI (2 µg/mL) (Roche Diagnostics; Barcelona, Spain) 2.3. SCD Test. For the Sperm Chromatin Dispersion test in Vectashield (Vector Laboratories; Burlingame, CA). The (SCDt), the Halosperm kit was used (Chromacell SL; positive control was prepared with an additional treatment Madrid, Spain). The SCD test is based on the principle with DNAse I (Roche Diagnostic GmbH; Penzberg, Ger- that sperm with fragmented DNA fails to produce the many), 100 IU, for 10 minutes at 37◦C. For this study, 300 characteristic halo of dispersed DNA loops that is observed in spermatozoa were scored and the percentage of sperm with nonfragmented DNA sperm [13]. The semen samples from fragmented DNA is referred to as sperm DNA fragmentation the patient and from three fertile and chromosomally normal (SDF). donors were washed twice in PBS and the concentration was adjusted to 20×106 cells/mL. Low-melting-point agarose was melted in a water bath at 90◦C–100◦C for 5 min and placed 2.4. Sperm Aneuploidy Study. The sperm aneuploidy study in water at 37◦C for 5 min to allow for equilibration. Then, was carried out using Fluorescence In Situ Hybridiza- 60 µL of the semen sample were mixed with agarose and tion (FISH). Frozen samples from three fertile control 20 µL of the semen-agarose mixture were pipetted onto an donors and the patient were thawed in a 37◦Cbathfor agarose-coated slide, covered with a coverslip and left at 4◦C 30 seconds and then washed in 0.9% (w/v) NaCl to remove for 5 min. The coverslip was gently removed and immersed the cryoprotectant, fixed, and decondensed following a in an acid solution for 7 min, washed for 5 min with protocol previously described [14]. Three-color FISH was 4 Journal of Biomedicine and Biotechnology

∗

SB

SCP1 SCP3 CENP SB MLH1

(a) (b)

Figure 3: Immunolabeled pachytene cells with synaptonemal complexes. (a) Representative image from the control group showing the normal morphology of the synaptonemal complex and sex body (SB). (b) Representative image of the cytological analysis of the patient’s cells. Arrowheads indicate multiple asynaptic regions in the autosomal synaptonemal complex; an asterisk indicates a loop of asynapsis as a consequence of pericentromeric heterochromatin polymorphism of chromosome 9. SCP1 and SCP3 indicate synaptonemal complexes in red; CENP indicates centromere in blue, and MLH1 (mut L homolog 1) indicates recombination foci in green.

SCP1 SCP3 CENP CEP9

∗

(a) (b)

Figure 4: Images show pachytene cells with the bivalent 9 synaptonemal complex identified by FISH analysis. (a) Representative image from a control donor. (b) Representative image from the 9qh+++ patient. An asterisk indicates the loop in the pericentromeric region; SCP1 and SCP3 indicate synaptonemal complexes in red; CENP indicates centromere in blue, and chromosome enumeration probe 9 (CEP9) indicates bivalent 9 in green. performed with a combination of centromeric probes for at a concentration of 0.032 ng/mL (Sigma; Madrid, Spain). chromosomes 18, X, and Y. Following the protocol rec- Hybridization signals were observed using an Olympus ommended by the commercial provider (AneuVysion EC Bx60 photomicroscope (Olympus Optical Co.; Hamburg, DNA Prove Kit; Vysis Inc; Woodcreek, IL, USA), slides were Germany) with a triple filter for DAPI/FICT/PI. Images were denatured for 5 min in a 70% (v/v) formamide 2x standard captured and produced by a Cytovision system (Applied saline citrate (2x SSC) solution prewarmed at 70% ± 1◦C Imaging; Sunderland, UK). in a waterbath, passed through three ethanol series (70%, From three control donors, a total of 31 134 spermato- 90%, 100%) and air-dried. Five µlofthedenaturedmix- zoa were scored. Moreover, 616 spermatozoa were scored probe were applied to each slide, and 18 mm × 18 mm from the 9qh+++ patient. Strict criteria were applied: only coverslips were added and sealed with rubber cement. individual, well-delineated and intact sperm nuclei were Slides were incubated overnight at 37◦C. After incubation, evaluated, and a sperm head was scored as disomic when it slides were washed following the manufacturer’s instruc- displayed two clear signals for the same chromosome, which tions, dehydrated, and counterstained with antifade (Vector were of similar size, color and intensity, and separated by at Laboratories, Inc.; Burlingame, CA, USA) containing DAPI least one fluorescence domain. Journal of Biomedicine and Biotechnology 5

2.5. Synapsis and Recombination Study. Immunocytology of Table 1: Percentages of sperm with DNA fragmentation in semen spermatocytes from the control group and the patient sample of a heterochromatin polymorphism carrier and control group of was performed following Barlow and Hulten [15]. Four fertile donors. primary antibodies were used: rabbit anti-synaptonemal Patient Control (n = 3) P value complex protein-3 (SCP3) [16] and rabbit anti-SCP1 [17] TUNELa 77.81% 15.6% P<.0001 (both gifts from Dr. Christa Heyting, University of Wagenin- SCDb 87% 10.33% P<.0001 gen, The Netherlands), anti-centromere protein (CENP) a,b (CREST serum kindly provided by Dr. William Earnshaw), For the 9qh+++ carrier, 10000 and 300 spermatozoa were analyzed for TUNEL and SCD, respectively. For controls, 30000 and 900 sperm cells were and mouse anti-MLH1 protein (Pharmingen; San Diego, analyzed. CA, USA). The four primary antibodies were applied at 1 : 1000, 1 : 1000, 1 : 1000, and 1 : 500, respectively, in PBT Table 2: Values obtained for asynapsis in pachytene cells in the (PBS, 0.15% (v/v) Fetal Calf Serum, 0.1% (v/v) Tween 20) heterochromatin polymorphism carrier. overnight at room temperature. Fluorescence secondary antibodies were applied in two rounds. The first round Normal Anomalous included a combination of TRITC-conjugated goat anti- Synapsisa 8% 92% rabbit IgG antibody and FICT-conjugated goat anti-mouse Only in Chromosome Only in IgG antibody (both from Sigma; Madrid, Spain) at 1 : 500 chromosome 9 9andothers others in PBT for 2 h at room temperature. The last round was 40% 32% 20% performed using the Zenon Pacific Blue Rabbit IgG Labeling a The presence of synaptonemal complex abnormalities was analyzed in 50 Kit (Molecular Probes, Spain) to label an unconjugated pachytene cells. rabbit anti-human antibody. Incubation time was 40 minutes at room temperature. After three 5-minute washes in PBT and a brief rinse in distilled water, slides were allowed to were applied to quantitative data comparisons. A value of air-dry. Antifade (Vector lab Inc; Burlingame, CA, USA) P<.05 was considered significant. was applied to each slide. Evaluation was made using a fluorescent photomicroscope (Olympus Optical Co.; Ham- burg, Germany) and all observed pachytene nuclei with anti- 3. Results MLH1 antibody foci were captured and processed using a 3.1. Sperm DNA Damage Analysis. DNA fragmentation was Power Macintosh G3 with SmartCapture software (Digital high regardless of the method applied: 77.81% and 87% Scientific; Cambridge, UK). SDF for the flow cytometric TUNEL assay (Figure 2)and the SCD test, respectively. In the control group (n = 3), a 2.6. Chromosome 9 FISH. A specific CEP9 SpectrumGreen mean of 15.6% and 10.53% was found for the TUNEL and probe (Vysis, Abbott Molecular Inc; Des Plaines, IL, USA) the SCD tests, respectively. Statistical differences were found was used for the bivalent 9 identification. The spectrum (P<.0001) between the SDF values of this patient and those green probe was hybridized on previously immunostained of the control group (Table 1). preparations. Briefly, slides were washed with 2xSSC pH 7.0 for two minutes, after which they were dehydrated in an 3.2. Synapsis Analysis. Figure 3 shows the immunocytoge- ethanol series (70%, 85%, and 100%), each one for two netic analysis. The presence of asynapsis, SC fragmentation minutes, and dried at room temperature. Denaturalization and XY association was evaluated for all autosomal SCs in of the sample was performed in 70% formamide for 3 min 50, 224, and 213 pachytene nuclei in the 9qh+++ carrier ◦ at 73 C and probe solution was denatured for 5 min at and in two control groups [4, 10], respectively. Table 2 ◦ 73 C. Hybridization was performed in a humid lightproof shows the frequencies of synapsis disturbances observed ◦ container at 37 C overnight. After hybridization, the slides in pachytene cells of the 9qh+++ carrier. We found that ◦ were washed in 0.4xSSC/0.3% NP40 at 74 Cfortwominutes 92% of the analyzed spermatocytes presented some of these followed by a second wash with 2xSSC/0.01% NP40 at abnormalities. Of them, 40% of the cells presented asynapsis room temperature for 30 seconds. Finally, DNA was coun- only in chromosome 9, whereas 32% presented asynapsis in terstained by applying antifade solution containing 125 ng/µl chromosome 9, plus SC fragmentation, asynapsis in other of DAPI. Identification was performed using a fluorescent chromosomes, or XY association with autosomes. Finally, photomicroscope (Olympus Optical Co.; Hamburg, Ger- 20% of the cells presented complete synapsis of chromosome many) equipped with the ISIS digital FISH-imaging system 9, but there were different alterations affecting other SCs. In (MetaSystems; Altussheim, Germany). the control group, a total of 11.7% of unsynapsed bivalent regions (splits) were seen. Observed ranges were from 2.4% ff 2.7. Statistical Analysis. The Chi-Square test and Fisher to 29.2% [10]. Di erences regarding asynapsis frequency for test were applied when needed for qualitative data analysis bivalent 9 were found between the patient and the control to determine whether there were significant differences group [4](Figure 4 and Table 3). between two groups for the MLH1, aneuploidy percentages of chromosomes X, Y, and 18 and sperm DNA fragmentation 3.3. MLH1 Foci Analysis. For recombination analysis, a total variables. The Student’s t-test and U-Mann-Whitney test of 43 pachytene nuclei were studied and the number of 6 Journal of Biomedicine and Biotechnology

Table 3: Number and percentage of asynapsis and heterosynapsis found according to the different pachytene stages analyzed for bivalent 9.

Stage Controla (n = 213) Patient 9qh+++ (n = 50) Asynapsis in 9q Asynapsis in 9q Heterosynapsis in 9q n = 43 % n = 36 % n = 14 % Early 30 14.1 11 22 3 6 Late 13 6.1 20 40 7 14 Unknown — — 5 10 4 8 Total (%) 20.2 72 28 a Codina-Pascual el al., [4]

MLH1 foci was scored per cell. A significant reduction in the Table 4: Aneuploidy percentages of chromosomes X, Y, and 18 in MLH1 foci number has been found in the 9qh+++, when the heterochromatin polymorphism carrier and in a chromosoma- compared with our controls (P<.0001). The mean number lly normal control group. of MLH1 foci per cell observed in controls was 48.8±2.3, and Patienta Controlb P value ranged from 36 to 63 foci per cell, whereas a mean of 38±8.28 foci per cell was found in the 9qh+++, ranging from 12 to 50 Sex disomies < ∗∗ foci per cell. X,X 1.3% 0.04–0.09% 0.0001 Y,Y 1.1% 0.06–0.14% <0.0001∗∗ X,Y 1.4% 0.14–0.32% <0.0001∗∗ 3.4. Aneuploidy Assay. A total of 616 sperm from the Autosomal disomies 9qh+++ carrier and 31,134 sperm from the control group < ∗∗ (n = 3) were analyzed by triple-color FISH. Significant 18,18 0.9% 0.09–0.17% 0.0001 < ∗∗ differences were found between these two groups for sex Diploidy 2.6% 0.15–0.31% 0.0001 a,b disomies, autosomal disomies of chromosome 18, and 616 and 31134 spermatozoa were analyzed, respectively. diploidy (P<.0001). Results are summarized in Table 4. We have also analyzed the frequencies of MLH1 foci 4. Discussion and sperm aneuploidy for standard chromosomes X, Y, and 18 in the patient and in chromosomally normal controls. In the present report, a less common variant of chromosome In the patient, a significantly low frequency of MLH1 and 9 polymorphism has been analyzed, and new evidence that an increase of aneuploidy for all chromosomes analyzed correlates with infertility is provided. The karyotype of the were found (Table 4). It is generally accepted that abnormal patient showed an enlarged pericentromeric heterochro- meiotic recombination is associated with aneuploid sperm matin block which triples its normal length, with regards to production because crossing-over is necessary for proper its homologous chromosome (Figure 1). Significant meiotic chromosome segregation [21]. A recent report has shown alterations, anomalous aneuploidy rates, high-sperm DNA a correlation between meiotic recombination and testicular fragmentation, and altered seminogram parameters have sperm aneuploidy in the same individual [22]. been found. Concerning DNA integrity, a significant increase in In the clinical examination, the patient showed an the number of sperm with DNA fragmentation was seen impaired fertility status but no other pathologies. Therefore, in the patient in comparison with fertile donors (Table 1 the occurrence of a polymorphism of such significance seems and Figure 2). Furthermore, in other infertile patients with to have a strong effect on the germ cells, but not on somatic different pathologies of the reproductive system, such as cells. It seems that asynapsis is a determining aspect for varicocele, and even in patients with chromosomal rear- the origin of germ-cell collapse [18, 19]. Thus, the presence rangements, the values of SDF were statistically lower than of a threshold amount of asynapsed regions could be a those observed in this particular case [8]. The principally sign of abnormal meiotic progression and could trigger known causes of DNA fragmentation are apoptosis during apoptosis [4]. In this patient, synaptic disturbances in 92% the process of spermatogenesis; DNA strand breaks produced of the analyzed pachytene cells were found. Similar results during the remodeling of sperm chromatin in spermiogen- were reported by Solari et al. [20] in their previous work, esis, and DNA fragmentation induced by oxygen radicals where all early pachytene cells presented loops of asynapsis [23, 24]. In this case, apoptosis could be the main cause of in chromosome 9, which disappeared at late-pachytene, DNA damage at the testicular level, thus explaining, the low probably because of synaptic adjustment. In our case, a count of sperm cells found in the seminogram. However, high percentage of late-pachytene stage cells (40%) presented other causes could be responsible for sperm DNA damage. important loops of asynapsis at the pericentromeric region of The remodeling of sperm chromatin, the histone-protamine chromosome 9 (Figure 4(b) and Table 3) probably because transition, is an exclusive spermiogenetic cellular process that the heterochromatin polymorphism is extremely large and occurs during the round-spermatid to long-spermatid stage. the heterologous pairing could not compensate the impair- As the integrity of DNA and chromatin depends, in part, on ment in time and extension. the accurate progression of this process, alterations at this Journal of Biomedicine and Biotechnology 7 level can affect the normal nuclear architecture and induce structural abnormality,” Fertility and Sterility, vol. 92, no. 2, vulnerability to oxidative stress and to DNA fragmentation pp. 583–589, 2009. [25, 26]. A few studies have been reported about SDF in [8] A. Garcıa-Peir´ o,´ J. Martınez-Heredia,´ M. Oliver-Bonet et al., carriers of a chromosomal abnormality [7, 27] and abnormal “Protamine 1 to protamine 2 ratio correlates with dynamic SDF values have been found in these patients. Perhaps the aspects of DNA fragmentation in human sperm,” Fertility and biological process may be similar because chromosomal Sterility. In press. reorganization could interfere with the normal nuclear [9] World Health Organization, WHO Laboratory Manual for the architecture. Examination of Human Semen and Semen–Cervical Mucus Interaction, Cambridge University Press, Cambridge, UK, 4th The implication of all of these data could be useful for edition, 1999. clinical practice. In particular, it would be interesting to [10] M. Codina-Pascual, M. Oliver-Bonet, J. Navarro et al., “Synap- know to what extent which of the disturbances described sis and meiotic recombination analyses: MLH1 focus in the XY here, albeit less marked, could be present in other men pair as an indicator,” Human Reproduction,vol.20,no.8,pp. with heterochromatin polymorphism. The correlation seen 2133–2139, 2005. between sperm DNA integrity and the presence of hete- [11] A. H. F. M. Peters, A. W. Plug, M. J. Van Vugt, and P. De Boer, rochromatic polymorphism, if confirmed, can be of help, in “A drying-down technique for the spreading of mammalian order to establish a predictive fertility status, simply by an melocytes from the male and female germline,” Chromosome SDF analysis in this type of carrier. Research, vol. 5, no. 1, pp. 66–68, 1997. Further studies focusing on the role of chromosome-9 [12] D. Domınguez-Fandos,M.I.Camejo,J.L.Ballesc´ a,` and R. heterochromatin during male gametogenesis will be needed Oliva, “Human sperm DNA fragmentation: correlation of in order to elucidate the mechanisms underlying meiotic TUNEL results as assessed by flow cytometry and optical failure observed in carriers of chromosome-9 polymorphic microscopy,” Cytometry A, vol. 71, no. 12, pp. 1011–1018, variants. 2007. [13] J. L. Fernandez,´ L. Muriel, V. Goyanes et al., “Halosperm is an easy, available, and cost-effective alternative for determining Acknowledgments sperm DNA fragmentation,” Fertility and Sterility, vol. 84, no. 4, p. 860, 2005. The authors wish to thank Raquel Torres for technical [14] F. Vidal, M. Moragas, V. Catala et al., “Sephadex filtration and assistance and Chuck Simmons for the English revision of human serum albumin gradients do not select spermatozoa this manuscript. This work was supported by the Fondo by sex chromosome: a fluorescent in-situ hybridization study,” Investigacion´ Sanitaria (Grant Numbers PI051834, PI080623 Human Reproduction, vol. 8, no. 10, pp. 1740–1743, 1993. [15]A.L.BarlowandM.A.Hulten,´ “Crossing over analysis at to J. Benet), and by the Generalitat de Catalunya (Grant pachytene in man,” European Journal of Human Genetics,vol. Number 2009 SGR 1107 to J. Benet). A. Garcıa-Peir´ ohasa´ 6, no. 4, pp. 350–358, 1998. grant from the Catedra` de Recerca Eugin-UAB. [16]J.H.M.Lammers,H.H.Offenberg, M. Van Aalderen, A. C. G.Vink,A.J.J.Dietrich,andC.Heyting,“Thegeneencoding a major component of the lateral elements of synaptonemal References complexes of the rat is related to X-linked lymphocyte- [1]P.F.Madon,A.S.Athalye,andF.R.Parikh,“Polymorphic regulated genes,” Molecular and Cellular Biology, vol. 14, no. variants on chromosomes probably play a significant role in 2, pp. 1137–1146, 1994. ff infertility,” Reproductive BioMedicine Online,vol.11,no.6,pp. [17] R. L. J. Meuwissen, H. H. O enberg,A.J.J.Dietrich,A. 726–732, 2005. Riesewijk, M. Van Iersel, and C. Heyting, “A coiled-coil related [2] K. Yakin, B. Balaban, and B. Urman, “Is there a possible corre- protein specific for synapsed regions of meiotic prophase lation between chromosomal variants and spermatogenesis?” chromosomes,” EMBO Journal, vol. 11, no. 13, pp. 5091–5100, International Journal of Urology, vol. 12, no. 11, pp. 984–989, 1992. 2005. [18]J.Navarro,C.Templado,J.Benet,R.Lange,O.Rajmil,and [3] J. Lissitsina, R. Mikelsaar, and M. Punab, “Cytogenetic analy- J. Egozcu e, “Sperm chromosome studies in an infertile man ses in infertile men,” Archives of Andrology, vol. 52, no. 2, pp. with partial, complete asynapsis of meiotic bivalents,” Human 91–95, 2006. Reproduction, vol. 5, no. 2, pp. 227–229, 1990. [4] M. Codina-Pascual, J. Navarro, M. Oliver-Bonet et al., [19] F. Sun, P. Turek, C. Greene, E. Ko, A. Rademaker, and R. H. “Behaviour of human heterochromatic regions during the Martin, “Abnormal progression through meiosis in men with synapsis of homologous chromosomes,” Human Reproduction, nonobstructive azoospermia,” Fertility and Sterility, vol. 87, vol. 21, no. 6, pp. 1490–1497, 2006. no. 3, pp. 565–571, 2007. [5] M. Benchaib, V. Braun, J. Lornage et al., “Sperm DNA [20] A. J. Solari, R. Ponzio, and G. Rey Valzacchi, “Synaptonemal fragmentation decreases the pregnancy rate in an assisted complex karyotyping in an oligospermic patient with hete- reproductive technique,” Human Reproduction,vol.18,no.5, rochromatin duplication in chromosome n. 9,” Medicina,vol. pp. 1023–1028, 2003. 51, no. 3, pp. 217–221, 1991. [6] M. Bungum, P. Humaidan, A. Axmon et al., “Sperm DNA [21] R. H. Martin, “Meiotic errors in human oogenesis and integrity assessment in prediction of assisted reproduction spermatogenesis,” Reproductive BioMedicine Online, vol. 16, technology outcome,” Human Reproduction,vol.22,no.1,pp. no. 4, pp. 523–531, 2008. 174–179, 2007. [22] F. Sun, M. Mikhaail-Philips, M. Oliver-Bonet et al., “Reduced [7] A. Perrin, E. Caer, M. Oliver-Bonet et al., “DNA fragmentation meiotic recombination on the XY bivalent is correlated and meiotic segregation in sperm of carriers of a chromosomal with an increased incidence of sex chromosome aneuploidy 8 Journal of Biomedicine and Biotechnology

in men with non-obstructive azoospermia,” Molecular Human Reproduction, vol. 14, no. 7, pp. 399–404, 2008. [23] D. Sakkas, E. Seli, D. Bizzaro, N. Tarozzi, and G. C. Manicardi, “Abnormal spermatozoa in the ejaculated: abortive apoptosis and faulty nuclear remodelling during spermatogenesis,” Reproductive BioMedicine Online, vol. 7, no. 4, pp. 428–432, 2003. [24]G.N.DeIuliis,L.K.Thomson,L.A.Mitchelletal.,“DNA damage in human spermatozoa is highly correlated with the efficiency of chromatin remodeling and the formation of 8-hydroxy-2 -deoxyguanosine, a marker of oxidative stress,” Biology of Reproduction, vol. 81, no. 3, pp. 517–524, 2009. [25] R. J. Aitken and G. N. De Iuliis, “Origins and consequences of DNA damage in male germ cells,” Reproductive BioMedicine Online, vol. 14, no. 6, pp. 727–733, 2007. [26] N. Torregrosa, D. Domınguez-Fandos,´ M. I. Camejo et al., “Protamine 2 precursors, protamine 1/protamine 2 ratio, DNA integrity and other sperm parameters in infertile patients,” Human Reproduction, vol. 21, no. 8, pp. 2084–2089, 2006. [27] F. Brugnon, E. Van Assche, G. Verheyen et al., “Study of two markers of apoptosis and meiotic segregation in ejaculated sperm of chromosomal translocation carrier patients,” Human Reproduction, vol. 21, no. 3, pp. 685–693, 2006. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 524067, 9 pages doi:10.1155/2011/524067

Review Article Contributions of Cytogenetics and Molecular Cytogenetics to the Diagnosis of Adipocytic Tumors

Jun Nishio

Department of Orthopaedic Surgery, Faculty of Medicine, Fukuoka University, 7-45-1 Nanakuma, Jonan-ku, Fukuoka 814-0180, Japan

Correspondence should be addressed to Jun Nishio, [email protected]

Received 5 September 2010; Accepted 15 December 2010

Academic Editor: Brynn Levy

Copyright © 2011 Jun Nishio. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Over the last 20 years, a number of tumor-specific chromosomal translocations and associated fusion genes have been identified for mesenchymal neoplasms including adipocytic tumors. The addition of molecular cytogenetic techniques, especially fluorescence in situ hybridization (FISH), has further enhanced the sensitivity and accuracy of detecting nonrandom chromosomal translocations and/or other rearrangements in adipocytic tumors. Indeed, most resent molecular cytogenetic analysis has demonstrated a translocation t(11;16)(q13;p13) that produces a C11orf95-MKL2 fusion gene in chondroid lipoma. Additionally, it is well recognized that supernumerary ring and/or giant rod chromosomes are characteristic for atypical lipomatous tumor/well- differentiated liposarcoma and dedifferentiated liposarcoma, and amplification of 12q13–15 involving the MDM2, CDK4,and CPM genes is shown by FISH in these tumors. Moreover, myxoid/round cell liposarcoma is characterized by a translocation t(12;16)(q13;p11) that fuses the DDIT3 and FUS genes. This paper provides an overview of the role of conventional cytogenetics and molecular cytogenetics in the diagnosis of adipocytic tumors.

1. Introduction Most types of adipocytic tumor have distinctive cyto- genetic aberrations which can be of considerable help in Adipocytic tumors represent the largest group of soft tissue diagnosis. This paper reviews the cytogenetic and molecular tumors that have been studied by cytogenetic analysis. cytogenetic characteristics of adipocytic tumors as well as In 1986, the first consistent karyotypic abnormality was their clinicopathologic features. The consistent chromoso- discovered in adipocytic tumors [1–3]. The current World mal alterations are summarized in Table 1. Health Organization (WHO) classification of adipocytic tumors includes eleven benign, one intermediate, and five malignant subtypes [4]. 2. Methods of Cytogenetic and Molecular The diagnosis of adipocytic tumors is primarily based Cytogenetic Analyses on clinical features and histologic patterns. However, atyp- ical lipomatous tumor/well-differentiated liposarcoma ded- A soft tissue sample submitted for conventional cytogenetic ifferentiated liposarcoma are often difficult to distinguish analysis must be fresh and should be representative of the morphologically from benign adipocytic tumors and other neoplastic process. Also, necrotic tissue should be dissected high-grade sarcomas, respectively. Immunohistochemistry from the sample. Generally, a 1-2 cm3 fresh sample is plays little role in the differential diagnosis of adipocytic provided for cytogenetics [5]. The basic process of cell tumors [4]. Moreover, the use of minimally invasive biopsies culturing is the same for all adipocytic lesions. Briefly, sterile to diagnose adipocytic tumors has become increasingly tumor tissue is minced with scissors and then disaggregated common, and this shift has created additional challenges. In with collagenase. The isolated cells are washed, diluted in such instances, molecular genetic testing can serve as a useful culture medium, and seeded in culture flaks or chamber diagnostic adjunct for adipocytic tumors. slides. The cultures are incubated in a 5% CO2 atmosphere 2 Journal of Biomedicine and Biotechnology

Table 1: Chromosomal aberrations and associated molecular events in adipocytic tumors.

Tumor type Chromosomal aberration Molecular event Benign Lipoma t(3;12)(q27-28;q13–15) HMGA2-LPP t(9;12)(p22;q13–15) HMGA2-NFIB t(2;12)(q37;q13–15) HMGA2-CXCR7 t(5;12)(q32-33;q13–15) HMGA2-EBF1 t(12;13)(q13–15;q12) HMGA2-LHFP 6p21–23 rearrangement HMGA1 rearrangement 13q deletion Not known Chondroid lipoma t(11;16)(q13;p13) C11of95-MKL2 Spindle cell/pleomorphic lipoma 13q and/or 16q deletions Not known Hibernoma 11q13 rearrangement MEN1, PPP1A deletion Lipoblastoma 8q11–13 rearrangement PLAG1 rearrangement Intermediate (locally aggressive) Atypical lipomatous tumor/ Ring/giant marker chromosome MDM2, CDK4, CPM, well differentiated liposarcoma (12q13–15 amplification) HMGA2 amplification Malignant Ring/giant marker Dedifferentiated liposarcoma MDM2, CDK4, CPM, chromosome∗ (12q13–15 amplification) HMGA2 amplification Myxoid/round cell liposarcoma t(12;16)(q13;p11) FUS-DDIT3 t(12;22)(q13;q12) EWSR1-DDIT3 Pleomorphic liposarcoma Complex karyotype Not known ∗Dedifferentiated liposarcoma may contain complex aberrations in addition to ring or giant marker chromosomes. at 37◦C. A short-term culturing usually results in a sufficient experiment [8]. Briefly, tumor (test) and reference (control) number of mitoses within 5–10 days. Then, dividing cells DNAs are differentially labeled with green or red fluorescence are arrested in metaphase by the addition of a mitotic- dyes, mixed in a 1 : 1 ratio in the presence of human Cot- spindle inhibitor such as colcemid. The cells are fixed 1 DNA (to block repetitive sequences), and cohybridized to with methanol/glacial acetic acid (3 : 1) and stained using a normal metaphase chromosome spreads. Metaphase spreads trypsin-Giemsa method to produce characteristic banding are captured using a high resolution or cooled charge- patterns. Ideally, 20 metaphase cells are analyzed for each coupled device camera, and the images are analyzed with specimen. the CGH software. The sensitivity of CGH is restricted During the last two decades, the ability to identify by purity of the cell population and depends on the level chromosomal abnormalities has been markedly improved by and size of the copy number changes. In addition, CGH the development of molecular cytogenetic technologies such cannot detect rearrangements such as inversions or balanced as fluorescence in situ hybridization (FISH) and comparative translocations. Recently, a higher resolution version of CGH, genomic hybridization (CGH). FISH is a technique that so-called array CGH, has been made available [9]. In this involves detection of specific DNA sequences by hybridiza- novel technique, test and reference DNAs are differentially tion with complimentary DNA probes. A major advantage labeled and competitively hybridized to glass slides (chips) of FISH is that nondividing (interphase) nuclei from fresh, containing multiple DNA fragments. A distinct advantage frozen, or formalin-fixed samples can be evaluated. It has of array CGH is the ability to directly map the copy been realized that FISH is an effective adjunct in the number changes to the genome sequence. Moreover, low diagnosis of soft tissue tumors including adipocytic tumors copynumbergainsandlossescanbedetectedbyarrayCGH [6]. On the other hand, FISH cannot detect smaller genetic at a resolution about 100 kb. alterations such as point mutations. Recently, multicolor FISH (M-FISH) can be used to detect cryptic rearrangements 3. Benign Adipocytic Tumors or decipher the origin of marker chromosomes in complex karyotypes [7]. The combination of chromosome banding 3.1. Lipoma. Ordinary lipoma is the most common soft analysis with M-FISH has the potential to identify and tissue tumor and may appear at any site. It occurs mainly describe most karyotypic changes of sarcoma cells. CGH in the fifth to seventh decades of life, frequently in obese is a technique for the analysis of DNA sequence copy individuals. Lipomas are rare in children. Approximately numberchangesacrossthegenomeinasinglehybridization 5% of patients have multiple lipomas [4]. Ordinary lipomas Journal of Biomedicine and Biotechnology 3 present as painless, slowly growing soft tissue masses and upper back, particularly older males. Histologically, spindle can arise within subcutaneous tissue or deep soft tissue. cell lipoma is composed of a mixture of mature fat cells Deep-seated lipomas (e.g., intramuscular or intermuscular and small spindle cells associated with a myxoid matrix lipomas) are larger and grossly less well-defined than their and collagen bundles. In the other end of the spectrum, subcutaneous counterparts and can mimic atypical lipoma- pleomorphic lipoma is characterized by the presence of mult- tous tumor/well differentiated liposarcoma. Histologically, inucleated floret-like giant cells. Immunohistochemically, the the tumor is composed of lobules of mature fat cells which spindle cells in both spindle cell and pleomorphic lipomas vary slightly in size and shape. are strongly positive for CD34 [4]. Clonal cytogenetic aberrations have been identified in Spindle cell and pleomorphic lipomas show similar nearly 60% of ordinary lipomas [4, 10–12]. The 12q13–15 cytogenetic aberrations which are usually more complex region is the most commonly involved in such aberrations, than ordinary lipomas. The karyotypes of these tumors followed by 6p21–23 and 13q [10, 13, 14]. This chromosomal are frequently hypodiploid with multiple partial deletions region recombines with a large variety of other chromosome and few balanced rearrangements. The recurrent cytogenetic bands through translocations. The most frequent transloca- aberrations appear to be deletion of 16q13-qter, monosomy tion is t(3;12)(q27-28;q13–15) that fuses the HMGA2 and for chromosome 13, or partial deletion of 13q [30–32]. LPP genes [15]. HMGA2 has also been reported to form However, it should be kept in mind that deletions and fusion genes with CXCR7 (at 2q37), EBF1 (at 5q33), NFIB structural rearrangements of 13q have been described in (at 9p22), and LHFP (at 13q12) [16–20]. Rearrangements of other adipocytic tumors [23]. HMGA2 can be identified by FISH analysis [14, 17, 21, 22], but these probes are not widely available. About 15%–20% 3.4. Hibernoma. Hibernoma is rare, benign adipocytic of ordinary lipomas show rearrangements or deletions of the tumor composed of brown fat cells with granular, multi- long arm of chromosome 13, in particular 13q12–22 [14, 23]. vacuolated cytoplasm. The tumor occurs primarily in the Moreover, FISH analysis has revealed that chromosome 13 thigh and scapular and interscapular regions of young is involved in a variety of rearrangements and deletions adults. In cases with numerous univacuolated cells, histologic ∼ that cover a limited segment ( 2.5 Mb) of chromosome distinction from ordinary lipoma may be difficult. Also, band 13q14, distal to the RB1 gene [23]. Rearrangements hibernoma may be misdiagnosed as well differentiated or of 6p21–23 involving the HMGA1 gene has been described myxoid liposarcoma because of the paucity of diagnostic in ordinary lipomas without 12q13–15 aberrations [10, 14]. brown fat cells in the lipoma-like or myxoid variant [12]. Recently, Wang et al. [24] detected the presence of an Hibernomas have near or pseudodiploid karyotypes HMGA1-LPP/TPRG1 gene fusion in an ordinary lipoma which are frequently somewhat more complex than ordinary with t(3;6)(q27;p21). A CGH study has indicated that no lipomas. They are characterized by structural rearrange- copy number changes are found in ordinary lipomas, and ments involving the long arm of chromosome 11, in particu- ff this technique may help in the di erential diagnosis of lar 11q13. No chromosomal band has been involved more intermediate adipocytic tumors [25]. than once as a translocation partner [4]. Metaphase FISH analyses have demonstrated that homozygous deletion of the 3.2. Chondroid Lipoma. Chondroid lipoma is a distinctive MEN1 tumor suppressor gene (at 11q13.1) and heterozygous tumor composed of strands and nests of lipoblasts and deletion of PPP1CA (distal to MEN1 at 11q13) are found in mature fat cells in a variably myxoid or myxochondroid hibernomas [33]. Recently, Maire et al. [34] reported that the matrix. This tumor occurs predominantly in the proximal altered region at 11q13 is larger than previously reported and extremities and limb girdles of middle-aged adults. Chon- rearrangements of GARP (at 11q13.5) or a neighboring gene droid lipoma may be mistaken for several other benign and may be important in the pathogenesis of hibernomas. malignant soft tissue tumors such as myxoid liposarcoma or extraskeletal myxoid chondrosarcoma [12]. 3.5. Lipoblastoma. Lipoblastoma occurs predominantly in A reciprocal translocation t(11;16)(q13;p13) has been childrenyoungerthan3yearsofage.Itpresentsasalocalized found in six chondroid lipoma cases [26–29]. Most recently, (lipoblastoma) or diffuse (lipoblastomatosis) tumor, resem- Huang et al. [29] reported that this chromosomal transloca- bling fetal white adipose tissue. The extremities are the most tion results in a fusion of C11orf95 and MKL2. The presence common site, but many other locations can be involved of the t(11;16) or the C11orf95-MKL2 fusion transcript is [4]. Histologically, lipoblastoma shows a lobular appearance highly specific for chondroid lipoma, and is absent in any and is composed of an admixture of mature adipocytes and other related tumors. Therefore, an analysis of C11orf95 or lipoblasts in different stages of development. The matrix can ff MKL2 rearrangement using FISH is useful for the di erential be myxoid with plexiform vascular pattern. Lipoblastoma diagnosis of chondroid lipoma and its histologic mimickers. can be confused with intermediate and malignant adipocytic tumors, including atypical lipomatous tumor/well differen- 3.3. Spindle Cell Lipoma/Pleomorphic Lipoma. Spindle cell tiated liposarcoma and myxoid liposarcoma [12]. and pleomorphic lipomas are histologic ends of a spectrum Lipoblastomas usually have simple, pseudodiploid kary- of a single clinicopathologic entity and supported by cytoge- otypes with structural chromosomal alterations. They are netic evidence [4]. These tumors present as circumscribed characterized by rearrangements of 8q11–13 involving the subcutaneous lesions occurring typically on the neck and PLAG1 gene [35–38]. Excess copies of chromosome 8 may 4 Journal of Biomedicine and Biotechnology be found in cases with or without 8q11–13 rearrangements as a painless, slowly growing mass that can attain a very [10, 39]. Among the several chromosomal aberrations tar- large size. Histologically, the tumor is composed entirely geting PLAG1, two partner genes have been indentified: or partially of a mature adipocytic proliferation showing HAS2 at 8q24 and COL1A2 at 7q22 [40]. Interestingly, significant variation in cell size and at least focal nuclear PLAG1 rearrangement can be demonstrated by FISH analysis atypia in both adipocytes and stromal cells. Four main [36, 37, 41–43]. These findings provide a useful distin- subtypes of atypical lipomatous tumor/well differentiated guishing feature from the cytogenetic and molecular cyto- liposarcoma are recognized in the current WHO classifica- genetic aberrations found in myxoid liposarcoma and other tion: adipocytic (lipoma-like), sclerosing, inflammatory, and adipocytic tumors. spindle cell [4].Thepresenceofmorethanonehistologic pattern in the same lesion is common. In some situations, ff 3.6. Miscellaneous Types of Lipoma. Angiolipoma occurs atypical lipomatous tumor/well di erentiated liposarcoma chiefly as a subcutaneous painful nodule in young adults. The may be indistinguishable from benign adipocytic tumors forearm is the most common site, followed by the trunk and at the histologic level, and inadequate samples can lead to upper arm. Multiple angiolipomas are much more common misdiagnosis. than solitary ones. Histologically, angiolipoma is composed Cytogetically, atypical lipomatous tumor/well differen- of mature fat cells separated by a branching network of tiated liposarcoma is characterized by the presence of small vessels. There has been only a single case report of an supernumerary ring and/or giant marker chromosomes, angiolipoma with a t(X;12)(p22;p12) [44]. lacking alpha-satellite centromeric sequences. These ring Angiomyolipoma is an uncommon mesenchymal tumor and giant marker chromosomes have been observed as the composed of a variable mixture of mature fat cells, spindle sole change or concomitant with a few other numerical and epithelioid smooth muscle cells, and abnormal thick- or structural aberrations in mostly near-diploid karyotypes. walled blood vessels. Although most commonly presenting Random and nonrandom telomeric associations can be in the kidney, angiomyolipomas may also occur in the found [52]. FISH and CGH studies have shown that ring extrarenal sites. Approximately one-third of patients with and giant marker chromosomes are composed mainly of angiomyolipoma present with manifestations of the tuberous amplified sequences from the 12q13–15 region, including the sclerosis [12]. Immunohistochemically, angiomyolipomas MDM2, CDK4, HMGA2,andSAS genes [53–61]. Recently, are characterized by a coexpression of the melanocytic Erickson-Johnson et al. [62]demonstratedthatCPM (at marker HMB-45 and smooth muscle markers such as 12q15) is coamplified with MDM2 in atypical lipomatous ff smooth muscle action and muscle-specific action. Cytoge- tumors/well di erentiated liposarcomas. Coamplification of netic studies in renal angiomyolipomas have shown chro- 1q21–23 involving the COAS genes has also been reported mosomal aberrations involving trisomy for chromosomes 7 [63]. This 12q13–15 amplification is not observed in benign and/or 8 and rearrangements of the long arm of chromosome adipocytic tumors, and its detection can therefore be used as 12 [45–49]. A CGH study has indicated that chromosomal an ancillary diagnostic technique for the diagnosis of atypical ff imbalances are common and the 5q33-34 region may contain lipomatous tumor/well di erentiated liposarcoma [64, 65]. a tumor suppressor gene significant in the pathogenesis of More importantly, FISH for MDM2 amplification can be some renal angiomyolipomas [50]. performed on nondividing cells from limited tissue samples and is a more sensitive and specific adjunctive tool than Myelolipoma, most common in the adrenal grand, is MDM2 immunohistochemistry [66]. a rare, benign tumor or tumor-like lesion composed of mature fat cells and haematopoietic elements comprising myeloid and erythroid cells as well as megakaryocytes. It 4.2. Dedifferentiated Liposarcoma. Dedifferentiated liposar- can also occur in extra-adrenal soft tissue. There has been coma is a malignant adipocytic tumor showing transition only a single case report of an adrenal myelolipoma with a from atypical lipomatous tumor/well differentiated liposar- t(3;21)(q25;p11) [51]. coma to a nonlipogenic sarcoma of variable histologic grade. Dedifferentiation is thought to be a time-dependent phe- 4. Intermediate and Malignant nomenon that occurs in up to 10% of atypical lipomatous Adipocytic Tumors tumor/well differentiated liposarcoma. About 90% of dedif- ferentiated liposarcomas arise “de novo,” while 10% occur in 4.1. Atypical Lipomatous Tumor/Well Differentiated Liposar- recurrences [4]. The risk of dedifferentiation appears to be coma. In the current WHO classification, atypical lipo- higher in deep-seated lesions. Dedifferentiated liposarcoma matous tumor and well differentiated liposarcoma have occurs typically in the retroperitoneum of elderly individuals been grouped under the “intermediate (locally aggressive) and can also affect the extremities. It usually presents as malignancy” label [4]. It has been suggested to use the a painless, large mass, which may be found by chance. In term “atypical lipomatous tumor” only for the superficial contrast to atypical lipomatous tumor/well differentiated or subcutaneous locations. Atypical lipomatous tumor/well liposarcoma, dedifferentiated liposarcoma has a 15%–20% differentiated liposarcoma accounts for about 40%–45% metastatic rate [67]. Histologically, dedifferentiated liposar- of all liposarcomas and occurs most frequently in the coma is traditionally defined by the association of atypical thigh, retroperitoneum, and paratesticular/inguinal region lipomatous tumor/well differentiated liposarcoma areas and of middle-aged and older individuals [4]. It usually presents a nonlipogenic component, most often in an abrupt fashion. Journal of Biomedicine and Biotechnology 5

In about 90% of cases, the dedifferentiated components have translocations and molecular alterations is highly sensitive the appearance of a high-grade poorly differentiated sarcoma and specific for myxoid/round cell liposarcoma and is [12]. Recently, the concept of low-grade dedifferentiation absent in other liposarcoma subtypes or in other myxoid has increasingly been recognized [68]. Due to the histologic soft tissue tumors. Therefore, cytogenetics is an excellent complexity of dedifferentiated liposarcoma, many differen- analytic method for the initial workup of a suspected tial diagnoses may be raised on the morphologic aspect myxoid/round cell liposarcoma. Moreover, dual color, break alone. apart rearrangement probes spanning the genomic regions of Similar to atypical lipomatous tumor/well differentiated DDIT3 (12q13), FUS (16p11), and EWSR1 (22q12) (Abbott liposarcoma, dedifferentiated liposarcoma is characterized by Molecular/Vysis, Des Plaines, IL) are readily available, and the presence of ring or giant marker chromosomes and dou- FISH can be used to provide support for the diagnosis of ble minutes. A peculiarity of dedifferentiated liposarcoma myxoid/round cell liposarcoma [6, 87]. Conventional and might be the presence of multiple abnormal clones [4]. FISH array CGH studies have shown that genomic imbalances and CGH studies have demonstrated that ring and giant frequently include gains of 8p21–23, 8q, and 13q in myx- marker chromosomes are composed, exclusively or partly, oid/round cell liposarcomas [88–90]. of amplified 12q13–15 material, involving MDM2, CDK4, and HMGA2 [56, 69]. In a previous analysis, we established 4.4. Pleomorphic Liposarcoma. Pleomorphic liposarcoma is ff the first human dedi erentiated liposarcoma cell line (FU- a rare, high-grade sarcoma with at least focal adipocytic DDLS-1) and showed that giant marker chromosomes differentiation in the form of pleomorphic lipoblasts. It were composed partly of chromosome 12 material [70]. occurs predominantly in the extremities of elderly patients In addition to the 12q13–15 amplification, 1p32 and 6q23 (>50 years) and is usually deep-seated but may be superficial. ff amplifications have been detected by CGH in dedi erenti- In general, pleomorphic liposarcoma has an aggressive ated liposarcomas [71–73]. Array CGH analyses have shown behavior with a 30%–50% metastatic rate and an overall that the target genes are JUN in the 1p32 band [74]andASK1 tumor-associated mortality of 40%–50% [4]. Histologically, in the 6q23 band [75]. Interestingly, co-amplifications of the tumor is composed of pleomorphic multivacuolated 1p32 and 6q23 are absent in atypical lipomatous tumor/well lipoblasts admixed with pleomorphic spindle cells and ff di erentiated liposarcoma, suggesting that CGH is a helpful multinucleated giant cells. In some cases of pleomorphic ff diagnostic adjunct in the discrimination between dedi er- liposarcoma, a small round cell area indistinguishing from entiated liposarcoma and atypical lipomatous tumor/well myxoid/round cell liposarcoma is observed with a varying ff di erentiated liposarcoma. number of pleomorphic lipoblasts [12]. Pleomorphic liposarcomas are generally associated with 4.3. Myxoid Liposarcoma/Round Cell Liposarcoma. The highly complex karyotypes lacking specific structural or WHO Committee combined myxoid and round cell liposar- numerical aberrations [76, 78, 91].Thepresenceofrings, comas (previously two distinct subtypes) under the umbrella large markers, or double minute chromosomes has been of myxoid liposarcoma [4]. Myxoid liposarcoma, the second reported [4]. Recently, Sugita et al. [92]demonstrated most common subtype of liposarcoma, occurs predomi- that the number of DDIT3 split signals in pleomorphic nantly in the extremities of young to middle-aged adults liposarcomas is extremely scarce compared with that of and has a tendency to recur locally or to metastasize myxoid/round cell liposarcoma. Therefore, FISH for DDIT3 to unusual sites such as the retroperitoneum, opposite rearrangement can play a role in distinguishing between extremity, and bone. Histologically, the tumor is composed these two liposarcoma subtypes. Conventional and array of a mixture of uniform round- to oval- shaped primitive CGH analyses have shown gains of 1p21, 1q21-22, 5p13– mesenchymal cells and a variable number of small lipoblasts 15, 7q22, 9q22-qter, 13q, 17p11.2–12, 20q13, and 22q and in a prominent myxoid stroma. The presence of round cell losses of 2q, 3p, 4q, 10q, 11q, 12p13, 13q21, and 14q23-24 component is associated with a poor prognosis. Pure myxoid [72, 88, 89, 93, 94]. Interestingly, amplification of the 12q13– liposarcoma must be differentiated from a number of benign 15 region and the MDM2 gene does not occur consistently and malignant soft tissue lesions characterized by a myxoid in pleomorphic liposarcomas, suggesting that CGH can be stroma, such as lipoblastoma, myxoma, myxofibrosarcoma, performed to distinguish pleomorphic liposarcoma from ff low-grade fibromyxoid sarcoma, and extraskeletal myxoid high grade dedi erentiated liposarcoma. chondrosarcoma. Myxoid/round cell liposarcoma is generally associated 4.5. Mixed-Type Liposarcoma. Mixed-type liposarcoma rep- with a chromosome number in the diploid range, with only resents the rarest subtype of liposarcoma and is still con- rare cases being hyperdiploid or near-triploid [76]. It is sidered a controversial entity. It is defined as a liposarcoma characterized by a translocation t(12;16)(q13;p11) in more showing a mixture of features of at least two main subtypes than 90% of cases, resulting in an FUS-DDIT3 fusion gene by histologic examination [4]. The tumor occurs predom- [77–80]. A variant translocation t(12;22)(q13;q12) has also inantly in retroperitoneal or intra-abdominal locations of been described, resulting in an EWR1-DDIT3 fusion gene elderly patients. Most recently, de Vreeze et al. [95]proposed [81–83]. In addition, several nonrandom secondary aber- that mixed-type liposarcomas should not be regarded as col- rations have been identified, including del(6q), i(7)(q10), lision tumors, but as an extreme variant of the morphologic +8, and der(16)t(1;16) [84–86]. The presence of these spectrum within a single biologic entity. 6 Journal of Biomedicine and Biotechnology

Cytogenetic aberrations in mixed-type liposarcomas translocation t(3;12) (q28;q14),” Cancer Genetics and Cytoge- usually reflect at least one of the histologic components of the netics, vol. 23, no. 4, pp. 283–289, 1986. tumor. The presence of ring or giant marker chromosomes [3]S.Heim,N.Mandahl,andU.Kristoffersson, “Reciprocal has been observed as the sole anomaly or in association with translocation t(3;12) (q27;q13) in lipoma,” Cancer Genetics complex rearrangements [31, 69, 96]. Interestingly, Mentzel and Cytogenetics, vol. 23, no. 4, pp. 301–304, 1986. et al. [97] have reported that amplification of the MDM2 [4]C.D.M.Fletcher,K.K.Unni,andF.Mertens,Pathology and and CDK4 genes and rearrangements of the DDIT3 and Genetics of Tumours of Soft Tissue and Bone,WorldHealth FUS genes were detected by FISH analysis in the atypical Organization Classification of Tumours, IARC Press, Lyon, France, 2002. lipomatous tumor/well differentiated liposarcoma and myx- [5] J. A. Bridge, “Advantages and limitations of cytogenetic, oid/round cell liposarcoma components, respectively. molecular cytogenetic, and molecular diagnostic testing in mesenchymal neoplasms,” Journal of Orthopaedic Science,vol. 5. Molecular Diagnostic Algorithm for 13, no. 3, pp. 273–282, 2008. [6] M. R. Tanas and J. R. Goldblum, “Fluorescence in situ Adipocytic Tumors hybridization in the diagnosis of soft tissue neoplasms: a review,” Advances in Anatomic Pathology,vol.16,no.6,pp. Molecular genetic testing can be used to distinguish between 383–391, 2009. (1) lipoma and atypical lipomatous tumor/well differentiated [7]L.Kearney,“Multiplex-FISH(M-FISH):technique,develop- liposarcoma; (2) myxoid liposarcoma and a variety of ments and applications,” Cytogenetic and Genome Research, myxoid soft tissue tumors including lipoblastoma; and (3) vol. 114, no. 3-4, pp. 189–198, 2006. ff dedi erentiated liposarcoma and pleomorphic liposarcoma [8] A. Kallioniemi, O. P. Kallioniemi, D. Sudar et al., “Compara- when histologic diagnosis is difficult. In addition, molecular tive genomic hybridization for molecular cytogenetic analysis genetic testing should be considered for recurrent lipomas, of solid tumors,” Science, vol. 258, no. 5083, pp. 818–821, 1992. large adipocytic tumors (>15 cm) with minimal or no cyto- [9] D. Pinkel, R. Segraves, D. Sudar et al., “High resolution logic atypia [98], lesions arising in rare anatomic locations or analysis of DNA copy number variation using comparative unusual age groups, or small biopsy specimens. genomic hybridization to microarrays,” Nature Genetics,vol. 20, no. 2, pp. 207–211, 1998. [10] A. A. Sandberg, “Updates on the cytogenetics and molecular 6. Conclusions and Future Directions genetics of bone and soft tissue tumors: lipoma,” Cancer Genetics and Cytogenetics, vol. 150, no. 2, pp. 93–115, 2004. Cytogenetics is the most comprehensive laboratory method [11] M. Hameed, “Pathology and genetics of adipocytic tumors,” for spotting the various translocations and other structural Cytogenetic and Genome Research, vol. 118, no. 2-4, pp. 138– alterations that characterize adipocytic tumors. In addition, 147, 2007. dramatic advances in molecular cytogenetic technologies [12] S. W. Weiss and J. R. Goldblum, Enzinger and Weiss’s Soft Tissue have greatly improved diagnostic accuracy in adipocytic Tumors, Mosby, Philadelphia, Pa, USA, 15th edition, 2008. tumors. In our experience, FISH is very useful in the [13] H. Willen,´ M. Akerman,˚ P. Dal Cin et al., “Comparison of diagnosis of adipocytic tumors, which harbor consistent chromosomal patterns with clinical features in 165 lipomas: molecular alterations including nonrandom translocations a report of the CHAMP study group,” Cancer Genetics and and amplification of gene regions. Hopefully in the future, Cytogenetics, vol. 102, no. 1, pp. 46–49, 1998. clinical decisions will increasingly be based on a combination [14] H. Bartuma, K. H. Hallor, I. Panagopoulos et al., “Assessment ff of histologic criteria and specific molecular/cytogenetic aber- of the clinical and molecular impact of di erent cytogenetic rations. Better understanding of the molecular biology of subgroups in a series of 272 lipomas with abnormal kary- otype,” Genes Chromosomes and Cancer, vol. 46, no. 6, pp. 594– adipocytic tumors will undoubtedly lead to the development 606, 2007. of novel therapeutic strategies. [15]M.M.R.Petit,R.Mols,E.F.P.M.Schoenmakers,N.Mandahl, andW.J.M.VanDeVen,“LPP,thepreferredfusionpartner Acknowledgments gene of HMGIC in lipomas, is a novel member of the LIM protein gene family,” Genomics, vol. 36, no. 1, pp. 118–129, This paper was supported in part by Kaibara Morikazu 1996. Medical Science Promotion Foundation, Japan Orthopaedics [16] K. Broberg, M. Zhang, B. Strombeck¨ et al., “Fusion of and Traumatology Foundation, Fukuoka Cancer Society, RDC1 with HMGA2 in lipomas as the result of chromosome Clinical Research Foundation, and a Grant-in-Aid for Young aberrations involving 2q35-37 and 12q13-15,” International Journal of Oncology, vol. 21, no. 2, pp. 321–326, 2002. Scientists (B) (21791424) from the Ministry of Education, [17] M. Nilsson, F. Mertens, M. Hoglund,¨ N. Mandahl, and Culture, Sports, Science and Technology of Japan. I. Panagopoulos, “Truncation and fusion of HMGA2 in lipomas with rearrangements of 5q32 → q33 and 12q14 → References q15,” Cytogenetic and Genome Research, vol. 112, no. 1-2, pp. 60–66, 2006. [1]A.A.Sandberg,Z.Gibas,andE.Saren,“Chromosome [18] M. Nilsson, I. Panagopoulos, F. Mertens, and N. Mandahl, abnormalities in two benign adipose tumors,” Cancer Genetics “Fusion of the HMGA2 and NFIB genes in lipoma,” Virchows and Cytogenetics, vol. 22, no. 1, pp. 55–61, 1986. Archiv, vol. 447, no. 5, pp. 855–858, 2005. [2] C. Turc-Carel, P. Dal Cin, and U. Rao, “Cytogenetic studies [19] A. Italiano, N. Ebran, R. Attias et al., “NFIB rearrangement of adipose tissue tumors. I. A benign lipoma with reciprocal in superficial, retroperitoneal, and colonic lipomas with Journal of Biomedicine and Biotechnology 7

aberrations involving chromosome band 9p22,” Genes Chro- metaphase fluorescence in situ hybridization reveals complex mosomes and Cancer, vol. 47, no. 11, pp. 971–977, 2008. rearrangements not detected by conventional cytogenetics,” [20] M. M. R. Petit, E. F. P. M. Schoenmakers, C. Huysmans, J. M. American Journal of Pathology, vol. 155, no. 1, pp. 61–66, 1999. W.Geurts,N.Mandahl,andW.J.M.VanDeVen,“LHFP,a [34] G. Maire, A. Forus, C. Foa et al., “11q13 alterations in novel translocation partner gene of HMGIC in a lipoma, is a two cases of hibernoma: large heterozygous deletions and member of a new family of LHFP-like genes,” Genomics,vol. rearrangement breakpoints near GARP in 11q13.5,” Genes 57, no. 3, pp. 438–441, 1999. Chromosomes and Cancer, vol. 37, no. 4, pp. 389–395, 2003. [21] H. Bartuma, I. Panagopoulos, A. Collin et al., “Expression [35] D. Gisselsson, M. K. Hibbard, P. Dal Cin et al., “PLAG1 alter- levels of HMGA2 in adipocytic tumors correlate with mor- ations in lipoblastoma: involvement in varied mesenchymal phologic and cytogenetic subgroups,” Molecular Cancer,vol. cell types and evidence for alternative oncogenic mechanisms,” 8, article 36, 2009. American Journal of Pathology, vol. 159, no. 3, pp. 955–962, [22]X.Wang,R.L.Hulshizer,M.R.Erickson-Johnsonetal., 2001. “Identification of novel HMGA2 fusion sequences in lipoma: [36] P. Brandal, B. Bjerkehagen, and S. Heim, “Rearrangement of evidence that deletion of let-7 miRNA consensus binding site chromosomal region 8q11-13 in lipomatous tumours: corre- 1intheHMGA23 UTR is not critical for HMGA2 transcrip- lation with lipoblastoma morphology,” Journal of Pathology, tional upregulation,” Genes Chromosomes and Cancer, vol. 48, vol. 208, no. 3, pp. 388–394, 2006. no. 8, pp. 673–678, 2009. [37] H. Bartuma, H. A. Domanski, F. V. Von Steyern, C. M. ff [23] A. Dahlen,´ M. Debiec-Rychter, F. Pedeutour et al., “Clustering Kullendor ,N.Mandahl,andF.Mertens,“Cytogenetic of deletions on chromosome 13 in benign and low-malignant and molecular cytogenetic findings in lipoblastoma,” Cancer lipomatous tumors,” International Journal of Cancer, vol. 103, Genetics and Cytogenetics, vol. 183, no. 1, pp. 60–63, 2008. ffi no. 5, pp. 616–623, 2003. [38] C. M. Co n, A. Lowichik, and A. Putnam, “Lipoblastoma [24]X.Wang,R.Q.Zamolyi,H.Zhangetal.,“FusionofHMGA1 (LPB): a clinicopathologic and immunohistochemical analysis to the LPP/TPRG1 intergenic region in a lipoma identified of 59 cases,” American Journal of Surgical Pathology, vol. 33, no. by mapping paraffin-embedded tissues,” Cancer Genetics and 11, pp. 1705–1712, 2009. Cytogenetics, vol. 196, no. 1, pp. 64–67, 2010. [39] A. M. Meloni-Ehrig, L. Riggott, N. C. Christacos, P. N. [25] J. Szymanska, M. Virolainen, M. Tarkkanen et al., “Overrep- Mowrey, and J. Johal, “Acase of lipoblastoma with seven copies resentation of 1q21-23 and 12q13-21 in lipoma-like liposar- of chromosome 8,” Cancer Genetics and Cytogenetics, vol. 190, comas but not in benign lipomas: a comparative genomic no. 1, pp. 49–51, 2009. hybridization study,” Cancer Genetics and Cytogenetics, vol. 99, [40]M.K.Hibbard,H.P.Kozakewich,P.DalCinetal.,“PLAG1 no. 1, pp. 14–18, 1997. fusion oncogenes in lipoblastoma,” Cancer Research,vol.60, no. 17, pp. 4869–4872, 2000. [26] D. Gisselsson, H. A. Domanski, M. Hoglund¨ et al., “Unique [41] R. Sciot, I. De Wever, and M. Debiec-Rychter, “Lipoblastoma cytological features and chromosome aberrations in chon- in a 23-year-old male: distinction from atypical lipomatous droid lipoma: a case report based on fine-needle aspiration tumor using cytogenetic and fluorescence in-situ hybridiza- cytology, histopathology, electron microscopy, chromosome tion analysis,” Virchows Archiv, vol. 442, no. 5, pp. 468–471, banding, and molecular cytogenetics,” American Journal of 2003. Surgical Pathology, vol. 23, no. 10, pp. 1300–1304, 1999. [42] A. Ropke,¨ T. Kalinski, U. Kluba, U. Von Falkenhausen, P. F. [27] T. A. Thomson, D. Horsman, and T. C. Bainbridge, “Cyto- Wieacker, and M. Ropke,¨ “PLAG1 activation in lipoblastoma genetic and cytologic features of chondroid lipoma of soft coinciding with low-level amplification of a derivative chro- tissue,” Modern Pathology, vol. 12, no. 1, pp. 88–91, 1999. mosome 8 with a deletion del(8)(q13q21.2),” Cytogenetic and [28]F.Ballaux,M.Debiec-Rychter,I.DeWever,andR.Sciot, Genome Research, vol. 119, no. 1-2, pp. 33–38, 2007. “Chondroid lipoma is characterized by t(11;16)(q13;p12-13),” [43] N. De Saint Aubain Somerhausen, J. M. Coindre, M. Debiec- Virchows Archiv, vol. 444, no. 2, pp. 208–210, 2004. Rychter, J. Delplace, and R. Sciot, “Lipoblastoma in adoles- [29] D. Huang, J. Sumegi, P. D. Cin et al., “C11orf95-MKL2 is the cents and young adults: report of six cases with FISH analysis,” resulting fusion oncogene of t(11;16)(q13;p13) in chondroid Histopathology, vol. 52, no. 3, pp. 294–298, 2008. lipoma,” Genes Chromosomes and Cancer,vol.49,no.9,pp. [44] R. Sciot, M. Akerman, P. Dal Cin et al., “Cytogenetic analysis 810–818, 2010. of subcutaneous angiolipoma: further evidence supporting [30] N. Mandahl, F. Mertens, H. Willen, A. Rydholm, O. Brosjo, its difference from ordinary pure lipomas: a report of the and F. Mitelman, “A new cytogenetic subgroup in lipomas: loss CHAMP study group,” American Journal of Surgical Pathology, of chromosome 16 material in spindle cell and pleomorphic vol. 21, no. 4, pp. 441–444, 1997. lipomas,” Journal of Cancer Research and Clinical Oncology, [45]B.DeJong,S.M.M.J.Castedo,J.W.Oosterhuis,andA.Dam, vol. 120, no. 12, pp. 707–711, 1994. “Trisomy 7 in a case of angiomyolipoma,” Cancer Genetics and [31] C. D. M. Fletcher, M. Akerman, P. Dal Cin et al., “Correlation Cytogenetics, vol. 34, no. 2, pp. 219–222, 1988. between clinicopathological features and karyotype in lipoma- [46] M. Debiec-Rychter, H. Saryusz-Wolska, and M. Salagierski, tous tumors: a report of 178 cases from the Chromosomes “Cytogenetic analysis of renal angiomyolipoma,” Genes Chro- and Morphology (CHAMP) Collaborative Study Group,” mosomes and Cancer, vol. 4, no. 1, pp. 101–103, 1992. American Journal of Pathology, vol. 148, no. 2, pp. 623–630, [47] B. Wullich, W. Henn, S. Siemer, G. Seitz, A. Freiler, and K. 1996. D. Zang, “Clonal chromosome aberrations in three of five [32] P. D. Cin, R. Sciot, P. Polito et al., “Lesions of 13q may occur sporadic angiomyolipomas of the kidney,” Cancer Genetics and independently of deletion of 16q in spindle cell/pleomorphic Cytogenetics, vol. 96, no. 1, pp. 42–45, 1997. lipomas,” Histopathology, vol. 31, no. 3, pp. 222–225, 1997. [48]P.DalCin,R.Sciot,H.VanPoppel,L.Baert,B.Van [33] D. Gisselsson, M. Hoglund,F.Mertens,P.DalCin,and¨ Damme, and H. Van Den Berghe, “Chromosome analysis in N. Mandahl, “Hibernomas are characterized by homozygous angiomyolipoma,” Cancer Genetics and Cytogenetics, vol. 99, deletions in the multiple endocrine neoplasia type region: no. 2, pp. 132–134, 1997. 8 Journal of Biomedicine and Biotechnology

[49] P. Dal Cin, N. C. Gutierrez, J. M. Hernandez, and H. Van Den International Journal of Cancer, vol. 109, no. 3, pp. 363–369, Berghe, “Molecular cytogenetics in angiomyolipomas,” Cancer 2004. Genetics and Cytogenetics, vol. 106, no. 2, p. 182, 1998. [64] N. Sirvent, J. M. Coindre, G. Maire et al., “Detection of [50] M. M. Kattar, D. J. Grignon, J. N. Eble et al., “Chromosomal MDM2-CDK4 amplification by fluorescence in situ hybridiza- analysis of renal angiomyolipoma by comparative genomic tion in 200 paraffin-embedded tumor samples: utility in hybridization: evidence for clonal origin,” Human Pathology, diagnosing adipocytic lesions and comparison with immuno- vol. 30, no. 3, pp. 295–299, 1999. histochemistry and real-time PCR,” American Journal of [51]K.C.Chang,P.I.Chen,Z.H.Huang,Y.M.Lin,andP.L.Kuo, Surgical Pathology, vol. 31, no. 10, pp. 1476–1489, 2007. “Adrenal myelolipoma with translocation (3;21)(q25;p11),” [65] J. Weaver, E. Downs-Kelly, J. R. Goldblum et al., “Fluorescence Cancer Genetics and Cytogenetics, vol. 134, no. 1, pp. 77–80, in situ hybridization for MDM2 gene amplification as a 2002. diagnostic tool in lipomatous neoplasms,” Modern Pathology, [52] N. Mandahl, F. Mertens, H. Willen,A.Rydholm,A.Kre-´ vol. 21, no. 8, pp. 943–949, 2008. icbergs, and F. Mitelman, “Nonrandom pattern of telomeric [66]J.Weaver,P.Rao,J.R.Goldblumetal.,“CanMDM2analytical associations in atypical lipomatous tumors with ring and giant tests performed on core needle biopsy be relied upon to marker chromosomes,” Cancer Genetics and Cytogenetics,vol. diagnose well-differentiated liposarcoma?” Modern Pathology, 103, no. 1, pp. 25–34, 1998. vol. 23, no. 10, pp. 1301–1306, 2010. [53] P. D. Cin, P. Kools, R. Sciot et al., “Cytogenetic and fluores- [67]W.H.Henricks,Y.C.Chu,J.R.Goldblum,andS.W.Weiss, cence in situ hybridization investigation of ring chromosomes “Dedifferentiated liposarcoma: a clinicopathological analysis characterizing a specific pathologic subgroup of adipose tissue of 155 cases with a proposal for an expanded definition of tumors,” Cancer Genetics and Cytogenetics, vol. 68, no. 2, pp. dedifferentiation,” American Journal of Surgical Pathology,vol. 85–90, 1993. 21, no. 3, pp. 271–281, 1997. [54] F. Pedeutour, R. F. Suijkerbuijk, J. Van Gaal et al., “Chro- [68] F. Elgar and J. R. Goldblum, “Well-differentiated liposarcoma mosome 12 origin in rings and giant markers in well- of the retroperitoneum: a clinicopathologic analysis of 20 differentiated liposarcoma,” Cancer Genetics and Cytogenetics, cases, with particular attention to the extent of low-grade vol. 66, no. 2, pp. 133–134, 1993. dedifferentiation,” Modern Pathology, vol. 10, no. 2, pp. 113– [55] F. Pedeutour, R. F. Suijkerbuijk, A. Forus et al., “Complex 120, 1997. composition and co-amplification of SAS and MDM2 in ring [69] D. Gisselsson, M. Hoglund,F.Mertensetal.,“Thestructure¨ and giant rod marker chromosomes in well-differentiated and dynamics of ring chromosomes in human neoplastic and liposarcoma,” Genes Chromosomes and Cancer, vol. 10, no. 2, non-neoplastic cells,” Human Genetics, vol. 104, no. 4, pp. pp. 85–94, 1994. 315–325, 1999. [56] J. Szymanska, M. Tarkkanen, T. Wiklund et al., “Gains [70] J. Nishio, H. Iwasaki, M. Ishiguro et al., “Establishment of and losses of DNA sequences in liposarcomas evaluated by a novel human dedifferentiated liposarcoma cell line, FU- comparative genomic hybridization,” Genes Chromosomes and DDLS-1: conventional and molecular cytogenetic characteri- Cancer, vol. 15, no. 2, pp. 89–94, 1996. zation,” International Journal of Oncology,vol.22,no.3,pp. [57] F. Pedeutour, A. Forus, J. M. Coindre et al., “Structure of the 535–542, 2003. supernumerary ring and giant rod chromosomes in adipose [71] F. Chibon, O. Mariani, J. Derreetal.,“Asubgroupof´ tissue tumors,” Genes Chromosomes and Cancer, vol. 24, no. 1, malignant fibrous histiocytomas is associated with genetic pp. 30–41, 1999. changes similar to those of well-differentiated liposarcomas,” [58] A. P. Dei Tos, C. Doglioni, S. Piccinin et al., “Coordinated Cancer Genetics and Cytogenetics, vol. 139, no. 1, pp. 24–29, expression and amplification of the MDM2, CDK4, and 2002. HMGI-C genes in atypical lipomatous tumours,” Journal of [72] R. J. Rieker, S. Joos, C. Bartsch et al., “Distinct chromosomal Pathology, vol. 190, no. 5, pp. 531–536, 2000. imbalances in pleomorphic and in high-grade dedifferentiated [59] F. Micci, M. R. Teixeira, B. Bjerkehagen, and S. Heim, “Charac- liposarcomas,” International Journal of Cancer, vol. 99, no. 1, terization of supernumerary rings and giant marker chromo- pp. 68–73, 2002. somes in well-differentiated lipomatous tumors by a combi- [73] I. Hostein, J. M. Coindre, J. Derre,´ O. Mariani, F. Chibon, nation of G-banding, CGH, M-FISH, and chromosome- and and A. Aurias, “Comparative genomic hybridization study locus-specific FISH,” Cytogenetic and Genome Research,vol. of paraffin-embedded dedifferentiated liposarcoma fixed with 97, no. 1-2, pp. 13–19, 2002. Holland Bouin’s fluid,” Diagnostic Molecular Pathology,vol.12, [60] A. Italiano, L. Bianchini, F. Keslair et al., “HMGA2 is the no. 3, pp. 166–173, 2003. partner of MDM2 in well-differentiated and dedifferentiated [74] O. Mariani, C. Brennetot, J. M. Coindre et al., “JUN oncogene liposarcomas whereas CDK4 belongs to a distinct inconsistent amplification and overexpression block adipocytic differentia- amplicon,” International Journal of Cancer, vol. 122, no. 10, pp. tion in highly aggressive sarcomas,” Cancer Cell, vol. 11, no. 4, 2233–2241, 2008. pp. 361–374, 2007. [61] D. Trombetta, F. Mertens, A. Lonoce et al., “Characterization [75] F. Chibon, O. Mariani, J. Derre´ et al., “ASK1 (MAP3K5) of a hotspot region on chromosome 12 for amplification as a potential therapeutic target in malignant fibrous histi- in ring chromosomes in atypical lipomatous tumors,” Genes ocytomas with 12q14q-q15 and 6q23 amplifications,” Genes Chromosomes and Cancer, vol. 48, no. 11, pp. 993–1001, 2009. Chromosomes and Cancer, vol. 40, no. 1, pp. 32–37, 2004. [62] M. R. Erickson-Johnson, A. R. Seys, C. W. Roth et al., [76] A. A. Sandberg, “Updates on the cytogenetics and molecular “Carboxypeptidase M: a biomarker for the discrimination genetics of bone and soft tissue tumors: liposarcoma,” Cancer of well-differentiated liposarcoma from lipoma,” Modern Genetics and Cytogenetics, vol. 155, no. 1, pp. 1–24, 2004. Pathology, vol. 22, no. 12, pp. 1541–1547, 2009. [77] C. Turc-Carel, J. Limon, and P. Dal Cin, “Cytogenetic studies [63] M. Nilsson, L. A. Meza-Zepeda, F. Mertens, A. Forus, O. of adipose tissue tumors. II. Recurrent reciprocal translocation Myklebost, and N. Mandahl, “Amplification of chromosome t(12;16) (q13;p11) in myxoid liposarcomas,” Cancer Genetics 1 sequences in lipomatous tumors and other sarcomas,” and Cytogenetics, vol. 23, no. 4, pp. 291–299, 1986. Journal of Biomedicine and Biotechnology 9

[78]C.Sreekantaiah,C.P.Karakousis,S.P.L.Leong,andA.A. analysis of human sarcomas: I. Occurrence of genomic Sandberg, “Cytogenetic findings in liposarcoma correlate with imbalances and identification of a novel major amplicon at histopathologic subtypes,” Cancer, vol. 69, no. 10, pp. 2484– 1q21-q22 in soft tissue sarcomas,” Genes Chromosomes and 2495, 1992. Cancer, vol. 14, no. 1, pp. 8–14, 1995. [79] B. P. Rubin and P. Dal Cin, “The genetics of lipomatous [94] P. Popov, M. Virolainen, E. Tukiainen et al., “Primary soft tis- tumors,” Seminars in Diagnostic Pathology,vol.18,no.4,pp. sue sarcoma and its local recurrence: genetic changes studied 286–293, 2001. by comparative genomic hybridization,” Modern Pathology, [80] H. Iwasaki, K. Nabeshima, J. Nishio et al., “Pathology of soft- vol. 14, no. 10, pp. 978–984, 2001. tissue tumors: daily diagnosis, molecular cytogenetics and [95] R. S. de Vreeze, D. de Jong, W. Koops et al., “Oncogenesis experimental approach,” Pathology International, vol. 59, no. and classification of mixed-type liposarcoma: a radiological, 8, pp. 501–521, 2009. histopathological and molecular biological analysis,” Interna- [81] I. Panagopoulos, M. Hoglund,¨ F. Mertens, N. Mandahl, F. tional Journal of Cancer, vol. 128, no. 4, pp. 778–786, 2011. Mitelman, and P. Aman,˚ “Fusion of the EWS and CHOP genes [96] R. Schneider-Stock, H. Walter, K. Radig et al., “MDM2 ampli- in myxoid liposarcoma,” Oncogene, vol. 12, no. 3, pp. 489–494, fication and loss of heterozygosity at Rb and p53 genes: no 1996. simultaneous alterations in the oncogenesis of liposarcomas,” [82] I. Panagopoulos, C. Lassen, M. Isaksson, F. Mitelman, N. JournalofCancerResearchandClinicalOncology, vol. 124, no. Mandahl, and P. Aman,˚ “Characteristics sequence motifs at 10, pp. 532–540, 1998. the breakpoints of the hybrid genes FUS/CHOP, EWS/CHOP [97] T. Mentzel, G. Palmedo, M. Hantschke, J. Woziwodzki, and FUS/ERG in myxoid liposarcoma and acute myeloid and C. Beck, “Mixed-type liposarcoma: clinicopathological, leukemia,” Oncogene, vol. 15, no. 11, pp. 1357–1362, 1997. immunohistochemical, and molecular analysis of a case [83] P. Dal Cin, R. Sciot, I. Panagopoulos et al., “Additional arising in deep soft tissues of the lower extremity,” Virchows evidence of a variant translocation t(12;22) with EWS/CHOP Archiv, vol. 453, no. 2, pp. 197–201, 2008. fusion in myxoid liposarcoma: clinicopathological features,” [98] H. Zhang, M. Erickson-Johnson, X. Wang et al., “Molecular Journal of Pathology, vol. 182, no. 4, pp. 437–441, 1997. testing for lipomatous tumors: critical analysis and test [84] K. Mrozek and C. D. Bloomfield, “Der(16)t(1;16) is a sec- recommendations based on the analysis of 405 extremity- ondary chromosome aberration in at least eighteen different based tumors,” American Journal of Surgical Pathology, vol. 34, types of human cancer,” Genes Chromosomes and Cancer,vol. no. 9, pp. 1304–1311, 2010. 23, no. 1, pp. 78–80, 1998. [85] Z. Gibas, M. Miettinen, J. Limon et al., “Cytogenetic and immunohistochemical profile of myxoid liposarcoma,” Amer- ican Journal of Clinical Pathology, vol. 103, no. 1, pp. 20–26, 1995. [86] N. C. Birch, C. R. Antonescu, M. Nelson et al., “Inconspicuous insertion 22;12 in myxoid/round cell liposarcoma accompa- nied by the secondary structural abnormality der(16)t(1;16),” Journal of Molecular Diagnostics, vol. 5, no. 3, pp. 191–194, 2003. [87] E. Downs-Kelly, J. R. Goldblum, R. M. Patel et al., “The utility of fluorescence in situ hybridization (FISH) in the diagnosis of myxoid soft tissue neoplasms,” American Journal of Surgical Pathology, vol. 32, no. 1, pp. 8–13, 2008. [88] F. Parente, J. Grosgeorge, J. M. Coindre, P. Terrier, O. Vilain, and C. Turc-Carel, “Comparative genomic hybridization reveals novel chromosome deletions in 90 primary soft tissue tumors,” Cancer Genetics and Cytogenetics, vol. 115, no. 2, pp. 89–95, 1999. [89] H. Schmidt, F. Bartel, M. Kappler et al., “Gains of 13q are correlated with a poor prognosis in liposarcoma,” Modern Pathology, vol. 18, no. 5, pp. 638–644, 2005. [90]T.Ohguri,M.Hisaoka,S.Kawauchietal.,“Cytogenetic analysis of myxoid liposarcoma and myxofibrosarcoma by array-based comparative genomic hybridisation,” Journal of Clinical Pathology, vol. 59, no. 9, pp. 978–983, 2006. [91] F. Mertens, C. D. M. Fletcher, P. Dal Cin et al., “Cytogenetic analysis of 46 pleomorphic soft tissue sarcomas and correla- tion with morphologic and clinical features: a report of the champ study group,” Genes Chromosomes and Cancer, vol. 22, no. 1, pp. 16–25, 1998. [92] S. Sugita, K. Seki, K. Yokozawa et al., “Analysis of CHOP rear- rangement in pleomorphic liposarcomas using fluorescence in situ hybridization,” Cancer Science, vol. 100, no. 1, pp. 82–87, 2009. [93] A. Forus, D. O. Weghuis, D. Smeets, O. Fodstad, O. Myklebost, and A. G. Van Kessel, “Comparative genomic hybridization Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 636170, 7 pages doi:10.1155/2011/636170

Research Article Enhancement of 2,3-Butanediol Production by Klebsiella oxytoca PTCC 1402

Maesomeh Anvari1 and Mohammad Reza Safari Motlagh2

1 Department of Microbiology, Faculty of Sciences, Islamic Azad University, Rasht Branch, P.O. Box 41335-3516, Rasht, Iran 2 Department of Plant Pathology, Faculty of Agriculture, Islamic Azad University, Rasht Branch, P.O. Box 41335-3516, Rasht, Iran

Correspondence should be addressed to Mohammad Reza Safari Motlagh, [email protected]

Received 1 November 2010; Accepted 17 December 2010

Academic Editor: J. Birchler

Copyright © 2011 M. Anvari and M. R. Safari Motlagh. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Optimal operating parameters of 2,3-Butanediol production using Klebsiella oxytoca under submerged culture conditions are determined by using Taguchi method. The effect of different factors including medium composition, pH, temperature, mixing intensity, and inoculum size on 2,3-butanediol production was analyzed using the Taguchi method in three levels. Based on these analyses the optimum concentrations of glucose, acetic acid, and succinic acid were found to be 6, 0.5, and 1.0 (% w/v), respectively. Furthermore, optimum values for temperature, inoculum size, pH, and the shaking speed were determined as 37◦C, 8 (g/L), 6.1, and 150 rpm, respectively. The optimal combinations of factors obtained from the proposed DOE methodology was further validated by conducting fermentation experiments and the obtained results revealed an enhanced 2,3-Butanediol yield of 44%.

1. Introduction the rest of the test variables constant. This single-factor-at-a- time strategy is generally time consuming and requires a large 2,3-Butanediol, otherwise known as 2,3-butylene glycol number of experiments to be carried out. Taguchi’s method (2,3-BD), is a valuable chemical feedstock because of its is based upon an approach, which is completely different application as a solvent, a liquid fuel, and a precursor of many from the conventional practices of quality engineering. This synthetic polymers and resins [1]. A wide variety of chemi- methodology emphasizes integrating quality into products cals can also be easily prepared from 2,3-butanediol [2]. Cur- and processes, whereas usual practice relies upon inspection rently, the manufacturing of 2,3-butanediol is still growing [9]. In the present study, we optimized 2,3-butanediol by an annual rate of 4–7% due to the increased demand for production under submerged culture conditions by Klebsiella γ polybutylene terephthalate resin, -butyrolactone, spandex, oxytoca PTCC 1402 using Taguchi methodology. and their precursors [3]. Interest in microbial production of 2,3-butanediol has been increasing recently due to extensive industrial applica- 2. Materials and Methods tion of this product [4]. Many bacterial species produce 2,3- butanediol by fermentation, but the best producers seem to 2.1. Microorganism. Bacterial strain used in this study was be Klebsiella oxytoca [5], Enterobacter aerogenes [6], Bacillus Klebsiella oxytoca PTCC 1402, obtained from the Iranian polymyxa [7], and Bacillus licheniformis [8]. Research Organization for Science and Technology (IROST). This work primarily aimed at optimizing the process The strain was maintained on nutrient agar slants at 4◦Cand variables for production of 2,3-butanediol in using statistical subcultured monthly. The preculture medium was nutrient optimization technique for multivariable effect. The classical broth containing 2.0 g/L yeast extract, 5.0 g/L peptone, method of optimization involves varying the level of one 5.0 g/L NaCl, and 1.0 g/L beef extract, sterilized at 121◦Cfor parameter at a time over a certain range while holding 15 min. 2 Journal of Biomedicine and Biotechnology

2.2. Taguchi Methodology. Taguchi method of design of Table 1: The selected fermentation factors and their assigned levels. experimental (DOE) involves establishment of a large num- ber of experimental situations described as orthogonal array No. Factor Level 1 Level 2 Level 3 (OA) to reduce experimental errors and to enhance their a Glucose (% w/v) 3.0 6.0 9.0 efficiency and reproducibility of the laboratory experiments b Acetic acid (% w/v) 0.1 0.5 1.0 [10]. The first step is to determine the various factors to c Succinic acid (% w/v) 0.5 1.0 1.5 be optimized in the culture medium that have critical effect d pH 6.1 6.8 7.5 on the 2,3-butanediol production. Factors were selected eTemperature(◦C) 28 32 37 and the ranges were further assigned based on the group f Mixing intensity (rpm) 120 150 180 consensus consisting of design engineers, scientists, and gInoculumsize(g/L)258 technicians with relevant experience. Based on the obtained experimental data, seven factors having significant influence on the 2,3-butanediol production were selected for the 2.4. Software. Qualitek-4 software (Nutek Inc., MI) for present Taguchi DOE study to optimize the submerged cul- automatic design of experiments using Taguchi approach was ture condition. Seven factors (glucose, acetic acid, succinic used in the present study. Qualitek-4 software is equipped acid, temperature, pH, mixing intensity, and inoculum size) to use L-4 to L-64 arrays along with selection of 2 to 63 which showed significantly influence on the 2,3-Butanediol factors with two, three, and four levels to each factor. The production [1, 4, 6, 11, 12] were considered in the present automatic design option allows Qualitek-4 to select the array experimental situation (Table 1). used and assign factors to the appropriate columns. The The next step was to design the matrix experiment and to obtained experimental data was processed in the Qualitek- define the data analysis procedure. The appropriate OAs for 4 software with bigger and better quality characteristics for the control parameters to fit a specific study were selected. the determination of the optimum culture conditions for the Taguchi provides many standard OAs and corresponding fermentation, to identify individual factors influence on the linear graphs for this purpose [13]. In the present case, the 2,3-butanediol production and to estimate the performance three levels of factors variation were considered and the size (fermentation) at the optimum conditions. of experimentation was represented by symbolic arrays L18 (which indicates 18 experimental trails). Seven factors with three levels were used and are depicted in Tables 1 and 2. 3. Results and Discussion In the design OA, each column consists of a number of Submerged fermentation experiments studies with the conditions depending on the levels assigned to each factor. designed experimental condition showed significant varia- Submerged fermentation experiments were carried out in tion in the 2,3-butanediol yield (Table 2). Production levels cotton plugged 500 ml erlenmeyer flasks containing 100 ml were found to be very much dependent on the culture of production medium ((g/100 ml of distilled water) glucose conditions. Variation of values in 2,3-butanediol yield at (3.0, 6.0, and 9.0), yeast extract 1, acetic acid (0.1, 0.5, assigned levels by K. oxytoca PTCC1402 was depicted in and 1), succinic acid (0.5, 1.0, and 1.5), (NH4)2HPO4 2.4, Table 3 and Figure 1. · · MgSO4 7H2O 0.088, KCl 0.18, EDTA 0.051, FeSO4 7H2O The difference between average value of each factor at ∗ −3 · ∗ −3 · 2.25 10 ,ZnSO4 7H2O0.75 10 ,MnSO4 7H2O higher level and lower level indicated the relative influence − 0.28 ∗ 10 3, and sodium citrate 0.0295 dissolved in 100 ml of the effect at their individual capacities. The positive or of distilled water and pH adjusted by adding NaOH or HCl negative sign denoted variation of yield values from level 1 ◦ prior to sterilization, 15 min, 121 C. Glucose was sterilized to 2 or 3. Glucose (carbon source) and acetic acid showed separately). positive impact with increase in their concentration, while Submerged fermentation experiments were performed incubation temperature and inoculum size had negligible for 2,3-butanediol production with Klebsiella oxytoca PTCC impact on 2,3-butanediol yield, whereas medium pH had 1402 employing selected 18 experimental trails (Table 2)in negative influence (Figure 1). Subsector level data denoted combination with 7 factors at three levels (Table 1)andthe that pH factor caused negative influence on 2,3-butanediol result was calculated from each set as 2,3-butanediol yield (g yield, while the rest of the selected factors showed positive product/g substrate) and shown in Table 2. effect with change in fermentation parameter values from level 1 to 2 (Table 3). Similarly, further increase in parameter 2.3. Analysis. Cell concentration of the inoculum was deter- values to level 3 varied the 2,3-butanediol yield (Table 3). mined by optical density measurement at 620 nm using a These data further confirmed that the physiological factor calibration curve to relate this parameter to cell mass dry and their concentrations were important in achieving better weight. 2,3-Butanediol concentrations were determined by a 2,3-butanediol production. Such variation was also noted Fractovap 4200 gas chromatograph (Carlo Erba, Milan, Italy) with 2,3-butanediol production by other microbes [1, 6]. using a Chromosorb 101 column (Supelco, Bellefonte, PA) Among the factors studied, glucose showed stronger ◦ operated with N2 as the carrier gas, at 250 C injector tem- influence compared to other factors followed by acetic acid, perature, 300◦C detector temperature, and 175◦C column succinic acid, and mixing intensity in the 2,3-butanediol temperature, and using n-butanol as the internal standard. yield. Individually at level stage pH has the highest effect in Glucose was assayed through the use of a glucose kit. level 1 whereas glucose and temperature have high effects Journal of Biomedicine and Biotechnology 3

Table 2: The experimental setup (L-18 orthogonal array).

Factor levels Expt. no. 2,3-butanediol yield (g product/g substrate) abcdefg 1 1 1 1 1 1 1 1 0.120 2 1 2 2 2 2 2 2 0.341 3 1 3 3 3 3 3 3 0.204 4 2 1 1 2 2 3 3 0.272 5 2 2 2 3 3 1 1 0.432 6 2 3 3 1 1 2 2 0.303 7 3 1 2 1 3 2 3 0.404 8 3 2 3 2 1 3 1 0.186 9 3 3 1 3 2 1 2 0.076 10 1 1 3 3 2 2 1 0.129 11 1 2 1 1 3 3 2 0.293 12 1 3 2 2 1 1 3 0.244 13 2 1 2 3 1 3 2 0.297 14 2 2 3 1 2 1 3 0.420 15 2 3 1 2 3 2 1 0.322 16 3 1 3 2 3 1 2 0.138 17 3 2 1 3 1 2 3 0.308 18 3 3 2 1 2 3 1 0.222

Table 3: The main effects of the factors at the assigned levels on 2,3-butanediol yield.

Factors Level 1 Level 2 Level 3 L2 − L1 L3 − L2 Glucose 0.221 0.340 0.222 0.119 −0.119 Acetic acid 0.226 0.329 0.228 0.102 −0.101 Succinic acid 0.231 0.323 0.230 0.091 −0.093 pH 0.293 0.250 0.240 −0.043 −0.011 Temperature 0.243 0.243 0.298 0.000 0.054 Mixing intensity 0.238 0.301 0.245 0.062 −0.056 Inoculum size 0.235 0.241 0.308 0.006 0.067

in levels 2 and 3 respectively on 2,3-butanediol yield. With acetate, propionate, pyruvate, and succinate enhanced 2,3- increasing glucose concentration the yield decreased and butanediol production. Among the organic acids giving an these results show that the fermentation time gradually grows enhanced 2,3-butanediol production, acetate seemed to be and the conversion yield lowers with increasing the starting the most appropriate additive because it gave the highest substrate level, which is in agreement with what is observed 2,3-butanediol production [16]. While acetate at high levels for most fermentation processes [6]. To explain such a may be inhibitory to Klebsiella oxytoca, low levels of acetate yield decrease, additional determinations were performed stimulate 2,3-butanediol production [15]. Stormer noted to detect the possible formation of by-products, already that acetate in its ionized form induces acetolactate synthase observed by Raspoet in various B. licheniformis strains [14]. formation and thereby enhances the catalysis of pyruvate It was demonstrated that, whenever the overall yield of to 2,3-butanediol [17]. The production of 2,3-butanediol diol lowered, the formations of acetate, ethanol, format, by K. oxytoca NRRL B-199 was enhanced in the presence glycerol, and lactate were favored and these by-products of low levels (>8g/l) of lactate [18]. Klebsiella oxytoca became even predominant. These results agree with well- ATCC 8724 grew well on xylose with 10 g/l succinate and known shifts in the fermentation products that occur in produced additional 2,3-butanediol [19]. The production many microorganisms under conditions of high availability of 2,3-butanediol by E. cloacae NRRL B-23289 was also of the energy source [1]. enhanced by the supplementation of acetate, lactate, and It is reported that 2,3-butanediol production can be succinate [2]. New finding suggested that some amount increased by addition of different organic acids, because of ethanol is formed by acetate reduction. Relative to they are intermediate metabolites for 2,3-butanediol pro- this, a previous report demonstrated that acetate is con- duction [15]. Nakashimada et al. found that addition of verted to butanediol by condensation with pyruvate after 4 Journal of Biomedicine and Biotechnology

0.64 0.62

0.61 0.59 0.56 0.58 0.53 0.55 0.5 2,3-butanediol yield 0.52 2,3-butanediol yield 0.47

0.49 0.44 123 123 (a) (b)

0.64 0.6 0.62 0.58 0.6 0.58 0.56

0.56 0.54 0.54 2,3-butanediol yield 2,3-butanediol yield 0.52 0.52 0.5 0.5 123 123 (c) (d)

0.6 0.6 0.59 0.58 0.58 0.57 0.56 0.56 0.55 0.54 0.54 0.53 2,3-butanediol yield 2,3-butanediol yield 0.52 0.52 0.51 0.5 0.5 123 123 (e) (f)

0.62

0.6

0.58

0.56

0.54

2,3-butanediol yield 0.52

0.5 123 (g)

Figure 1: Impact of selected fermentation-factor-assigned level on 2,3-butanediol yield by K. oxytoca. Impact of selected-factor-assigned levels on 2,3-butanediol yield by K. oxytoca. X-axis represents assigned levels of selected factor and Y-axis represents 2,3-butanediol yield. (a) Glucose, (b) acetic acid, (c) succinic acid, (d) pH, (e) temperature, (f) mixing intensity, and (g) inoculum size G (- - -) indicates average 2,3-butanediol yield during experimentation and (—) indicates individual factors contribution 2,3-butanediol yield during experimentation. Journal of Biomedicine and Biotechnology 5 the reduction of acetate to acetaldehyde [16]. Our findings confirm increasing effect of acetic acid on 2,3-butanediol yield. In the study 2,3-butanediol yield of K. oxytoca at initial substrate concentrations was considerably enhanced by the addition of 0.5% acetic acid to the media. In the case of succinic acid when the initial concentration of acid was great, the greater the maximum butanediol yield was great too. With continuous increasing of succinic acid Glucose Temperature concentration the yield of butanediol produced as a result of Acetic acid Mixing intensity additional succinic acid decreased. Succinic acid Inoculum Increasing of temperature and inoculum size has resulted pH Error in increasing 2,3-butanediol production. Perego et al. in Figure 2: The relative influence of factors and interaction. an optimization study on 2,3-butanediol production by B. licheniformis (NCIMB 8059) found that butanediol produc- tion has a progressive increasing, when temperature was and inoculum size were observed to be major influential increased from 34 to 37◦C. Conversely, they all sharply ◦ parameters and contributed to more than 80% of total 2,3- decreased over 37 C, likely due to the well-known thermal butanediol yield (Table 5). inactivation of biosystems at temperature higher than the By studying the main effects of each of the factors, optimum. Thus supporting the assumption of considering the general trends of the influence of the factors towards 2,3-butanediol production as a process controlled enzyme the process can be characterized. The characteristics can be [1]. On the other hand carbon consumption depended on controlled such that a lower or a higher value in a particular the culture temperature [12]. influencing factor produces the preferred result. Thus, the An optimization study of glucose fermentation by B. levels of factors, to produce the best results, can be predicted. licheniformis, likely performed using a factorial experimental ANOVA with the percentage of contribution of each factor design, demonstrated that an increase in the inoculum size with interactions is shown in Table 5.Itcanbeobserved had positive effect on the yield as well [8]. from the table that glucose is the most significant factor Mixing intensity is another important factor for 2,3- for the 2,3-butanediol yield. Acetic acid and succinc acid butanediol production. Saha and Bothast postulates that are the next most important significant factors in the 2,3- aeration may be of value in removing carbon dioxide butanediol yield. The least influential factors among the produced in the process and thus have a stimulatory effect on selected parameters include pH, incubation temperature, the fermentation [2]. Although 2,3-butanediol is a product and mixing intensity under the studied experimental setup. of anaerobic fermentation, aeration is known to enhance its The error observed (0.521%) was very low which indicated production [20]. In the case of mixing intensity increase to the accuracy of the experimentation (Figure 2). level 2 resulted in increase and subsequent increase to level 3, Table 6 represents the optimum conditions required for showed decrease in 2,3-butanediol yield. This may respond the maximum 2,3-butanediol yield by this bacterial strain. to the other constitutive effect of culture media. Based on software prediction, the average performance of Table 4 indicates the interaction between two selected this strain in 2,3-butanediol yield was observed to be 0.261 factors. The interaction was measured based on severity (Table 6). index value calculated by software program. This value However, fermentation-optimized factors contribution between two selected factors varied (1–53%) with factor to in enhancing the 2,3-butanediol yield was noted to be factor (Table 4). 0.358. The data also suggested that glucose, acetic acid, and It is clear that the interaction between two least 2,3- succinic acid play a vital role contributing approximately butanediol yield influential factors (at their individual levels) 59% in 2,3-butanediol yield under the optimized conditions showed the highest severity index and vice versa with (Table 6). Temperature, mixing intensity, and inoculum size two highest influential factors (at their individual levels) also contributed to the tune of 33.5% in total 2,3-butanediol (Table 4). For example, the severity index between two least yield, while the pH of the medium contributed to only 7.5% impact factors, mixing intensity versus inoculum size, was (Table 6) under optimized environment. The experimental found to be 53.31%, while the severity index between two data showed an enhanced 2,3-butanediol yield of 0.467 higher impact factors, glucose versus succinic acid, was from 0.261 (44% improvement in butanediol yield) with the noted to be only 4.56%. These results further confirmed modified culture conditions. that each studied factor was important in 2,3-butanediol The study of interactive influence of selected factors yield and the influence of one factor on 2,3-butanediol (Table 6) revealed a unique relationship such as showing yield was dependent on the condition of the other factor in low influence on product production at individual level and optimization of 2,3-butanediol yield by K. oxytoca,although higher severity index at interactive level (Table 4), indicating they have different influences at their individual levels. the importance of parameter optimization on any product ANOVA data indicated percentage contribution of production and the role of various physicochemical param- selected parameters on 2,3-butanediol yield, which varied eters including carbon source, organic acids concentration, with factor to factor. Glucose, acetic acid, succinic acid, mixing intensity, temperature, and pH of the medium in 6 Journal of Biomedicine and Biotechnology

Table 4: The estimated interaction of severity index for different parameters.

Interacting factors Column∗ SI (%)• Col.♠ Opt. Mixing intensity ∗ inoculum (f ∗ g) 53.31 15 (2,3) Glucose ∗ inoculum (a ∗ g) 49.90 10 (2,1) Acetic acid ∗ mixing intensity (b ∗ f) 40.23 4 (2,1) Tem per ature ∗ mixing intensity (e ∗ f) 37.70 1 (3,2) Glucose ∗ pH (a ∗ d) 37.16 7 (2,3) Succinic acid ∗ mixing intensity (c ∗ f) 33.24 3 (2,2) Acetic acid ∗ temperature (b ∗ e) 30.56 5 (2,2) pH ∗ inoculum (d ∗ g) 29.35 13 (1,3) Succinic acid ∗ pH (c ∗ d) 27.40 1 (2,3) Glucose ∗ mixing intensity (a ∗ f) 26.09 5 (2,1) Tem per ature ∗ inoculum (e ∗ g) 25.44 14 (3,1) Acetic acid ∗ inoculum (b ∗ g) 17.74 11 (2,3) pH ∗ mixing intensity (d ∗ f) 17.53 2 (1,2) Acetic acid ∗ succinic acid (b ∗ c) 13.53 7 (2,2) Succinic acid ∗ temperature (c ∗ e) 10.32 2 (2,3) Glucose ∗ acetic acid (a ∗ b) 8.45 1 (2,2) Succinic acid ∗ inoculum (c ∗ g) 8.40 12 (2,1) Acetic acid ∗ pH (b ∗ d) 7.82 6 (2,3) Glucose ∗ succinic acid (b ∗ c) 4.56 6 (2,2) pH ∗ temperature (d ∗ e) 3.65 3 (1,3) Glucose ∗ temperature (a ∗ e) 1.53 4 (2,3) ∗Columns represent the column locations to which the interacting factors are assigned. •SI: interaction severity index (100% for 90◦ angle between the lines, 0% for parallel lines). ♠Col. Shows the column that should be reserved if this interaction effect were to be studied (2-L factors only). Opt. indicates the factor levels desirable for the optimum conditions (based strictly on the first two levels).

Table 5: Analysis of variance (ANOVA).

Factors DOF Sumofsquares(S)Variance(V)F-ratio(F) Pure sum (S)Precent(P%) Glucose 2 0.056 0.028 492.233 0.056 29.893 Acetic acid 2 0.041 0.020 365.194 0.041 22.162 Succinic acid 2 0.034 0.017 297.380 0.034 18.035 pH 2 0.009 0.004 82.273 0.009 4.945 Temperature 2 0.012 0.006 107.866 0.012 6.503 Mixing intensity 2 0.014 0.007 123.254 0.014 7.439 Inoculum size 2 0.019 0.009 173.59 0.019 10.502 Other/error 3 −0.001 −0.001 0.521 Total 17 0.185 100 microbial metabolism. Such factor-mediated regulation of Table 6: The optimal conditions and their performance in microbial fermentation was observed with many microbial production of 2,3-butanediol. species on any product [21]. Factors Level description Level Contribution Glucose (% w/v) 6 2 0.079 4. Conclusions Acetic acid (% w/v) 0.5 2 0.068 Culture conditions and media composition optimization Succinic acid (% w/v) 1.0 2 0.061 by a conventional one-at-the-approach led to a substantial pH 6 1 0.030 increase in 2,3-butanediol yield. However, this approach Temper ature ( ◦C) 37 3 0.036 not only is cumbersome and time consuming but also has Mixing intensity (rpm) 150 2 0.037 the limitation of ignoring the importance of interaction of Inoculum size (g/L) 8 3 0.047 various parameters. Taguchi approach of OA experimental design for process optimization, involving a study of a given system by a set of independent variables (factors) over a of individual factors, establishs the relationship between specific region of interest (levels) by identifying the influence variables and operational conditions and finally establishs Journal of Biomedicine and Biotechnology 7 the performance at the optimum levels obtained. In this [13] G. Taguchi, S. Chowdhury, and Y. Wu, Taguchi’s Qualit y methodology, the desired design is sought by selecting the Engineering Handbook, John Wiley & Sons, New York, NY, best performance under conditions that produces consistent USA, 2004. performance leading to a more fully developed process. The [14] D. Raspoet, B. Pot, D. De Deyn, P. De Vos, K. Kersters, and obtained optimal culture condition for the 2,3-butanediol J. De Ley, “Differentiation between 2,3-butanediol producing production from the proposed methodology was validated Bacillus licheniformis and B. polymyxa strains by fermenta- by performing the experiments with the obtained conditions. tion product profiles and whole-cell protein electrophoretic patterns,” Systematic and Applied Microbiology,vol.14,no.1, pp. 1–7, 1991. Acknowledgment [15] E. K. C. Yu and J. N. Saddler, “Enhanced production of 2,3- butanediol by Klebsiella pneumoniae grown on high sugar This experiment was supported by the Islamic Azad Univer- concentrations in the presence of acetic acid,” Applied and sity, Rasht Branch, Iran. Environmental Microbiology, vol. 44, no. 4, pp. 777–784, 1982. [16] Y. Nakashimada, B. Marwoto, T. Kashiwamura, T. Kakizono, References and N. Nishio, “Enhanced 2,3-butanediol production by addition of acetic acid in Paenibacillus polymyxa,” Journal of [1] P. Perego, A. Converti, and M. Del Borghi, “Effects of temper- Bioscience and Bioengineering, vol. 90, no. 6, pp. 661–664, ature, inoculum size and starch hydrolyzate concentration on 2000. butanediol production by Bacillus licheniformis,” Bioresource [17] F. C. Stormer, “Evidence for regulation of Aerobacter aerogenes Technology, vol. 89, no. 2, pp. 125–131, 2003. pH6 acetolactate forming enzyme by acetate ion,” Biochemical [2] B. C. Saha and R. J. Bothast, “Production of 2,3-butanediol by and Biophysical Research Communications, vol. 74, no. 3, newly isolated Enterobacter cloacae,” Applied Microbiology and pp. 898–902, 1977. Biotechnology, vol. 52, no. 3, pp. 321–326, 1999. [18] N. Qureshi and M. Cheryan, “Effect of lactic acid on growth [3] D. H. Mallonee and R. A. Speckman, “Development of and butanediol production by Klebsiella oxytoca,” Journal of a mutant strain of Bacillus polymyxa showing enhanced Industrial Microbiology, vol. 4, no. 6, pp. 453–456, 1989. production of 2,3-butanediol,” Applied and Environmental [19] M. A. Eiteman and J. H. Miller, “Effect of succinic acid on 2,3- Microbiology, vol. 45, no. 1, pp. 168–171, 1988. butanediol production by Klebsiella oxytoca,” Biotechnology [4] J. Qin, Z. Xiao, C. Ma, N. Xie, P. Liu, and P. Xu, “Production Letters, vol. 17, no. 10, pp. 1057–1062, 1995. of 2,3-butanediol by Klebsiella pneumoniae using glucose and ammonium phosphate,” Chinese Journal of Chemical [20]N.B.Jansen,M.C.Flickinger,andG.T.Tsao,“Production Engineering, vol. 14, no. 1, pp. 132–136, 2006. of 2,3-butanediol from D-xylose by Klebsiella oxytoca ATCC [5]B.P.Grover,S.K.Garg,andJ.Verma,“Productionof2,3- 8724,” Biotechnology and Bioengineering, vol. 26, no. 4, butanediol from wood hydrolysate by Klebsiella pneumoniae,” pp. 362–369, 1984. World Journal of Microbiology & Biotechnology,vol.6,no.3, [21]P.A.Nagarjun,R.S.Rao,S.Rajesham,andL.V.Rao, pp. 328–332, 1990. “Optimization of lactic acid production in SSF by Lactobacillus [6] P. Perego, A. Converti, A. Del Borghi, and P. Canepa, “2,3- amylovorus NRRL B-4542 using Taguchi Methodology,” Jour- butanediol production by Enterobacter aerogenes: selection nal of Microbiology, vol. 43, no. 1, pp. 38–43, 2005. of the optimal conditions and application to food industry residues,” Bioprocess Engineering, vol. 23, no. 6, pp. 613–620, 2000. [7] C. de Mas, N. B. Jansen, and G. T. Tsao, “Production of optically active 2,3-butanediol by Bacillus polymyxa,” Biotech- nology and Bioengineering, vol. 31, no. 4, pp. 366–377, 1988. [8]S.S.Nilegaonkar,S.B.Bhosale,C.N.Dandage,andA.H. Kapadi, “Potential of Bacillus licheniformis for the production of 2,3-butanediol,” Journal of Fermentation and Bioengineer- ing, vol. 82, no. 4, pp. 408–410, 1996. [9] D. C. Hao, P. H. Zhu, S. L. Yang, and L. Yang, “Optimization of recombinant cytochrome P450 2C9 protein production in Escherichia coli DH5α by statistically-based experimental design,” World Journal of Microbiology and Biotechnology, vol. 22, no. 11, pp. 1169–1176, 2006. [10] D. C. Montgomery, Design and Analysis of Experiments,John Wiley & Sons, New York, NY, USA, 2004. [11] S. Ghosh and T. Swaminathan, “Optimization of process variables for the extractive fermentation of 2,3-butanediol by Klebsiella oxytoca in aqueous two-phase system using response surface methodology,” Chemical and Biochemical Engineering Quarterly, vol. 17, no. 4, pp. 319–325, 2003. [12] B. Marwoto, Y. Nakashimada, T. Kakizono, and N. Nishio, “Enhancement of (R, R)-2,3-butanediol production from xylose by Paenibacillus polymyxa at elevated temperatures,” Biotechnology Letters, vol. 24, no. 2, pp. 109–114, 2002. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 370195, 9 pages doi:10.1155/2011/370195

Research Article Cytogenetics of Premature Ovarian Failure: An Investigation on 269 Affected Women

Simona Baronchelli,1 Donatella Conconi,1 Elena Panzeri,1 Angela Bentivegna,1 Serena Redaelli,1 Sara Lissoni,2 Fabiana Saccheri,2 Nicoletta Villa,2 Francesca Crosti,2 Elena Sala,2 Emanuela Martinoli,3 Marinella Volonte,` 3 Anna Marozzi,3 and Leda Dalpra` 1, 2

1 Dipartimento di Neuroscienze e Tecnologie Biomediche, Universita` degli Studi di Milano-Bicocca, Via Cadore 48, 20900 Monza, Italy 2 US Genetica Medica, Ospedale San Gerardo, 20900 Monza, Italy 3 Dipartimento di Biologia e Genetica per Scienze Mediche, Universita` degli Studi di Milano, 20133 Milano, Italy

Correspondence should be addressed to Leda Dalpra,` [email protected]

Received 14 September 2010; Revised 11 November 2010; Accepted 14 December 2010

Academic Editor: Ricardo Benavente

Copyright © 2011 Simona Baronchelli et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The importance of X chromosome in the aetiology of premature ovarian failure (POF) is well-known but in many cases POF still remains idiopathic. Chromosome aneuploidy increase is a physiological phenomenon related to aging, but the role of low-level sex chromosome mosaicism in ovarian function is still undiscovered. Standard cytogenetic analysis was carried out in a total of 269 patients affected by POF: 27 chromosomal abnormalities were identified, including X chromosome and autosomal structural and numerical abnormalities. In 47 patients with 46,XX karyotype we performed interphase FISH using X alpha-satellite probe in order to identify X chromosome mosaicism rate. Aneuploidy rate in the patient group was significantly higher than the general population group. These findings underline the importance of X chromosome in the aetiology of POF and highlight the potential role of low-level sex chromosome mosaicism in ovarian aging that may lead to a premature onset of menopause.

1. Introduction of 40, associated with elevated gonadotropins serum levels (FSH ≥ 40 UI/l) and affects at least 1%–3% of women The increase of chromosome aneuploidy in human lympho- of reproductive age [15]. The aetiology of POF is highly cytes with aging has been described since early 1960s [1, 2]. heterogeneous including genetic, autoimmune, metabolic Numerous reports confirmed the observations of Jacobs and and infectious causes, but in most cases the aetiology is still colleagues and showed that hypodiploidy increases with age unknown [16, 17]. The most common genetic causes of POF and is more common than hyperdiploidy [3–6]. Subsequent are X chromosome abnormalities [18, 19], ranging from studies on metaphase spreads from peripheral blood lym- numerical defects, deletions, X-autosome translocations, and phocytes demonstrated that there was a preferential loss of X isochromosomes [17]. Turner syndrome, associated to X and Y chromosomes in female and male, respectively [7–10], monosomy, leads to ovarian dysgenesis and accelerated suggesting that loss of sex chromosomes follows an upward follicular atresia, showing that two intact X chromosomes are trend according to aging. An increase in micronucleus essential for the maintenance of ovarian function as many formation with age has been highlighted in many studies and genes, probably involved in ovarian function, escape X inac- in particular a high overrepresentation of the X chromosome tivation and are required for a normal ovarian development in lymphocyte micronuclei of women [6, 11–14]. and maintenance [16, 20–22]. On the other hand, X trisomy Premature ovarian failure (POF, OMIM 311360) is seems to be related to ovarian dysfunction as 47,XXX women defined as the cessation of ovarian function before the age might experience oligomenorrhea, secondary amenorrhea, 2 Journal of Biomedicine and Biotechnology and early menopause [23]. Moreover the role of low-level probe was used as reference signal in order to evaluate sex chromosome mosaicism in ovarian function is still hybridization efficiency. A range of 40–210 nuclei was unknown, in most cases they escape diagnosis because they analyzed for each case. only monosomic and trisomic cells do not seem to cause any phenotypic effect [24, 25]. for X chromosome were taken into account to determine the The aim of this work is to carry out a study on a aneuploidy rate, since other anomalous categories are small group of 269 patients affected by POF, through a cytogenetic and so irrelevant [32]. investigation, in order to identify chromosomal abnormal- ities. Moreover, we assessed an analysis on X chromosome 2.4. Statistical Analysis. χ2 test was carried out on raw data aneuploidy, by means of FISH on interphase nuclei, to using a Microsoft Excel spreadsheet (Microsoft Corporation, evaluate low-level sex chromosome mosaicism rate, trying to Redmond, WA). Data analysis between the two groups understand if there is a correlation between advanced and analyzed was considered significant, setting a threshold equal increased loss of X chromosome and POF. to P<.05.

2. Materials and Methods 3. Results 2.1. Clinical Population. A total of 269 patients affected High-resolution cytogenetic analysis (QFQ banding) by POF referred to genetic laboratory for conventional of peripheral blood lymphocytes from 269 patients cytogenetic analysis. A subpart of this case group has been revealed 27 chromosomal abnormalities (Table 1 and already published in previous works by Vegetti et al. (1998); Figure 1). There were 13 nonmosaic X chromosome Tibiletti et al. (1999) and Marozzi et al. (2000) [26–28]. In structural abnormalities (48.2% of detected abnormalities), this study all of the patients had the cessation of menses including X-autosome translocations, X;Y translocations, for a duration of 6 months or longer, with FSH levels ≥ Xq deletions, and pseudodicentric chromosomes. The of 40 IU/l, before or at the age of 40 (POF1), or between 46,X,der(X)t(X;Y)(q26.2;q11.223) was a maternal inherited the age of 41 and 45 years (POF2). Also patients affected translocation and the mother ceased her menses at 40 by primary amenorrhea were included in the study group, years of age. The 46,X,der(X)t(X;19)(p21.1;13.42) case is as this clinical condition can be considered the most severe a maternal inherited translocation, but the sister of this cause of ovarian insufficiency [29, 30]. These patients did patient, who has inherited the same aberration is not not show any typical features of Turner syndrome. All of the affected by POF [33]. X chromosome was also involved patients underwent a complete clinical assessment, including in 3 (11.1%) cases of 45,X mosaic with the other cell complete medical and gynaecological history, in order to line characterized by a pseudodicentric X chromosome. 6 exclude any other related pathology. Informed consent was (22.2%) patients showed X chromosome aneuploidy, in obtained from all participants. particular one patients was nonmosaic 47,XXX, one patient The general population group was composed by 357 nonmosaic 45,X, 3 patients were 45,X/46,XX mosaic and one uncultured female amniocytes derived from routinely diag- patient was 46,XX/47,XXX mosaic. In addition, 3 (11.1%) nostic procedures, in order to establish the best unbiased ref- autosomal structural abnormalities were identified, one erence group. All foetuses showed normal female karyotype involving chromosomes 4 and 5 and a patient was mosaic after culture using standard cytogenetic techniques. for an isochromosome 9p. The patient with the 46,XX, t(3;7)(q23;p12) karyotype was characterized by primary 2.2. Conventional Cytogenetics. Metaphase-chromosome amenorrhea and bilateral euryblepharon. The chromosome spreads were obtained from phytohaemagglutinin-stimulat- 3 breakpoint fell under the FOXL2 locus and she was not ed peripheral blood lymphocytes using standard methods. affected by the blepharophimosis-ptosis-epicanthus inversus The chromosomes were QFQ-banded using quinacrine mus syndrome. Autosomal numerical abnormalities were found tard, and slides were mounted in McIlvaine buffer. A range in 2 patients (7.4%) including a 47,XX,+21 case and a of 30–50 cells were analyzed for karyotype following the 46,XX/47,XX+18 mosaic case successively described by guidelines of the International System for Chromosome Bettio et al. (2003) [34]. Nomenclature 2009 (ISCN 2009) with the exclusion of The distribution of aneuploidy rate for the patients and mosaicism at 10%–6% grade, with 95% confidential level reference group is given in Tables 2 and 3. FISH analysis on [31]. interphase nuclei from amniocytes on the general population group revealed X chromosome monosomy in 2.7% (range 2.3. FISH Analysis on Interphase Nuclei. FISH analysis on 0%–11.4%) of cases and triple X signal in 0.6% (range 0%– interphase nuclei from lymphocytes was assessed on patients 6.1%) of cells. POF patient group showed higher aneuploidy (n = 47) with normal constitutional karyotype and on values than reference group, in particular the percentage of uncultured amniocytes. The mean age of the patients at the cells with only one detectable signal was 7.5% (range 2.0%– time of the study was 34 years (range 12–45). FISH study 19.2%), while a triple X chromosome signals were found was performed using alpha satellite probes of chromosomes in 3.3% (0%–12%) of cells. All these data were referred X, Y, and 18 (AneuVysion Multicolor DNA Probe Kit, to cells with 2 visible 18 chromosome signals in order to Vysis, Abbott Molecular) and performed according to the evaluate only the cells with right hybridization efficiency. We manufacturer’s instructions. Chromosome 18 centromeric established three 18:X categories and in detail: (i) 2:1 (two 18 Journal of Biomedicine and Biotechnology 3

Table 1: Summary of the chromosomal abnormalities found in the POF patient group.

nonmosaic 46,X,t(X;2)(q21.33;q14.3) nonmosaic 46,X,der(X)t(X;9)(q21.33;p22.3)∗ nonmosaic 46,X,der(X)t(X;19)(p21.1;13.42)# nonmosaic 46,X,der(X)t(X,X)(q21.3;p21)∗ nonmosaic 46,X,del(X)(q21.2 → qter)∗ nonmosaic 46,X,del(X)(q22.3 → q27)∗ nonmosaic 46,X,del(X)(q26.2 → qter)∗ X chromosome structural abnormalities nonmosaic 46,X,del(X)(p21 → pter?) nonmosaic 46,X,del(X)(p21.2) nonmosaic 46,X,psudic(X)(q10;q10) nonmosaic 46,X,del(X)(q21.1;q21.3) nonmosaic 46,X,der(Y)t(X;Y)(q13.1;q11.223)† nonmosaic 46,X,der(X)t(X;Y)(q26.2;q11.223) mosaic 46,X,psudic(X)(q23;q23)[75]/45,X[25] mosaic 45,X[97]/46,X,psudic(X)(q22;q22)[3]∗ mosaic 45,X[29]/46,X,der(X)t(X;X)(q21.2;p22.33)[47] nonmosaic 47,XXX nonmosaic 45,X X chromosome numerical abnormalities mosaic 46,XX[99]/45(X)[24] mosaic 46,XX[96]/47,XXX[4] mosaic 46,X[96]/45,X[4] mosaic 46,X[96]/45,X[4] nonmosaic 46,XX,t(4;5) Autosomal structural abnormalities nonmosaic 46,XX,t(3;7)(q23;p12) mosaic 47,XX,+i(9)(p10)[72]/46,XX[28] nonmosaic 47,XX,+21 Autosomal numerical abnormalities mosaic 46,XX[54]/47,XX+18[36]§ ∗ Marozzi et al. (2000) [28]; # Maraschio and Fraccaro (1983) [33]; §Bettio et al. (2003) [34]; †Lissoni et al. (2009) [35]. Square brackets, placed after the karyotype description, are used to designate the absolute number of cells in each clone, as stated by the International System for Human Cytogenetic Nomenclature 2009. signals and one X signal), (ii) 2:2, and (iii) 2:3 (Figure 2). All insufficiency. In this study we identified 27 chromosomal the cells that did not fall within these three categories were abnormalities out of 269 cases of POF occurred to our classified as “other” and their percentage was 5.1% and 4.8% attention. Cytogenetic findings include X chromosome and for the reference and patient groups, respectively. autosomal structural and numerical abnormalities. Our data X chromosome aneuploidy comparison of raw data show a prevalence of X structural abnormalities (16 chro- between the two groups by the means of statistical analysis mosomal abnormalities out of 27 found, equal to 59.3%), using the χ2 test for variance showed a significant difference highlighting the importance of X chromosome in ovarian between the data distribution of the two groups (P<.001). function and POF aetiology as described in the literature Interestingly, there was no difference in the distribution of [18, 19]. Conventional cytogenetic analysis through QFQ so-called “other” signals, so the difference of X chromosome banding is a powerful tool for a first round of screening, but a aneuploidy between the two groups can not be attributed to wide range of POF cases remains defined as idiopathic. Some different signal dispersion (Table 3). of these cases may be explained by FRAXA premutation or mutations in BMP15 or inhibin alpha gene [36–38]buta 4. Discussion large group of cases still remains with unknown cause. Turner syndrome is the chromosomal disorder most Cytogenetic analysis on blood lymphocytes derived from commonly associated with POF, but the correlation between POF patients is an important tool in the detection of ovarian function and karyotype is less clear [39, 40]. Never- cytogenetic abnormalities that lead to premature ovarian theless, the highest number of follicles were found in subjects 4 Journal of Biomedicine and Biotechnology

Table 2: Detailed list of 18:X chromosome signals found in the patient group.

Age at Number of signals (18:X) Case no. Diagnosis Other Total menopause 2: 1 2:2 2:3 1 POF2-FAM2 45 5 51 5 0 61 2PA/7543064 3 POF1-FAM2 40 11 69 10 0 90 4 POF1 27 6 86 8 0 100 5 POF1 33 13 99 7 0 119 6 POF2 42 16 82 2 0 100 7 POF1-FAM2 36 3 138 9 0 150 8PA-FAM1/1256112099 9 POF2-FAM1 41 7 81 3 9 100 10 POF1-FAM2 35 16 72 3 8 99 11 POF1-FAM1 34 12 76 3 8 99 12 POF1 12 10 74 9 8 101 13 POF2 42 17 74 2 11 104 14 POF1-FAM1 33 8 72 3 13 96 15 POF1-FAM1 38 19 62 3 15 99 16 PA / 15 74 2 9 100 17 POF1 32 5 83 2 11 101 18 POF1 35 11 75 4 10 100 19 POF1 37 10 74 6 9 99 20 POF1-FAM1 25 4 88 6 2 100 21 POF1 40 6 89 1 4 100 22 POF1-FAM1 37 10 76 6 8 100 23 POF1 34 6 32 8 54 100 24 POF1-FAM2 34 4 35 6 5 50 25 POF1 37 6 80 10 4 100 26 POF1-FAM1 18 9 87 4 5 105 27 POF1-FAM1 34 12 176 6 14 208 28 POF1 30 11 167 0 6 184 29 POF1-FAM2 35 16 167 5 12 200 30 POF1 34 13 168 6 7 194 31 POF1 27 9 180 7 3 199 32 POF1 40 14 183 8 2 207 33 POF1 40 6 190 4 3 203 34 POF1-FAM1 40 13 182 4 5 204 35 POF2 41 15 177 5 7 204 36 POF1 26 12 182 4 5 203 37 POF2 44 12 188 2 2 204 38 POF1-FAM2 30 10 187 4 4 205 39 POF1-FAM2 33 4 176 8 14 202 40 PA / 23 177 2 3 205 41 PA / 12 192 2 2 208 42 POF1-FAM1 38 12 192 1 4 209 43 POF1 38 13 191 5 5 214 44 POF1-FAM1 18 10 190 2 3 205 45 POF1 38 15 181 6 7 209 46 POF1-FAM1 17 15 185 3 3 206 47 POF1-FAM1/2 31 17 184 4 5 210 % 7.4 84.4 3.3 4.8 POF1: menopause before or at the age of 40; POF2: menopause between 41 and 45 years of age; PA: primary amenorrhea; FAM1: at least one relative with POF1; FAM2: at least one relative with POF2. Journal of Biomedicine and Biotechnology 5

25 26 24 25 23 24.2 24.3 der(2)der(X) 22 24.1 23 22 21 21.3 22 22.3 16 22.2 21.2 21 der(2) chr2 chrX der(X) 15 21.1 14.3 22.1 14 14.2 15.3 15.2 21.3 13 14.1 15.1 21.2 13 13.3 21.1 11.3 12 14 11.4 11.2 12 13 13.2 11.3 11.1 chrX der(X) 11.2 11.1 12 12 11.23 11.22 11.2 11.1 13.1 11.21 11.1 11.2 11.1 11 12 11.1 11.21 11.2 11.1 11.1 11.2 11.1 11.22 12 11.2 11.1 11.21 11.22 11 12 11.23 chrX derX 13.1 12 13.1 13 13 14.1 13.2 11.23 14.2 13.3 21.1 13.2 21.1 12 14.3 13.3 21.2 21.1 21.2 21 21.2 21.3 21.3 21.3 22 13.4 22.1 22 23 22 22.3 22.2 31.1 23 chrY 23 24 31.2 chr19 24 24.1 25 31.3 25 24.2 24.3 26.1 32 26 31 26.2 33 27 32.1 26.3 34 32.2 27 35 28 32.3 28 36 29 33 chrX 34 35 chr3 chr7 36 37.1 37.2 37.3 chr2 46,X,t(X; 2)(q21.33 : q14.3) 46,X,der(X)t(X; 19)(p21.1; q13.42) (a) (b) (c) chrX der(X) chrX

chrX der(X) chrX der(X) der(Y)

46,X,der(Y)t(X; Y)(q13.1; q11.223) 46,X,der(X)t(X; Y)(q26.2; q11.223) (d) (e)

Figure 1: Conventional cytogenetic analysis. (a) Ideograms of the normal chromosomes (550-band level). (b)–(f) Chromosomal abnormalities found in 5 patients affected by POF. Partial Q-banding karyotype on the left and ideograms of derivative chromosome on the right.

Table 3: FISH analysis on interphase nuclei data and statistical analysis.

Number of signals (18:X) 2:1 2:2 2:3 Other Total 512 5754 224 329 Patients (n = 47) 6819 (7.5%) (84.4%) (3.3%) (4.8%) 596 20020 139 1121 Reference group (n = 357) 21876 (2.7%) (91.5%) (0.6%) (5.1%) P-value∗ .001 .001 .001 .161 / patients versus reference group ∗ χ2 test. with mosaic Turner syndrome and, above all, in subjects with of low level sex chromosome mosaicism in ovarian function the lowest percentage of cells with the 45,X karyotype [41]. even if the precise role is still unknown [24, 25]. These data strengthen the importance of X chromosome InordertoevaluateXchromosomeaneuploidywe in ovarian function, showing that a double dose of some performed FISH analysis using alpha satellite probes on genes located on the X chromosome is essential in ovary interphase cells because the exclusive analysis of metaphase maintenance, preventing follicle apoptosis and atresia [22]. chromosome may provide only partial information since the Evaluating the implication of 45,X low level mosaicism in analysis is restricted to a specific type of cycling cells and in POF patients could give some clues in understanding the role this way nondividing cells would remain undetected [42]. 6 Journal of Biomedicine and Biotechnology

(a) (b) (c)

Figure 2: FISH analysis on interphase nuclei. FISH was performed using alpha satellite probes of X (green) and 18 (aqua) chromosomes. The images show the three different categories of signals detected: (a) X monosomy (two 18 signals and one X signal); (b) X disomy and (c) Xtrisomy.

25 in order to detect low-level X chromosome mosaicism and to 20 understand if there is a correlation between increased rate of sex chromosome aneuploidy and POF condition. 15 The identification of the suitable reference group is 10 tricky both for the type of disorder itself (POF) and the

monosomy (%) kind of analysis (X chromosome aneuploidy). The study

X 5 on the impact of X chromosome mosaicism on fertility is very difficult to assess due to the lack of a normal 01020304050 fertile reference group [47]. In the literature, the rate of Age X monosomy and aging has already been determined by several works [10, 25, 48] and so we decided to use a new POF patients Normal female population∗ reference group based on the most possible random and POF patients unbiased group. Thus we established a general population 1 Normal female population∗ group composed by uncultured amniocytes derived from 2 Normal female population∗ routinely diagnostic procedures and analyzed during the same period of POF patients. This group can be considered Figure 3: Percentage of X monosomy related to aging. The graph a sort of rational reference group (a general population) shows the linear trend of X monosomy both in POF patient group as, in this specific case, a real reference group can not and in two different reference groups described in two reports from the literature: ∗(1) Guttenbach et al. (1995) [10] and (2) be formed, due to the characteristics of the disease itself: Lakhal et al. (2010) [25]. POF can occur till the age of 40(POF1)-45(POF2) and does not show any early biochemical or phenotypic signal, furthermore using a general female population, other time- Moreover, FISH analysis on interphase cells is a sensitive related variables should be considered, such as personal method for detecting low-level sex chromosome mosaicism habits or occupational exposure. Thus, an age-matched and also avoids artifacts and problems that may be associated female group could determine a pre-established bias [49]. to metaphase chromosome preparations [24, 43]. Indeed, Moreover, women with a regular ovarian function normally metaphase chromosome spreads only allow the exclusion cease their menses between 45 and 55 years of age and so of 10 to 6% of mosaicism at confidence level of 95% [31] their lymphocytes are already predisposed to X chromosome while the detection of low-level mosaicism increases from aneuploidy as it is a physiological phenomenon related to 30%–40% of cases to 74% using standard karyotyping and aging [50]. molecular techniques (FISHs), respectively [39]. In this study we report a higher percentage of X Many reports describe the increase of X chromosome aneuploidy rate in the POF patient group than in the general aneuploidy with aging and that the increasing age-related population group and we found also that the percentage of loss of sex chromosome loss associates with a higher level of monosomic nuclei is much higher than trisomic nuclei. In micronuclei formation [6, 10, 13, 14, 33]. Instead, few works particular, in the general population group, the percentage try to correlate X chromosome loss and POF [24, 25, 44]orat of 45,X cells was 2.7% and 47,XXX was 0.6%. POF group most, it is possible to find some studies that are more general showed a statistical significant higher percentage rate equal and amenorrhea or aneuploidy only represent a secondary to 7.5% and 3.3%, respectively (P<.001, χ2 test). We aspects [45, 46]. compared also the percentage of one X chromosome signal in We studied a group of 47 POF patients with normal kary- interphase cells between our patient group and two normal otype among our case group, using interphase FISH analysis, female population described in the literature in two reports Journal of Biomedicine and Biotechnology 7 by Guttenbach and colleagues in 1995 and Lakhal et al. to highlight that the karyotypic pattern of the gonad may be (2010) (Figure 3). Guttenbach et al. analyzed X chromosome different [46]. Anyway, blood lymphocytes provide the best mosaicism in a group of female aged 1 week to 91 years and indicator in the detection of senescence, and the increasing of in particular they found that the percentage of X monosomy chromosome aneuploidy with aging was assessed also in skin in female aged 16–50 years was 3,13% [10, 25, 48]. The fibroblasts (reviewed in [48]). So it is reasonable to use blood comparison between this literature age-matched control lymphocytes as a model to study chromosome aneuploidy as group and our patient group showed a significant increase of the specific tissue of interest is often not available. X monosomy in POF patient group (7.5% of X monosomy, Fitzgerald in 1975 suggested a mechanism for X chro- P<.001). Similar results were obtained comparing our mosome loss based on premature centromeric division patient control group and the control group described by (PCD), linked to a subsequent chromosome nondisjunction Lakhal and colleagues (2.33% of X monosomy) [25]. These that may result in cells with an extra X chromosome or data suggest that low-level X chromosome mosaicism may with only one sex chromosome, with a great majority of contribute to POF pathology and these findings are very 45,X cells [58]. Burgoyne and Baker in 1984 suggested interesting because POF is a premature cessation of ovarian that 45,X/46,XX/47,XXX mosaicism may accelerate follicular function and probably the lack of adequate number of atresia by different mechanisms: (i) aberrant chromosome follicles may be due to an earlier oocyte aging in these pairing during meiosis; (ii) deficiency or overexpression of patients that could lead to premature follicular atresia [24, specific gene products on the X chromosome may influence 25]. In particular, Lakhal and colleagues found a correlation oocyte quality; (iii) an overall impaired genetic control could between X chromosome monosomy and the age of POF be related to X chromosome mosaicism leading to defects installation in a subgroup (11.5%) of patients, suggesting in meiosis-mitosis process, resulting in gonadal damage, that mosaicism in these patients was pathological and linked aberrant meiosis, and oocyte atresia [59]. to POF [25]. Considering the high rate of X chromosome loss in Many studies suggest that the incidence of cells lacking POF patients, it is reasonable to hypothesize that POF sex chromosome, however, might be caused by a preferential represents a disease spectrum with various degrees, maybe cell survival rate than preferential X chromosome loss. related to X chromosome mosaicism. In fact, considering In fact, the loss of sex chromosomes (late replicating X our data it is possible to suggest that women with X chro- chromosome for female and Y chromosome for male) should mosome mosaicism can experience premature menopause not affect cell survival as these chromosomes should not [24, 25, 44]. The underling pathological mechanism may play a critical role in lymphocyte survival [6, 49, 50]. X be explained by accelerated oocyte aging due to increased chromosome loss could be accounted by aneuploidy of the mosaicism rate that leads to premature follicular atresia. late replicating X [51, 52]. Anyway, even if X chromosome is not fundamental for lymphocyte or other type of cell survival, it might have an essential role in the ovary, since 5. Conclusion various X chromosome abnormalities are associated with We performed a study on a large group of POF patients POF and many studies suggest that two intact X chromosome and we identified 27 chromosomal abnormalities associated are essential for proper ovarian function [16, 20–22]. X with POF. Moreover, we assessed a higher frequency of X chromosome has a pivotal role in ovarian development chromosome aneuploidy rate in POF patients than in the and maintenance, so the 45,X mosaicism may influence general population group, in particular an increased rate of survival rate and be related to accelerated aging of ovarian X chromosome loss, observed by FISH on interphase nuclei. cells. Follicular deficit of POF patients may be explained by These findings confirm the importance of X chromosome in decreased germ cell number, accelerated oocyte atresia, and POF aetiology and the incidence of low-level X chromosome postnatal destruction of germ cells [53]. The X chromosome mosaicism in POF patients, as sex chromosome mosaicism appears to play an essential role in the mechanism that leads may account for some “idiopathic” POF cases. to POF phenotype, as females lacking an X chromosome, or showing extra copies of the X chromosome, are predisposed to developing POF [54]. In this regard, even trisomy seems Acknowledgment to be related to ovarian dysfunction: although normal ovarian function and fertility are reported in most 47,XXX The authors gratefully acknowledge Telethon Foundation, females, some of these patients experience delayed menarche Italy (Grant no. GGP09126 to Professor A. Marozzi). or premature ovarian failure, late onset menarche, and oligomenorrhea [23, 55]. The prevalence of X monosomy can not be attributed to References culture artifacts since this phenomenon has been described [1] P. A. Jacobs, W. M. Court Brown, and R. Doll, “Distribution both in vitro and in vivo [11–13, 56] and it is unlikely of human chromosome counts in relation to age,” Nature, vol. that the observed hypodiploidy can be due primarily to 191, no. 4794, pp. 1178–1180, 1961. technical factors, considering X loss rate in the younger [2]P.A.Jacobs,M.Brunton,W.M.C.Brown,R.Doll,andH. and older age groups [57]. Peripheral blood lymphocytes Goldstein, “Change of human chromosome count distribu- still remain the standard method in cytogenetic diagnosis tions with age: evidence for a sex difference,” Nature, vol. 197, procedures because of their accessibility, but it is important no. 4872, pp. 1080–1081, 1963. 8 Journal of Biomedicine and Biotechnology

[3]E.H.KleisnerDeGalan,´ “Age and chromosomes,” Nature, vol. [23] C. M. Holland, “47,XXX in an adolescent with premature 211, no. 5055, pp. 1324–1325, 1966. ovarian failure and autoimmune disease,” Journal of Pediatric [4] J. S. Fang, G. Jagiello, M. Ducayen, and J. Graffeo, “Aging and Adolescent Gynecology, vol. 14, no. 2, pp. 77–80, 2001. and X chromosome loss in the human ovary,” Obstetrics and [24] A. S. Devi, D. A. Metzger, A. A. Luciano, and P. A. Benn, Gynecology, vol. 45, no. 4, pp. 455–458, 1975. “45,X/46,XX mosaicism in patients with idiopathic premature [5] J. M. Martin, J. M. Kellett, and J. Kahn, “Aneuploidy in ovarian failure,” Fertility and Sterility, vol. 70, no. 1, pp. 89–93, cultured human lymphocytes: I. Age and sex differences,” Age 1998. and Ageing, vol. 9, no. 3, pp. 147–153, 1980. [25] B. Lakhal, R. Braham, R. Berguigua et al., “Cytogenetic [6] N. Bukvic, M. Gentile, F. Susca et al., “Sex chromosome loss, analyses of premature ovarian failure using karyotyping and micronuclei, sister chromatid exchange and aging: a study interphase fluorescence in situ hybridization (FISH) in a including 16 centenarians,” Mutation Research, vol. 498, no. group of 1000 patients,” Clinical Genetics,vol.78,no.2,pp. 1-2, pp. 159–167, 2001. 181–185, 2010. [7] P. Neurath, K. Deremer, B. Bell, L. Jarvik, and T. Kato, [26] W. Vegetti, M. G. Tibiletti, G. Testa et al., “Inheritance in “Chromosome loss compared with chromosome size, age and idiopathic premature ovarian failure: analysis of 71 cases,” sex of subjects,” Nature, vol. 225, no. 5229, pp. 281–282, 1970. Human Reproduction, vol. 13, no. 7, pp. 1796–1800, 1998. [8] P. H. Fitzgerald and C. M. McEwan, “Total aneuploidy [27] M. G. Tibiletti, G. Testa, W. Vegetti et al., “The idiopathic and age-related sex chromosome aneuploidy in cultured forms of premature menopause and early menopause show lymphocytes of normal men and women,” Human Genetics, the same genetic pattern,” Human Reproduction, vol. 14, no. vol. 39, no. 3, pp. 329–337, 1977. 11, pp. 2731–2734, 1999. [9] F. Richard, A. Aurias, J. Couturier et al., “Aneuploidy in human [28] A. Marozzi, E. Manfredini, M. Tibiletti et al., “Molecular lymphocytes: an extensive study of eight individuals of various definition of Xq common-deleted region in patients affected ages,” Mutation Research, vol. 295, no. 2, pp. 71–80, 1993. by premature ovarian failure,” Human Genetics, vol. 107, no. [10] M. Guttenbach, B. Koschorz, U. Bernthaler, T. Grimm, 4, pp. 304–311, 2000. and M. Schmid, “Sex chromosome loss and aging: in situ [29] S. Mumm, L. Herrera, P. W. Waeltz et al., “X/autosomal hybridization studies on human interphase nuclei,” American translocations in the Xq critical region associated with prema- Journal of Human Genetics, vol. 57, no. 5, pp. 1143–1150, 1995. ture ovarian failure fall within and outside genes,” Genomics, [11] J. C. Hando, J. Nath, and J. D. Tucker, “Sex chromosomes, vol. 76, no. 1–3, pp. 30–36, 2001. micronuclei and aging in women,” Chromosoma, vol. 103, no. [30] M. F. Portno¨ı, A. Aboura, G. Tachdjian et al., “Molecular 3, pp. 186–192, 1994. cytogenetic studies of Xq critical regions in premature ovarian [12] F. Richard, M. Muleris, and B. Dutrillaux, “The frequency of failure patients,” Human Reproduction,vol.21,no.9,pp. micronuclei with X chromosome increases with age in human 2329–2334, 2006. females,” Mutation Research, vol. 316, no. 1, pp. 1–7, 1994. [31] E. B. Hook, “Exclusion of chromosomal mosaicism: tables of [13] J. Catalan,K.Autio,E.Kuosma,andH.Norppa,“Age-´ 90%, 95%, and 99% confidence limits and comments on use,” dependent inclusion of sex chromosomes in lymphocyte American Journal of Human Genetics, vol. 29, no. 1, pp. 94–97, micronuclei of man,” American Journal of Human Genetics, 1977. vol. 63, no. 5, pp. 1464–1472, 1998. [32] A. B. Mukherjee and S. Thomas, “A longitudinal study of [14] A. Wojda, E. Zietkiewicz, and M. Witt, “Effects of age and human age-related chromosomal analysis in skin fibroblasts,” gender on micronucleus and chromosome nondisjunction fre- Experimental Cell Research, vol. 235, no. 1, pp. 161–169, 1997. quencies in centenarians and younger subjects,” Mutagenesis, [33] P. Maraschio and M. Fraccaro, “Phenotypic effects of X- vol. 22, no. 3, pp. 195–200, 2007. chromosome deficiencies,” in Citogenetica of the Mammalian [15] C. B. Coulam, “Premature gonadal failure,” Fertility and X Chromosome—part B: X Chromosome Anomalies and Their Sterility, vol. 38, no. 6, pp. 645–655, 1982. Clinical Manifestations, pp. 359–369, Alan R. Liss, New York, [16]T.Laml,O.Preyer,W.Umek,M.Hengstschlager,andE. NY, USA, 1983. Hanzal, “Genetic disorders in premature ovarian failure,” [34] D. Bettio, P. Levi Setti, P. Bianchi, and V. Grazioli, “Trisomy 18 Human Reproduction Update, vol. 8, no. 5, pp. 483–491, 2002. mosaicism in a woman with normal intelligence,” American [17] D. Goswami and G. S. Conway, “Premature ovarian failure,” Journal of Medical Genetics, vol. 120, no. 2, pp. 303–304, 2003. Human Reproduction Update, vol. 11, no. 4, pp. 391–410, 2005. [35] S. Lissoni, S. Baronchelli, N. Villa et al., “Chromosome [18] A. Devi and P. A. Benn, “X-chromosome abnormalities in territories, X;Y translocation and premature ovarian failure: women with premature ovarian failure,” JournalofReproduc- is there a relationship?” Molecular Cytogenetics, vol. 2, p. 19, tive Medicine for the Obstetrician and Gynecologist, vol. 44, no. 2009. 4, pp. 321–324, 1999. [36] A. Marozzi, W. Vegetti, E. Manfredini et al., “Association [19] D. Schlessinger, L. Herrera, L. Crisponi et al., “Genes and between idiopathic premature ovarian failure and fragile X translocations involved in POF,” American Journal of Medical premutation,” Human Reproduction, vol. 15, no. 1, pp. 197– Genetics, vol. 111, no. 3, pp. 328–333, 2002. 202, 2000. [20] R. M. Davison, C. J. Davis, and G. S. Conway, “The X [37] A. Marozzi, C. Porta, W. Vegetti et al., “Mutation analysis of chromosome and ovarian failure,” Clinical Endocrinology, vol. the inhibin alpha gene in a cohort of Italian women affected 51, no. 6, pp. 673–679, 1999. by ovarian failure,” Human Reproduction,vol.17,no.7,pp. [21] G. S. Conway, “Premature ovarian failure,” British Medical 1741–1745, 2002. Bulletin, vol. 56, no. 3, pp. 643–649, 2000. [38] R. Rossetti, E. D. Pasquale, A. Marozzi et al., “BMP15 [22] A. R. Zinn, “The X chromosome and the ovary,” Journal of the mutations associated with primary ovarian insufficiency cause Society for Gynecologic Investigation, vol. 8, no. 1, supplement, a defective production of bioactive protein,” Human Mutation, pp. S34–S36, 2001. vol. 30, no. 5, pp. 804–810, 2009. Journal of Biomedicine and Biotechnology 9

[39] L. Hanson, I. Bryman, M. L. Barrenas¨ et al., “Genetic analysis “47,XXX/45,X/46,XX mosaicism in a patient with Turner of mosaicism in 53 women with Turner syndrome,” Hereditas, phenotype and spontaneous puberal development,” Fertility vol. 134, no. 2, pp. 153–159, 2001. and Sterility, vol. 92, no. 5, pp. 1747.e5–1747.e7, 2009. [40] M. Cameron, S. Grover, P. Moore, and Y. Jayasinghe, “Non- [56] M. Guttenbach, R. Schakowski, and M. Schmid, “Aneuploidy chromosomal, non-iatrogenic premature ovarian failure in an and ageing: sex chromosome exclusion into micronuclei,” adolescent population: a case series,” Journal of Pediatric and Human Genetics, vol. 94, no. 3, pp. 295–298, 1994. Adolescent Gynecology, vol. 21, no. 1, pp. 3–8, 2008. [57] J. H. Ford and J. A. Russel, “Differences in the error [41] J. G. Hreinsson, M. Otala, M. Fridstrom¨ et al., “Follicles mechanisms affecting sex and autosomal chromosomes in are found in the ovaries of adolescent girls with Turner’s women of different ages within the reproductive age group,” syndrome,” Journal of Clinical Endocrinology and Metabolism, American Journal of Human Genetics, vol. 37, no. 5, pp. 973– vol. 87, no. 8, pp. 3618–3623, 2002. 983, 1985. [42] A. B. Mukherjee, J. Alejandro, S. Payne, and S. Thomas, [58] P. H. Fitzgerald, “A mechanism of X chromosome aneuploidy “Age-related aneuploidy analysis of human blood cells in vivo in lymphocytes of aging women,” Humangenetik, vol. 28, no. by fluorescence in situ hybridization (FISH),” Mechanisms of 2, pp. 153–158, 1975. Ageing and Development, vol. 90, no. 2, pp. 145–156, 1996. [59] P. S. Burgoyne and T. G. Baker, “Meiotic pairing and [43] A. B. Mukherjee, S. Thomas, and E. Schmitt, “Chromoso- gametogenic failure,” Symposia of the Society for Experimental mal analysis in young vs. senescent human fibroblasts by Biology, vol. 38, pp. 349–362, 1984. fluorescence in situ hybridization: a selection hypothesis,” Mechanisms of Ageing and Development, vol. 80, no. 1, pp. 11– 23, 1995. [44] R. C. Wu, P. L. Kuo, S. J. Lin, C. H. Liu, and C. C. Tzeng, “X chromosome mosaicism in patients with recurrent abortion or premature ovarian failure,” Journal of the Formosan Medical Association, vol. 92, no. 11, pp. 953–956, 1993. [45] G. P. Nowinski, D. L. Van Dyke, B. C. Tilley et al., “The frequency of aneuploidy in cultured lymphocytes is correlated with age and gender but not with reproductive history,” American Journal of Human Genetics, vol. 46, no. 6, pp. 1101– 1111, 1990. [46] P. L. Kuo and H. R. Guo, “Mechanism of recurrent sponta- neous abortions in women with mosaicism of X-chromosome aneuploidies,” Fertility and Sterility, vol. 82, no. 6, pp. 1594– 1601, 2004. [47] A. K. Moore, K. Lynch, M. J. Arny, and D. R. Grow, “Turner mosaicism (45,X/46,XX) diagnosed in a young woman sub- sequent to low oocyte maturity and failed ICSI,” Fertility and Sterility, vol. 90, no. 5, pp. 2012.e13–2012.e15, 2008. [48] A. Wojda and M. Witt, “Manifestations of ageing at the cytogenetic level,” Journal of Applied Genetics, vol. 44, no. 3, pp. 383–399, 2003. [49] C. Bolognesi, A. Abbondandolo, R. Barale et al., “Age-related increase of baseline frequencies of sister chromatid exchanges, chromosome aberrations, and micronuclei in human lympho- cytes,” Cancer Epidemiology Biomarkers and Prevention, vol. 6, no. 4, pp. 249–256, 1997. [50] J. F. Stone and A. A. Sandberg, “Sex chromosome aneuploidy and aging,” Mutation Research, vol. 338, no. 1–6, pp. 107–113, 1995. [51] M. A. Abruzzo, M. Mayer, and P. A. Jacobs, “Aging and aneuploidy: evidence for the preferential involvement of the inactive X chromosome,” Cytogenetics and Cell Genetics, vol. 39, no. 4, pp. 275–278, 1985. [52] J. D. Tucker, J. Nath, and J. C. Hando, “Activation status of the X chromosome in human micronucleated lymphocytes,” Human Genetics, vol. 97, no. 4, pp. 471–475, 1996. [53] L. Pal and N. Santoro, “Premature ovarian failure (POF): discordance between somatic and reproductive aging,” Ageing Research Reviews, vol. 1, no. 3, pp. 413–423, 2002. [54] A. L. Villanueva and R. W. Rebar, “Triple-X syndrome and premature ovarian failure,” Obstetrics and Gynecology, vol. 62, supplement 3, pp. 70s–73s, 1983. [55] A. J. L. Brambila-Tapia, H. Rivera, H. Garc´ıa-Castillo, M. G. Dom´ınguez-Quezada, and I. P. Davalos-Rodr´ ´ıguez, Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 792362, 19 pages doi:10.1155/2011/792362

Review Article Genetics, Cytogenetics, and Epigenetics of Colorectal Cancer

Lucia Migliore,1, 2 Francesca Migheli,1 Roberto Spisni,3 and Fabio Coppede`1, 2

1 Department of Human and Environmental Sciences, University of Pisa, Street S. Giuseppe 22, 56126 Pisa, Italy 2 Istituto Toscano Tumori, 50139 Firenze, Italy 3 Department of Surgery, University of Pisa, 56126 Pisa, Italy

Correspondence should be addressed to Lucia Migliore, [email protected]

Received 14 October 2010; Accepted 14 December 2010

Academic Editor: Nathan A. Ellis

Copyright © 2011 Lucia Migliore et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Most of the colorectal cancer (CRC) cases are sporadic, only 25% of the patients have a family history of the disease, and major genes causing syndromes predisposing to CRC only account for 5-6% of the total cases. The following subtypes can be recognized: MIN (microsatellite instability), CIN (chromosomal instability), and CIMP (CpG island methylator phenotype). CIN occurs in 80–85% of CRC. Chromosomal instability proceeds through two major mechanisms, missegregation that results in aneuploidy through the gain or loss of whole chromosomes, and unbalanced structural rearrangements that lead to the loss and/or gain of chromosomal regions. The loss of heterozygosity that occur in the first phases of the CRC cancerogenesis (in particular for the genes on 18q) as well as the alteration of methylation pattern of multiple key genes can drive the development of colorectal cancer by facilitating the acquisition of multiple tumor-associated mutations and the instability phenotype.

1. Introduction tumor-node-metastasis (TNM) classification, as defined by the American Joint Committee on Cancer (AJCC). TNM is Worldwide, more than one million individuals develop the most commonly used staging system and is based on colorectal cancer (CRC) each year, and the disease-specific depth of invasion of the bowel wall, extent of regional lymph mortality rate is nearly 33% in the developed world [1]. node involvement, and presence of distant sites of disease. In Europe cancer of the gastrointestinal tract is the most The depth of tumor invasion defines the T stage and increases common cancer: more than half of gastrointestinal cancer from T1 (invasion of the submucosa) to T4 (invasion into the cases arise from the colon and around 250,000 new colon serosa or adjacent structures) [4]. Another grading system cases are diagnosed every year, accounting for around 9% of is Dukes classification that considers the arrangement of the all the malignancies [2]. Colorectal cancer most commonly cells rather than the percentage of the differentiated cells. occurs sporadically, and only 25% of the patients have a The initial Dukes approach has evolved into the three-grade family history of the disease, suggesting a contribution for system. Grade 1 is the most differentiated, with well-formed shared genes and environment. However, only 5%-6% of tubules and the least nuclear polymorphism and mitoses. CRC is due to inherited mutations in major CRC genes whilst Grade 3 is the least differentiated, with only occasional the remaining of the familial forms likely result from gene- glandular structures, pleomorphic cells and a high incidence environment interactions [3]. Rates of this cancer increase of mitoses. Grade 2 is intermediate between Grades 1 and 3 with industrialization and urbanisation, further indicating [2]. that environmental factors can likely represent risk factors. The development of colorectal cancer is a multistep Diet is definitely the most important exogenous factor process that involves an accumulation of mutations in tumor identified so far in the etiology of colorectal cancer. suppressor genes and oncogenes. It has provided a useful CRC progresses through a series of clinical and histo- model for the understanding of the multistep process of car- pathological stages ranging from single crypt lesions through cinogenesis. The model of colorectal tumorigenesis includes small benign tumors (adenomatous polyps) to malignant several genetic changes that are required for cancer initiation cancers (carcinomas). Stages are usually defined by the and progression [5]. The earliest trigger genetic event is 2 Journal of Biomedicine and Biotechnology the inactivation of the APC (adenomatous polyposis coli) and colon after the first decade of life, that inevitably pathway. Mutations in other tumor suppressor genes (APC, result in CRC development in untreated subjects. Males and SMAD2, 4, TP53) and oncogenes (KRAS) and likely several females are equally likely to be affected. FAP accounts for other genes/pathways accompany transitions in pathology less than 1% of CRC cases, with an estimated prevalence of the lesions and drive tumor towards malignancy and of 1/11,300–37,600 in the European Union [17]. FAP may metastasis [6]. Alongside with gene mutations a deregulated present with some extraintestinal manifestations such as expression of oncogenes and/or tumor suppressor genes osteomas, dental abnormalities, congenital hypertrophy of can also occur following epigenetic modifications of their the retinal pigment epithelium, and extracolonic tumours promoters. (desmoid tumors, stomach tumors, duodenum/small bowel tumors, thyroid cancers, pancreas tumors, hepatoblastoma, and central nervous system tumors) [3, 17]. Attenuated FAP 2. Genetics of Colorectal Cancer (AFAP) is a less aggressive variant of FAP, characterized by Colorectal cancer represents the third most diagnosed cancer fewer colorectal adenomatous polyps (usually 10 to 100), an in both men and women. About 75% of the patients have average 69% lifetime risk of CRC, and later age of adenoma sporadic forms of the disease. The remaining 25% of the appearance. Some extracolonic tumors also occur in AFAP, patients have a family history of the disease, suggesting a including duodenum/periampullary and thyroid cancers [3, contribution for shared genes and environment. However, 17]. Gardner syndrome is a variant of FAP and results only 5%-6% of CRC is due to highly penetrant inherited in the manifestation of numerous external and internal mutations in major genes, whilst the remaining of the symptoms including gastrointestinal polyps, osteomas, den- familial forms likely result from interactions between less tal anomalies, desmoid tumors, and epidermoid cysts [18]. penetrant genes and environmental factors [3]. FAP, attenuated FAP, and Gardner syndrome all result from Several studies suggest that first degree relatives of an germline mutations in the tumor suppressor Adenomatous affected individual diagnosed after age 50 years have a Polyposis Coli (APC) gene on chromosome 5q21, which twofold to threefold increased risk of colorectal cancer. encodes a protein acting as an essential negative regulator Moreover, the number of affected family members and age in the evolutionarily conserved Wnt/Wingless (Wg) signal at cancer diagnosis correlate with disease risk, suggesting transduction pathway [19]. Disease severity and the presence that either having more than one first relative with colorectal of extracolonic manifestations seem to be correlated with cancer or a first relative individual diagnosed at an age below the location of the mutation within APC. Severe polyposis > 45 years are conditions associated with a threefold to sixfold ( 1000 adenomas) is found in patients with mutations increased relative risk. When the family history includes two between codons 1250 and 1464. AFAP is correlated with or more relatives with colorectal cancer, the possibility of a mutations before codon 157, after codon 1595, and in the genetic syndrome is increased substantially [3, 7]. alternatively spliced region of exon 9. Mutations in the Other CRC risk factors include the presence of large ser- remainder of the APC gene cause an intermediate phenotype rated polyps (serrated adenomas and hyperplastic polyps), (hundreds to thousands of adenomas). Congenital hypertro- a diet rich in total fat and meat, cigarette smoking, male phies of the retinal pigment epithelium and desmoid tumors gender, the use of nonsteroidal anti-inflammatory drugs, are associated with mutations between codons 311 and 1444 alcohol intake, a sedentary lifestyle, body mass index (BMI) and after codon 1444, respectively [20]. and abdominal obesity [8–12]. High intakes of folate, vitamins and dietary fiber, colonoscopy with removal of 2.1.2. MUTYH-Associated Polyposis (MAP). MUTYH-asso- adenomatous polyps, and postmenopausal hormone use ciated polyposis (MAP) is an autosomal recessive disorder have been associated with decreased CRC risk [13–16]. characterised by adenomatous polyps of the colorectum and a very high risk of colorectal cancer. It shares important 2.1. Major CRC Genes and Syndromes. Some inherited gastroenterological features with autosomal dominant FAP. conditions predispose an individual to the development of The colonic phenotype of MAP mimics AFAP, and the colorectal cancer. The study of these CRC syndromes has led burden of adenomas ranges from very few to hundreds. to the identification of several major CRC genes (Table 1). Key extracolonic manifestations include a predisposition to Among major CRC genetic syndromes there are familial duodenal adenomas and cancer and a modest increase in adenomatous polyposis (FAP), attenuated FAP (AFAP), risk for several extraintestinal tumors [3, 21]. The disease MUTYH-associated polyposis (MAP), and Lynch syndrome is caused by biallelic MUTYH mutations [22]. The Mut (hereditary nonpolyposis colorectal cancer HNPCC). Rare Y homolog (MUTYH) gene, located on chromosome 1p, syndromes include hamartomatous polyposis conditions encodes a protein of the DNA base excision repair pathway (Peutz-Jeghers syndrome (PJS), juvenile polyposis syndrome whose impaired function leads to increased G:C to T:A (JPS), and others) and hyperplastic polyposis (Table 1). transversions. The two common MUTYH variants observed in MAP patients are Tyr165Cys and Gly382Asp [22]. 2.1.1. Familial Adenomatous Polyposis (FAP), Attenuated FAP (AFAP), and Gardner Syndrome. FAP is an autosomal 2.1.3. Lynch Syndrome (Hereditary Nonpolyposis Colorectal dominant condition characterized by the development of Cancer or HNPCC). Lynch syndrome (LS), also known as multiple (hundreds to thousands) adenomas in the rectum hereditary non-polyposis colorectal cancer or HNPCC, is Journal of Biomedicine and Biotechnology 3

Table 1: Major CRC genes and syndromes.

Gene(s) Syndrome Inheritance Lifetime CRC risk APC FAP Autosomal dominant 100% APC AFAP Autosomal dominant 69% MUTYH MAP Autosomal recessive 80% MLH1, MSH2, MSH6, PMS2, TACSTD1 (EpCAM) LS Autosomal dominant 80% STK11 PJS Autosomal dominant 39% SMAD4 (DPC4), BMPR1A JPS Autosomal dominant 39% PTEN CS Autosomal dominant rare

an autosomal dominant condition caused by mutations in 3A → T), that occurs worldwide and may account for one of several DNA mismatch repair (MMR) genes and as much as 5%–10% of all Lynch syndrome (for a review represents the most common hereditary CRC predisposing see [23]). MTS is often associated with germline MSH2 or syndrome, accounting for approximately 3% of the total MLH1 mutations, though sporadic cases are known [24]. CRCs. Unlike FAP, polyposis is rare. Carriers of a Lynch In addition to MSH2, MLH1, MSH6, and PMS2 mutations, syndrome gene mutation have an estimated 80% lifetime little evidence suggests that some cases of Lynch syndrome risk of developing CRC [23]. Colon cancers are most might be due to germline MLH3 variants [25, 26]. Recently, likely to develop in the right side, they frequently show germline deletions in the TACSTD1 gene (also known as mucinous or signet ring cell morphology, are characterized epithelial cell adhesion molecule gene: EpCAM)havebeen by lymphoid aggregates at the periphery of the tumor and/or identified in families with Lynch syndrome resulting in lymphocytes infiltrating the tumor, and have an elevated multiple TACSTD1/MSH2 fusion transcripts and epigenetic frequency of microsatellite instability [23]. In addition to inactivation of the corresponding MSH2 allele [27, 28]. CRC, patients with Lynch syndrome and their relatives are at increased risk for several types of cancers, including 2.1.4. Hamartomatous Polyposis Conditions: Peutz-Jeghers endometrial adenocarcinoma and gastric, ovarian, biliary, Syndrome, Juvenile Polyposis Syndrome, Mixed Polyposis Syn- urinary tract, small bowel, brain, and pancreatic cancers drome, and Others. Peutz-Jeghers syndrome (PJS) is an [3]. Muir-Torre syndrome (MTS) is considered a variant of inherited, autosomal dominant disorder distinguished by Lynch syndrome; it is a rare disorder characterized by the hamartomatous polyps in the gastrointestinal tract and presence of at least one sebaceous gland neoplasm and at least pigmented mucocutaneous lesions, typically presenting in one visceral malignancy. Sebaceous adenomas, sebaceous childhood on the lips, buccal mucosa, and perioral region. carcinomas, and sebaceous epitheliomas are all characteristic Prevalence of PJS is estimated from 1 in 8300 to 1 in 280,000 glandular tumors of MTS. The most common visceral individuals. PJS predisposes sufferers to various malignancies malignancies associated with MTS are colorectal, followed by (gastrointestinal, pancreatic, lung, breast, uterine, ovarian genitourinary. These visceral malignancies frequently have a and testicular tumors) [29, 30]. The majority of patients that more indolent course in patients with MTS than they would meet the clinical diagnostic criteria have a causative mutation otherwise. Muir-Torre syndrome is an autosomal dominant in the tumor suppressor STK11 gene, located at 19p13.3, disorder, often associated with germline mutations in the encoding a serine threonine kinase (STK) protein [31]. MSH2, and the MLH1 genes [24]. The genes responsible Juvenile polyposis syndrome (JPS) is a rare, early-onset for Lynch syndrome include MSH2 (mutS homolog 2)on disease, characterized by the presence of hamartomatous chromosome 2p16, MLH1 (mutL homolog 1)onchro- polyps throughout the gastrointestinal tract [32]. The mosome 3p21, MSH6 (mutS homolog 6) on chromosome lifetime CRC risk in JPS individuals is estimated to be 2p16, and PMS2 (postmeiotic segregation 2) on chromosome 39% [33]. It is estimated that 15%–20% of JPS patients 7p22. These genes encode for MMR proteins that correct carry autosomal dominant mutations in the SMAD4/DPC4 base mismatches or small insertions or deletions occurring (deleted in pancreatic cancer locus 4) gene, on chromosome during DNA replication. Their mutations in Lynch syndrome 18q21.1, that encodes a critical cytoplasmic mediator in individuals account for the microsatellite instability observed the transforming growth factor-beta signaling pathway [34], in tumor cells. MSH2 and MLH1 mutations account for whereas 25%–40% of the patients carry autosomal dominant most of the cases of Lynch syndrome, and several recurrent mutations in the gene encoding bone morphogenetic protein or founder mutations have been identified in these two receptor 1A (BMPR1A), on chromosome 10q22-23 [35]. The genes. For example the founder mutation in Ashkenazi Jews rest of JPS cases appear to be sporadic. (MSH2 1906G>C), a genomic deletion of exon 16 of MLH1 Hereditary mixed polyposis syndrome (HMPS) is char- that probably dates back 1000 years or more and accounts acterized by polyps of mixed adenomatous/hyperplastic/ for >50% of all Lynch syndrome in Finland, a genomic atypical juvenile histology that are autosomal dominantly deletion of exons 1–6 of MSH2 in German American inherited and that eventually lead to colorectal cancer. There populations, and the recurrent A → T transversion in the is consistent phenotypic overlap between JPS and HMPS. donor splice site of intron 5 of MSH2 (designation c.942 + A recent study showed that germline BMPR1A defect is the 4 Journal of Biomedicine and Biotechnology

CRC causing mutation in 50% of Singapore Chinese HMPS (http://www.cancer.gov/cancertopics/genetics/colorectal/ families [36]. Linkage between HMPS and chromosome 15q healthprofessional). Table 2 lists some examples of genes and has also been reported [37]. loci associated with CRC risk. Cowden syndrome (CS) is another rare autosomal dominant hamartomatous polyposis condition. 27%–43% of 2.2.1. Candidate Gene Approaches and Meta-Analyses. Spo- CS patients have been shown to have hamartomatous polyps radic CRC is considered to be a multifactorial disease, in in the gastrointestinal tract; however, CS seems to confer which multiple exposures to endogenous factors interact little, if any, CRC risk [32]. The disease is caused in most of with individual genetic background in a complex manner, the cases by mutations of the tumor suppressor phosphatase resulting in modulation of the risk. Several genes have and tensin homolog (PTEN)gene[38]. been investigated as candidate CRC risk factors, often with conflicting or inconclusive results, and meta-analyses or 2.1.5. Hyperplastic Polyposis Syndrome (HPPS). HPPS is a updated reviews of the literature are currently available. rare condition characterized by the presence of multiple Glutathione S-transferases (GSTs) are particularly attractive and/or large hyperplastic polyps throughout the colon candidates for CRC susceptibility because they code enzymes that predisposes 50% or more of the patients to CRC involved in the metabolism of environmental carcinogens; development [39]. The World Health Organization (WHO) recent meta-analyses of the literature suggest that both established that the diagnosis of HPPS must accomplish one GSTM1 and GSTT1 null genotypes are associated with of the following criteria: (1) at least five hyperplastic polyps an increased risk of CRC, especially in the Caucasian occurring proximal to the sigmoid colon (of which at least populations [41–43]. Conflicting results have been obtained two should be larger than 10 mm in diameter); (2) More than concerning DNA repair gene polymorphisms and CRC 30 hyperplastic polyps distributed throughout the colon; (3) risk [44–46]. Cyclooxygenase-2 (COX2), a key enzyme in at least one hyperplastic polyp proximal to the sigmoid colon arachidonic acid metabolism, is overexpressed in several in an individual who has at least one first-degree relative with epithelial malignancies including colorectal cancer, and HPPS [40]. Little is still known about the etiology and the recent meta-analyses revealed that promoter polymorphisms genetics of this condition. of the COX2 gene may be potential risk factors for cancers of the digestive tract in Asians, including colorectal cancer [47– 49]. Polymorphisms of genes involved in folate metabolism, 2.1.6. Familial Colorectal Cancer (FCC). As detailed in the such as methionine synthase (MTR) and methylenetetrahy- introduction of this section, a family history of colorectal drofolate reductase (MTHFR), might also increase CRC cancer (i.e., one or more relatives with CRC) confers a risk [50, 51]. Interaction between smoking status and N- twofold to sixfold increased CRC risk, depending on the acetyltransferases (NAT1 and NAT2)polymorphismsseem ff number of a ected family members and the age at diagnosis to affect CRC risk [52]. TGF-beta1, its receptor TGFbetaRII, ff of the a ected relatives. Even if it is estimated that familial and the signaling proteins Smad4 and Smad7 have been clusters of CRC account for almost 20% of CRCs in devel- observed in the majority of colorectal cancer tissues [53]. oped countries, the rare CRC syndromes described above Conflicting results have been obtained concerning TGFbeta contribute only to a fraction of them, suggesting the existence receptor I (TGFBR1) polymorphisms and CRC risk [54], of other less penetrant genes and/or gene-environment whilst increased risk of colon cancer was associated with interactionsatthebasisoffamilialCRCaggregatesTheterm variants of SMAD7 in several studies [55–58]. The I1307K familial colorectal cancer (FCC) is used to categorize CRC polymorphism in the APC gene occurs almost exclusively in families that do not meet the clinical criteria for a diagnosis Ashkenazi Jews and increases the risk of colorectal cancer of known hereditary CRC syndromes. Several approaches [59]. Some polymorphisms also affect the phenotype of have been performed to identify less penetrant loci that Lynch syndrome (HNPCC). For example, age at onset of might contribute to familial CRC, including family linkage, CRC in HNPCC is modified by a promoter polymorphism ff a ected relative pair studies, and genome-wide association of the insulin-like growth factor gene (IGF1)[60, 61]. studies. Some of these studies have identified potential loci on chromosomes 8, 9, 11, and 18 (see the review by Jasperson 2.2.2. Genome-Wide Association Studies (GWAS). Large et al. [3], and the next section). genome-wide association studies (GWAS) identified several loci as possible common low-risk susceptibility alleles, 2.2. Genetic Polymorphisms and Colorectal Cancer Risk. including 8q23.3, 8q24, 10p14, 11q23, 15q13, and 18q21 [62, Polymorphisms underlying genetic susceptibility to CRC 63]. A meta-analysis of those GWAS revealed four additional have been investigated either by means of the classical susceptibility loci on 14q22.2, 16q22.1, 19q13.1, and 20p12.3, candidate gene approach (based on the known function of in addition to the six loci previously identified [64]. A the gene and its relevance in pathways likely involved in recent GWAS in German familial CRC cases confirmed CRC pathogenesis) or, more recently, by means of genome- the two previously reported loci at 8q24 and 11q23, and wide association studies (GWAS) where half a million or suggested novel polymorphisms (rs12701937, rs6038071, more single nucleotide polymorphisms (SNPs) are tested and rs11014993) associated with CRC in familial cases [65]. simultaneously in a large case-control cohort. A contin- uously updated overview of the genetic polymorphisms 2.3. Genes Involved in CRC Progression: TP53 and K-RAS. associated with CRC risk can be found at the NCI website Mutations in TP53 and K-RAS do not cause CRC syndromes, Journal of Biomedicine and Biotechnology 5

Table 2: Some of the genes or loci associated with CRC risk (see the text for details).

Gene or locus Type of study Comment GSTT1 null genotype associated with increased CRC GSTT1 Meta-analysis of genetic association studies risk (Caucasians) GSTM1 null genotype associated with increased CRC GSTM1 Meta-analysis of genetic association studies risk (Caucasians) Promoter polymorphisms associated with increased COX2 Meta-analysis of genetic association studies CRC risk (Asians) MTHFR Meta-analysis of genetic association studies MTHFR 677C>T associated with increased CRC risk Interaction between NATs polymorphisms and smoking NATs Gene-environment interaction status affect CRC risk MTR Meta-analysis of genetic association studies MTR 2756A>G associated with increased CRC risk SMAD7 Genetic association studies and GWAS SMAD7 variants associated with increased CRC risk APC I1307K associated with increased CRC risk in APC Genetic association studies Ashkenazi Jews IGF1 promoter polymorphisms associated with IGF1 Genetic association studies HNPCC age at onset 8q23.3 GWAS Associated with CRC risk 8q24 GWAS Associated with CRC risk 10p14 GWAS Associated with CRC risk 11q23 GWAS Associated with CRC risk 15q13 GWAS Associated with CRC risk 14q22.2 Meta-analysis of GWAS Associated with CRC risk 16q22.1 Meta-analysis of GWAS Associated with CRC risk 18q21 GWAS Associated with CRC risk 19q13.1 Meta-analysis of GWAS Associated with CRC risk 20p12.3 Meta-analysis of GWAS Associated with CRC risk however; they are the genetic abnormalities most exhaus- survival. This mutation also appeared to have a greater tively implicated and studied in CRC progression. TP53 impact on outcome in Dukes’ C cancers than in Dukes’ encodes a transcription factor (p53) defined as the “guardian B tumours. The study demonstrated that not only is the of the genome” since it is involved in the coordination of presence of a codon 12 glycine to valine mutation important cellular responses to oxidative stress, DNA damage, cell cycle for cancer progression, but also that it may predispose regulation, apoptosis, and many other pathways. Loss of to more aggressive biological behaviour in patients with TP53 function through gene mutation is a critical event in advanced colorectal cancer [68]. the development and progression of many tumour types including CRC. The majority of TP53 mutations occur in the core domain which contains the sequence-specific DNA 3. Cytogenetics of Colorectal Cancer: binding activity of the protein, and they results in loss The CIN Phenotype of DNA binding. Inactive TP53 mutations were found in 29% of all CRCs and were more frequent in rectal than For colorectal cancers, the acquisition of genomic instability proximal colon tumours. TP53 mutations were associated is considered a key hallmark. Three major molecular sub- with lymphatic invasion in proximal tumors, and with worse types can be recognized: MIN (or MSI, for “microsatellite survival in distal tumors. Higher frequencies of inactive TP53 instability”), CIN (for “chromosomal instability”) and CIMP mutations were also seen in advanced-stage tumours and (for “CpG island methylator phenotype”) [79, 80]. MIN CRC in tumours with the poor prognostic features of vascular accounts for approximately 15%–20% of sporadic colorectal and lymphatic invasion. Inactive TP53 mutations have been cancers. It is a well-defined subtype that results from a loss associated with significantly worse outcome only in patients of DNA mismatch repair function, secondary to inactivation with Dukes stage D tumours [66, 67]. of MMR genes (see Lynch syndrome, Section 2.1.3). MIN The RAS signalling pathway is involved in growth tumors were at the beginning believed to be near-diploid differentiation, cell survival, cell proliferation, apoptosis, with few, if any, karyotypic abnormalities [77]. However cytoskeleton organization and function, inflammation, and in MSI tumors, the pathway of chromosome gains is cell transformation. A glycine to valine mutation on codon frequently observed whereas that of chromosomal losses is 12 of K-RAS, found in 8.6% of all patients, had a statisti- rarely found [75]. On the other hand the definitions of the cally significant impact on failure-free survival and overall three pathways (MIN, CIN, and CIMP) are not completely 6 Journal of Biomedicine and Biotechnology

Table 3: The most frequent aberrations found in CRC (see the text for details).

Chromosome loss Chromosome gain References 18, 17p, 1p, 4, 14, 5q, 21 7, 12, X, 5, 8 Dutrillaux, 1988 [69] 18q21 Fearon et al., 1990 [70] 20q13 Korn et al., 1999 [71] 18q 20q De Angelis et al., 1999 [72] 18p21-pter, 15q11-q21, 8q23-ter, 13p14-31, 20q13 Hermsen et al., 2002 [73] 17p12-13, 18q12-21 4, 18p, 14q 17p, 17q, 1q11, 12p, 19 Diep et al., 2006 [74] 8p, 18q, 1p22, 4q26, 15q21 20, 8q, 8q28, 16q24.3, 20q13 Camps et al., 2006 [75] 18q 13q Fensterer et al., 2007 [76] 18, 17p, Y, 1p3, 8p 13, 20, 7, X, 12, 6 Muleris et al., 2008 [77] 8p, 18, 18q 3, 3q, 5, 5p, 5q, 7, 8q, 20, 20q, 13, X Knutsen et al., 2010 [78] 4, 5, 8, 10, 14, 15, 17, 18, 21, 22, Y, 18q10 [i(8) 7, 13, 20, X Mitelman Database online (q10)], 17q10 [i (17) (q10)]

defined and thus not mutually exclusive, it is believed that a In general, genomic copy number changes are frequently tumor can occasionally show features of multiple pathways, found in different types of cancer and are believed to although the extent and nature of this overlap remains to be contribute to their development and progression through determined [77, 81]. inactivation of tumour suppressor genes, activation of CIN is the most common type of genomic instability oncogenes, or more subtlly through gene dosage changes observed in colon cancer and occurs in 80%–85% of [76]. Chromosomal instability is an efficientmechanismfor colorectal tumors [82]. It occurs mainly in non-MIN cancers causing the physical loss of a wild-type copy of a tumor- (or MSS for “microsatellite stable”) which are proficient for suppressor gene, such as in CRC: APC, TP53,andSMAD mismatch repair. family member 4 (SMAD4), whose normal activities oppose CIN CRC show several forms of genomic instability, the malignant phenotype [85]. The first cytogenetic studies characterized mainly by chromosomal rearrangements and on primary CRC tumors suffered by limitations due to numerical abnormalities at a greatly increased rate compared the poor quality of the preparations. The improvement of with normal cells [83]. molecular cytogenetic studies, performed subsequently with Originally, the CIN phenotype was used to describe the application of fluorescence in situ hybridization (FISH) tumors with a high degree of intercellular heterogeneity in based techniques such as comparative genomic hybridization chromosome number, ascertained by counts for a restricted (CGH) and spectral karyotyping (SKY), allowed many set of chromosome-specific centromeres [79]. CIN was groups to show that colorectal carcinomas are characterized further employed to describe cancers with either aneuploid by multiple patterns of chromosomal imbalances which or polyploid DNA content as measured by cytometry or sequentially accumulate during adenoma to carcinoma pro- cytogenetics, or multiple gains or deletions of chromosomes gression [73]. or chromosome arms, or frequent losses of heterozygosity Among the first findings, Fearon et al. [70]confirmed (LOH) [79]. The first cytogenetic observations on cancer a frequent genomic loss in CRC at chromosome 18q21. By cells from colorectal adenocarcinomas were described by using comparative genomic hybridization (CGH) Korn et al. Dutrillaux [69]. With classical cytogenetic approach he [71] found that most frequent gains are at 20q13 and with the observed two distinct patterns of chromosomal anomalies. same technique De Angelis et al. [72] determined that gains The first one, called “monosomic type”,was characterized by of 20q and losses of 18q were the most frequent aberrations. many chromosomes losses, including the losses or deletions Accumulation of losses in 8p21-pter, 15q11-q21, 17p12- of chromosomes 18, 17 (short arm = p), 1p, 4, 14, 5 (long 13, and 18q12-21, and gains in 8q23-qter, 13q14-31, and arm = q) and 21. He noticed that this condition frequently 20q13 were found strongly associated with adenoma-to- evolves towards polyploidy, by duplication of all remaining carcinoma progression, independent of the degree of dyspla- chromosomes. The second pattern, called “trisomic type”, sia [73]. was characterised by the gain of several chromosomes: 7, 12, Diep et al. [74] by applying different statistical analyses X, 5 and 8. The chromosomal anomalies observed seemed at and combining these on a large series of genome profiles that time to have no topological relationships with oncogenes from reported CRC, were able to identify specific chromo- [69]. Indeed subsequently it became clearer that the cancer- somal alterations linked to the different stages of tumor specific aneuploidies generate complex, malignant pheno- progression. They found that losses at 17p and 18 and types, through the abnormal dosages of the thousands of gains of 8q, 13q, and 20 occur early in the establishment genes [84]. of primary CRC whereas loss of 4p is associated with the Journal of Biomedicine and Biotechnology 7 transition from Dukes’ A to B–D stages. They observed tumors without MIN exhibit a striking defect in chro- that deletion of genes located at chromosome 4 might mosome segregation, resulting in gain, or losses in excess therefore contribute to increased aggressiveness of the tumor, of 10−2 per chromosome per generation. They performed enabling it to penetrate the muscular layer, and contribute cell fusion experiments between CIN and non-CIN cells to the establishment of advanced stages; moreover loss of (transfected HT-29 cells) and showed that the CIN pheno- chromosome 4 has been shown to be associated with poor type acts dominantly at the cellular level, suggesting that it clinical outcome in a large series of CRC [74]. The transition can arise from gain-of-function mutations; aneuploidy was from primary tumor to liver metastasis results correlated considered indeed the result of an abnormally high rate of with the deletion of 8p and gains of 7p and 17q, whereas CIN [79]. losses of 14q and gains of 1q, 11, 12p, and 19 are late events. Muleris et al. [77] performed a study to address the In a pilot study by Fensterer and coworkers [76] using question if CIN occurs mainly as the consequence of either macrodissected paraffin-embedded tissue samples, matrix- missegregation of normal chromosomes (MSG) or structural CGH was performed. The majority of advanced tumours dis- rearrangement (SR) by karyotyping a consecutive series of 96 played 13q-gain and 18q-loss. In locally restricted tumours, near-diploid colorectal cancers. MSGs and SRs were found only half tumours showed a gain on 13q and 7/12 tumours not randomly associated within tumors, delineating two showed a loss on 18q. Interphase-FISH and high-resolution major pathways of chromosome alterations that consisted of arraymapping of the gain on 13q confirmed the validity either chromosome gains by MSG or chromosomal losses by of the arraydata and narrowed the chromosomal interval both MSG and SR [77]. containing potential oncogenes. The amplification on 13q Recently Knutsen et al. [78] reviewed the karyotypes of appeared to harbour candidate genes that might confer a 345 cases of adenocarcinoma of the large intestine listed more aggressive phenotype to colorectal cancer cells [76]. in the Mitelman Database of Chromosome Aberrations in Finally, to summarize the numerous investigations per- Cancer and compared them with the types of abnormalities formed in the last decade in primary colon cancer tumors, observed in 15 established colorectal cancer cell lines, including the recent study by Knutsen and co-workers, reflecting those seen in primary tumors, using spectral comparing the CGH patterns in all of these reports, gains karyotyping (SKY), fluorescence in situ hybridization, and were most frequent for 3/3q, 5/5p/5q, 7, 8q, 20/20q, 13, comparative genomic hybridization (CGH). They found that and the X, and losses were most frequent for 8p and there were no recurrent translocations in either tumors or 18/18q [78]. Searching for the most frequent structural and cell lines; isochromosomes were the most common recurrent numerical aberrations found in the large intestine adeno- abnormalities; and breakpoints occurred most frequently at carcinoma specimens in the Mitelman Database of Chro- the centromeric/pericentromeric and telomere regions. They mosome Aberrations in Cancer (http://cgap.nci.nih.gov/ concluded that copy number alterations appear to be the Chromosomes/Mitelman), among unbalanced Chromoso- major mechanism for transcriptional deregulation of cancer mal Abnormalities there are 8q10 i(8)(q10) and 17q10 genes in CRC [78]. i(17)(q10); among numerical trisomies +7, +13, +20, and Other research groups performed studies addressed to +X; among monosomies −4, −5, −8, −10, −14, −15, −17, identify proteins that regulate the fidelity of chromosomes −18, −21, −22, and −Y. The most recurrent aberration (regulation of DNA fidelity during DNA replication and found in all cytogenetic studies performed, either in primary in response to genotoxic stress) either by means of model tumorsorincoloncancercelllinesorinfixedcolorectal organisms, such as yeasts, Drosophila and mice. Chromoso- cancer tissue blocks is thus 18q (Table 3). LOH of this mal instability is considered the result of somatic mutations region indicates an unfavorable outcome in patients with in genes that regulate the mitotic spindle checkpoint, stage II CRC [86]. In the 18q21-18q21.1 region several DNA replication checkpoints, DNA damage checkpoints, tumor suppressor genes have been mapped, including chromosome metabolism, and centrosome function [81, 82]. SMAD4/DPC4. However, since microsatellite instability was In particular, studies were concentrated on three functional inversely correlated with loss of heterozygosity for chromo- pathways: defects in proteins that are involved in double- somes 5q, 17p, and 18q, it has been hypothesized that some strand break repair, kinetochore function, and chromatid colorectal cancers (MSI in particular) may arise through a segregation [88]. Within this context, Pino and Chung [81] mechanism that does not necessarily involve loss of hetero- observed that although over 100 genes can cause chromoso- zygosity [87]. mal instability in the yeast Saccharomyces cerevisiae,onlya few of them have been observed in human tumors. Genes 3.1. Mechanisms Responsible of Chromosome Instability in such as hMAD, hBUB1, hBUBR1, hZw10, hZwilch, hRod, CRC. In these last years, there has been intense interest CENP-A, CENP-H, and APC are involved in the mitotic in identifying the mechanisms responsible for the CIN. In checkpoint that allows a proper chromosome separation. most carcinomas, including CRC, chromosomal instability Mutations of these genes have been found in human proceeds through two major mechanisms, missegregation cancers, for example mutated hMAD1 and hMAD2 have been that results in aneuploidy through the gain or loss of whole- found in leukaemia and breast cancer, mutations of hZw10, chromosomes, and unbalanced structural rearrangements hZwilch, and hRod have been found in CRC, and mutations (unbalanced translocations, deletions, isochromosomes, ...) of hBUB1 and hBUBR1 resulted in no checkpoint arrest in that lead to the loss and/or gain of chromosomal regions cancer cell lines [81]. The role of APC in CRC pathogenesis [77]. Lengauer and co-workers [79] showed first that CRC has been largely described in Section 2.1.1.TheAPC gene 8 Journal of Biomedicine and Biotechnology product is involved in the Wingless/Wnt signal pathway and instead of cytogenetic ones are more studied and stan- has a role even in chromosome segregation. Other categories dardized, compared to other cancers. For example, germ- of genes that might contribute to the CIN phenotype in line mutations in tumor-suppressor genes, such as APC, CRC tissues are those involved in centrosome function MLH1,andMSH2, indicate a very high risk of colorectal and duplication, such as those encoding the protein kinase cancer and guide the frequency of CRC surveillance and Aurora A (AURKA) and the serine/threonine kinase Plk1 recommendations for prophylactic surgery [85] (see also the (PLK1), and those involved in the DNA damage response previous Section 2.1). machinery, particularly TP53 [81]. Diep and co-workers (see A few genomic markers are useful for prognosis. previous paragraph) supplemented their findings aimed at Microsatellite instability and loss of heterozygosity at chro- the identification of chromosomal aberrations that differen- mosome 18q are the two best-defined molecular prognostic tiate among the Dukes’ stages of colorectal cancer as well markers [91]. as those that are responsible for the progression into liver Studies have been performed to understand functional metastases, with a list of potential target genes for the specific relevance of chromosomal aberrations for colorectal cancer alterations from a publicly available microarray expression progression but these somatic markers have modest or dataset of CRC [74]. For instance a gene that shows reduced unconfirmed prognostic value and are not currently used expression in colorectal carcinomas is CENT1, located at to direct care. Patients with MSI sporadic colorectal cancers 18p11.32. The relative protein, a member of the calcium- generally have a favorable prognosis [91]; poor survival in binding EF-hand protein super-family, has an important stage II and III colon cancers is associated with the loss of role in the determination of centrosome position and p27 (a proapoptotic regulator of the cell cycle) or the loss of segregation, and in the process of microtubule severing. One heterozygosity at chromosomal location 18q [78,Makowitz of the early changes is gain of 20q; the expression data et al., 2009]. However in a large prospective study of patients revealed a potential candidate gene for this chromosomal with non-MSI-high colorectal cancer, 18q LOH or allelic alteration MYBL2, located at 20q13.12 and directly regulated imbalance was not associated with patient survival [92]. by the CDKN2A/CCND/RB/E2F pathway along with many Mutations in K-RAS, observed in approximately 40% critical S-phase genes; increased expression of this gene has of colon tumours, have significant implications for pre- been observed in several tumors [74]. The expression dataset dicting likelihood of response to the antibody-based EGFR revealed moreover that IGFBP1 as a gene that may be one inhibitors (cetuximab and panitumumab) therapy, with K- of the targets for gain of 7p.IGFBP1, an insulin like growth RAS mutant patients now clearly shown to be inherently factor-binding protein, has been observed to have an effect resistant to these agents [1]. on cell growth, and increased expression of this gene has been seen in different cancer types [74]. Barber et al. [89], through bioinformatic approaches 4. Epigenetics and Colorectal Cancer compared 102 human genes highly related to 96 yeast CIN Epigenetics is defined as heritable changes in gene expression genes and showed that downregulation or genetic disruption that are not accompanied by changes in DNA sequence. of genes directly involved in sister chromatid cohesion (such An epigenetic modification is DNA methylation, a covalent as MRE11A and CDC4) play a major role in the CIN addition of a methyl group (CH3) to the nucleotide cytosine. phenotype in human colorectal tumors [89]. In mammals, most of the DNA CpG sites are methylated The comparison of array-CGH and gene expression (90%–98%), but there are specific CpG-rich areas of DNA microarray data for primary CRCs and CRC cell lines where most CpGs are not methylated (CpG islands); a showed that MSI-associated gene expression changes broadly few genes are imprinted genes, regulated by methylation reflect systematic DNA copy-number differences between of the CpG islands in their promoter, and the markings MSI tumors, which tend to be near-diploid, and MSS are stably replicated during cell division but are reversed tumors, which tend to be aneuploid [90]. These data when inherited through an individual of the opposite sex. demonstrate that DNA copy number changes in cancer cells Promoter hypomethylation has been associated with an have profound effects on gene expression, and therefore, this increased gene transcription. DNA hypermethylation occurs mechanism contributes to the clinical differences between at specific regulatory sites in the promoter regions or MSI and MSS tumors. repetitive sequences. A heavy density of cytosine methylation Either TP53 or K-RAS mutations are involved in CRC in the CpG islands of the tumor suppressor gene promoters progression and, given their respective functions (see Sec- can lead to a complete block of transcription, and many types tion 2.3), both genes could contribute to CIN [81]. According of cancer use this mechanism to inactivate tumor suppressor to Pino and Chung [81] other factors that could drive CIN genes. Epigenetic events are a characteristic of human cancer, in CRC are telomere dysfunction and loss of heterozygosity including CRC. Other epigenetic modifications include (LOH) for the genes on 18q. histone acetylation and gene silencing mediated by small noncoding RNA (microRNA or miRNA). Table 4 shows 3.2. Cytogenetic Aberrations in CRC as Biomarkers. In general epigenetic alterations observed in CRC. cytogenetic aberrations found in cancers are considered biomarkers for disease since they can provide diagnos- tic, prognostic, and treatment-related information for the 4.1. DNA Methylation in CRC. Methylation of CDKN2A,a associated cancers. However in CRC molecular biomarkers tumour suppressor gene, is detected in 40% of colorectal Journal of Biomedicine and Biotechnology 9

Table 4: Epigenetic alterations in colorectal cancer.

Genes involved in CRC Gene functions and epigenetic changes APC Adenomatosis polyposis coli Tumour suppressor gene, antagonist of Wnt signaling pathway. O-6-methylguanine-DNA Involved in repairing DNA damage; silencing by hypermethylation correlates with MGMT methyltransferase G to A mutations in the K-RAS oncogene. Cyclin-dependent kinase inhibitor 2A, Tumour suppressor gene, involved in cell cycle regulation; its silencing by CDKN2A/P14 alternated reading frame hypermethylation is associated with increased risk of CRC. This gene encodes for a chromatin remodelling factor. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain HLTF Helicase-like transcription factor genes by altering the chromatin structure around those genes. Its silencing could increase CRC risk. hMLH1, MutL homolog 1, 2 DNA repair genes; their silencing, by hypermethylation is associated with MSI CRC. hMLH2 Tumor suppressor gene that plays an important role in regulating the cell cycle; CDKN2A/P16 Cyclin-dependent kinase inhibitor 2A mutations or inactivation by hypermethylation in the CDKN2A gene are associated with increased risk of a wide range of cancers. It is a regulator of cellular adhesion-deadhesion processes, and its inactivation CDH13 H-cadherin through hypermethylation contributes to the dissemination of cancer cells. UNC5C is one of the Netrin-1 receptors, has tumor-suppressor activity. The loss of UNC5C Unc-5homologC UNC5C expression is particularly prominent in colorectal cancer. Encodes for a membrane-bound protein of the immunoglobulin-CAM family and may function as tumor suppressor gene which controls programmed cell death. DCC Deleted in colorectal carcinoma DCC has been identified on a region of chromosome 18, which is deleted in 70% of colorectal cancer. Prostaglandineendoperoxide COX2 Involved in inflammation and mitogenesis, tumour angiogenesis and metastasis. synthase 2 HACE1 might act as a tumor suppressor in colorectal carcinomas and HACE1 HACE 1 E3 ubiquitin ligase methylation might present a malignant potential in colorectal cancer. Ras association (RalGDS/AF-6) Suppressor protein involved in death receptor-dependent apoptosis and it is RASSF1A domain family 1 localized to microtubules. This gene encodes a member of the runt domain-containing family of transcription factors and can either activate or suppress transcription. It also interacts with other RUNX3 Runt-related transcription factor 3 transcription factors. It functions as a tumor suppressor, and its silencing by hypermethylation could influence CRC risk. SOCS1 is involved in negative regulation of cytokines that signal through the SOCS1 Suppressor of cytokine signaling 1 JAK/STAT3 pathway; its silencing by hypermethylation could influence CRC risk. CHFR functions as part of an early G2/M checkpoint. CHFR might act as a tumor Checkpoint with FHA and RING CHFR suppressor and CHFR methylation might, therefore, be a particular phenomenon finger of early colorectal cancer. Members of this family are membrane-anchored proteins and have been implicated A disintegrin and metalloproteinase in a variety of biological processes involving cell-cell and cell-matrix interactions. ADAM23 domain 23 ADAM23 may be downregulated by aberrant promoter hypermethylation during the progression of colorectal cancer. Deleted in lung and oesophageal May act as a tumor suppressor by inhibiting cell proliferation and its silencing by DLEC1 cancer 1 hypermethylation correlates with CRC risk.

SERF1 Secreted frizzled -related protein 1 Epigenetic silencing of SFRP genes lead to aberrant activation of the Wnt pathway. MyoD removes cells from the cell cycle (halt proliferation) by enhancing the MYOD Myogenic factor 3 transcription of p21. Its silencing could influence CRC risk. TIS gene is a tumor suppressor, which encodes a cyclin-dependent kinase inhibitor and it is positively regulated by transforming growth factor- (TGF-). P15 Cyclin-dependent kinase inhibitor 2B hypermethylation of the P15 gene promoter, which should silence gene expression, correlates with CRC risk. 10 Journal of Biomedicine and Biotechnology

Table 4: Continued.

Genes involved in CRC Gene functions and epigenetic changes P73 maps to chromosome region 1p36.3, which is frequently deleted in a variety of solid tumors. Participates in the apoptotic response to DNA damage. May be a P73 Tumor protein p73 tumor suppressor protein, so its silencing by aberrant methylation correlates with CRC risk. It has a tumor suppressor as well as an oncogenic role in tumor formation. Then WT1 Wilms tumor 1 aberrant methylation could influence CRC risk. Binds to trascription factor E2F-1, p21, Rb family protein; aberrant methylation in Cyclin A1 Cyclin A1 this gene could influence CRC risk. Probably represses transcription via the recruitment of large complexes containing MINT histone deacetylase proteins. May bind both to DNA and RNA. Tumor suppressor gene, mediates the growth inhibitory action of retinoic acid; its RAR-b Retinoic acid receptor beta silencing by hypermethylation promotes tumour progression. Chromodomain helicase Tumor suppressor gene involved in regulating chromatin architecture and in CDH5 DNA-binding protein 5 modifying chromatin structure in an ATP-dependent manner. RGC-32 regulate a group of genes involved in chromatin assembly. RGC-32 knockdown induced an increase in acetylation of histones H2B lysine 5 (H2BK5), RGC-32 Response gene to complement H2BK15, H3K9, H3K18, and H4K8, a decreased expression of SIRT1 and trimethylation of histone H3K27. RGC-32 silencing is associated with chromatin remodeling and activation of cell cycle. It could be repressed by CpG island hypermethylation, relative to normal tissue; it miRNA124a could so influence expression of oncogenic protein. miR-34b/c, miR-9-1, Methylation of these genes was observed in CRC cell lines and in primary CRC miR-129-2 and tumour respect to normal mucosa. R-137 Alterated methylation could upregulate this microRNA in colorectal cancer, miR-21 promoting invasion and metastasis. Down regulated in colon cancer; expression of K-RAS was found inversely miR-143 correlated with this microRNA in vivo; miR-143 was inversely correlated with mRNA and the protein expression of DNMT3A in CRC. Inversed association between this microRNA and the level of APC mRNA was miR135 observed in colorectal adenomas and carcinoma. miR-34amayactasatumorsuppressorbyblockingSIRT1,therebypermitting increased p53 activity. By deacetylating p53, SIRT1 decreases the ability of p53 to miR-34a promote cell cycle arrest. SIRT1 activity may increase the risk of cancer. MiR 34a silencing, by hypermethylation cannot inhibit SIRT1 activity. cancers and has been found also in colorectal adenoma. A significant increase of HACE1 gene methylation in colorec- Methylation of P16 was found in colorectal cancer (Dukes tal cancer was observed in the maximal tumour size. A signif- stage C) suggesting that P16 inactivation was important icant alteration of UNC5C methylationincolorectalcancer, for tumorigenesis [93]. Also, Wettergren and co-workers principally in Dukes stage C than in earlier stages was also found an increase of P16 methylation in older than younger observed [93]. Wasson and coworkers [96] demonstrated patients; moreover the frequency of P16 hypermethylation that in folate depleted colon cells, there was an increment was highest in right-sided colon followed by rectum and left- of global DNA hypomethylation; particularly there was a sided colon. Furthermore patients without methylation of major hypomethylation in the region of TP53 gene. DNA P16 in mucosa, survived more than patients with hyperme- hypomethylation is important for genome stability; then it thylation [94]. Keyes and coworkers [95] found that aging may cause strand breaks and mutagenesis through alterations causes DNA bypomethylation, but increases p16 promoter in chromatin conformation, which increase the accessibility methylation in mouse colons and the effect is dependant on of the DNA to DNA-damaging agents promoting genomic dietary folate. instability. Adifferent CDH13 methylation between poorly differen- The activation of proto-oncogenes, such as RAS gene tiated colorectal cancer and differentiated cancer was found. and the inactivation of tumoursuppressor genes, such as the Journal of Biomedicine and Biotechnology 11

APC and TP53 have been identified in colorectal cancer. of the promoter CpG islands are very common in CRC. In a ThelossofUNC5C and DCC (deleted in colon cancer) study 31 targets have been analyzed, 65 cases of CRC, 8 cases expression is associated with their methylation [97, 98]; of adenoma, five cases of noncancerous mucosa from the aberrant methylation of these genes was detected in 68% cancer patients and one case mucosa from the non-cancerous and 56% respectively of the primary colorectal carcinomas. patient. By taking the methylation profile of the mucosa from Hibi and Nakao [99] studied the combined methylation the non-cancerous patient as the reference, the following status of P16, P14, HLFT (helicase-like transcription factor), genes MGMT, hMLH1, P16, MINT1, MINT31, COX2, cyclin SOCS1 (suppressor of cytokine signalling-1), CDH13 (H- A1, CDX1, RAR-b, MYOD1, P15, CDH13, CXX1, P73,and cadherin),RUNX3(a member of the human runt-related WT1 assumed altered methylation patterns [106]. transcription factor family) and CHFR (checkpoint with FHA and RING finger) in 58 primary colorectal carcinomas 4.2. Modifications of Histones in Colorectal Cancer. Another and correlated them with the pathologic features of the epigenetic change is chromatin modification, specifically, patients. They found a significant difference in histology covalent modifications of the histone proteins. Histone between the number of methylated genes and the colon acetylation is a hallmark of active regions while hypoacety- cancer stadia. Then the methylated status of colorectal carci- lated histone tails are found in transcriptionally inac- nomas was significantly correlated with malignant potential. tive euchromatic or heterochromatic regions. The acety- In a study of Ram´ırez et al. [100], 47% of normal samples lation/deacetylation is performed by histone deacetylases (82 individuals) had nonmethylated gene and 41% of these (HDACs) and histone acetyl transferases. Phosphorylation had one or two methylated-loci. Three or more methylated- of serine 10 in histone H3 has been correlated with gene loci were observed in 12% of normal colon tissues. In inactivation in mammalian cells; methylation of lysine contrast, three or more methylated loci were observed in 9 of histone H3 is associated with DNA silencing. The 33% of tumors samples. MGMT and P14 were the most modifications present on histone tails are recognized by frequent methylated genes in CRC lesions and the least chromatin-remodelling enzymes that are able to modify commonly methylated in the corresponding nontumour chromatin structure; chromodomain helicase DNA-binding tissue; the hMLH1 gene, instead, was the least frequent protein 5 (CDH5) is a tumor suppressor that is involved methylated gene in CRC tissues. Choi and co-workers in proliferation, apoptosis, and senescence. It was found observed that the promoter region of the ADAM23 gene was that epigenetic inactivation of CDH5 contributes to aberrant hypermethylated in colorectal cancer cell lines and tissues. structural changes of chromatin on genome of the cancer Gene silencing caused by aberrant promoter hypermethy- cells (colon, breast, cervix, glioma) [107]. lation is likely to result in abnormal cell-cell interactions Mazon´ Pelaez´ and coworkers suggest that histone cova- and favour cell migration and metastasis [101]. DLEC1, lent modifications can be affected by oncogenic RAS path- located at 3p22.3, is a common tumour suppressor locus ways to regulate the expression of target genes like Cyclin with frequent genetic abnormalities in multiple cancers. It D1 or E-cadherin and that the dynamic balance of opposing was found frequently silenced by promoter methylation in histone-modifying enzymes is critical for the regulation of colorectal and gastric cancers in a tumour-specific manner. cell proliferation [108]. Tumour-specific promoter methylation makes this gene a Response gene to complement 32 (RGC-32) is a substrate biomarker for tumour early diagnosis. Reintroduction of and regulator of CDC2, and its overexpression induces cell DLEC1 into silenced tumour cells significantly suppressed cycle activation. The expression of RGC-32 was found higher tumour cell clonogenicity [102]. Germline mutations in in advanced stages of colon cancer than in precancerous the tumour suppressor APC cause FAP, and somatic muta- states or the initial stages of colon cancer. RGC-32 knock- tions are common in sporadic CRCs. Hypermethylation down induced an increase in acetylation of histones H2B of APC promoter 1A has been reported in early steps of lysine 5 (H2BK5), H2BK15, H3K9, H3K18, and H4K8. RGC- carcinogenesis in several tumours [103]. A study reported 32 silencing was also associated with decreased expression of that the frequencies of aberrant promoter methylation were SIRT1 and decreased trimethylation of histone H3K27. These 16% for CDH1,2%forP16,4%forMGMT and 24% data suggest that RGC-32 may contribute to the development for APC genes. An aberrant methylation of at least one of of colon cancer by regulating chromatin assembly [109]. these genes was found in 45 of 51 (88%) primary tumors [104]. Ras association domain family protein 1A (RASSF1A) is a tumor suppressor protein involved in death receptor- 4.3. MiRNA and Colorectal Cancer. Another type of epi- dependent apoptosis and it is localized to microtubules. genetic event is driven by microRNAs (miRNAs), short, RASSF1A methylation levels were found significantly higher non-coding RNAs, that regulate the translation of several in distal CRCs; then methylation levels of RASSF1A and genes binding to their 3UTR regions (degrading mRNA SFRP1 in the normal-appearing mucosa of distal CRC cases or repressing the expression of their proteins). MiRNAs are were significantly higher than those in the proximal CRC involved in several biological processes; a study marked a cases. Hypermethylation of these genes was also positively miR-34a decrease in human colon cancer tissues compared correlated with age [105]. Silencing of SFRP by promoter with normal tissues; miR-34a inhibited SIRT1 expression and methylation causes constitutive activation of the Wnt/B- increased the level of acetylated p53; suppression of SIRT1 by catenin signaling patway, which is associated with several miR-34a led to apoptosis in human colon cancer cells [110]. tumors as well as CRC. Thus changes in methylation pattern Methylation of miR-34b/c, miR-9-1, miR-129-2 and R-137 12 Journal of Biomedicine and Biotechnology genes was observed in CRC cell lines and in primary CRC Low levels of folate in the diet or in blood were associated tumour in respect to normal mucosa. Expression of K-RAS with higher CRC risk; inversely high intake of folate has been was found inversely correlated with miR143 in vivo; miR- associated with reduced CRC risk [125]. It also observed 143 was inversely correlated with mRNA and the protein that high plasma folate levels may be associated with expression of DNMT3A in CRC. Then, miRNAs expression increased CRC risk [126]. A study observed a small trend for could be reduced by means of DNA methylation, but also it higher levels of serum folate in the group of patients with could downregulate expression of DNMT and influence the methylated tumours, compared to those with unmethylated expression of tumour suppressor genes. Inverse association tumours (P = .06); moreover it was observed a trend for between the level of APC mRNA and miR135 was observed association between serum folate/vitamin B12 levels and in colorectal adenomas and carcinomas [111]. In colorec- gene promoter methylation: higher serum folate/vitamin B12 tal tumors miR-124a could be repressed by CpG island levels were strongly associated with promoter methylation hypermethylation, in respect to normal tissues; it could thus of P16 and had an association (trend) with promoter influence the expression of oncogenic proteins which are methylation of MLH1 and MLH2 genes [127]. Other studies not normally regulated by methylation. MiRNA, as miR-29, demonstrated that high folate intake enhances colorectal could also target DNMT 3A or 3B, participating to reduction recurrence and progression. Animal studies demonstrated of DNA methylation. MiRNAs could be downregulated in that high-dose of folic acid might promote colorectal tumori- tumors, due to chromosomal mutations, normally present genesis [128, 129]. Folate supplementation could protect in cancers. Recent studies have observed a role of miRNA against CRC in normal colorectal tissue, instead it could in metastasis formation. MiR-21, upregulated in colorectal promote tumour progression in pre-existing lesions [125]. cancer, promotes invasion and metastasis by down regulating Alterations in folate metabolizing genes or deficiency Pdcd4 [112]. of folate can result in elevated homocysteine levels. Folate deficiency is significantly more associated with oncogenesis 4.4. Genetic and Environmental Factors Likely Affecting DNA when combined with hyper-omocysteinemia (increased risk Methylation in Colorectal Cancer of 17 times of carcinogenic lesions); moreover, inflam- matory bowel disease patients with folate deficiency and 4.4.1. Polymorphisms of Folate Metabolizing Genes and DNA hyperhomocysteinemia might be associated with increased Methylation in Colorectal Cancer. Folate is a fundamental risk colorectal cancer [130]. It was observed that a positive nutrient mainly required for either DNA synthesis or association between vitamin B6 and rectal cancer risk exists methylation processes. Particularly, it is required for the in women. Among men, methionine was associated with synthesis of S-adenosylmethionine (SAM) the major intra- a decreased risk of proximal colon cancer whilst among cellular methyl donor. The availability of SAM is directly women it was inversely associated with rectal cancer [131]. influenced by the diet. SAM is formed from methyl groups Choline could derive from the diet, but also from derived from choline, methionine, or methyltetrahydrofolate de novo biosynthesis by means of an enzyme coded (MTHF). Because of their involvement in DNA methy- by the gene phosphatidylethanolamine-N-methyltransferase lation, single nucleotide polymorphisms (SNPs) in genes (PEMT). One of choline metabolites, betaine, participates involved in folate metabolism could be associated with in the methylation of homocysteine to form methionine. either aberrant gene methylation or CIMP. Indeed, several Then choline and betaine have been hypothesized to decrease polymorphisms of genes involved in folate metabolism, the risk of colorectal cancer. Estrogens cause a marked up- including methylenetetrahydrofolate reductase (MTHFR) regulationinPMETmRNAexpressionandenzymeactivity, C677T and A1298C, methionine synthase (MTR) A2756G then premenopausal women have an enhanced capacity for and methionine synthase reductase (MTRR) A66G; thymidy- de novo biosynthesis of choline. In choline deficient cells late synthase (TYMS) 28 bp repeats, DNA methyltransferase in culture, and in fetal rodent brains from mothers fed (DNMT3b) -149C>T, and the transcobalamin II (TCNII) with choline-deficient diets, methylation of the CDKN3 776G variant, often in combination with folate intake, have gene promoter decreased, resulting in overexpression of this been associated with CRC risk, CIMP, MSI phenotypes, and gene which inhibits cell proliferation. Maternal diet high aberrant methylation of CRC genes (Table 5)[113–122]. in choline and/or methionine and/or methyl-folate during pregnancy results in epigenetic changes in gene expression 4.4.2. Environmental Factors that Might Influence Epigenetic in the fetus [132]. Patterns in Colorectal Cancer. Studies where people migrate Alcohol consumption was found to be a risk factor for from low to high CRC risk areas of the world, demonstrate colorectal tumorigenesis. In an in vivo study (male rats), it that changes of diet and physical activity enhance the inci- was observed that a decrease in RFC1 (reduced folate carrier) dence of cancer in a high-risk country even over one or two mRNA and protein expression exists during alcoholism. That generations [123]. Moreover, monozygotic twins carriers of is a possible reason of lower blood folate levels commonly high penetrant genetic alteration in HNPCC, associated with found in chronic alcoholics [133]. Alcohol in murine studies MLH1 mutations, develop cancer at different ages. These appears to reduce MTR levels; then it could induce DNA observations suggest a role of the environment in epigenetic hypomethylation [134]. In a Dutch study, higher frequency changes [124]. Table 5 summarizes the contribution of of promoter methylation of APC 1A, P14, MLH1, MGMT, environmental factors to epigenetic modifications relevant to and RASSF1A was observed in low-folate/high-alcohol indi- CRC. viduals respect to high-folate/low alcohol consumers [135]. Journal of Biomedicine and Biotechnology 13

Table 5: Genetics and environmental factors linked to epigenetic changes in CRC.

Genetic and environmental factors Epigenetic changes in CRC TYMS 28 bp 3R/3R genotype Associated with CIMP−CRC MTHFR 677TT + 1298 CC genotypes/adequate folate intake Reduced MSI CRC risk MTHFR AC or CC genotype, low folate and methionine, high Associated with CIMP+ CRC risk alchol TCNII 776G variant Reduced CIMP+ CRC risk MTHFR 677CT genotype Decreased MGMT promoter hypermethylation MTR A2756G Reduced CIMP CRC risk, among men MTRR A66G Reduced MLH1 methylation DNMT -149TT Reduced risk proximal CRC (principally CIMP+ tumour) Associated with P16 promoter methylation and with MLH1, MLH2 High serum folate/vitB12 promoter methylation(trend) Choline deficiency Reduced CDKN3 promoter methylation Increased APC 1A, P14, MLH1, MGMT, and RASSF1A promoter Low folate/High alcohol methylation (trend) Alchol (murine studies) Reduced MTR levels/DNA hypomethylation Tobacco Reduced methylation levels of MGMT, RAR-b, and SST genes Heavy smokers/low folate/low fiber intake/long-term alcohol Increased CIMP+ CRC risk (trend) consumption Green tea Demethylation of MLH1, MGMT, and P16 genes Energy restriction Decreased CIMP+ CRC Higher dietary fiber Reduced risk CIMP+ CRC/restore protein acetylation (p53, Sp1, Sp3) Obesity Increased CIMP-low CRC, not CIMP high CRC Physical activity/use NSAIDs Reduced CIMP-low and CIMP-high CRC

Tobacco could also influence CRC risk. The methylation had a decreased risk of developing a CIMP tumor later levels for MGMT, RAR-b,andSST decrease in the follow- in life respect to individuals who were not exposed. The ing sequence: nonsmokers without colorectal adenomas > prepubertal and pubertal years are a period of rapid growth smokers without colorectal adenomas > nonsmokers with and hormonal change, where insulin-like growth factor-1 colorectal adenomas > smokers with colorectal adenomas. (IGF-1) can be four-times the normal adult serum concen- Smoking predisposes to diminished methylation of several tration. IGF-1 inhibits apoptosis and stimulates proliferation genes, which, in turn, contribute to colorectal adenoma of colonic epithelial cells in vitro. High levels of IGF-1 have development [136]. A study reported, although without been associated with a significant increase in colon cancer statistical significance, that the risk of CIMP-high tumor, risk [138]. It could be possible that energy restriction, during among smokers of 20 or more cigarettes per day, was puberty, may permanently influence the growth hormone- higher among those with low folate and low fiber intake IGF axis, subsequently influencing methylation patterns later and those who had greater longterm alcohol consumption. in life [139]. Moreover, among women alcohol and cigarette smoking Fiber intake reduces CRC risk, with dilution of fecal were associated with risk of CIMP-high tumors; women who potential carcinogens, promoting a favorable colonic micro- smoked 20 or more cigarettes per day and consumed little flora, by adsorption of bile acids and by production or no alcohol did not have an increased risk of a CIMP-high of protective short-chain fatty acids (SCFAs principally tumors [137]. acetate, propionate, and butyrate) through fermentation by In an in vitro study on HT 29 cells, green tea inhibited endosymbiotic bacteria. Butyrate is a potent inhibitor of DNMT1 causing CpG demethylation and reactivation of histone deacetylases (HDACs); reduced levels of butyrate previously methylated genes (hMLH1, MGMT, P16). Also will cause alterations in global protein acetylation, which selenium suppressed aberrant DNA methylation by means of may be permissive for colorectal cancer progression, while DNMT inhibition [134]. elevation of fibre levels and consequent butyrate levels may Energy restriction during adolescence and early adult- reduce or reverse these processes and restore a “normal” hood is associated with the CIMP phenotype in CRC, sug- profile of protein acetylation. Acetyl proteins identified are gesting that exposure to a transient environmental condition nuclear structural proteins, transcription factors including during this period of life may result in persistent epigenetic p53, Sp1, and Sp3, and structural proteins including tubulin changes that later influence CRC development. Individuals and cytokeratins [140]. Higher dietary fiber was associated exposed to a period of severe short-term energy restriction, with reduced risk of having a CIMP-high tumor [137]. Obese 14 Journal of Biomedicine and Biotechnology individuals were at 2-fold increased risk of CIMP-low colon A restricted folate diet or SNPs in one-carbon metab- cancer, but obesity does not influence CIMP-high tumors olism, then the reduction of the total amounts of DNA [137]. methylation in human tumors leads to hypomethylation DNA methylation has been also hypothesized as being a of repetitive DNA sequences, contributing to the origin consequence of inflammation. Prostaglandins, that promote of cancer cells by generation of chromosomal instability, inflammation and fever, are produced within the body reactivation of transposable elements, and loss of imprinting; cells by the enzyme cyclooxygenase (COX). Nonsteroidal moreover, hypomethylation could activate proto-oncogenes. antiinflammatory drugs (NSAIDs) block the COX enzymes The misincorporation of uracil into human DNA, favoured and reduce prostaglandins throughout the body, then their when thymidylate availability is restricted, could also assumption has been hypothesized to be associated with increase the frequency of chromosome cleavage. On the development of colon tumors that display CIMP. other hand, tumor suppressor genes could gain CpG island Physical activity and use of NSAIDs were inversely methylation, resulting in the inactivation of these protecting associated with both CIMP-low and CIMP-high tumors. The proteins. Moreover epigenetic alterations could influence protective effect associated with regular NSAIDs use largely either cancer initiation or progression. A tumor could disappeared among heavy smokers [137]. take different paths; therefore it is important to obtain data about age, sex, tumor site, stadiation, and diet when investigating genetic and epigenetic risk factors for CRC. 5. Concluding Remarks DNA methylation and histone modification changes are reversible, while genetic mutations are not; then, it could An unresolved question related to genomic instability, which be interesting to evaluate their relationship with dietary has been raised in many papers, is whether CIN arises factors and the genetic background of the individuals, for the early in tumorigenesis and initiates the adenoma-carcinoma development of novel strategies for cancer prevention. sequence or whether it is acquired during this process and There is a need for a preventive strategy that can utilize facilitates the formation of colon cancer. According to the biomarkers in order to stratify patients into appropriate genetic model of colorectal tumorigenesis, cancers develop screening or surveillance programs. In CRC, the best over the course of 20–40 years due to genetic disruption of biomarkers are germline APC mutations, which are highly the APC, RAS, and p53 pathways. Genetic instability arises predictive of colon cancer. Moreover, CRC in particular somewhere during the process of colorectal tumorigenesis, has a potential for prevention, since most cancers follow but whether it is the first event and therefore, initiates and the adenoma-carcinoma sequence, and the interval between drives the neoplastic transformation is still a matter of much detection of an adenoma and its progression to carcinoma is debate [141]. usually about a decade. There is also need of identifying clin- Some reports suggest that CIN arises early in colorectal ical variables (biomarkers) associated with clinical outcomes. tumorigenesis and, subsequently, drives tumor progression. New molecular biomarkers may be identified in the next Michor et al. [141] developed a mathematical representation decade, such as epigenetic methylation patterns and genetic of the evolutionary dynamics of colorectal tumorigenesis and polymorphisms. found that one or two CIN genes in the genome are enough to make sure CIN emerges early. However this view is not universally accepted: some Acknowledgment Authors are inclined to believe that CIN is acquired during F. Coppede` was supported by the Istituto Toscano Tumori, tumorigenesis and facilitates progression to malignancy. Florence, Italy. Even in light of the latest knowledge, the question is still considered unresolved (see the recent review by Pino and Chung [81]). References Different tumors show various patterns of aneuploidy. However, since chromosomal changes found in the tumors [1] D. Cunningham, W. Atkin, H. J. Lenz et al., “Colorectal of different individuals are not random, aneuploidy should cancer,” The Lancet, vol. 375, no. 9719, pp. 1030–1047, 2010. not be considered a side effect. The loss of heterozigosyty that [2] R. Labianca, G. D. Beretta, B. Kildani et al., “Colon cancer,” Critical Reviews in Oncology/Hematology, vol. 74, no. 2, pp. occur in the first phases of the CRC cancerogenesis, as well as 106–133, 2010. the alteration of methylation pattern of multiple key genes [3]K.W.Jasperson,T.M.Tuohy,D.W.Neklason,andR.W. can drive the development of colorectal cancer by facilitating Burt, “Hereditary and familial colon cancer,” Gastroenterol- the acquisition of multiple tumor-associated mutations and ogy, vol. 138, no. 6, pp. 2044–2058, 2010. the instability phenotype. [4]B.M.WolpinandR.J.Mayer,“Systemictreatmentof Aberrant CpG island methylation is involved in cancer colorectal cancer,” Gastroenterology, vol. 134, no. 5, pp. 1296– development, but it is not yet clear if it is a cause or an effect 1310, 2008. of cancer formation, which genes are methylated during [5] E. R. Fearon and B. Vogelstein, “A genetic model for the pathogenesis of individual cancers, when is the time of colorectal tumorigenesis,” Cell, vol. 61, no. 5, pp. 759–767, methylation and gene silencing, how specific methylation 1990. profiles are established, and what determines tumor type- [6] A. Bellacosa, “Genetic hits and mutation rate in col- specific methylation [103]. orectal tumorigenesis: versatility of Knudson’s theory and Journal of Biomedicine and Biotechnology 15

implications for cancer prevention,” Genes Chromosomes and [22] N. Al-Tassan, N. H. Chmiel, J. Maynard et al., “Inherited vari- Cancer, vol. 38, no. 4, pp. 382–388, 2003. ants of MYH associated with somatic G:C → T:A mutations [7] L. E. Johns and R. S. Houlston, “A systematic review and in colorectal tumors,” Nature Genetics, vol. 30, no. 2, pp. 227– meta-analysis of familial colorectal cancer risk,” American 232, 2002. Journal of Gastroenterology, vol. 96, no. 10, pp. 2992–3003, [23] H. T. Lynch, P. M. Lynch, S. J. Lanspa, C. L. Snyder, J. F. 2001. Lynch, and C. R. Boland, “Review of the Lynch syndrome: [8] C. A. Gonzalez, E. Riboli, K. Overvad et al., “Diet and cancer history, molecular genetics, screening, differential diagnosis, prevention: contributions from the European Prospective and medicolegal ramifications,” Clinical Genetics, vol. 76, no. Investigation into Cancer and Nutrition (EPIC) study,” 1, pp. 1–18, 2009. European Journal of Cancer, vol. 46, no. 14, pp. 2555–2562, [24] H. H. Hare, N. Mahendraker, S. Sarwate, and K. Tangella, 2010. “Muir-Torre syndrome: a rare but important disorder,” Cutis, [9] S. Hiraoka, J. Kato, S. Fujiki et al., “The presence of vol. 82, no. 4, pp. 252–256, 2008. large serrated polyps increases risk for colorectal cancer,” [25]Y.Wu,M.J.W.Berends,R.H.Sijmonsetal.,“Arolefor Gastroenterology, vol. 139, no. 5, pp. 1503–1510, 2010. MLH3 in hereditary nonpolyposis colorectal cancer,” Nature [10] M. Hoffmeister, S. Schmitz, E. Karmrodt et al., “Male sex and Genetics, vol. 29, no. 2, pp. 137–138, 2001. smoking have a larger impact on the prevalence of colorectal [26] T. Hienonen, P. Laiho, R. Salovaara et al., “Little evidence for neoplasia than family history of colorectal cancer,” Clinical involvement of MLH3 in colorectal cancer predisposition,” Gastroenterology and Hepatology, vol. 8, no. 10, pp. 870–876, International Journal of Cancer, vol. 106, no. 2, pp. 292–296, 2010. 2003. [11] L. Huang, X. Wang, W. Gong, Y. Huang, and B. Jiang, “The [27] M. E. Kovacs, J. Papp, Z. Szentirmay, S. Otto, and E. Olah, comparison of the clinical manifestations and risk factors of “Deletions removing the last exon of TACSTD1 constitute a colorectal cancer and adenomas: results from a colonoscopy- distinct class of mutations predisposing to lynch syndrome,” based study in southern Chinese,” International Journal of Human Mutation, vol. 30, no. 2, pp. 197–203, 2009. Colorectal Disease, vol. 25, no. 11, pp. 1343–1351, 2010. [28] M. J. L. Ligtenberg, R. P. Kuiper, T. L. Chan et al., “Heritable [12] S. C. Larsson and A. Wolk, “Meat consumption and risk somatic methylation and inactivation of MSH2 in families  of colorectal cancer: a meta-analysis of prospective studies,” with Lynch syndrome due to deletion of the 3 exons of International Journal of Cancer, vol. 119, no. 11, pp. 2657– TACSTD1,” Nature Genetics, vol. 41, no. 1, pp. 112–117, 2009. 2664, 2006. [29] M. Kopacova, I. Tacheci, S. Rejchrt, and J. Bures, “Peutz- Jeghers syndrome: diagnostic and therapeutic approach,” [13] M. Bretthauer, “Evidence for colorectal cancer screening,” World Journal of Gastroenterology, vol. 15, no. 43, pp. 5397– Best Practice & Research Clinical Gastroenterology, vol. 24, no. 5408, 2009. 4, pp. 417–425, 2010. [30] A. D. Beggs, A. R. Latchford, H. F. A. Vasen et al., “Peutz- [14] C. C. Dahm, R. H. Keogh, E. A. Spencer et al., “Dietary fiber Jeghers syndrome: a systematic review and recommendations and colorectal cancer risk: a nested case-control study using for management,” Gut, vol. 59, no. 7, pp. 975–986, 2010. food diaries,” Journal of the National Cancer Institute, vol. [31] D. E. Jenne, H. Reimann, J. I. Nezu et al., “Peutz-Jeghers 102, no. 9, pp. 614–626, 2010. syndrome is caused by mutations in a novel serine threonine [15] J. S. Hildebrand, E. J. Jacobs, P. T. Campbell et al., “Colorectal kinase,” Nature Genetics, vol. 18, no. 1, pp. 38–43, 1998. cancer incidence and postmenopausal hormone use by type, [32] D. Calva and J. R. Howe, “Hamartomatous polyposis syn- recency, and duration in cancer prevention study II,” Cancer dromes,” Surgical Clinics of North America, vol. 88, no. 4, pp. Epidemiology Biomarkers and Prevention, vol. 18, no. 11, pp. 779–817, 2008. 2835–2841, 2009. [33] L. A. A. Brosens, A. Van Hattem, L. M. Hylind et al., “Risk [16] D.-H. Kim, S. A. Smith-Warner, D. Spiegelman et al., “Pooled of colorectal cancer in juvenile polyposis,” Gut, vol. 56, no. 7, analyses of 13 prospective cohort studies on folate intake and pp. 965–967, 2007. colon cancer,” Cancer Causes and Control, vol. 21, no. 11, pp. [34] J. R. Howe, S. Roth, J. C. Ringold et al., “Mutations in the 1919–1930, 2010. SMAD4/DPC4 gene in juvenile polyposis,” Science, vol. 280, [17] E. Half, D. Bercovich, and P. Rozen, “Familial adenomatous no. 5366, pp. 1086–1088, 1998. polyposis,” Orphanet Journal of Rare Diseases, vol. 4, no. 1, [35] J. R. Howe, J. L. Bair, M. G. Sayed et al., “Germline mutations article 22, 2009. of the gene encoding bone morphogenetic protein receptor [18] E. Juhn and A. Khachemoune, “Gardner syndrome: skin 1A in juvenile polyposis,” Nature Genetics,vol.28,no.2,pp. manifestations, differential diagnosis and management,” 184–187, 2001. American Journal of Clinical Dermatology,vol.11,no.2,pp. [36] P. Y. Cheah, YU. H. Wong, Y. P. Chau et al., “Germline bone 117–122, 2010. morphogenesis protein receptor 1A mutation causes colorec- [19] H. Benchabane and Y. Ahmed, “The adenomatous polyposis tal tumorigenesis in hereditary mixed polyposis syndrome,” coli tumor suppressor and Wnt signaling in the regulation of American Journal of Gastroenterology, vol. 104, no. 12, pp. apoptosis,” Advances in Experimental Medicine and Biology, 3027–3033, 2009. vol. 656, pp. 75–84, 2009. [37] E. E. M. Jaeger, K. L. Woodford-Richens, M. Lockett et al., [20] M. H. Nieuwenhuis and H. F. A. Vasen, “Correlations “An ancestral Ashkenazi haplotype at the HMPS/CRAC1 between mutation site in APC and phenotype of familial locus on 15q13-q14 is associated with hereditary mixed adenomatous polyposis (FAP): a review of the literature,” polyposis syndrome,” American Journal of Human Genetics, Critical Reviews in Oncology/Hematology,vol.61,no.2,pp. vol. 72, no. 5, pp. 1261–1267, 2003. 153–161, 2007. [38] D. Liaw, D. J. Marsh, J. Li et al., “Germline mutations of [21] J. R. Sampson and N. Jones, “MUTYH-associated polyposis,” the PTEN gene in Cowden disease, an inherited breast and Best Practice and Research: Clinical Gastroenterology, vol. 23, thyroid cancer syndrome,” Nature Genetics, vol. 16, no. 1, pp. no. 2, pp. 209–218, 2009. 64–67, 1997. 16 Journal of Biomedicine and Biotechnology

[39] C. A. Rubio, S. Stemme, E. Jaramillo, and A. Lindblom, [54] L. G. Carvajal-Carmona, M. Churchman, C. Bonilla et al., “Hyperplastic polyposis coli syndrome and colorectal carci- “Comprehensive assessment of variation at the transforming noma,” Endoscopy, vol. 38, no. 3, pp. 266–270, 2006. growth factor β type 1 receptor locus and colorectal cancer [40] J. Jass, “Hyperplastic polyposis,” in Pathology and Genetics predisposition,” Proceedings of the National Academy of of Tumors of the Digestive System,S.R.HamiltonandL. Sciences of the United States of America, vol. 107, no. 17, pp. A. Aaltonen, Eds., pp. 135–136, International Agency for 7858–7862, 2010. Research on Cancer, Lyon, France, 2000. [55] P. Broderick, L. Carvajal-Carmona, A. M. Pittman et al., “A [41] Y. Gao, Y. Cao, A. Tan, C. Liao, Z. Mo, and F. Gao, genome-wide association study shows that common alleles “Glutathione S-transferase M1 polymorphism and sporadic of SMAD7 influence colorectal cancer risk,” Nature Genetics, colorectal cancer risk: an updating meta-analysis and HuGE vol. 39, no. 11, pp. 1315–1317, 2007. review of 36 case-control studies,” Annals of Epidemiology, [56] C. L. Thompson, S. J. Plummer, L. S. Acheson, T. C. Tucker, vol. 20, no. 2, pp. 108–121, 2010. G. Casey, and . , “Association of common genetic variants in [42] C. Liao, Y. Cao, L. Wu, J. Huang, and F. Gao, “An SMAD7 and risk of colon cancer,” Carcinogenesis, vol. 30, no. updating meta-analysis of the glutathione S-transferase T1 6, pp. 982–986, 2009. polymorphisms and colorectal cancer risk: a HuGE review,” [57] A. M. Pittman, S. Naranjo, E. Webb et al., “The colorectal International Journal of Colorectal Disease,vol.25,no.1,pp. cancer risk at 18q21 is caused by a novel variant altering 25–37, 2010. SMAD7 expression,” Genome Research,vol.19,no.6,pp. [43] K. P. Economopoulos and T. N. Sergentanis, “GSTM1, 987–993, 2009. GSTT1, GSTP1, GSTA1 and colorectal cancer risk: a com- [58] M. L. Slattery, J. Herrick, K. Curtin et al., “Increased risk prehensive meta-analysis,” European Journal of Cancer, vol. of colon cancer associated with a genetic polymorphism of 46, no. 9, pp. 1617–1631, 2010. SMAD7,” Cancer Research, vol. 70, no. 4, pp. 1479–1485, [44] B. Wang, D. Wang, G. Huang, C. Zhang, D. H. Xu, and W. 2010. Zhou, “XRCC1 polymorphisms and risk of colorectal cancer: [59] G. Y. Locker, K. Kaul, D. S. Weinberg et al., “The I1307K a meta-analysis,” International Journal of Colorectal Disease, APC polymorphism in Ashkenazi Jews with colorectal can- vol. 25, no. 3, pp. 313–321, 2010. cer: clinical and pathologic features,” Cancer Genetics and [45] Z. Jiang, C. Li, YE. Xu, and S. Cai, “A meta-analysis on Cytogenetics, vol. 169, no. 1, pp. 33–38, 2006. XRCC1 and XRCC3 polymorphisms and colorectal cancer [60] S. G. Reeves, D. Rich, C. J. Meldrum et al., “IGF1 is a modifier risk,” International Journal of Colorectal Disease, vol. 25, no. of disease risk in hereditary non-polyposis colorectal cancer,” 2, pp. 169–180, 2010. International Journal of Cancer, vol. 123, no. 6, pp. 1339– 1343, 2008. [46] K. Curtin, W. Y. Lin, R. George et al., “Genetic variants in [61] M. Zecevic, C. I. Amos, X. Gu et al., “IGF1 gene poly- XRCC2: new insights into colorectal cancer tumorigenesis,” morphism and risk for hereditary nonpolyposis colorectal Cancer Epidemiology Biomarkers and Prevention, vol. 18, no. cancer,” Journal of the National Cancer Institute, vol. 98, no. 9, pp. 2476–2484, 2009. 2, pp. 139–143, 2006. [47] H. Cao, Z. Xu, H. Long, X.-Q. Li, and S.-L. Li, “The - [62] I. P. M. Tomlinson, E. Webb, L. Carvajal-Carmona et al., “A 765C allele of the cyclooxygenase-2 gene as a potential risk genome-wide association study identifies colorectal cancer factor of colorectal cancer: a meta-analysis,” Tohoku Journal susceptibility loci on chromosomes 10p14 and 8q23.3,” of Experimental Medicine, vol. 222, no. 1, pp. 15–21, 2010. Nature Genetics, vol. 40, no. 5, pp. 623–630, 2008. [48]J.Dong,J.Dai,M.Zhang,Z.Hu,andH.Shen,“Potentially > [63] A. Tenesa, S. M. Farrington, J. G.D. Prendergast et al., functional COX-2-1195G A polymorphism increases the “Genome-wide association scan identifies a colorectal cancer risk of digestive system cancers: a meta-analysis,” Journal of susceptibility locus on 11q23 and replicates risk loci at 8q24 Gastroenterology and Hepatology, vol. 25, no. 6, pp. 1042– and 18q21,” Nature Genetics, vol. 40, no. 5, pp. 631–637, 1050, 2010. 2008. − > [49] W. Zhu, B. B. Wei, X. Shan, and P. Liu, “ 765G Cand [64] R. S. Houlston, E. Webb, P. Broderick et al., “Meta-analysis > 8473T C polymorphisms of COX-2 and cancer risk: a meta- of genome-wide association data identifies four new suscep- analysis based on 33 case-control studies,” Molecular Biology tibility loci for colorectal cancer,” Nature Genetics, vol. 40, no. Reports, vol. 37, no. 1, pp. 277–288, 2010. 12, pp. 1426–1435, 2008. ff [50] Y. Huang, S. Han, Y. Li, Y. Mao, and Y. Xie, “Di erent roles [65] J. Lascorz, A. Forsti,¨ B. Chen et al., “Genome-wide associa- of MTHFR C677T and A1298C polymorphisms in colorectal tion study for colorectal cancer identifies risk polymorphisms adenoma and colorectal cancer: a meta-analysis,” Journal of in German familial cases and implicates MAPK signalling Human Genetics, vol. 52, no. 1, pp. 73–85, 2007. pathways in disease susceptibility,” Carcinogenesis, vol. 31, no. [51] K. Yu, J. Zhang, J. Zhang et al., “Methionine synthase A2756G 9, pp. 1612–1619, 2010. polymorphism and cancer risk: a meta-analysis,” European [66] A. Russo, V. Bazan, B. Iacopetta, D. Kerr, T. Soussi, and N. Journal of Human Genetics, vol. 18, no. 3, pp. 370–378, 2010. Gebbia, “The TP53 colorectal cancer international collabo- [52] M. Sørensen, H. Autrup, A. Olsen, A. Tjønneland, K. rative study on the prognostic and predictive significance of Overvad, and O. Raaschou-Nielsen, “Prospective study of p53 mutation: influence of tumor site, type of mutation, and NAT1 and NAT2 polymorphisms, tobacco smoking and meat adjuvant treatment,” Journal of Clinical Oncology, vol. 23, no. consumption and risk of colorectal cancer,” Cancer Letters, 30, pp. 7518–7528, 2005. vol. 266, no. 2, pp. 186–193, 2008. [67] B. Iacopetta, A. Russo, V. Bazan et al., “Functional categories [53]M.Gulubova,I.Manolova,J.Ananiev,A.Julianov,Y. of TP53 mutation in colorectal cancer: results of an Interna- Yovchev, and K. Peeva, “Role of TGF-β1, its receptor tional Collaborative Study,” Annals of Oncology, vol. 17, no. TGFβRII, and Smad proteins in the progression of colorectal 5, pp. 842–847, 2006. cancer,” International Journal of Colorectal Disease, vol. 25, [68] H. J. N. Andreyev, A. R. Norman, D. Cunningham et al., no. 5, pp. 591–599, 2010. “Kirsten ras mutations in patients with colorectal cancer: Journal of Biomedicine and Biotechnology 17

the ’RASCAL II’ study,” British Journal of Cancer, vol. 85, no. [85] S. D. Markowitz and M. M. Bertagnolli, “Molecular origins 5, pp. 692–696, 2001. of cancer: molecular basis of colorectal cancer,” New England [69] B. Dutrillaux, “Recent data on the cytogenetics of colorectal Journal of Medicine, vol. 361, no. 25, pp. 2449–2460, 2009. adenocarcinoma,” Bulletin du Cancer, vol. 75, no. 6, pp. 509– [86] E. Martinez-Lopez, A. Abad, A. Font et al., “Allelic loss on 516, 1988. chromosome 18q as a prognostic marker in stage II colorectal [70] E. R. Fearon, K. R. Cho, J. M. Nigro et al., “Identification of cancer,” Gastroenterology, vol. 114, no. 6, pp. 1180–1187, a chromosome 18q gene that is altered in colorectal cancers,” 1998. Science, vol. 247, no. 4938, pp. 49–56, 1990. [87] S. N. Thibodeau, G. Bren, and D. Schaid, “Microsatellite [71] W. M. Korn, T. Yasutake, W. L. Kuo et al., “Chromosome arm instability in cancer of the proximal colon,” Science, vol. 260, 20q gains and other genomic alterations in colorectal cancer no. 5109, pp. 816–819, 1993. metastatic to liver, as analyzed by comparative genomic [88] Z. Wang, J. M. Cummins, D. Shen et al., “Three classes hybridization and fluorescence in situ hybridization,” Genes of genes mutated in colorectal cancers with chromosomal Chromosomes and Cancer, vol. 25, no. 2, pp. 82–90, 1999. instability,” Cancer Research, vol. 64, no. 9, pp. 2998–3001, [72] P. De Angelis, O. P. F. Clausen, A. Schjølberg, and T. 2004. Stokke, “Chromosomal gains and losses in primary colorectal [89]T.D.Barber,K.McManus,K.W.Y.Yuenetal.,“Chro- carcinomas detected by CGH and their associations with matid cohesion defects may underlie chromosome instability tumour DNA ploidy, genotypes and phenotypes,” British in human colorectal cancers,” Proceedings of the National Journal of Cancer, vol. 80, no. 3-4, pp. 526–535, 1999. Academy of Sciences of the United States of America, vol. 105, [73] M. Hermsen, C. Postma, J. Baak et al., “Colorectal adenoma no. 9, pp. 3443–3448, 2008. to carcinoma progression follows multiple pathways of [90] R. N. Jorissen, L. Lipton, P. Gibbs et al., “DNA copy-number ff chromosomal instability,” Gastroenterology, vol. 123, no. 4, alterations underlie gene expression di erences between pp. 1109–1119, 2002. microsatellite stable and unstable colorectal cancers,” Clinical [74] C. B. Diep, K. Kleivi, F. R. Ribeiro, M. R. Teixeira, O. C. Cancer Research, vol. 14, no. 24, pp. 8061–8069, 2008. Lindgjærde, and R. A. Lothe, “The order of genetic events [91] G. Lurje, WU. Zhang, and H. J. Lenz, “Molecular prognostic associated with colorectal cancer progression inferred from markers in locally advanced colon cancer,” Clinical Colorectal meta-analysis of copy number changes,” Genes Chromosomes Cancer, vol. 6, no. 10, pp. 683–690, 2007. and Cancer, vol. 45, no. 1, pp. 31–41, 2006. [92] S. Ogino, K. Nosho, N. Irahara et al., “Prognostic significance and molecular associations of 18q loss of heterozygosity: [75] J. Camps, G. Armengol, J. del Rey et al., “Genome-wide dif- a cohort study of microsatellite stable colorectal cancers,” ferences between microsatellite stable and unstable colorectal Journal of Clinical Oncology, vol. 27, no. 27, pp. 4591–4598, tumors,” Carcinogenesis, vol. 27, no. 3, pp. 419–428, 2006. 2009. [76] H. Fensterer, B. Radlwimmer, J. Strater¨ et al., “Matrix- [93] T. Goto, H. Mizukami, A. Shirahata et al., “Aberrant methy- comparative genomic hybridization from multicenter lation of the p16 gene is frequently detected in advanced formalin-fixed paraffin-embedded colorectal cancer tissue colorectal cancer,” Anticancer Research,vol.29,no.1,pp. blocks,” BMC Cancer, vol. 7, article 58, 2007. 275–277, 2009. [77] M. Muleris, A. Chalastanis, N. Meyer et al., “Chromosomal [94] Y. Wettergren, E. Odin, S. Nilsson, G. Carlsson, and B. instability in near-diploid colorectal cancer: a link between Gustavsson, “p16INK4a gene promoter hypermethylation in numbers and structure,” PLoS ONE, vol. 3, no. 2, Article ID mucosa as a prognostic factor for patients with colorectal e1632, 2008. cancer,” Molecular Medicine, vol. 14, no. 7-8, pp. 412–421, [78] T. Knutsen, H. M. Padilla-Nash, D. Wangsa et al., “Definitive 2008. molecular cytogenetic characterization of 15 colorectal can- [95] M. K. Keyes, H. Jang, J. B. Mason et al., “Older age and dietary cer cell lines,” Genes Chromosomes and Cancer, vol. 49, no. 3, folate are determinants of genomic and p16-specific DNA pp. 204–223, 2010. methylation in mouse colon,” Journal of Nutrition, vol. 137, [79] C. Lengauer, K. W. Kinzler, and B. Vogelstein, “Genetic no. 7, pp. 1713–1717, 2007. instability in colorectal cancers,” Nature, vol. 386, no. 6625, [96] G. R. Wasson, A. P. McGlynn, H. McNulty et al., “Global pp. 623–627, 1997. DNA and p53 region-specific hypomethylation in human [80] M. Toyota, N. Ahuja, M. Ohe-Toyota, J. G. Herman, S. B. colonic cells is induced by folate depletion and reversed by Baylin,andJ.P.J.Issa,“CpGislandmethylatorphenotype folate supplementation,” Journal of Nutrition, vol. 136, no. 11, in colorectal cancer,” Proceedings of the National Academy of pp. 2748–2753, 2006. Sciences of the United States of America, vol. 96, no. 15, pp. [97] A. Bernet, L. Mazelin, M. M. Coissieux et al., “Inactivation 8681–8686, 1999. of the UNC5C netrin-1 receptor is associated with tumor [81] M. S. Pino and D. C. Chung, “The chromosomal instability progression in colorectal malignancies,” Gastroenterology, pathwayincoloncancer,”Gastroenterology, vol. 138, no. 6, vol. 133, no. 6, pp. 1840–1848, 2007. pp. 2059–2072, 2010. [98] S. K. Shin, T. Nagasaka, B. H. Jung et al., “Epigenetic and [82] W. M. Grady and J. M. Carethers, “Genomic and epigenetic genetic alterations in Netrin-1 receptors UNC5C and DCC instability in colorectal cancer pathogenesis,” Gastroenterol- in human colon cancer,” Gastroenterology, vol. 133, no. 6, pp. ogy, vol. 135, no. 4, pp. 1079–1099, 2008. 1849–1857, 2007. [83] H. Rajagopalan, M. A. Nowak, B. Vogelstein, and C. [99] K. Hibi and A. Nakao, “Highly-methylated colorectal cancers Lengauer, “The significance of unstable chromosomes in show poorly-differentiated phenotype,” Anticancer Research, colorectal cancer,” Nature Reviews Cancer,vol.3,no.9,pp. vol. 26, no. 6 B, pp. 4263–4266, 2006. 695–701, 2003. [100] N. Ram´ırez, E. Bandres,´ A. Navarro et al., “Epigenetic events [84] P. Duesberg, R. Li, A. Fabarius, and R. Hehlmann, “Aneu- in normal colonic mucosa surrounding colorectal cancer ploidy and cancer: from correlation to causation,” Contribu- lesions,” European Journal of Cancer, vol. 44, no. 17, pp. 2689– tions to Microbiology, vol. 13, pp. 16–44, 2006. 2695, 2008. 18 Journal of Biomedicine and Biotechnology

[101] J. S. Choi, K. H. Kim, Y. K. Jeon et al., “Promoter hyperme- [117] A. M. Eaton, R. Sandler, J. M. Carethers, R. C. Millikan, J. thylation of the ADAM23 gene in colorectal cancer cell lines Galanko, and T. O. Keku, “5,10-Methylenetetrahydrofolate and cancer tissues,” International Journal of Cancer, vol. 124, reductase 677 and 1298 polymorphisms, folate intake, and no. 6, pp. 1258–1262, 2009. microsatellite instability in colon cancer,” Cancer Epidemiol- [102] J. Ying, F. F. Poon, J. Yu et al., “DLEC1 is a functional 3p22.3 ogy Biomarkers and Prevention, vol. 14, no. 8, pp. 2023–2029, tumour suppressor silenced by promoter CpG methylation 2005. in colon and gastric cancers,” British Journal of Cancer, vol. [118] K. Curtin, M. L. Slattery, C. M. Ulrich et al., “Genetic 100, no. 4, pp. 663–669, 2009. polymorphisms in one-carbon metabolism: associations [103] M. S. Kim, J. Lee, and D. Sidransky, “DNA methylation with CpG island methylator phenotype (CIMP) in colon markers in colorectal cancer,” Cancer and Metastasis Reviews, cancer and the modifying effects of diet,” Carcinogenesis, vol. vol. 29, no. 1, pp. 181–206, 2010. 28, no. 8, pp. 1672–1679, 2007. [104] H. Kamiyama, H. Noda, O. Takata, K. Suzuki, Y. Kawamura, [119] B. Iacopetta, J. Heyworth, J. Girschik, F. Grieu, C. Clayforth, and F. Konishi, “Promoter hypermethylation of tumor- and L. Fritschi, “The MTHFR C677T and ΔDNMT3B C- related genes in peritoneal lavage and the prognosis of 149T polymorphisms confer different risks for right- and patients with colorectal cancer,” Journal of Surgical Oncology, left-sided colorectal cancer,” International Journal of Cancer, vol. 100, no. 1, pp. 69–74, 2009. vol. 125, no. 1, pp. 84–90, 2009. [105] B. An, Y. Kondo, Y. Okamoto et al., “Characteristic methy- [120] T. Yamaji, M. Iwasaki, S. Sasazuki, H. Sakamoto, T. Yoshida, lation profile in CpG island methylator phenotype-negative and S. Tsugane, “Methionine synthase A2756G polymor- distal colorectal cancers,” International Journal of Cancer, vol. phism interacts with alcohol and folate intake to influence the 127, no. 9, pp. 2095–2105, 2010. risk of colorectal adenoma,” Cancer Epidemiology Biomarkers [106] X. L. Xu, J. Yu, H. Y. Zhang et al., “Methylation profile of and Prevention, vol. 18, no. 1, pp. 267–274, 2009. the promoter CpG islands of 31 genes that may contribute to [121] S. De Vogel, K. A. D. Wouters, R. W. H. Gottschalk et colorectal carcinogenesis,” World Journal of Gastroenterology, al., “Genetic variants of methyl metabolizing enzymes and vol. 10, no. 23, pp. 3441–3454, 2004. epigenetic regulators: associations with promoter CpG island [107] S. Mulero-Navarro and M. Esteller, “Chromatin remodeling hypermethylation in colorectal cancer,” Cancer Epidemiology factor CHD5 is silenced by promoter CpG island hyperme- Biomarkers and Prevention, vol. 18, no. 11, pp. 3086–3096, thylation in human cancer,” Epigenetics, vol. 3, no. 4, pp. 210– 2009. 215, 2008. [122] P. Karpinski, A. Myszka, D. Ramsey et al., “Polymorphisms [108] I. Mazon´ Pelaez,´ M. Kalogeropoulou, A. Ferraro et al., in methyl-group metabolism genes and risk of sporadic “Oncogenic RAS alters the global and gene-specific histone colorectal cancer with relation to the CpG island methylator modification pattern during epithelial-mesenchymal transi- phenotype,” Cancer Epidemiology, vol. 34, no. 3, pp. 338–344, tion in colorectal carcinoma cells,” International Journal of 2010. Biochemistry and Cell Biology, vol. 42, no. 6, pp. 911–920, [123] M. NystromandM.Mutanen,“Dietandepigeneticsincolon¨ 2010. cancer,” World Journal of Gastroenterology,vol.15,no.3,pp. [109] S. I. Vlaicu, C. A. Tegla, C. D. Cudrici et al., “Epigenetic mod- 257–263, 2009. ifications induced by RGC-32 in colon cancer,” Experimental [124] M. Esteller, “Epigenetics in evolution and disease,” The and Molecular Pathology, vol. 88, no. 1, pp. 67–76, 2010. Lancet, vol. 372, pp. 590–596, 2008. [110] M. Yamakuchi, M. Ferlito, and C. J. Lowenstein, “miR-34a [125] W. Du, W.-Y. Li, R. Lu, and J.-Y. Fang, “Folate and fiber in repression of SIRT1 regulates apoptosis,” Proceedings of the the prevention of colorectal cancer: between shadows and the National Academy of Sciences of the United States of America, light,” World Journal of Gastroenterology,vol.16,no.8,pp. vol. 105, no. 36, pp. 13421–13426, 2008. 921–926, 2010. [111] M. Liu and H. Chen, “The role of microRNAs in colorectal [126] B. Van Guelpen, J. Hultdin, I. Johansson et al., “Low folate cancer,” Journal of Genetics and Genomics,vol.37,no.6,pp. levels may protect against colorectal cancer,” Gut, vol. 55, no. 347–358, 2010. 10, pp. 1461–1466, 2006. [112] S. A. Melo and M. Esteller, “Dysregulation of microRNAsin [127] P.Mokarram, K. Kumar, H. Brim et al., “Distinct high-profile cancer: playing with fire,” FEBS Letters. In press. methylated genes in colorectal cancer,” PLoS ONE, vol. 4, no. [113] M. L. Slattery, J. D. Potter, W. Samowitz, D. Schaffer, and 9, Article ID e7012, 2009. M. Leppert, “Methylenetetrahydrofolate reductase, diet, and [128] Y. I. Kim, “Folate and colorectal cancer: an evidence-based risk of colon cancer,” Cancer Epidemiology Biomarkers and critical review,” Molecular Nutrition and Food Research, vol. Prevention, vol. 8, no. 6, pp. 513–518, 1999. 51, no. 3, pp. 267–292, 2007. [114] A. J. Levine, K. D. Siegmund, C. M. Ervin et al., “The [129] J. B. Mason, A. Dickstein, P. F. Jacques et al., “A temporal methylenetetrahydrofolate reductase 677C → Tpolymor- association between folic acid fortification and an increase phism and distal colorectal adenoma risk,” Cancer Epidemi- in colorectal cancer rates may be illuminating important ology Biomarkers and Prevention, vol. 9, no. 7, pp. 657–663, biological principles: a hypothesis,” Cancer Epidemiology 2000. Biomarkers and Prevention, vol. 16, no. 7, pp. 1325–1329, [115] T. Keku, R. Millikan, K. Worley et al., “5,10-Methyl- 2007. enetetrahydrofolate reductase codon 677 and 1298 polymor- [130] J. M. Phelip, V. Ducros, J. L. Faucheron, B. Flourie, and phisms and colon cancer in African Americans and whites,” X. Roblin, “Association of hyperhomocysteinemia and folate Cancer Epidemiology Biomarkers and Prevention, vol. 11, no. deficiency with colon tumors in patients with inflammatory 12, pp. 1611–1621, 2002. bowel disease,” Inflammatory Bowel Diseases,vol.14,no.2, [116] S. Kang, J. W. Kim, G. H. Kang et al., “Polymorphism in pp. 242–248, 2008. folate- and methionine-metabolizing enzyme and aberrant [131] S. De Vogel, V. Dindore, M. Van Engeland, R. A. Goldbohm, CpG island hypermethylation in uterine cervical cancer,” P. A. Van Den Brandt, and M. P. Weijenberg, “Dietary folate, Gynecologic Oncology, vol. 96, no. 1, pp. 173–180, 2005. methionine, riboflavin, and vitamin B-6 and risk of sporadic Journal of Biomedicine and Biotechnology 19

colorectal cancer,” JournalofNutrition, vol. 138, no. 12, pp. 2372–2378, 2008. [132] S. H. Zeisel, “Gene response elements, genetic polymor- phisms and epigenetics influence the human dietary require- ment for choline,” IUBMB Life, vol. 59, no. 6, pp. 380–387, 2007. [133] A. Hamid, M. Kiran, S. Rana, and J. Kaur, “Low folate transport across intestinal basolateral surface is associated with down-regulation of reduced folate carrier in in vivo model of folate malabsorption,” IUBMB Life, vol. 61, no. 3, pp. 236–243, 2009. [134] R. P. Arasaradnam, D. M. Commane, D. Bradburn, and J. C. Mathers, “A review of dietary factors and its influence on DNA methylation in colorectal carcinogenesis,” Epigenetics, vol. 3, no. 4, pp. 193–198, 2008. [135] M. Van Engeland, M. P. Weijenberg, G. M. J. M. Roemen et al., “Effects of dietary folate and alcohol intake on promoter methylation in sporadic colorectal cancer: the Netherlands cohort study on diet and cancer,” Cancer Research, vol. 63, no. 12, pp. 3133–3137, 2003. [136] B. C. Paun, D. Kukuruga, Z. Jin et al., “Relation between normal rectal methylation, smoking status, and the presence or absence of colorectal adenomas,” Cancer, vol. 116, no. 19, pp. 4495–4501, 2010. [137] M. L. Slattery, K. Curtin, C. Sweeney et al., “Diet and lifestyle factor associations with CpG island methylator phenotype and BRAF mutations in colon cancer,” International Journal of Cancer, vol. 120, no. 3, pp. 656–663, 2007. [138] S. E. Olivo-Marston, S. D. Hursting, J. Lavigne et al., “Genetic reduction of circulating insulin-like growth factor- 1 inhibits azoxymethane-induced colon tumorigenesis in mice,” Molecular Carcinogenesis, vol. 48, no. 12, pp. 1071– 1076, 2009. [139] L. A. E. Hughes, P. A. van den Brandt, A. P. de Bru¨ıne et al., “Early life exposure to famine and colorectal cancer risk: a role for epigenetic mechanisms,” PLoS ONE, vol. 4, no. 11, Article ID e7951, 2009. [140] B. M. Corfe, E. A. Williams, J. P. Bury et al., “A study protocol to investigate the relationship between dietary fibre intake and fermentation, colon cell turnover, global protein acetylation and early carcinogenesis: the FACT study,” BMC Cancer, vol. 9, article 332, 2009. [141] F. Michor, Y. Iwasa, C. Lengauer, and M. A. Nowak, “Dynamics of colorectal cancer,” Seminars in Cancer Biology, vol. 15, no. 6, pp. 484–493, 2005. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 631268, 8 pages doi:10.1155/2011/631268

Research Article MYC, TP53, and Chromosome 17 Copy-Number Alterations in Multiple Gastric Cancer Cell Lines and in Their Parental Primary Tumors

MarianaFerreiraLeal,1 Danielle Queiroz Calcagno,2 Joana de Fatima´ Ferreira Borges da Costa,2 Tanielly Cristina Raiol Silva,2 Andre´ Salim Khayat,2 Elizabeth Suchi Chen,1 Paulo Pimentel Assumpc¸ao,˜ 3 Marılia´ de Arruda Cardoso Smith,1 and Rommel Rodrıguez´ Burbano2

1 Genetics Division, Department of Morphology and Genetics, Federal University of Sao˜ Paulo, 04023-900 Sao˜ Paulo, SP, Brazil 2 Human Cytogenetics Laboratory, Institute of Biological Sciences, Federal University of Para,´ 66073-000 Bel´em, PA, Brazil 3 Surgery Service, Joao˜ de Barros Barreto University Hospital, Federal University of Para,´ 60673-000 Bel´em, PA, Brazil

Correspondence should be addressed to Mariana Ferreira Leal, [email protected]

Received 11 September 2010; Revised 23 December 2010; Accepted 8 January 2011

Academic Editor: Yataro Daigo

Copyright © 2011 Mariana Ferreira Leal et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

We evaluated whether MYC, TP53, and chromosome 17 copy-number alterations occur in ACP02, ACP03, and AGP01 gastric cancer cell lines and in their tumor counterpart. Fluorescence in situ hybridization for MYC and TP53 genes and for chromosome 17 was applied in the 6th, 12th, 60th, and 85th passages of the cell lines and in their parental primary tumors. We observed that three and four MYC signals were the most common alterations in gastric cell lines and tumors. ACP02 presented cells with two copies of chr17 and loss of one copy of TP53 more frequently than ACP03 and AGP01. Only ACP03 and AGP01 presented clonal chr17 trisomy with three or two TP53 copies. The frequency of MYC gain, TP53 loss, and chromosome 17 trisomy seems to increase in gastric cell lines compared to their parental tumors. Our findings reveal that these cell lines retain, in vitro, the genetic alterations presented in their parental primary tumors.

1. Introduction are also a useful tool for the study of anticancer treatments in vitro and in animal xenograft models. However, the process Chromosomal instability is characterized by changes in chro- of cell line immortalization has been implicated as a source mosome copy number (aneuploidy) and alterations in chro- of cytogenetic changes, and growth passages have been asso- mosomal regions, which may induce oncogene activation, ciated with random genomic instability [8–11]. Given their tumor suppressor gene inactivation, or both. Chromosomal importance as models, it is important to understand in which instability is one of the two major genomic instability path- way and to what degree cell lines grown under artificial con- ways observed in gastric cancer (GC) [1], the fourth most ditions reflect their parental in vivo genetic architecture [8]. frequent type of cancer and second most frequent cause of Our research group previously established three GC cell cancer mortality worldwide [2]. However, due to the diffi- lines from tumor samples of individuals from Northern culty in obtaining high-quality chromosome preparations in Brazil. ACP02 cell line was established from a diffuse-type these neoplasias, the evaluation of chromosomal alterations GC, and ACP03 and AGP01 were from an intestinal-type is complicated [3–7]. GC. These cell lines exhibited a composite karyotype with Cell lines derived from human cancers are useful in several clonal chromosomal alterations. All these cell lines order to understand the chromosomal alterations and other presented chromosome 8 trisomy—where MYC oncogene molecular alterations in the carcinogenesis process. Cell lines is located—and deletion of chromosome arm 17p, which 2 Journal of Biomedicine and Biotechnology includes the TP53 tumor suppressor locus. Moreover, were commonly observed. In the 85th passage, the most chromosome 17 (chr17) trisomy in ACP03 and AGP01 cell frequent alteration was the presence of 4 signals for MYC lines was detected [12]. probe, ranging from 33.5%–42% of cells. Five or more MYC Here, we analyzed the number of MYC, TP53, and chr17 copies by cells were also observed in all cell lines and parental copies in 6th (short-duration culture), 12th (long-duration tumors. High amplification of MYC was detected as clonal culture), 60th and 85th passages of ACP02, ACP03 and alteration mainly in cell lines (Figure 1(c)). AGP01 cell lines, and in their parental primary tumors. We Statistical analysis revealed that the frequency of cells ff aim to evaluate whether these gene/chromosomal alterations with high MYC amplification was significantly di erent χ2 = . occur in cell lines and in their tumor counterpart, as well as among ACP02, ACP03, and AGP01 cell lines ( 9 206, = P = . whether multiple passage growth leads to a difference in the df 2, 01, by Kruskal-Wallis test). The Games-Howell frequency of these alterations. posthoc analyses demonstrated that the ACP02, cell line, and parental tumor, presented a lower frequency of high MYC amplification cells than AGP01 (P = .019) and ACP03 (P = 2. Materials and Methods .014). FISH was performed on recently made slides from methanol/ Concerning the MYC signal frequency during culture χ2 = acetic acid fixed cells of four passages (6th, 12th, 60th, and process, we observed that the frequency of cells with 2 ( . = P = . χ2 = . 85th) of ACP02, ACP03, and AGP01 cell lines, as previously 10 933, df 4, 027, by Friedman test), 4 ( 10 667, = P = . χ2 = . described [13]. FISH was also applied on nuclei isolated df 4, 031, by Friedman Test), 5 or more ( 11 467, = P = . from parental primary tumors as previously reported [14]. df 4, 022, by Friedman test), and high amplification χ2 = . = P = . Tumor samples were obtained from Joao˜ de Barros Barreto ( 11 429, df 4, 022, by Friedman test) MYC ff University Hospital (HUJBB) in Para´ State, Brazil. copies were significantly di erent among parental tumor and their passages. However, the posthoc analysis by Wilcoxon To determine MYC gene copy number, cells were hybrid- test with Bonferroni correction did not reveal any significant ized with a rhodamine-labeled probe (Chromotrax, USA) for difference, probably due to the gradual alterations among MYC gene region (8q24.1-q24.2). To determine the chro- passages (Figures 2(a), 2(b), 2(c), 2(d)). mosome 17 and TP53 copy numbers, cells were hybridized using a dual-color direct labeled probe (Qbiogene, USA) specific for chr17 α-satellite and for TP53 gene region, and 3.2. Chr17/TP53. Two signals for chr17 and TP53 were labeled with fluorescein and rhodamine, respectively. Nuclei observed in about 97% of control cells (Figure 1(d)). Table 2 were counterstained with DAPI/antifade (Chemicon, USA). shows the frequency of chr17/TP53 signalsincelllinesfrom Fluorescence was detected using an Olympus BX41 fluores- the 6th, 12th, 60th, and 85th passages and tumor samples. cence microscope with DAPI/FITC/TRICT filters (Olympus, Thefrequencyofcellswith2signalsforchr17and2 Japan), and signals were analyzed using FISHView of Applied signals for TP53 was significantly different among ACP02, Spectral Imaging image analysis system (ASI Ldt., Israel). For ACP03, and AGP01 cell lines (χ2 = 6, df = 2, P = .05, each cell line or tumor, 200 interphase nuclei were analyzed by Kruskal-Wallis test). The Games-Howell posthoc analyses and scored using the criteria of Hopman et al. [15]. To avoid demonstrated that the ACP02, cell line, and parental tumor misinterpretation due to technical error, gastric mucosal presented a higher number of this cell type than AGP01. tissue (nonneoplastic) and normal lymphocyte nuclei were ACP02 also presented a higher frequency of cells with two used as control. copies of chr17 than AGP01 (P = .003, by Games-Howell P = . For statistical analysis, the MYC, TP53, or chr17 copy posthoc analysis) and ACP03 ( 009, by Games-Howell numbers were compared among cell lines using Krus- posthoc analysis). kal-Wallis nonparametric test followed by Games-Howell The frequency of cells with 2/1 (χ2 = 10.839, df = 2, posthoc test. Friedman test followed by Wilcoxon posthoc P = .004, by Kruskal-Wallis test), 2/3 (χ2 = 11.423, df = 2, test with Bonferroni correction were used to evaluate differ- P = .003, by Kruskal-Wallis test), and 3/3 (χ2 = 10.691, df = ences among primary tumor and their cell line passages. In 2, P = .005, by Kruskal-Wallis test) copies of chr17/TP53 was all analyses, the confidence interval was 95%, and P values significantly different among cell lines. The Games-Howell less than .05 were considered significant. posthoc analyses demonstrated that the ACP02 presented a higher frequency of cells with 2 copies of chr17 and loss of P = . P = . 3. Results TP53 than AGP01 ( 001) and ACP03 ( 001). In ACP02, the most common alteration observed was the loss 3.1. MYC. Two signals for MYC probe were observed in of one copy of TP53 (Figure 1(e)). 99.5% of peripheral blood lymphocytes and in 97% of nor- Only ACP03 and AGP01 presented clonal chr17 trisomy mal gastric cells (Figure 1(a)). Table 1 shows the frequency with two or three copies of TP53. Thus, the Games-Howell of MYC signals in cell lines and parental tumors. In primary posthoc analysis among cell lines also demonstrated that tumor samples, three MYC signals were the most frequent AGP01 and ACP03 presented a higher frequency of cells with alteration, ranging from 39%–45% of cells (Figure 1(b)). In chr17 trisomy with 2 TP53 copies than ACP02 (P = .035 and the 6th and 12th passages, 3 MYC signals were the most P = .15, resp.; Figure 1(f)). AGP01 also presented a higher frequent alteration (about 40%) followed by 4 signals (about frequency of cells with chr17 trisomy and 3 TP53 copies than 28%). In the 60th passage of cell lines, 3 and 4 MYC signals ACP02 (P = .013). Journal of Biomedicine and Biotechnology 3

(a) (d)

(b) (e)

(c) (f)

Figure 1: Fluorescence in situ hybridization assay. (a) Interphase nuclei presenting two MYC signals from normal gastric mucosa; (b) interphase nuclei presenting 2–5 MYC signals from ACP02 parental primary tumor; (c) interphase nuclei presenting MYC signal number alterations, including high amplification, from the 85th passage of AGP01 cell line; (d) interphase and metaphase cells presenting two copies of chr17/TP53 from lymphocytes control, with the green spots representing the 17 centromere probe and the red representing the TP53 gene probe; (e) interphase nuclei presenting two signals of chr17 and two or one TP53 signal(s) from ACP02 parental primary tumor; (f) interphase nuclei presenting three signals for chr17 and two TP53 signals from the 85th passage of ACP03 cell line. 4 Journal of Biomedicine and Biotechnology

Table 1: FISH analysis of MYC copy number in gastric cancer cell lines, in their parental primary tumors and in control samples.

Nuclei exhibiting MYC signals, no. (%)a 1 signal 2 signals 3 signals 4 signals ≥5 signals HA Parental primary tumor 0 (0) 57 (28.5) 78 (39) 57 (28.5) 8 (4) 0 (0) 6th passage 1 (0.5) 40 (20) 84 (42) 62 (31) 13 (6.5) 0(0) ACP02 12th passage 0 (0) 34 (17) 88 (44) 63 (31.5) 15 (7.5) 0(0) 60th passage 0 (0) 6 (3) 83 (41.5) 79 (39.5) 24 (12.5) 7 (3.5) 85th passage 2 (1) 8 (4) 65 (32.5) 84 (42) 30 (15) 11 (5.5) Parental primary tumor 0 (0) 39 (19.5) 84 (42) 41 (20.5) 23 (11.5) 13 (6.5) 6th passage 0(0) 33 (16.5) 89 (44.5) 40 (20) 24 (12) 14 (7) ACP03 12th passage 1 (0.5) 19 (9.5) 85 (42.5) 51 (25.5) 29 (14.5) 15 (7.5) 60th passage 1 (0.5) 8 (4) 71 (35.5) 63 (31.5) 39 (19.5) 18 (9) 85th passage 0 (0) 6 (3) 47 (23.5) 69 (34.5) 49 (24.5) 29 (14.5) Parental primary tumor 0 (0) 47 (23.5) 90 (45) 37 (18.5) 17 (8.5) 9 (4.5) 6th passage 4 (2) 12 (6) 69 (34.5) 59 (29.5) 36 (18) 20 (10) AGP01 12th passage 1 (0.5) 13 (6.5) 70 (35) 56 (28) 33 (16.5) 27 (13.5) 60th passage 0 (0) 2 (1) 64 (32) 63 (31.5) 41 (20.5) 30 (15) 85th passage 1 (0.5) 1 (0.5) 45 (22.5) 67 (33.5) 49 (24.5) 37 (18.5) Normal stomach tissue 4 (2) 194 (97) 2 (1) 0 (0) 0 (0) 0 (0) Control Lymphocytes 1 (0.5) 199 (99.5) 0 (0) 0 (0) 0 (0) 0 (0) a The FISH analysis was performed on 200 nuclei. HA: high amplification.

Table 2: FISH analysis of chr17/TP53 copy number in gastric cancer cell lines, in their parental primary tumors and in control samples.

Nuclei exhibiting chr17/TP53 signals, no. (%)a 1/0 signal 1/1 signals 2/1 signals 2/2 signals 2/3 signals 3/2 signals 3/3 signals Parental primary tumor 3 (1.5) 4 (2) 63 (31.5) 130 (65) 0 (0) 0 (0) 0 (0) 6th passage 2 (1) 4 (2) 62 (31) 132 (66) 0 (0) 0 (0) 0 (0) ACP02 12th passage 0 (0) 7 (3.5) 73 (36.5) 120 (60) 0 (0) 0 (0) 0 (0) 60th passage 1 (0.5) 10 (5) 84 (42) 104 (52) 1 (0.5) 0 (0) 0 (0) 85th passage 2 (1) 25 (12.5) 102 (51) 69 (34.5) 1 (0.5) 0 (0) 1 (0.5) Parental primary tumor 2 (1) 14 (7) 17 (8.5) 100 (50) 0 (0) 54 (27) 13 (6.5) 6th passage 3 (1.5) 15 (7.5) 14 (7) 86 (43) 3 (1.5) 47 (23.5) 32 (16) ACP03 12th passage 4 (2) 8 (4) 9 (4.5) 75 (37.5) 4 (2) 55 (27.5) 45 (22.5) 60th passage 1 (0.5) 1 (0.5) 2 (1) 21 (10.5) 2 (1) 70 (35) 103 (51.5) 85th passage 3 (1.5) 0 (0) 5 (2.5) 6 (3) 5 (2.5) 121 (60.5) 60 (30) Parental primary tumor 6 (3) 29 (14.5) 7 (3.5) 116 (58) 4 (2) 12 (6) 26 (13) 6th passage 5 (2.5) 12 (6) 4 (2) 36 (18) 0 (0) 31 (15.5) 112 (56) AGP01 12th passage 0 (0) 9 (4.5) 3 (1.5) 35 (17.5) 6 (3) 37 (18.5) 110 (55) 60th passage 4 (2) 4 (2) 0 (0) 30 (15) 5 (2.5) 36 (18) 121 (60.5) 85th passage 3 (1.5) 7 (3.5) 0 (0) 23 (11.5) 3 (1.5) 70 (35) 94 (47) Normal stomach tissue 0 (0) 4 (2) 1 (0.5) 193 (96.5) 0 (0) 0 (0) 2 (1) Control Lymphocytes 0 (0) 3 (1.5) 1 (0.5) 195 (97.5) 1 (0.5) 0 (0) 0 (0) a The FISH analysis was performed on 200 nuclei.

Concerning the chr17 and TP53 alterations during cul- did not reveal any significant difference, probably due to the ture process, we observed that the frequency of cells with two gradual alterations among passages (Figures 2(e), 2(f), 2(g), copies of chr17/TP53 (χ2 = 11.467, df = 4, P = .022, by 2(h)). Friedman test), two chr17 copies (χ2 = 10.373, df = 4, P = .035, by Friedman test), and chr17 trisomy (χ2 = 10.4, df = 4. Discussion 4, P = .034, by Friedman test) were significantly different among parental tumor and their passages. However, the Fluorescence in situ hybridization (FISH) assay allows rapid posthoc analysis by Wilcoxon test with Bonferroni correction detection of numerical genetic aberrations in interphase Journal of Biomedicine and Biotechnology 5

AGP01 ACP02 50 50 45 45 40 40 35 35 30 30 25 25 Cells (%) Cells (%) 20 20 15 15 10 10 5 5 0 0 Primary 6th 12th 60th 85th Primary 6th 12th 60th 85th tumor passage passage passage passage tumor passage passage passage passage (a) (b)

50 ACP03 70 Cell lines 45 60 40 35 50

30 40 25 30 Cells (%) 20 Cells (%) 15 20 10 10 5 0 0 Primary 6th 12th 60th 85th Primary 6th 12th 60th 85th tumor passage passage passage passage tumor passage passage passage passage

1MYCsignal 4MYCsignals 1MYCsignal 4MYCsignals 2MYCsignals 5ormoreMYCsignals 2MYCsignals 5ormoreMYCsignals 3MYCsignals High amplification of MYC 3MYCsignals High amplification of MYC (c) (d)

AGP01 70 70 ACP02

60 60

50 50

40 40

30 30 Cells (%) Cells (%) 20 20

10 10

0 0 Primary 6th 12th 60th 85th Primary 6th 12th 60th 85th tumor passage passage passage passage tumor passage passage passage passage

0/1 TP53/chr17 signal 3/2 TP53/chr17 signal 0/1 TP53/chr17 signal 3/2 TP53/chr17 signals 1/1 TP53/chr17 signals 2/3 TP53/chr17 signals 1/1 TP53/chr17 signals 2/3 TP53/chr17 signals 1/2 TP53/chr17 signals 3/3 TP53/chr17 signals 1/2 TP53/chr17 signals 3/3 TP53/chr17 signals 2/2 TP53/chr17 signals 2/2 TP53/chr17 signals (e) (f)

Figure 2: Continued. 6 Journal of Biomedicine and Biotechnology

70 ACP03 70 Cell lines

60 60

50 50

40 40

30 30 Cells (%) Cells (%)

20 20

10 10

0 0 Primary 6th 12th 60th 85th Primary 6th 12th 60th 85th tumor passage passage passage passage tumor passage passage passage passage

0/1 TP53/chr17 signal 3/2 TP53/chr17 signals 0/1 TP53/chr17 signal 3/2 TP53/chr17 signals 1/1 TP53/chr17 signals 2/3 TP53/chr17 signals 1/1 TP53/chr17 signals 2/3 TP53/chr17 signals 1/2 TP53/chr17 signals 3/3 TP53/chr17 signals 1/2 TP53/chr17 signals 3/3 TP53/chr17 signals 2/2 TP53/chr17 signals 2/2 TP53/chr17 signals (g) (h)

Figure 2: Distribution of cells according to (a) MYC signals in AGP01 parental tumor and cell line passages; (b) MYC signals in ACP02 parental tumor and cell line passages; (c) MYC signals in ACP03 parental tumor and cell line passages; (d) mean of MYC signals of AGP01, ACP02, and ACP03 parental tumor and cell line passages; (e) TP53/chr17 signals in AGP01 parental tumor and cell line passages; (f) TP53/chr17 signals in ACP02 parental tumor and cell line passages; (g) TP53/chr17 signals in ACP03 parental tumor and cell line passages; (h) mean of TP53/chr17 signals of AGP01, ACP02, and ACP03 parental tumor and cell line passages. nuclei in tumor cells. FISH assay should be used to evaluate primary GC. Moreover, the frequency of MYC gain in cell-to-cell heterogeneity in gene or loci copy number and advanced GC observed by FISH seems to be higher in our detect small subpopulations of genetically aberrant cells population than in East Asia, which ranges from 15.5% [16]. Using FISH assay, our research group previously to 48% of cases [6, 24, 25]. MYC amplification has been reported several frequent aneusomies in GC samples and cell suggested as the main mechanism for its deregulation in GC lines from individuals of Northern Brazil, which suggests a (see review [26]). genomic instability [7, 12, 13, 17–20]. Molecular cytogenetic Concerning TP53/chr17 copies, we observed that ACP02, studies have shown that gains at 3q, 7p, 7q, 8q, 13q, 17q, cell line, and its parental tumor, presented cells with two 20p, and 20q and losses at 4q, 9p, 17p, and 18q are recurrent copies of chr17 and loss of one copy of TP53 more frequently chromosomal alterations in GC. (For a review, see [21].) than ACP03 and AGP01. This finding corroborates our Our research group has observed that chr8 trisomy, previous study using dual-color FISH for chr17/TP53 in where MYC is located, is present in almost all gastric tumors primary tumor samples, in which we observed that the and cell lines from our population by conventional and frequency of cells with two chr17 and one TP53 signals was molecular cytogenetic analyses [7, 12, 13, 17, 19, 20, 22, higher in the diffuse-type than in the intestinal-type GC 23]. We have previously described that ACP02, ACP03, and [27]. AGP01 at the 60th passage presented chr8 trisomy, as well We also observed that only ACP03 and AGP01 cells and as tetrasomy. In these cell lines, more than 5 signals of chr8 parental tumors presented chr17 trisomy as clonal alteration, were observed in less than 5% of cells [12]. However, MYC in agreement with the karyotype of these cell lines at 60th copy number seems to be higher than the number of chr8 passage [12]. Although primary tumors of individuals from copies in our studies [19, 20, 23]. High MYC amplification Northern Brazil present clonal crh17 trisomy or monosomy has frequently been observed in primary tumors from by FISH analysis [27], chr17 aneusomy is not the most our population, and we have also previously reported that frequent alteration within primary tumors of our population MYC can be inserted into other chromosomes. The higher [7, 22, 28]. frequency of MYC high amplification in ACP03 and AGP01, Moreover, we detected TP53 loss in all cell lines and originated from intestinal-type GC, than ACP02, originated primary tumors. TP53 somatic alteration is described in from a diffuse-type GC, agrees with our previous observation about 50% of human cancers, including GC [29]. Deletion of in primary GC. Our group had observed that clonal high chromosome arm 17p was also observed in ACP02, ACP03, amplification of MYC is less frequent in diffuse-type than and AGP01 by conventional cytogenetic analysis [12]. In intestinal-type primary GC [19, 20, 23]. our population, TP53 deletion was previously observed Thus, the presence of three or more copies of MYC, in all analyzed primary tumor samples, despite Lauren’s´ including gene high amplification, in all samples of the histopathologic types; therefore, corroborating the present present study corroborates our previous observations in study [27]. Journal of Biomedicine and Biotechnology 7

Although we did not observe any significant difference [3] A. D. Ferti-Passantonopoulou, A. D. Panani, J. D. Vlachos, and among parental tumors and their cell line passages after S. A. Raptis, “Common cytogenetic findings in gastric cancer,” posthoc analysis, we were able to observe that the number of Cancer Genetics and Cytogenetics, vol. 24, no. 1, pp. 63–73, MYC signals is significantly higher in cell lines than primary 1987. tumors. We also observed a reduction in the number of [4]J.C.Xia,S.Lu,J.S.Geng,S.B.Fu,P.Li,andQ.Z.Liu,“Direct nuclei with two signals for chr17/TP53 when we compared chromosome analysis of ten primary gastric cancers,” Cancer Genetics and Cytogenetics, vol. 102, no. 1, pp. 88–90, 1998. GC cell lines with their parental tumors, which reflects an [5] H. Ochi, H. O. Douglass, and A. A. Sandberg, “Cytogenetic increase of aneusomy cells. studies in primary gastric cancer,” Cancer Genetics and Tumor samples are usually composed of a heterogeneous Cytogenetics, vol. 22, no. 4, pp. 295–307, 1986. clonal population which can include nonneoplastic cells. [6] Y. Kitayama, H. Igarashi, and H. Sugimura, “Different vulner- The increased frequency of cells with MYC gain, TP53 loss, ability among chromosomes to numerical instability in gastric and chr17 trisomy in cell lines may be due to the selection carcinogenesis: stage-dependent analysis by FISH with the use of a subpopulation of cancer cells during the cell line of microwave irradiation,” Clinical Cancer Research, vol. 6, establishment. Normal cells can divide only a limited number no. 8, pp. 3139–3146, 2000. of times in vitro, because of replicative senescence. However, [7] P.P.Assumpcao, G. Ishak, E. S. Chen et al., “Numerical aberra- some tumor cells can become immortal and, therefore, they tions of chromosome 8 detected by conventional cytogenetics do not undergo senescence when cultured in vitro [30]. and fluorescence in situ hybridization in individuals from According to the Hayflick limit, the maximum number of northern Brazil with gastric adenocarcinoma,” Cancer Genetics and Cytogenetics, vol. 169, no. 1, pp. 45–49, 2006. passages that a normal cell attains before senescence is about [8] J. Greshock, K. Nathanson, A. M. Martin et al., “Cancer cell 50 [31]. Here, we evaluated GC cell lines in the 60th and lines as genetic models of their parent histology: analyses in 85th passages, which select cells with genomic alterations based on array comparative genomic hybridization,” Cancer that are essential for cell survival and proliferation in vitro. Research, vol. 67, no. 8, pp. 3594–3600, 2007. A meta-analysis of the studies using comparative [9] Y. Jin, H. Zhang, S. W. Tsao et al., “Cytogenetic and molecular genomic hybridization assay to evaluate chromosomal alter- genetic characterization of immortalized human ovarian ations in cancer cell lines and primary tumors demonstrated surface epithelial cell lines: consistent loss of chromosome 13 that, on average, the relatively large-scale copy number and amplification of chromosome 20,” Gynecologic Oncology, genetic aberrations seen in cell lines in vitro accurately reflect vol. 92, no. 1, pp. 183–191, 2004. [10] S. B. Ratsch, Q. Gao, S. Srinivasan, D. E. Wazer, and V. their parent histology [8]. In this meta-analysis study, it was ffi also reported that MYC oncogene amplification seems to be Band, “Multiple genetic changes are required for e cient immortalization of different subtypes of normal human more frequent in cell lines in several histologies, indicating mammary epithelial cells,” Radiation Research, vol. 155, no. 1, that the deregulation of this gene may be acquired as part of part 2, pp. 143–150, 2001. cell immortalization or that their occurrence is selected when [11] L. F. Meisner, S. Q. Wu, B. J. Christian, and C. A. Reznikoff, tumors are chosen for transformation. Therefore, we suggest “Cytogenetic instability with balanced chromosome changes that, in our GC cell lines, cells with MYC amplification are in an SV40 transformed human uroepithelial cell line,” Cancer selected during the long culture process. Research, vol. 48, no. 11, pp. 3215–3220, 1988. [12]M.F.Leal,J.L.MartinsdoNascimento,C.E.A.daSilvaetal., “Establishment and conventional cytogenetic characterization 5. Conclusion of three gastric cancer cell lines,” Cancer Genetics and Cytoge- Our findings reveal that ACP02, ACP03, and AGP01 cell netics, vol. 195, no. 1, pp. 85–91, 2009. lines retain in vitro the genetic alterations presented in their [13] A. Costa Guimaraes, L. Goncalves Quintana, M. Ferreira Leal et al., “Aneuploidy of chromosome 8 detected by fluorescence parental primary tumors. Thus, these findings suggest that in situ hybridisation in ACP01 cell line gastric adenocar- these cell lines are an interesting model to study GC biology cinoma,” Clinical and Experimental Medicine, vol. 6, no. 3, as well as to evaluate new anticancer strategies. pp. 129–133, 2006. [14] M. I. Stamouli, A. D. Ferti, A. D. Panani et al., “Application of Acknowledgments multiplex fluorescence in situ hybridization in the cytogenetic analysis of primary gastric carcinoma,” Cancer Genetics and This paper was supported by Conselho Nacional de Desen- Cytogenetics, vol. 135, no. 1, pp. 23–27, 2002. volvimento Cient´ıfico e Tecnologico´ (CNPq; MACS and [15] A. H. N. Hopman, F. C. S. Ramaekers, A. K. Raap et al., “In RRB) and Fundac¸ao˜ de Amparo a` Pesquisa do Estado de Sao˜ situ hybridization as a tool to study numerical chromosome Paulo (FAPESP; MFL and DQC). aberrations in solid bladder tumors,” Histochemistry, vol. 89, no. 4, pp. 307–316, 1988. [16] A. Kallioniemi, T. Visakorpi, R. Karhu, D. Pinkel, and O. P. References Kallioniemi, “Gene copy number analysis by fluorescence in situ hybridization and comparative genomic hybridization,” [1] L. Ottini, M. Falchetti, R. Lupi et al., “Patterns of genomic Methods, vol. 9, no. 1, pp. 113–121, 1996. instability in gastric cancer: clinical implications and perspec- [17] E. M. Lima, J. D. Rissino, M. L. Harada et al., “Conventional tives,” Annals of Oncology, vol. 17, no. 7, pp. vii97–vii102, 2006. cytogenetic characterization of a new cell line, ACP01, estab- [2]D.M.Parkin,F.Bray,J.Ferlay,andP.Pisani,“Globalcancer lished from a primary human gastric tumor,” Brazilian Journal statistics, 2002,” Ca-A Cancer Journal for Clinicians, vol. 55, of Medical and Biological Research, vol. 37, no. 12, pp. 1831– no. 2, pp. 74–108, 2005. 1838, 2004. 8 Journal of Biomedicine and Biotechnology

[18] A. C. Guimaraes, E. M. Lima, A. S. Khayat et al., “Interrela- tionships among chromosome aneuploidy, promoter hyper- methylation, and protein expression of the CDKN2A gene in individuals from northern Brazil with gastric adenocar- cinoma,” Cancer Genetics and Cytogenetics, vol. 179, no. 1, pp. 45–51, 2007. [19] D. Q. Calcagno, M. F. Leal, A. D. Seabra et al., “Inter- relationship between chromosome 8 aneuploidy, C-MYC amplification and increased expression in individuals from northern Brazil with gastric adenocarcinoma,” World Journal of Gastroenterology, vol. 12, no. 38, pp. 6207–6211, 2006. [20] D. Queiroz Calcagno, M. Ferreira Leal, S. Satomi Takeno et al., “Aneuploidy of chromosome 8 and C-MYC amplification in individuals from northern Brazil with gastric adenocarci- noma,” Anticancer Research, vol. 25, no. 6 B, pp. 4069–4074, 2005. [21] A. D. Panani, “Cytogenetic and molecular aspects of gastric cancer: clinical implications,” Cancer Letters, vol. 266, no. 2, pp. 99–115, 2008. [22] R. Burbano, P. P. Assumpcao, M. Ferreira Leal et al., “C-MYC locus amplification as metastasis predictor in intestinal-type gastric adenocarcinomas: CGH study in Brazil,” Anticancer Research, vol. 26, no. 4 B, pp. 2909–2914, 2006. [23] D. Q. Calcagno, A. C. Guimaraes, M. F. Leal et al., “MYC insertions in diffuse-type gastric adenocarcinoma,” Anticancer Research, vol. 29, no. 7, pp. 2479–2483, 2009. [24]S.H.Koo,K.C.Kwon,S.Y.Shinetal.,“Geneticalterations of gastric cancer: comparative genomic hybridization and fluorescence in situ hybridization studies,” Cancer Genetics and Cytogenetics, vol. 117, no. 2, pp. 97–103, 2000. [25] T. Hara, A. Ooi, M. Kobayashi, M. Mai, K. Yanagihara, and I. Nakanishi, “Amplification of c-myc, K-sam, and c-met in gas- tric cancers: detection by fluorescence in situ hybridization,” Laboratory Investigation, vol. 78, no. 9, pp. 1143–1153, 1998. [26]D.Q.Calcagno,M.F.Leal,P.P.Assumpcao,M.D.A.C. Smith, and R. R. Burbano, “MYC and gastric adenocarcinoma carcinogenesis,” World Journal of Gastroenterology, vol. 14, no. 39, pp. 5962–5968, 2008. [27] A. S. Khayat, A. C. Guimaraes, D. Q. Calcagno et al., “Inter- relationship between TP53 gene deletion, protein expression and chromosome 17 aneusomy in gastric adenocarcinoma,” BMC Gastroenterology, vol. 9, article 55, 2009. [28]S.SatomiTakeno,M.F.Leal,L.C.FriasLisboaetal., “Genomic alterations in diffuse-type gastric cancer as shown by high-resolution comparative genomic hybridization,” Can- cer Genetics and Cytogenetics, vol. 190, no. 1, pp. 1–7, 2009. [29] K. Szymanska and P.Hainaut, “TP53 and mutations in human cancer,” Acta Biochimica Polonica, vol. 50, no. 1, pp. 231–238, 2003. [30] R. R. Reddel, “The role of senescence and immortalization in carcinogenesis,” Carcinogenesis, vol. 21, no. 3, pp. 477–484, 2000. [31] H. Rubin, “Promise and problems in relating cellular senes- cence in vitro to aging in vivo,” Archives of Gerontology and Geriatrics, vol. 34, no. 3, pp. 275–286, 2002. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 693691, 7 pages doi:10.1155/2011/693691

Research Article Chromosomal Rearrangements in Post-Chernobyl Papillary Thyroid Carcinomas: Evaluation by Spectral Karyotyping and Automated Interphase FISH

Ludwig Hieber,1 Reinhard Huber,1 Verena Bauer, 1 Quirin Schaffner,¨ 1 Herbert Braselmann,1 Geraldine Thomas,2 Tatjana Bogdanova,3 and Horst Zitzelsberger1

1 Department of Radiation Cytogenetics, Helmholtz Zentrum Munchen,¨ German Research Center for Environmental Health, Ingolstadter¨ Landstraße 1, 85764 Neuherberg, Germany 2 Human Cancer Studies Group, Department of Surgery and Cancer, Hammersmith Hospital, G Block, Du Cane Road, London W12 0NN, UK 3 Institute of Endocrinology and Metabolism, Academy of Medical Sciences of Ukraine, Vyshgorodskaya Street 69, 254114 Kiev, Ukraine

Correspondence should be addressed to Ludwig Hieber, [email protected]

Received 14 September 2010; Accepted 12 January 2011

Academic Editor: Settara Chandrasekharappa

Copyright © 2011 Ludwig Hieber et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Structural genomic rearrangements are frequent findings in human cancers. Therefore, papillary thyroid carcinomas (PTCs) were investigated for chromosomal aberrations and rearrangements of the RET proto-oncogene. For this purpose, primary cultures from 23 PTC have been established and metaphase preparations were analysed by spectral karyotyping (SKY). In addition, interphase cell preparations of the same cases were investigated by fluorescence in situ hybridisation (FISH) for the presence of RET/PTC rearrangements using RET-specific DNA probes. SKY analysis of PTC revealed structural aberrations of chromosome 11 and several numerical aberrations with frequent loss of chromosomes 20, 21, and 22. FISH analysis for RET/PTC rearrangements showed prevalence of this rearrangement in 72% (16 out of 22) of cases. However, only subpopulations of tumour cells exhibited this rearrangement indicating genetic heterogeneity. The comparison of visual and automated scoring of FISH signals revealed concordant results in 19 out of 22 cases (87%) indicating reliable scoring results using the optimised scoring parameter for RET/PTC with the automated Metafer4 system. It can be concluded from this study that genomic rearrangements are frequent in PTC and therefore important events in thyroid carcinogenesis.

1. Introduction initially performed by conventional banding techniques [3]. This was further improved by the development of fluores- The detection and quantification of tumour-specific rear- cence in situ hybridization (FISH) techniques that allows a rangements are important issues in cancer research and in cytogenetic analysis of rearrangements on metaphase spreads clinical diagnosis of tumours. In particular, its significance as well as on interphase cell nuclei [4]. Multicolour FISH became obvious for haematological malignancies that exhibit approaches such as spectral karyotyping (SKY) allowed a characteristic translocations in specific tumour subgroups more detailed analysis of cytogenetic aberrations, in particu- [1]. Although gene rearrangements are typical for haemato- lar in the case of complex and hidden rearrangements [5, 6]. logical malignancies, they also may occur in solid tumours The analysis of interphase nuclei by FISH has the advantage as characteristic changes. This has been shown for RET/PTC that gene rearrangements can be investigated at single cell rearrangements in papillary thyroid carcinoma (PTC) that level in nonproliferating cells. An evaluation of FISH signals fuse the RET proto-oncogene to a variety of constitutively is usually performed by visual inspection directly from the expressed partner genes (for review see Zitzelsberger [2]). microscopic image. In this case, cell numbers for further The detection of such chromosomal rearrangements was statistical analysis and a possible bias of the investigator 2 Journal of Biomedicine and Biotechnology towards positivity or negativity of FISH signals indicating the 2.2. SKY Analysis. Spectral karyotyping was performed as rearrangement are major limitations. In order to analyse a described previously in [8]. Briefly, metaphase preparations statistically relevant number of cells, an automatic scanning were pretreated with RNase A (0.1 mg/mL in 2 × SSC) prior system for fluorescence spot counting using a fully motorized to hybridization. Chromosome denaturation was achieved fluorescence microscope with an eight-slide scanning stage by treatment of the slides in 70% formamide in 2 × SSC at and a high-resolution CCD camera driven by the MetaCyte 72◦C for 1-2 min. Subsequently the slides were dehydrated software (MetaSystems, Altlussheim, Germany) has been in a 70%, 90%, and 100% ethanol series and hybridized established and optimized. To demonstrate routine applica- with a denatured SKY-probe mixture (SkyPaint DNA Kit, tion of the scanning system, the RET/PTC rearrangement in Applied Spectral Imaging, Mannheim, Germany). After papillary thyroid carcinomas has been scored with a probe hybridization (24 h), slides were washed in 0.5 × SSC for ◦ set that produces split FISH signals if a gene rearrangement 5minat75 C, 4 × SSC/0.1% Tween for 2 min and H2Obidest is present [7]. Therefore, the parameters of the scanning for 2 min, both at room temperature. Probe detection was system had to be optimized using cell culture models as achieved using antidigoxigenin (1 : 250; Roche, Penzberg, positive and negative controls. The aims of the present study Germany), avidin-Cy-5, and avidin-Cy-5.5 antibodies (both were to establish such optimised scanning parameters and to 1 : 100; Biomol, Hamburg, Germany) according to the characterise chromosomal and RET/PTC rearrangements in manufacturers’ protocols. Metaphase spreads were counter-  a PTC cohort. stained with 0.1% 4 ,6-diamidino-2-phenylindole (DAPI) in antifade solution (VECTASHIELD mounting medium; 2. Material and Methods Vector Laboratories, Burlingame, CA,USA). A minimum of 15 metaphases were analyzed to determine the karyotype 2.1. Cell Cultures from PTC and Cell Lines. Primary cell of each primary culture. Chromosome aberrations were cultures of 23 PTCs from children and adults from Ukraine detectable by colour junctions within affected chromosomes. that developed papillary thyroid carcinomas in the aftermath Image acquisition was done using a SpectraCube system, of the Chernobyl accident were established according to and analyses were accomplished using the SkyView imaging a published protocol [8]. The median age of the patients software (both from Applied Spectral Imaging, Mannheim, at operation was 21 years, ten patients were male, and 13 Germany). patients were female. 21 out of 23 cases were investigated for chromosomal aberrations and 22 cases for RET/PTC 2.3. Fluorescence In Situ Hybridization. For FISH analysis rearrangements. In addition, a cell line originating from a of RET/PTC rearrangements, labelling of YAC DNA probes PTC (TPC1) carrying the RET/PTC1 rearrangement served 344H4, 214H10 and, 313F4 was carried as previously as a positive control [9, 10]. As negative control we used described in [7]. The YAC probes 313F4 and 214H10 a cell line derived from human retinal epithelium (“RPE,” map proximal to and include the RET locus, whilst clone hTERT immortalised) that displays a normal karyotype 344H4 contains DNA sequences distal to RET. They were [11]. All cell lines and primary cell cultures were grown in labelled either with digoxigenin-11-dUTP (344H4) or with RPMI 1640 (PAA Laboratories, Colbe,¨ Germany) with the biotin-16-dUTP (214H10, 313F4) using nick translation and addition of Penicillin (5 IU/mL) and Streptomycin (5 μg/mL) were detected with antidigoxigenin-Cy3 antibody, followed (Gibco-BRL Life Technologies, Karlsruhe, Germany) and by rat-anti-mouse Cy3 and mouse-anti-rat Cy3 for red supplemented with 10% or 20% FBS (Sigma, Taufkirchen, fluorescence, and streptavidin-FITC, followed by biotin- Germany), respectively. Metaphase preparations from pri- antistreptavidin and streptavidin-FITC, respectively. A nor- mary cultures were needed for SKY analysis. Therefore mal RET locus results into two overlapping red and green 2.5 × 105 cells were grown in 4 mL media on a sterile FISH signals, while split FISH signals (separated red and glass slide positioned in Quadriperm cell culture cham- green signals) indicated a rearranged RET gene. Only cells bers (In Vitro Systems and Services GmbH, Gottingen,¨ with either two overlapping signals or one split and one Germany) and addition of 0.05 μg/mL Colcemid (Roche, overlapping signal were analysed to ensure completeness of Penzberg, Germany) overnight arrested cells in metaphase. the nuclei. After 24–32 h growth, the media were removed and the slide covered with 4 mL hypotonic KCl-solution (0.075 M). 2.4. Evaluation of FISH Slides. For the analysis of the RET/ After incubation under hypotonic conditions for 20 min at PTC rearrangements, a fluorescence-based scanning system, 37◦C, 4 mL of ice-cold fixative (methanol/glacial acetic acid, Metafer4 (MetaSystems, Altlussheim, Germany), was used. 3 : 1) were added followed by another incubation step for This scanning system is based on a motorized Axioplan 20 min on ice. Subsequently the solutions were removed and 2 microscope (Zeiss, Oberkochen, Germany), a motorized replaced by another 4 mL of ice-cold fixative. After 20 min eight-slide scanning stage (Marzh¨ auser,¨ Wetzlar, Germany), incubation on ice, this last step was repeated. Finally, the and high-resolution CCD Camera (JAI Corporation, Japan). slides were air-dried perpendicularly under a laminar flow. The scanning system is driven by the software MetaCyte. For interphase preparations, cells were directly grown on The classifiers of the MetaCyte software allow the settings of glass slides in Quadriperm cell culture chambers. Cells were image capture, exposure parameters, image processing, and fixed with Carnoy’s fixative (methanol/acetic acid; 3 : 1), air- cell processing steps. These classifiers contain variable criteria dried, and stored at room temperature for 7 days before for cell selection taking into account cell characteristics like hybridization. cell area, aspect ratio, concavity index, and signal intensity. Journal of Biomedicine and Biotechnology 3

For capturing of cell images, a 40x Plan Neofluar air objective chromosome aberrations could be detected in 13 cases was used. Slide scanning procedure was started with the focus (62%) with frequent losses of chromosomes 21 (six cases, determination of cells in the DAPI channel in the selected 29%), 20 (five cases, 24%), 7, 10, and 22 (three cases each, scanning area. Then, a stack of five images within a distance 14%). Clonal chromosome aberrations are summarized in 0.9 μm were captured in the Cy3 and FITC channels. From Table 1. Figure 1 shows an exemplary SKY image of case 402T eachstack,a2Dimagewithallsignalsinfocuswascreated exhibiting a deletion on chromosome 11 and i(11)(q10). and a local background reduction was performed applying two standard Top Hat filters. Overlapping or incomplete 3.2. RET/PTC Rearrangements Are Present on FISH Analysis cell nuclei as well as nuclei with incorrect numbers of red of Primary Cultures of PTC. FISH was carried out on and green signals were excluded from the analysis. For the interphase cell preparations from primary cultures of 22 analysis of fused or split signals, the distance of signals was PTCs using a combination of three YAC probes that were measured in the XY positionsaswellasinZ positions. labelled in two different colours [7]. Cell nuclei exhibiting Between 100 and 870 cells were analyzed in the different a rearranged RET gene show a split FISH signal in red and samples. Each 2D image was displayed as gallery pictures green in addition to an overlapping FISH signal, whereas presenting the cell number, the number of red and green normal cells show two overlapping FISH signals (Figure 2). signals, and the number of overlapping red and green signals. Sixteen out of 22 PTCs (72%) exhibited RET rearrangements On the gallery screen also the results for each sample could be diagnosed by FISH interphase analysis (Table 1). The highest displayed as scatter diagram and/or as bar diagram. All data frequency of rearranged cells after FISH interphase analysis can be exported into common statistics and graphic software was 41% (case S430T). These 16 cases showed a significantly programs. elevated frequency of split FISH signals compared to RPE cell In parallel, every captured cell was analysed visually in line and S414 normal tissue which represent negative con- order to compare visual and automated scoring of FISH trols without any RET/PTC rearrangement. The frequency signals. In contrast to automated scoring the visual analysis of false positive FISH signals in these control cells is in the can be performed in two dimensions only. order of 1–3% (Table 1). Therefore, we used a threshold of 7.1% of cells with a split FISH signal in order to define a 2.5. Optimisation and Testing of Classifier Parameters. For RET/PTC-positive tumour as published earlier in [7]. The optimization of the classifier parameters for RET/PTC positive control cell line TPC1 showed 98% rearranged cells. rearrangements exhibiting split signals negative and positive control samples were analysed several times after changing 3.3. Comparison of Automated Scoring and Visual Scoring the parameter settings for image capture, cell nucleus of Rearranged FISH Signals. In order to create the initial characteristics, and cell nucleus selection, by criteria such as parameter settings for classifiers of the automated Metafer4 nuclear area, aspect ratio, and concavity index of the nuclei, scoring system the RPE (human Retina pigment epithelial) as well as size and distance of red and green signals. The final cell line and primary culture of normal tissue from case parameter settings for the automated analysis were optimised S414, both with a normal karyotype, were used as negative for the lowest numbers of false positive and false negative control. The TPC1 cell line that was derived from a human results. papillary carcinoma carrying a RET/PTC1 rearrangement was used as a positive control. Based on these control 2.6. Statistical Analysis. Frequencies of cells with split signals cells the classifiers of the Metafer4 system were optimized determined by automated analyses and by visual analyses several times by changing the parameter settings for cell were compared with an χ2 test. Significant differences were nucleus characteristics and cell nucleus selection by criteria accepted for P values less than .05 after adjustment for false such as nuclear area, aspect ratio, and concavity index of detection by the Bonferroni method [12]. the nuclei. For the scoring of fused and split FISH signals an optimisation of the parameters for minimum signal 3. Results area, maximum distance of red and green signals, and the minimum signal intensity has been performed in multiple 21 PTCs were analyzed for chromosomal aberrations, and training procedures. The optimised parameters and their 22 PTCs were investigated for RET/PTC rearrangements. variability are given in Table 2. For testing the final parameter The RET/PTC status was determined by FISH analysis on settings of the classifier the above-mentioned 22 PTCs were interphase cells from the same primary cultures that were analysed using the automated scoring system as well as visual used for SKY analysis of chromosomal aberrations. For scoring of the recorded images. Results of both scoring an evaluation of RET/PTC rearrangements an automated procedures are shown in Table 1. The negative control cell scoring system (Metafer4) was used and data were compared lines showed a frequency of false positive RET/PTC rear- to FISH signals that had been scored visually. rangement of 1–3%. The frequencies of RET/PTC positive cells among the PTC primary cultures varied between 1.0% 3.1. SKY Analysis Detected Clonal Chromosome Rearrange- and 41.5%. Concordance of results from automated and ments and Numerical Aberrations. SKY analysis revealed visual scoring was tested statistically. Statistical correlation clonal chromosomal rearrangements in five out of 21 cases analysis using the χ2 test confirmed a concordance of the (24%). In two cases (10%) structural aberrations involving data from automated and visual analysis in 19 cases (86%). chromosome 11 could be observed. Additionally, numerical Only in three cases (S407T, S418T, and S422T) the automated 4 Journal of Biomedicine and Biotechnology

1 2 3 4 5

6 7 8 9 10 11 12

13 14 15 16 17 18

19 20 21 22 X Y

Figure 1: SKY analysis of case S402T showing a karyotype of 46, XY, del(11p), i(11q) (arrows). Isochromosome 11 is a clonal aberration in this case. The coloured chromosomes represent the false colour from the original RGB pictures of the multicolour FISH. Chromosomes were counterstained with DAPI (similar to Giemsa-banding).

S414N S422T 82 2 84 2 183 1 192 1

2 2 2 2 2 2 2 2 87 2 89 2 376 1 386 1

2 2 2 2 2 2 2 2 (a) (b)

Figure 2: FISH analysis of RET/PTC rearrangement: S414N nontumour cells showing two fused red and green signals; S422T tumour cells have one fused and one split red/green signal pair, indicating a RET gene rearrangement. Cells were hybridized with YAC probes 313F4 and 214H10 (FITC labelled, green signals) and 344H4 (Cy3 labeled, red signals). Arrows indicate the split signals of RET/PTC rearrangements.

and visual analysis differed significantly (P<.05; Bonferroni breakpoints of structural rearrangements of chromosomes value, Figure 3). 4q, 5q, 6p, 12q, 13q, and 14q and of complex rearrangements have been reported using a complementary analysis of 4. Discussion conventional karyotyping, SKY and FISH with BAC clones [8, 18, 19]. In our study, also rearrangements involving In this study, we describe karyotype abnormalities and chromosome 11 could be detected in two cases (Table 1, rearrangements of the RET proto-oncogene in PTC from Figure 1), indicating an important gene on this chromo- patients that were exposed to the radioiodine fallout of some that might be involved in thyroid carcinogenesis. the Chernobyl accident. There is evidence from several Besides the structural rearrangements it is remarkable that studies that exposure to ionising radiation leads to the many numerical aberrations were observed mostly involving induction of chromosomal rearrangements that may result chromosomes 20, 21, and 22. Loss of chromosome 22 has in gene alterations and deregulated gene expression [13, 14]. already been reported to represent a cytogenetic marker In PTC chromosomal breakpoints on 1p32-36, 1p11-13, for poor prognosis in thyroid cancer [20–22]. Thus, this 3p25-26, and 7q32-36 have previously been reported after observation in PTC may explain to some extent the more conventional karyotyping [15]. Other cytogenetic studies aggressive phenotypes of tumours that have developed after on PTC showed a deletion on chromosome 11q [16]and the Chernobyl accident. a chromosome 2 rearrangement with an assumed tyrosine Another frequent cytogenetic finding in PTC is the kinase gene at the breakpoint [17]. In addition, novel rearrangements of chromosome 10q with breakpoints at Journal of Biomedicine and Biotechnology 5

Table 1: Karyotypes and RET/PTC rearrangements in papillary thyroid carcinomas from Ukraine.

RET/PTC rearrangement (rearranged cells %) Visual scoring of SKY analysis Clonal Automated scoring Case Age/gender No. of cells scored Metafer4 recorded aberrations# with Metafer4 cells RPE (control w/o RET/PTC) —/f — 186 0.7 1.1 der(1)t(1;3), der(1)t(1;21), del(3p), i(8p), TPC1 (control with RET/PTC) —/f der(10)t(10q;3p), 103 98.1 97.1 der(10)t(10q;1q); del(10p), −21 S414N (control w/o RET/PTC) 33/f n.a. 180 3.1 1.1 S399T 13/m — 103 17.7+ 8.7+ S400T 19/m −7, −12, −21, −20 354 13.3+ 16.1+ S402T 34/m −19, −11, i(11)(q10) 139 12.1+ 10.8+ S403T 12/m del(11p) n.a. S404T 16/f −11, −20, −21, −22 154 11.6+ 11.7+ S405T 16/f −10, −12 233 19.4+ 21.0+ S407T 19/f −10, −16, −18, −20, −21 608 5.4∗ 10.7∗+ −2, −5, −7, −10,−13, −17, S408T 25/m 715 2.1 1.5 −18, −22 S409T 28/f n.a. 122 10.6+ 13.9+ S411T 12/f — 793 2.2 2.0 S412T 21/f −7, −8, −21 267 12.9+ 9.0+ S413T 18/f −14, −21 220 5.2 5.9+ S414T 33/f −20 67 23.8+ 20.9+ S416T 15/m — 211 1.0 2.4 S418T 27/m −16 262 12.9∗+ 3.1∗ S420T 28/f — 190 14.2+ 9.5+ S422T 31/m — 756 23.2∗+ 14.6∗+ S428T 21/m — 683 11.0+ 16.8+ S429T 13/f −9, −22 330 20.6+ 16.7+ S430T 32/f — 102 41.5+ 33.3+ S431T 21/f −9, −19, −20 110 33.8+ 30.0+ S432T 26/m n.a. 80 12.2+ 12.5+ S437T 22/f −21 126 15.1+ 13.5+ # At least 15 metaphases were analysed by SKY. —: normal karyotype. n.a.: not analysed. ∗Significant difference between automated and visual scoring (χ2test, P<.05; Bonferroni value). +Significant difference to respective negative control (S414N; Fisher’s exact test, P<.05).

10q11.2 that lead to an activation of the RET proto-oncogene regardless of the specific fusion partner involved at a single- [23, 24]. The most frequent rearrangements are paracentric cell level [7]. The frequency of RET/PTC-positive cases of inversions on chromosome 10q leading to the oncogenes 72% is in line with earlier reports on tissue sections using RET/PTC1 and RET/PTC3. Thus, these chromosomal rear- a three-dimensional evaluation of FISH signals either with rangements lead to transcribed fusion genes that affect laser-scanning microscopy or Apotome-equipped fluores- the MAPkinase pathway. Investigations of these RET/PTC cence microscopy [7, 27]. The reported genetic heterogeneity rearrangements are important in PTC since they represent could be confirmed in this study since only a subpopulation frequent alterations and molecular targets for therapeutic of tumour cells showed the RET/PTC rearrangement. interventions [25, 26].Inthisstudy,wehaveinvestigated Although interphase FISH analysis has a number of RET/PTC rearrangements in the PTC using an interphase advantages in detecting gene rearrangements, it is a chal- FISH approach that allows to detect RET rearrangements lenge to score adequately the frequency of rearranged cells. 6 Journal of Biomedicine and Biotechnology

50 labelling of the YAC probes in red and green resulted in overlapping red/green signals for the wild-type RET gene and in a split red and green FISH signals for the rearrangement. 40 The automated evaluation of FISH signals revealed matching results in 87% of the 22 cases with the visual analysis of 30 FISH signals. A possible explanation for three misclassified cases is a bias of the investigator scoring visually towards RET/PTC-positive or -negative cells, especially in cases with 20 high background signals. Also different cell features in S422T S407T those three cases may account for the observed discrepancy. 10 An additional difference in fusion counting automatically or by eye is that the automated system is measuring the Analysis per eye (translocated cells (%)) S418T distance 3-dimensionally, whereas directly at the microscope 0 0 1020304050or with captured images a visual scoring is performed at Automated analysis (translocated cells (%)) 2D projection. A comparison of automated and manual evaluation of interphase FISH results was only presented χ2 Figure 3: Correlation analysis using the test. For three samples by Kajtar´ et al [29] in case of BCR/ABL rearrangements in ff P<. P the data di ered significantly ( 05; Bonferroni value) between CML patients. Although the probe design is different (fusion automatic and visual analysis (filled symbols). probe versus split signal probe), we received a similar good concordance of automated and manual evaluation results. Table 2: Classifier parameters for cell and signal selection. We have demonstrated here for the first time the usage of the 3D automated FISH analysis for the detection of RET/PTC Finally Variability of rearrangements in PTC. Parameters optimized parameters In conclusion, we have shown that chromosomal rear- parameters rangements (5 out of 21) and rearrangements of the RET Cell selection parameters gene (16 out of 22) are frequent in papillary thyroid Minimum cell nucleus area 0 to 32,000 μm2 120 μm2 carcinomas from patients of the Ukraine after the Chernobyl Maximum cell nucleus area 0 to 32,000 μm2 500 μm2 accident. For the detection of RET/PTC rearrangements we Maximumconcavitydepth 0to1 0.35 have demonstrated an automated FISH analysis approach which provides reliable results in higher cell numbers. The Maximumaspectratio 1to10 2.5 results of RET/PTC rearrangements again indicate a genetic Signal parameters heterogeneity since only subpopulations of tumour cells Min. absolute signal area 0 to 100 μm2 0.1 μm2 carried the RET/PTC rearrangement. Max. distance of fused signals 0.1 to 100 μm0.8μm Min. of max. signal intensity 0 to 100% 33% Acknowledgments The excellent technical assistance of Elke Konhauser¨ is gratefully acknowledged. This work was supported by the A major problem that also affects the sensitivity of the FISH Bavarian Research Foundation and by the EC Grant CHIPS approach is the inevitable scoring of false positive FISH no. FIS5-1999-00032. signals due to random generation of rearrangement-positive FISH signals. The choice of adequate FISH probes (fusion References probes or split probes for the detection of a rearranged cell) is one issue that has to be addressed; an impartial [1]D.Perrotti,C.Jamieson,J.Goldman,andT.Skorski,“Chronic evaluation of FISH signals is another important issue. In this myeloid leukemia: mechanisms of blastic transformation,” study, we have compared visual inspection of FISH signals Journal of Clinical Investigation, vol. 120, no. 7, pp. 2254–2264, with an automated evaluation. In the automated process, 2010. a correct detection of FISH signals is a great challenge, [2]H.Zitzelsberger,V.Bauer,G.Thomas,andK.Unger,“Molec- since FISH signals exhibit large variations in shape, size, and ular rearrangements in papillary thyroid carcinomas,” Clinica intensity [28]. After cell nucleus selection and correct FISH Chimica Acta, vol. 411, no. 5-6, pp. 301–308, 2010. signal detection, a discrimination of nuclei with and without [3] J. D. Rowley, “Identification of a translocation with quinacrine RET/PTC rearrangement could be achieved by measuring fluorescence in a patient with acute leukemia,” Annales de Genetique, vol. 16, no. 2, pp. 109–112, 1973. the signal distances and defining the minimal distance to [4] D. Pinkel, T. Straume, and J. W. Gray, “Cytogenetic analysis diagnose a split FISH signal. Therefore, cells with 100% using quantitative, high-sensitivity, fluorescence hybridiza- RET/PTC-positive signals were needed. TPC1 cell line has tion,” Proceedings of the National Academy of Sciences of the this feature and showed in our study 97% and 98% positivity, United States of America, vol. 83, no. 9, pp. 2934–2938, 1986. respectively. The automated analysis reported in this study [5] E. Schrock,¨ S. Du Manoir, T. Veldman et al., “Multicolor was optimised to detect RET/PTC rearrangements by means spectral karyotyping of human chromosomes,” Science, vol. of a YAC probe set covering the RET gene locus. Differential 273, no. 5274, pp. 494–497, 1996. Journal of Biomedicine and Biotechnology 7

[6] T. Veldman, C. Vignon, E. Schrock,¨ J. D. Rowley, and T. [22] B. Perissel, I. Coupier, M. De Latour et al., “Structural Ried, “Hidden chromosome abnormalities in haematological and numerical aberrations of chromosome 22 in a case of malignancies detected by multicolour spectral karyotyping,” follicular variant of papillary thyroid carcinoma revealed by Nature Genetics, vol. 15, no. 4, pp. 406–410, 1997. conventional and molecular cytogenetics,” Cancer Genetics [7] K. Unger, H. Zitzelsberger, G. Salvatore et al., “Heterogene- and Cytogenetics, vol. 121, no. 1, pp. 33–37, 2000. ity in the distribution of RET/PTC rearrangements within [23]M.Santoro,F.Carlomagno,I.D.Hayetal.,“Retoncogene individual post-chernobyl papillary thyroid carcinomas,” The activation in human thyroid neoplasms is restricted to the Journal of Clinical Endocrinology and Metabolism, vol. 89, no. papillary cancer subtype,” Journal of Clinical Investigation, vol. 9, pp. 4272–4279, 2004. 89, no. 5, pp. 1517–1522, 1992. [8] H. Zitzelsberger, L. Lehmann, L. Hieber et al., “Cytogenetic [24]M.A.Pierotti,M.Santoro,R.B.Jenkinsetal.,“Characteri- changes in radiation-induced tumors of the thyroid,” Cancer zation of an inversion on the long arm of chromosome 10 Research, vol. 59, no. 1, pp. 135–140, 1999. juxtaposing D10S170 and RET and creating the oncogenic [9]S.M.Jhiang,D.R.Caruso,E.Gilmoreetal.,“Detection sequence RET/PTC,” Proceedings of the National Academy of of the PTC/ret(TPC) oncogene in human thyroid cancers,” Sciences of the United States of America, vol. 89, no. 5, pp. 1616– Oncogene, vol. 7, no. 7, pp. 1331–1337, 1992. 1620, 1992. [10] Y. Ishizaka, F. Itoh, T. Tahira et al., “Presence of aberrant [25] C. Lanzi, G. Cassinelli, V. Nicolini, and F. Zunino, “Targeting transcripts of ret proto-oncogene in a human papillary thyroid RET for thyroid cancer therapy,” Biochemical Pharmacology, carcinoma cell line,” Japanese Journal of Cancer Research, vol. vol. 77, no. 3, pp. 297–309, 2009. 80, no. 12, pp. 1149–1152, 1989. [26] Y. E. Nikiforov, “Thyroid carcinoma: molecular pathways and [11] A. Riches, C. Peddie, S. Rendell et al., “Neoplastic trans- therapeutic targets,” Modern Pathology, vol. 21, supplement 2, formation and cytogenetic changes after gamma irradiation pp. S37–S43, 2008. of human epithelial cells expressing telomerase,” Radiation [27] K. Unger, L. Zurnadzhy, A. Walch et al., “RET rearrangements Research, vol. 155, no. 1, part 2, pp. 222–229, 2001. in post-Chernobyl papillary thyroid carcinomas with a short [12] C. E. Bonferroni, “Teoria statistica delle classi e calcolo della latency analysed by interphase FISH,” British Journal of Cancer, probabilita,”` Pubblicazioni del R Istituto Superiore di Scienze vol. 94, no. 10, pp. 1472–1477, 2006. Economiche e Commerciali di Firenze, vol. 8, pp. 3–62, 1936. [28] K. Truong, J. Boenders, Z. Maciorowski et al., “Signal [13] H. B. Forrester and I. R. Radford, “Ionizing radiation- amplification of FISH for automated detection using image induced chromosomal rearrangements occur in transcription- cytometry,” Analytical Cellular Pathology, vol. 13, no. 3, pp. ally active regions of the genome,” International Journal of 137–146, 1997. Radiation Biology, vol. 80, no. 10, pp. 757–767, 2004. [29] B. Kajtar,´ G. Mehes,´ T. Lorch¨ et al., “Automated fluorescent [14] K. Unger, J. Wienberg, A. Riches et al., “Novel gene rearrange- in situ hybridization (FISH) analysis of t(9;22)(q34;q11) in ments in transformed breast cells identified by high-resolution interphase nuclei,” Cytometry Part A, vol. 69, no. 6, pp. 506– breakpoint analysis of chromosomal aberrations,” Endocrine- 514, 2006. Related Cancer, vol. 17, no. 1, pp. 87–98, 2010. [15] L. Roque, V. M. Nunes, C. Ribeiro, C. Martins, and J. Soares, “Karyotypic characterization of papillary thyroid carcinomas,” Cancer, vol. 92, no. 10, pp. 2529–2538, 2001. [16] E. Olah, E. Balogh, F. Bojan, F. Juhasz, V. Stenszky, and N. R. Farid, “Cytogenetic analyses of three papillary carcinomas and a follicular adenoma of the thyroid,” Cancer Genetics and Cytogenetics, vol. 44, no. 1, pp. 119–129, 1990. [17] L. Lehmann, K. M. Greulich, H. Zitzelsberger et al., “Cyto- genetic and molecular genetic characterization of a chro- mosome 2 rearrangement in a case of human papillary thyroid carcinoma with radiation history,” Cancer Genetics and Cytogenetics, vol. 96, no. 1, pp. 30–36, 1997. [18] H. U. G. Weier, T. B. Tuton, Y. Ito et al., “Molecular cytogenetic characterization of chromosome 9-derived material in a human thyroid cancer cell line,” Cytogenetic and Genome Research, vol. 114, no. 3-4, pp. 284–291, 2006. [19] C. M. Lu, J. Kwan, A. Baumgartner et al., “DNA probe pooling for rapid delineation of chromosomal breakpoints,” Journal of Histochemistry and Cytochemistry, vol. 57, no. 6, pp. 587–597, 2009. [20] S. Hemmer, V. M. Wasenius, S. Knuutila, K. Franssila, and H. Joensuu, “DNA copy number changes in thyroid carcinoma,” American Journal of Pathology, vol. 154, no. 5, pp. 1539–1547, 1999. [21] B. Singh, D. Lim, J. C. Cigudosa et al., “Screening for genetic aberrations in papillary thyroid cancer by using comparative genomic hybridization,” Surgery, vol. 128, no. 6, pp. 888–894, 2000. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 218231, 8 pages doi:10.1155/2011/218231

Research Article Chromosome Mapping of Repetitive Sequences in Rachycentron canadum (Perciformes: Rachycentridae): Implications for Karyotypic Evolution and Perspectives for Biotechnological Uses

Uedson Pereira Jacobina,1 Marcelo de Bello Cioffi,2 Luiz Gustavo Rodrigues Souza,3 Leonardo Luiz Calado,1 Manoel Tavares,4 Joao˜ Manzella Jr.,4 Luiz Antonio Carlos Bertollo,2 and Wagner Franco Molina1

1 Departamento de Biologia Celular e Gen´etica, Centro de Biociˆencias, Universidade Federal do Rio Grande do Norte, Natal, RN 59078-970, Brazil 2 Departamento de Gen´etica e Evoluc¸ao,˜ Universidade Federal de Sao˜ Carlos, Sao˜ Carlos, SP 13565-905, Brazil 3 Departamento de Botanica,ˆ Universidade Federal de Pernambuco, Recife, PE 50670-420, Brazil 4 Aqualider, Laboratorio´ de Piscicultura Marinha, Ipojuca, PE 55900-000, Brazil

Correspondence should be addressed to Wagner Franco Molina, [email protected]

Received 13 September 2010; Accepted 1 February 2011

Academic Editor: Brynn Levy

Copyright © 2011 Uedson Pereira Jacobina et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The cobia, Rachycentron canadum, a species of marine fish, has been increasingly used in aquaculture worldwide. It is the only member of the family Rachycentridae (Perciformes) showing wide geographic distribution and phylogenetic patterns still not fully understood. In this study, the species was cytogenetically analyzed by different methodologies, including Ag-NOR and chromomycin A3 (CMA3)/DAPI staining, C-banding, early replication banding (RGB), and in situ fluorescent hybridization with probes for 18S and 5S ribosomal genes and for telomeric sequences (TTAGGG)n. The results obtained allow a detailed chromosomal characterization of the Atlantic population. The chromosome diversification found in the karyotype of the cobia is apparently related to pericentric inversions, the main mechanism associated to the karyotypic evolution of Perciformes. The differential heterochromatin replication patterns found were in part associated to functional genes. Despite maintaining conservative chromosomal characteristics in relation to the basal pattern established for Perciformes, some chromosome pairs in the analyzed population exhibit markers that may be important for cytotaxonomic, population, and biodiversity studies as well as for monitoring the species in question.

1. Introduction biotechnological initiatives and/or genetic improvement of the species, especially with respect to cytogenetic aspects. The cobia (Rachycentron canadum) is the only member of the Cytogenetic analyses in fish have been used in natural family Rachycentridae (Perciformes) found in tropical seas environments to characterize cryptic species and/or popula- worldwide. It is highly valued on the international fish mar- tions (Bertollo et al. [7]; Jacobina et al. [8]; Cioffi et al. [9]) ket and is a promising species for marine aquaculture (Kaiser and identify polymorphisms (Mantovani et al. [10]; Molina and Holt [1]; Liao et al. [2]; Benetti et al. [3]; Benetti et al. and Galetti [11]), inventories of existing biodiversity (Galetti [4]). Among its favorable breeding traits are easy adaptation, Jr. et al. [12]; Artoni et al. [13]), in addition to chromosomal prolificacy, rapid growth, and meat quality (Frank et al. [5]; evolution in large taxonomic groups (e.g., Bertollo et al. [7]; Arnold et al. [6]). Although well-established breeding tech- Molina [14]). The information obtained has contributed to nology is available, there is little genetic information to guide a better understanding of genetic diversity, monitoring, and 2 Journal of Biomedicine and Biotechnology

 conservation, as well as providing elements for a rational CMA3 banding, using DAPI (4 ,6-diamidino-2-phenylin- exploitation of fish stocks. dole) as counterstain (Barros-e-Silva and Guerra, [27]). Current approaches, particularly involving the manipu- Slides aged for 3 days were stained with CMA3 (0.1 mg/mL) lation of chromosomal sets, have gone beyond the experi- for 60 min and restained with DAPI (1 μg/mL) for 30 min. mental field and are being increasingly used in aquaculture Next, the slides were mounted in glycerol : McIlvaine buffer, (Ocalewicz et al. [15]). From the technological viewpoint, pH 7.0 (1 : 1) and aged for three days before analysis under the chromosomal data in fish have created conditions for epifluorescence microscope equipped with appropriate fil- implementing ploidy handling protocols aimed at increased ters. growth and/or weight gain (Beardmore et al. [16]; Jankun et al. [17]), gynogenetic production (Devlin and Nagahama, 2.2. Replication Banding. Replication bands were obtained in [18]; Piferrer et al. [19]; Chen et al. [20]), establishment of 10 specimens of R. canadum using in vivo incorporation of monosex cultivations (Coimbra et al. [21]; Chen et al. [20]), the base analog 5-Bromo-2-deoxyuridine (5-BrdU), follow- and physical identification of quantitative trait loci (QTLs) ing methodology developed by Giles et al. [28], with some (Ning et al. [22]) for several marine or fresh water species. modifications. A solution of 5-BrdU (5 mg/mL in 0.9% NaCl Because of the growing economic importance and inc- solution) was injected intraperitoneally into each specimen reasingly sophisticated cultivation techniques, recent off- ataproportionof1mL/100gofbodyweight,6h(earlyS shore commercial breeding initiatives of R. canadum stocks phase) before animal sacrifice to obtain mitotic chromo- from the Western Atlantic have been very successful (Benetti somes. The FPG (Fluorochrome Photolysis Giemsa) staining et al. [4]). In order to get new useful characters for com- method was used to reveal RBG (Replication bands by bro- parative genomics at chromosomal levels and provide ade- modeoxyuridine using Giemsa) bands. The slides with chro- quate conditions for future uses of genetic improvement mosomal preparations were washed in 2 × SSC saline solu- and biotechnological innovations, a resolutive chromosomal tion. They were then stained with Hoescht 33258 solution characterization of this species is presented here for the first (Sigma) (1 mg of Hoescht in 1 mL of methanol and 100 mL of time, using conventional Giemsa staining, C-banding, posi- 0.5 × SSC)for40mininadarkchamber,washedindistilled tion and frequency of nucleoli organizer regions (NORs), water, covered with a 2 × SSC film, and exposed to ultraviolet η CMA3 and DAPI fluorochrome staining, physical mapping light (254 m) at a distance of 10 cm, for 1 h. The slides were of repetitive sequences using fluorescent in situ hybridization then incubated in 2 × SSC buffer for 90 minutes and stained (FISH) with 18S and 5S rDNA probes and telomeric seque- with 6% Giemsa solution (pH 6.8) for 10 minutes. nces (TTAGGG)n, in addition to replication banding pat- terns by the incorporation of base analogue 5-BrdU in this 2.3. Chromosome Hybridization Probes. Two tandem-arrayed species. DNA sequences isolated from the Hoplias malabaricus (Teleostei, Characiformes) genome were used. The first 2. Material and Methods probe contained a 5S rDNA repeat copy and included 120 base pairs (bp) of the 5S rRNA encoding gene and 200 bp Cytogenetic analyses were developed from a sample of 40 of the nontranscribed spacer (NTS) [29]. The second probe cobia fry, weighing around 35 grams, obtained from a com- corresponded to a 1,400 bp segment of the 18S rRNA gene mercial marine fish culture farm located in the state of Per- obtained via PCR from nuclear DNA (Cioffi et al. [30]). The nambuco, in Northeastern Brazil. The specimens were previ- 18S rDNA probe was labeled by nick translation with DIG- ously submitted to in vivo mitotic stimulation for 24 hours, 11-dUTP, according to the manufacturer’s specifications using intramuscular and intraperitoneal inoculation of fun- (Roche) and the 5S rDNA probe was labeled with biotin- gal and bacterial antigen complexes (Molina [23]), anes- 14-dATP by nick translation, also according to the manufac- thetized with clove oil (eugenol) and sacrificed to remove turer’s specifications (Bionick Labelling System, Invitrogen). the renal tissue. Metaphasic chromosomes were obtained The telomeric DNA sequence (TTAGGG)n was also used from cell suspensions of anterior rim fragments, according as a probe. This probe was generated by PCR (PCR DIG- to short-term in vitro methodology (Gold Jr. et al. [24]). Probe Synthesis Kit, Roche) in the absence of template using The cell suspension obtained was dropped onto clean (TTAGGG)5 and (CCCTAA)5 as primers (Ijdo et al. [31]). slides and covered with a film of distilled water heated to ◦ 60 C. The chromosomes were stained with a solution of 2.4. Chromosome Hybridization and Analysis. Fluorescent in 5% Giemsa, and 30 metaphases of each individual were situ hybridization (FISH) was performed on mitotic chromo- analyzed to determine the number of chromosomes. Males some spreads (Pinkel et al., [32]). The metaphase chromo- and females were identified by macroscopic or histologic some slides were incubated with RNAse (40 μg/mL) for 1.5 h examination of the gonads. The best metaphases were pho- at 37◦C. After denaturation of chromosomal DNA in 70% tographed under an Olympus BX50 epifluorescence micro- formamide, spreads were incubated in 2 × SSC for 4 min scope equipped with a DP70 digital image capture system. at 70◦C. Hybridization mixtures containing 100 ng of dena- tured probe, 10 mg/mL dextran sulfate, 2 × SSC, and 50% 2.1. Chromosome Banding. The heterochromatic regions and formamide in a final volume of 30 μlweredroppedontothe ribosomal sites were identified by techniques proposed by slides, and hybridization was performed overnight at 37◦Cin Sumner [25] and Howell and Black [26], respectively. The a moist chamber. Posthybridization washes were carried out ◦ CMA3/DAPI double-staining technique was employed for at 37 Cin2× SSC, 50% formamide for 15 min, followed by Journal of Biomedicine and Biotechnology 3 asecondwashin2× SSC for 15 min, and a final wash at FISH with telomeric probes (TTAGGG)n showed no room temperature in 4 × SSC for 15 min. Signal detection ectopic signals, other than those present in the terminal was performed using avidin-FITC (Sigma) for the 5S region of the chromosome complement (Figure 1(e)). The rDNA probe and anti-digoxigenin-rhodamine (Roche) for wide range in telomeric signal intensity observed between 18S rDNA and (TTAGGG)n probes. One-color FISH was chromosome pairs was markedly higher in some pairs than performed to detect (TTAGGG)n repeats,while5Sand18S in others (Figure 1(e)). rDNA were detected by double-FISH. The posthybridization The replication band pattern enabled a better identi- washes were performed in a shaker (150 rpm). The fication of chromosome pairs (Figures 1(c) and 2). Early chromosomes were counterstained with DAPI (1.2 μg/mL). replication bands coincided with the euchromatic chromo- FISH analysis was carried out with an epifluorescence some regions. The heterochromatin blocks identified by C- microscope (Olympus BX50) and chromosomal plates were banding showed a synchronous pattern of late replication. captured by the CoolSNAP system, Image Pro Plus, 4.1 Interestingly, the heterochromatinized 18S and 5S rDNA sites (Media Cybernetics). exhibited a typical initial replication pattern.

2.5. Chromosome Measures and Idiogram. Determination of 4. Discussion chromosome types (Levan et al. [33]) and their measures The karyotype patterns of R. canadum are similar to those were obtained using Image Tools 0.8.1 software, from five considered basal and conserved in most Perciformes fish. complete metaphases of R. canadum, where the locations of These symplesiomorphies are characterized by a diploid primary restrictions and telomeric regions of each chromo- number of chromosomes equal to 48, karyotypes composed some were clearly defined. Total chromosome length (S), arm mainly of acrocentric chromosomes, simple NORs, and a ratio (AR = long/short arm), in addition to size and position reduced amount of heterochromatin (Molina [14]). Indeed, of heterochromatic blocks (numerical data not shown) were this relatively heterochromatin-poor karyotypic pattern, determined. An idiogram with chromosomal data for the preferentially located in the pericentromeric region of acro- species was created, using the Easy Idio program (Diniz and centric chromosomes, has been identified in several groups Xavier [34]), showing the position of 18S and 5s rDNA sites, of marine Perciformes (e.g., Molina and Galetti Jr., [11]; late replication bands, and telomeric sequences. Molina and Bacurau [35]; De Araujo´ et al. [36]). However, the presence of six bi-armed chromosomes (pairs 1, 2, 3. Results and3)inthekaryotypeofR. canadum reflects the more pronounced diversification in the karyotypic macrostructure R. canadum has 2n = 48 chromosomes, with a chromosomal of this species, indicating the occurrence of pericentric formula composed of a submetacentric pair (sm), two subte- inversions associated to chromosomal evolution. Pericentric locentric pairs (st) and 21 acrocentric pairs (a), with a funda- inversions are the prevalent evolutionary events in some mental number (FN) of 54 (Figure 1(a)). Chromosome size groups of marine fish, such as Pomacentridae, Carangidae, ranged from 4.49 to 1.55 μm. The largest chromosome pair and Apogonidae (Molina and Galetti Jr. [37]; Rodrigues et (2nd pair), subtelocentric, exhibited secondary constriction al. [38]; De Araujo´ et al. [36]) and have been reported as in the short arm (Figure 1(a)), which showed polymorphic being the main mechanism of chromosomal diversification behavior, causing substantial homologue size variation. This in Perciformes (Galetti Jr. et al. [39]). polymorphism was evidenced by both conventional staining Replication bands in fish chromosomes are still restricted and in chromosomes submitted to the other chromosome to a reduced number of species. Although the R band bandings. patterns produced help achieve better homologue pairing, C-positive heterochromatic blocks were observed in the the symmetrical karyotype and relatively small size of R. pericentromeric regions of the 1st pair (sm), in the cen- canadum chromosomes enable more precise chromosomal tromeric and telomeric position (reduced content) in most individualization, as observed in a number of other fish of the acrocentric chromosomes, in the terminal position species. The replication patterns obtained revealed the on the long arm of the 3rd pair (st) and in the interstitial presence of three functional groups of chromatin in the kary- region of the long arm of some chromosome pairs. Sec- otype of this species. The first corresponds to euchromatic ondary constriction, present in the 2nd subtelocentric pair, regions, exhibiting the characteristic pattern of initial repli- was heterochromatic (CMA+/DAPI−), corresponding to the cation. The second group corresponds to heterochromatic location of the Ag-NOR sites (Figures 1(a) and 1(b)). regions composed of ribosomal gene repeats, with initial In situ hybridization with 18S and 5S rDNA probes replication and where the genic clusters of 18S rDNA showed characterized a nonsyntenic condition for these ribosomal characteristically strong fluorescence with GC-specific flu- subunits. The two 18S rDNA sites detected were located orochromes. A similar condition was identified earlier in in the C+/CMA+/DAPI− region of the short arm of the three species of the genus Leporinus (Anostomidae), in which 2nd chromosome pair. Conversely, four 5S rDNA sites were intensely GC-rich positive mitramycin bands (MM+) also detected and mapped in the terminal position of the long showed an initial replication pattern, while medium- or arm of the 3rd pair and on the short arm of the 13th pair of low-mitramycin fluorescence bands exhibited late replication chromosomes, both colocated with heterochromatic bands (Molina and Galetti Jr. [40]). Finally, the third group of (Figure 1(d)). chromatin from R. canadum corresponds to repetitive DNAs 4 Journal of Biomedicine and Biotechnology

sm st 1 2 3

a 4567891011 12 13 14

15 16 17 18 19 20 21 22 23 24

(a)

sm st 1 2 3

a 4 567891011 12 13 14

15 16 17 18 19 20 21 22 23 24

(b)

sm st 1 2 3

a 4 567891011 12 13 14

15 16 17 18 19 20 21 22 23 24

(c)

sm st 1 2 3

a 4 567891011 12 13 14

15 16 17 18 19 20 21 22 23 24

(d)

sm st 1 2 3

a 4 567891011 12 13 14

15 16 17 18 19 20 21 22 23 24

(e)

Figure 1: Karyotypes of Rachycentron canadum. Conventional staining (a) highlighting the Ag-NOR sites in chromosome 2; (b) C-banding, + − highlighting the NORs as CMA3 /DAPI heterochromatic regions; (c) replication bands, showing 18S (pair 2) and 5S (pairs 3 and 13) rDNA sites with early replication; (d) double-FISH with 18S (pink) and 5S (green) rDNA probes, showing the location of 18S rDNA sites in pair 2 and of 5S rDNA sites in pairs 3 and 13; (e) FISH with (TTAGGG)n sequences showing the location of telomeric sites in the chromosomes (orange). Bar = 5 μm. Journal of Biomedicine and Biotechnology 5

the chromosomes (Mantovani et al. [51]). Similarly, hete- rochromatins associated to ribosomal genes play a different evolutionary role in R. canadum, involving composition, position, and/or functional aspects, compared to other merely heterochromatic regions of the karyotype. Whereas the first contained high GC levels and replication at the 1 2 3 4 5 6 7 8 9 10 11 12 onset of the S phase, the remaining heterochromatic portions showed late replication and CMA3/DAPI staining neutrality. However, examples of nonheterochromatinized ribosomal sites are also present in different fish groups (e.g., Fujiwara 13 14 15 16 17 18 19 20 21 22 23 24 et al. [49]; Rab´ et al. [52]; Rabov´ a´ et al. [53]). Telomeric (TTAGGG)n sequences are present in the 18S rDNA + GC + Ag-NOR telomeres of vertebrate chromosomes, and their analysis allows one to establish the presence of chromosomal rear- Late replication rangements, such as Robertsonian fusions or inversions, which are involved in chromosomal evolution (Meyne et al. Heterochromatic regions [54]). These sequences have been used to identify chromoso- 5S rDNA mal rearrangements in fish (Saitoh et al. [55]), such as some Telomeric sequences species of Salmoniformes, Salvelinus namaycush, S. fontinalis, Figure 2: Idiogram of the chromosome complement of Rachy- S. alpinus, and Oncorhynchus spp. (Reed and Phillips [56]; centron canadum, exhibiting cytogenetic mapping of ribosomal Phillips and Reed [57]); Characiformes, Hoplias malabaricus ffi ffi sequences, Ag-NORs, heterochromatic regions, and chromosome (Cio and Bertollo [58]), and Erythrinus erythrinus (Cio replication bands. Bar = 5 μm. et al. [59]); Anguilliformes and Perciformes (Salvadori et al. [60]; Gornung et al. [61]; Caputo et al. [62]). FISH with the telomeric probe (TTAGGG)n revealed hybridization signals with late replication, exhibiting no positive response to AT or in the telomeric region of the chromosomes. Hybridization GC-specific fluorochromes. signals exhibited intensity variations in some chromosome In general, replication bands indicate less heterogeneity pairs, suggesting the occurrence of telomeric repeat ampli- in heterochromatins from R. canadum, compared to other fication or their dispersion into telomeric heterochromatic species (Molina and Galetti Jr. [40]). This apparent compo- regions. Interstitial telomeric sites (ITS) were not detected, sition homogeneity in the heterochromatic portions of the R. which indicates that Robertsonian fusions or chromosomal canadum genome may reflect the heterochromatic segments translocations were likely not involved in the karyotypic conserved in the karyotype. Such a situation seems to be par- evolution of R. canadum. However, we cannot rule out ticularly disseminated in Perciformes, suggesting the occur- this possibility, since it is known that loss of telomeric rence of similar chromosomal diversification mechanisms sequences may occur after such rearrangements (Slijepcevic in phylogenetically similar groups, characterizing karyotypic [63]; Nanda et al. [64], De Almeida-Toledo et al. [65]). Main- orthoselection processes (Molina [14]). Despite the contro- taining the basal diploid number for Perciformes, as well as versies regarding the different compositions and functionali- the relative conservatism of the karyotype, in fact do not ties of heterochromatins and their evolutionary role (Allshire appear to indicate that recent chromosomal rearrangements [41]; Huisinga et al. [42]; Djupedal and Ekwall, [43]), have occurred in the chromosomal evolution of cobia fish. analysis of their location, distribution, and composition has The phylogenetic relationships of the family Rachy- been essential in the chromosomal characterization of many centridae, based on morphological characters, suggest its fish groups and often effective as cytotaxonomic markers proximity with Nematistiidae, Echeneidae, Carangidae, and (Moreira-Filho and Carlos Bertollo [44]; Sola et al. [45]). Coryphaenidae (Johnson [66]; Springer and Smith-Vaniz Martins and Galetti Jr. [46] proposed that the location [67]). Indeed, the evolutionary proximity between families of 5S and 18S rDNA sites in different chromosomes, as has been corroborated by cytogenetic data available for a observed for most vertebrates, could allow these loci to evolve number of species belonging to these groups (Caputo et independently, since their divergent functional dynamics al. [68]; Sola et al. [45]; Rodrigues et al. [38]; Chai et requires a physical distance. This divergent location of 18S al. [69]; present study), complemented by the investigation and 5S rDNA loci seems to be the most common situation of mitochondrial sequences (Cit B) (Reed et al. [70]) and observed in fish, as well as in other vertebrates (Lucchini et larval morphology (Ditty and Shaw [71]), which point to al. [47]; Suzuki et al. [48]). However, although present in Coryphaenidae as a sister group of R. canadum. smaller numbers, syntenic or even equilocal arrangements of R. canadum has emerged as an important model for these rDNA families have also been observed (Fujiwara et al. marine fish culture. Nevertheless, there are few genetic stud- [49]), possibly even characterizing a frequent condition in ies on this species (Garber et al. [72]; Liu et al. [73]). Given some groups, such as Channichthyidae (Mazzei et al. [50]). that it belongs to a monotypic family with vast worldwide The occurrence of evolutionary dynamics involved in distribution in tropical and subtropical areas, its populations these genes in some species has been confirmed by a may be subject to marked genetic structuring, like others greater variability in the distribution of 45S rDNA sites in species with similar biogeographic characteristics. The 6 Journal of Biomedicine and Biotechnology presence of some chromosome pairs, such as the first three of three classes of repetitive DNAs,” Cytogenetic and Genome (sm, st, st, resp.) of the karyotype is particularly indicated Research, vol. 125, no. 2, pp. 132–141, 2009. as cytotaxonomic markers in the cobia population studied, [10] M. Mantovani, L. D. D. S. Abel, C. A. Mestriner, and O. considering its morphology, size, presence of heterochro– Moreira-Filho, “Accentuated polymorphism of heterochro- matin, and 18S and 5S rDNA sites. In this respect, such matin and nucleolar organizer regions in Astyanax scabripinnis chromosomes may contain important characters for inter- (Pisces, Characidae): tools for understanding karyotypic evo- population approaches, biodiversity characterization and lution,” Genetica, vol. 109, no. 3, pp. 161–168, 2000. monitoring, in addition to contributing to future biotech- [11] W. F. Molina and P. M. Galetti Jr., “Robertsonian rearrange- nological assays. ments in the reef fish Chromis (Perciformes, Pomacentridae) involving chromosomes bearing 5s rRNA genes,” Genetics and Molecular Biology, vol. 25, no. 4, pp. 373–377, 2002. Acknowledgments [12]P.M.GalettiJr.,W.F.Molina,P.R.A.M.Affonso, and C. T. Aguilar, “Assessing genetic diversity of Brazilian reef fishes by This study was financed by the National Research Council chromosomal and DNA markers,” Genetica, vol. 126, no. 1-2, (CNPq) (Process no. 557280/05-2) and the REUNI scholar- pp. 161–177, 2006. ship (Ministry of Education) awarded to UPJ. The authors [13] R. F. Artoni, M. R. Vicari, M. C. Almeida, O. Moreira- wish to thank the Aqualider Aquaculture Company for Filho, and L. A. C. Bertollo, “Karyotype diversity and fish cession the specimens used in the study. They also express conservation of southern field from South Brazil,” Reviews in their appreciation to Dr. Marcelo Guerra for providing Fish Biology and Fisheries, vol. 19, no. 3, pp. 393–401, 2009. telomere probes for FISH analysis. [14] W. F. Molina, “Chromosome changes and stasis in marine fish groups,” in Fish Cytogenetics,E.Pisano,C.Ozouf-Costaz,F. Foresti, and B. G. Kapoor, Eds., vol. 1, pp. 69–110, Science References Publisher, 2007. [1] J. B. Kaiser and G. J. Holt, “Cobia: a new species for [15] K. Ocalewicz, M. Jankun, and M. Luczynski, “Cytogenetic aquaculture in the US,” World Aquaculture Magazine, vol. 35, characteristics of interespecific hybrids and chromosome set pp. 12–14, 2004. manipulated finfish,” in Fish Cytogenetics,E.Pisano,C.Ozouf- [2]I.C.Liao,T.S.Huang,W.S.Tsai,C.M.Hsueh,S.L.Chang, Costaz, F. Foresti, and B. G. Kapoor, Eds., pp. 289–332, Science and E. M. Leano,˜ “Cobia culture in Taiwan: current status and Publisher, 2007. problems,” Aquaculture, vol. 237, no. 1–4, pp. 155–165, 2004. [16] J. A. Beardmore, G. C. Mair, and R. I. Lewis, “Monosex male [3] D. D. Benetti, M. R. Orhun, I. Zink et al., “Aquaculture of cobia production in finfish as exemplified by tilapia: applications, (Rachycentron canadum) in the Americas and the Caribbean,” problems, and prospects,” Aquaculture, vol. 197, no. 1–4, pp. in Cobia Aquaculture: Research, Development and Commercial 283–301, 2001. Production,I.C.LiaoandE.M.Leano,Eds.,pp.57–78,World [17] M. Jankun, H. Kuzminski, and G. Furgala-Selezniow, “Cyto- Aquaculture Society, New Orleans, La, USA, 2007. logic ploidy determination in fish–an example of two [4]D.D.Benetti,B.O’Hanlon,J.A.Rivera,A.W.Welch,C. salmonid species,” Environmental Biotechnology, vol. 3, no. 2, Maxey, and M. R. Orhun, “Growth rates of cobia (Rachycen- pp. 52–56, 2007. tron canadum) cultured in open ocean submerged cages in the [18] R. H. Devlin and Y. Nagahama, “Sex determination and sex Caribbean,” Aquaculture, vol. 302, no. 3-4, pp. 195–201, 2010. differentiationinfish:anoverviewofgenetic,physiological, [5]J.S.Frank,J.T.Ogle,J.M.Lotz,L.C.Nicholson,D.N.Barnes, and environmental influences,” Aquaculture, vol. 208, no. 3-4, and K. M. Larsen, “Spontaneous spawning of cobia, Rachy- pp. 191–364, 2002. centron canadum, induced by human chorionic gonadotropin [19]F.Piferrer,R.M.Cal,C.Gomez,´ C. Bouza, and P. Mart´ınez, (HCG), with comments on fertilization, hatching and larval “Induction of triploidy in the turbot (Scophthalmus maximus): development,” Proceedings of the Gulf and Caribbean Fisheries II. Effects of cold shock timing and induction of triploidy in a Institute, vol. 52, pp. 598–609, 2001. large volume of eggs,” Aquaculture, vol. 220, no. 1–4, pp. 821– [6] C. R. Arnold, J. B. Kaiser, and G. J. Holt, “Spawning of 831, 2003. cobia Rachycentron canadum in captivity,” Journal of the World [20] S. L. Chen, Y. S. Tian, J. F. Yang et al., “Artificial gynogenesis Aquaculture Society, vol. 33, no. 2, pp. 205–208, 2002. and sex determination in half-smooth tongue sole (Cynoglos- [7]L.A.C.Bertollo,G.G.Born,J.A.Dergam,A.S.Fenoc- sus semilaevis),” Marine Biotechnology, vol. 11, no. 2, pp. 243– chio, and O. Moreira-Filho, “A biodiversity approach in the 251, 2009. neotropical Erythrinidae fish, Hoplias malabaricus. Karyotypic [21] M. R. M. Coimbra, K. Kobayashi, S. Koretsugu et al., “A genetic survey, geographic distribution of cytotypes and cytotaxo- linkage map of the Japanese flounder, Paralichthys olivaceus,” nomic considerations,” Chromosome Research, vol. 8, no. 7, pp. Aquaculture, vol. 220, no. 1–4, pp. 203–218, 2003. 603–613, 2000. [22]Y.Ning,X.Liu,Z.Y.Wang,W.Guo,Y.Li,andF.Xie,“A [8]U.P.Jacobina,P.R.A.M.Affonso,P.L.S.Carneiro,and genetic map of large yellow croaker Pseudosciaena crocea,” J. A. Dergam, “Biogeography and comparative cytogenetics Aquaculture, vol. 264, no. 1–4, pp. 16–26, 2007. between two populations of Hoplias malabaricus (Bloch, 1794) [23] W. F. Molina, “An alternative method for mitotic stimulation (Ostariophysi: Erythrinidae) from coastal basins in the State of in fish cytogenetics,” Chromosome Science, vol. 5, pp. 149–152, Bahia, Brazil,” Neotropical Ichthyology, vol. 7, no. 4, pp. 617– 2001. 622, 2009. [24] L. C. Gold Jr., N. S. Shipley, and P. K. Powers, “Improved [9] M. B. Cioffi, C. Martins, L. Centofante, U. Jacobina, and L. methods for working with fish chromosomes with a review of A. C. Bertollo, “Chromosomal variability among allopatric metaphase chromosome banding,” Journal of Fish Biology, vol. populations of erythrinidae fish Hoplias malabaricus: mapping 37, pp. 563–575, 1990. Journal of Biomedicine and Biotechnology 7

[25] A. T. Sumner, “A simple technique for demonstrating cen- [41] R. Allshire, “Molecular biology: RNAi and heterochroma- tromeric heterochromatin,” Experimental Cell Research, vol. tina—a hushed-up affair,” Science, vol. 297, no. 5588, pp. 75, no. 1, pp. 304–306, 1972. 1818–1819, 2002. [26] W. M. Howell and D. A. Black, “Controlled silver-staining [42] K. L. Huisinga, B. Brower-Toland, and S. C. R. Elgin, “The of nucleolus organizer regions with a protective colloidal contradictory definitions of heterochromatin: transcription developer: a 1-step method,” Experientia,vol.36,no.8,pp. and silencing,” Chromosoma, vol. 115, no. 2, pp. 110–122, 1014–1015, 1980. 2006. [27] A. E. Barros e Silva and M. Guerra, “The meaning of [43] I. Djupedal and K. Ekwall, “Molecular biology: the paradox of DAPI bands observed after C-banding and FISH procedures,” silent heterochromatin,” Science, vol. 320, no. 5876, pp. 624– Biotechnic and Histochemistry, vol. 85, no. 2, pp. 115–125, 625, 2008. 2010. [44] O. Moreira-Filho and L. A. Carlos Bertollo, “Astyanax [28] V. Giles, G. Thode, and M. C. Alvarez, “Early replication bands scabripinnis (Pisces, Characidae): a species complex,” Revista in two scorpion fishes, Scorpaena porcus and S. notata (Order Brasileira de Genetica, vol. 14, no. 2, pp. 331–357, 1991. Scorpaeniformes),” Cytogenetic and Cell Genetics, vol. 47, pp. [45]L.Sola,O.Cipelli,E.Gornung,A.R.Rossi,F.Andaloro, 80–83, 1988. and D. Crosetti, “Cytogenetic characterization of the greater [29] C. Martins, I. A. Ferreira, C. Oliveira, F. Foresti, and P. M. amberjack, Seriola dumerili (Pisces: Carangidae), by different Galetti Jr., “A tandemly repetitive centromeric DNA sequence staining techniques and fluorescence in situ hybridization,” of the fish Hoplias malabaricus (Characiformes: Erythrinidae) Marine Biology, vol. 128, no. 4, pp. 573–577, 1997. is derived from 5S rDNA,” Genetica, vol. 127, no. 1–3, pp. 133– [46] C. Martins and P. M. Galetti Jr., “Conservative distribution 141, 2006. of 5S rDNA loci in Schizodon (Pisces, Anostomidae) chromo- [30] M. B. Cioffi, C. Martins, L. Centofante, U. Jacobina, and L. somes,” Chromosome Research, vol. 8, no. 4, pp. 353–355, 2000. A. C. Bertollo, “Chromosomal variability among allopatric [47] S. De Lucchini, I. Nardi, G. Barsacchi, R. Batistoni, and F. populations of erythrinidae fish Hoplias malabaricus: mapping Andronico, “Molecular cytogenetics of the ribosomal (18S + of three classes of repetitive DNAs,” Cytogenetic and Genome 28S and 5S) DNA loci in primitive and advanced urodele Research, vol. 125, no. 2, pp. 132–141, 2009. amphibians,” Genome, vol. 36, no. 4, pp. 762–773, 1993. [31] J. W. Ijdo, R. A. Wells, A. Baldini, and S. T. Reeders, [48] H. Suzuki, S. Sakurai, and Y. Matsuda, “Rat 5S rDNA spacer “Improved telomere detection using a telomere repeat probe sequences and chromosomal assignment of the genes to the (TTAGGG)(n) generated by PCR,” Nucleic Acids Research, vol. extreme terminal region of chromosome 19,” Cytogenetics and 19, no. 17, p. 4780, 1991. Cell Genetics, vol. 72, no. 1, pp. 1–4, 1996. [32] D. Pinkel, T. Straume, and J. W. Gray, “Cytogenetic analysis [49]A.Fujiwara,S.Abe,E.Yamaha,F.Yamazaki,andM.C. using quantitative, high-sensitivity, fluorescence hybridiza- Yoshida, “Chromosomal localization and heterochromatin tion,” Proceedings of the National Academy of Sciences of the association of ribosomal RNA gene loci and silver-stained United States of America, vol. 83, no. 9, pp. 2934–2938, 1986. nucleolar organizer regions in salmonid fishes,” Chromosome [33] A. Levan, K. Fredga, and A. A. Sandberg, “Nomenclature for Research, vol. 6, no. 6, pp. 463–471, 1998. centromeric position on chromosomes,” Hereditas, vol. 52, pp. [50] F. Mazzei, L. Ghigliotti, C. Bonillo, J. P. Coutanceau, C. Ozouf- 201–220, 1964. Costaz, and E. Pisano, “Chromosomal patterns of major [34] D. Diniz and P. M. Xavier, “Easy Idio,” 2006, http://geocities and 5S ribosomal DNA in six icefish species (Perciformes, .yahoo.com.br/easyidio. Notothenioidei, Channichthyidae),” Polar Biology, vol. 28, no. [35]W.F.MolinaandT.O.D.F.Bacurau,“Structuraland 1, pp. 47–55, 2004. numerical chromosome diversification in marine Perciformes [51] M. Mantovani, L. D. Dos Santos Abel, and O. Moreira- (Priacanthidae and Gerreidae),” Cytologia, vol. 71, no. 3, pp. Filho, “Conserved 5S and variable 45S rDNA chromosomal 237–242, 2006. localisation revealed by FISH in Astyanax scabripinnis (Pisces, [36] W. C. De Araujo,´ P. A. Mart´ınez, and W. F. Molina, “Mapping Characidae),” Genetica, vol. 123, no. 3, pp. 211–216, 2005. of ribosomal DNA by FISH, EcoRI digestion and replication [52] P. Rab,M.R´ abov´ a,´ P. S. Economidis, and C. Triantaphyllidis, bands in the cardinalfish Apogon americanus (Perciformes),” “Banded karyotype of the Greek endemic cyprinid fish, Cytologia, vol. 75, no. 1, pp. 109–117, 2010. Pachychilon macedonicum,” Ichthyological Research, vol. 47, no. [37] W. F. Molina and P. M. Galetti Jr., “Karyotypic changes asso- 1, pp. 107–110, 2000. ciated to the dispersive potential on Pomacentridae (Pisces, [53] M. Rabov´ a,´ P. Rab,´ and C. Ozouf-Costaz, “Extensive polymor- Perciformes),” Journal of Experimental Marine Biology and phism and chromosomal characteristics of ribosomal DNA Ecology, vol. 309, no. 1, pp. 109–119, 2004. in a loach fish, Cobitis vardarensis (Ostariophysi, Cobitidae) [38] M. M. Rodrigues, S. Baroni, and L. F. De Almeida-Toledo, detected by different banding techniques and fluorescence in “Karyological characterization of four marine fish species, situ hybridization (FISH),” Genetica, vol. 111, no. 1–3, pp. genera Trachinotus and Selene (Perciformes: Carangidae), 413–422, 2001. from the Southeast Brazilian coast,” Cytologia, vol. 72, no. 1, [54] J. Meyne, R. L. Ratliff, and R. K. Moyzis, “Conservation of the pp. 95–99, 2007. human telomere sequence (TTAGGG)n among vertebrates,” [39] P. M. Galetti Jr., C. T. Aguilar, and W. F. Molina, “An overview Proceedings of the National Academy of Sciences of the United of marine fish cytogenetics,” Hydrobiologia, vol. 420, no. 1–3, States of America, vol. 86, no. 18, pp. 7049–7053, 1989. pp. 55–62, 2000. [55] Y. Saito, R. R. Edpalina, and S. Abe, “Isolation and character- [40] W. F. Molina and P. M. Galetti Jr., “Early replication banding ization of salmonid telomeric and centromeric satellite DNA in Leporinus species (Osteichthyes, Characiformes) bearing sequences,” Genetica, vol. 131, no. 2, pp. 157–166, 2007. differentiated sex chromosomes (ZW),” Genetica, vol. 130, no. [56] K. M. Reed and R. B. Phillips, “Molecular cytogenetic analysis 2, pp. 153–160, 2007. of the double-CMA chromosome of lake trout, Salvelinus 8 Journal of Biomedicine and Biotechnology

namaycush,” Cytogenetics and Cell Genetics, vol. 70, no. 1-2, [72] F. Garber, W. D. Grater, K. C. Stuck, and J. S. Frank, pp. 104–107, 1995. “Characterization of the mitochondrial DNA control region [57] R. B. Phillips and K. M. Reed, “Application of fluorescence of Cobia, Rachycentron canadum, from Mississippi coastal in situ hybridization (FISH) techniques to fish genetics: a waters,” Proceedings of the Gulf and Caribbean Fisheries review,” Aquaculture, vol. 140, no. 3, pp. 197–216, 1996. Institute, vol. 53, pp. 570–580, 2002. [58] M. B. Cioffi andL.A.C.Bertollo,“InitialstepsinXY [73] L. Liu, C. Liu, and N. A. Liang, “Genetic analysis of population chromosome differentiation in Hoplias malabaricus and the of cobia, Rachycentron canadum around Zhanjiang waters origin of an X1X2Y sex chromosome system in this fish group,” of South China Sea with microsatellite markers,” Journal of Heredity, vol. 105, pp. 554–561, 2010. Tropical Oceanography, vol. 27, no. 6, pp. 57–61, 2008. [59] M. B. Cioffi, C. Martins, and L. A. Bertollo, “Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyoevolution in fish,” BMC Evolution- ary Biology, vol. 10, no. 1, article 271, 2010. [60] S. Salvadori, A. Deiana, C. Elisabetta, G. Floridia, E. Rossi, and O. Zuffardi, “Colocalization of (TTAGGG)n telomeric sequences and ribosomal genes in Atlantic eels,” Chromosome Research, vol. 3, no. 1, pp. 54–58, 1995. [61] E. Gornung, I. Gabrielli, and L. Sola, “Localization of the (TTAGGG)n telomeric sequence in zebrafish chromosomes,” Genome, vol. 41, no. 1, pp. 136–138, 1998. [62] V. Caputo, M. Sorice, R. Vitturi, R. Magistrelli, and E. Olmo, “Cytogenetic studies in some species of scorpaeniformes (Teleostei: Percomorpha),” Chromosome Research, vol. 6, no. 4, pp. 255–262, 1998. [63] P. Slijepcevic, “Telomeres and mechanisms of Robertsonian fusion,” Chromosoma, vol. 107, no. 2, pp. 136–140, 1998. [64] I. Nanda, S. Schneider-Rasp, H. Winking, and M. Schmid, “Loss of telomeric sites in the chromosomes of Mus musculus domesticus (Rodentia: Muridae) during Robertsonian rear- rangements,” Chromosome Research, vol. 3, no. 7, pp. 399–409, 1995. [65] L. F. De Almeida-Toledo, M. F. Z. Daniel-Silva, C. E. Lopes, and S. D. A. Toledo-Filho, “Sex chromosome evolution in fish. II. Second occurrence of an X1X2Y sex chromosome system in Gymnotiformes,” Chromosome Research, vol. 8, no. 4, pp. 335– 340, 2000. [66] G. D. Johnson, “Percoidei: development and relationships,” in Ontogeny and Systematics of Fishes,H.G.Moseretal., Ed., vol. 1, pp. 464–498, American Society of Ichthyology and Herpetology, 1984. [67] V. G. Springer and W. F. Smith-Vaniz, “Supraneural and pterygiophore insertion patterns in carangid fishes, with description of a new Eocene carangid tribe, Paratrachinotini, and a survey of anterior anal-fin pterygiophore insertion patterns in Acanthomorpha,” Bulletin of the Biological Society of Washington, no. 16, pp. 1–73, 2008. [68] V. Caputo, F. Marchegiani, and E. Olmo, “Karyotype differen- tiation between two species of carangid fishes, genus Trachurus (Perciformes: Carangidae),” Marine Biology, vol. 127, no. 2, pp. 193–199, 1996. [69] X. Chai, X. Li, R. Lu, and S. Clarke, “Karyotype analysis of the yellowtail kingfish Seriola lalandi lalandi (Perciformes: Carangidae) from South Australia,” Aquaculture Research, vol. 40, no. 15, pp. 1735–1741, 2009. [70] D. L. Reed, K. E. Carpenter, and M. J. DeGravelle, “Molecular systematics of the Jacks (Perciformes: Carangidae) based on mitochondrial cytochrome b sequences using parsimony, likelihood, and Bayesian approaches,” Molecular Phylogenetics and Evolution, vol. 23, no. 3, pp. 513–524, 2002. [71] J. G. Ditty and R. F. Shaw, “Larval development, distribution, and ecology of cobia Rachycentron canadum (Family: Rachy- centridae) in the northern Gulf of Mexico,” Fishery Bulletin, vol. 90, no. 4, pp. 668–677, 1992. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 104631, 23 pages doi:10.1155/2011/104631

Review Article Acute Myeloid Leukemia with the t(8;21) Translocation: Clinical Consequences and Biological Implications

Hakon˚ Reikvam,1 Kimberley Joanne Hatfield,2 Astrid Olsnes Kittang,1, 2 Randi Hovland,3 and Øystein Bruserud1, 2

1 Division of Hematology, Institute of Medicine, University of Bergen, 5021 Bergen, Norway 2 Division of Hematology, Department of Medicine, Haukeland University Hospital, 5021 Bergen, Norway 3 Division of Hematology, Center of Medical Genetics and Molecular Medicine, Haukeland University Hospital, 5021 Bergen, Norway

Correspondence should be addressed to Øystein Bruserud, [email protected]

Received 14 September 2010; Revised 31 January 2011; Accepted 22 February 2011

Academic Editor: Allal Ouhtit

Copyright © 2011 Hakon˚ Reikvam et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The t(8;21) abnormality occurs in a minority of acute myeloid leukemia (AML) patients. The translocation results in an in-frame fusion of two genes, resulting in a fusion protein of one N-terminal domain from the AML1 gene and four C-terminal domains from the ETO gene. This protein has multiple effects on the regulation of the proliferation, the differentiation, and the viability of leukemic cells. The translocation can be detected as the only genetic abnormality or as part of more complex abnormalities. If t(8;21) is detected in a patient with bone marrow pathology, the diagnosis AML can be made based on this abnormality alone. t(8;21) is usually associated with a good prognosis. Whether the detection of the fusion gene can be used for evaluation of minimal residual disease and risk of leukemia relapse remains to be clarified. To conclude, detection of t(8;21) is essential for optimal handling of these patients as it has both diagnostic, prognostic, and therapeutic implications.

1. Introduction the biology and clinical characteristics of the most common t(8;21) abnormality. Acute myeloid leukemia (AML) is a heterogeneous bone marrow malignancy, and patients with the cytogenetic 2. The t(8;21) Abnormality in Human AML t(8;21) abnormality represent a subset with specific clinical and biological characteristics [1]. The translocation fuses 2.1. Frequency and Predisposition. The t(8;21) abnormality the AML1 gene (also called RUNX1) on chromosome 21 is found in approximately 5%–10% of all AML cases and with the ETO gene (also referred to as the RUNX1T1 gene 10%–22% of AML cases with maturation corresponding to that encodes the CBFA2T1 protein) on chromosome 8. The the previous FAB class M2 [3–8]. The incidence of AML criteria for the diagnosis differs from other AML patients; with favourable cytogenetic abnormalities decreases with age the leukemia cells show biological characteristics that are [9, 10]; this is also true for t(8;21) that is most common in uncommon in other AML subsets, and the prognosis after children/younger patients [11]anduncommoninpatients intensive chemotherapy is better for these patients than above 60 years of age [10]. Approximately 10%–20% of for the majority of AML patients [1]. t(8;21) was the first children with AML have this translocation [12–15]. The cytogenetic abnormality discovered in AML [2], and today detection of t(8;21) transcripts in Guthrie cards suggests it offers a unique example of how a cytogenetic abnormality that the initiating events can occur in utero [16]. This is is used to define a distinct subgroup of patients. The AML1 also supported by studies of umbilical cord leukocytes that gene has p.d.d. been reported to be involved in 39 different have described an association between prenatal pesticide rearrangements and most of them have been detected in exposure (i.e., detection of pesticides in meconium) and myeloid malignancies. In the present paper we describe the detection of t(8;21) in the leukocytes and the level of 2 Journal of Biomedicine and Biotechnology the fusion transcript then correlated with the pesticide level abnormality; patients with t(8;21) together with del(9q) had [17]. a 5-year overall survival of 75% in this study [26]. Tissue-specific genomic organization probably con- Sweetser et al. investigated the molecular genetics of tributes to the formation of this disease-specific transloca- 43 patients with del(9q) [45]. They described a commonly tion. Studies of the nuclear architecture have concluded that deleted region of 2.4 Mb containing 11 genes, 7 of these chromosomes 8 and 21 tend to colocalize in myeloid cells being downregulated in del(9q) AML compared with normal [18]. Furthermore, the chromatin organization at intron 5 of CD34+ hematopoietic cells or AML cells with normal the RUNX1/AML1 gene, where the sequenced breakpoints karyotype. Two of these genes, TLE1 and TLE4, are most have been mapped, are characterized by reduced histone likely tumor suppressor since, loss of expression in AML1- H1 levels and increased levels of hyperacetylated H3 for ETO expressing cells leads to increased proliferation and cell AML1 expressing cells. Induction of DNA damage can then survival. induce formation of t(8;21) in the HL-60 AML cell line but not in nonhematopoietic HeLa cells [19]. Thus, both the Numerical Abnormalities. Loss of sex chromosomes is espe- nuclear microarchitecture and epigenetic mechanisms seem cially common in t(8;21) AML patients (Table 1). Loss of one to be important for the risk of t(8;21) formation in myeloid X chromosome does not seem to have any prognostic impact, cells. The AML1-ETO fusion protein alone is not sufficient whereas a recent study described a weak good prognostic for leukemia development (see Section 9), but the protein impact for -Y [7]. downregulates the expression of DNA repair enzyme 8- oxoguanine DNA glycosylase (OGG1), which may then lead Other Cytogenetic Abnormalities. Several abnormalities have to additional genetic abnormalities required for development been described in patients with t(8;21) AML such as trisomy of AML [20]. 4 and 8, but these combinations are uncommon, and their possible prognostic impact remains to be investigated. Other 2.2. AML1-ETO: Variant Rearrangements and Combination abnormalities include tetraploid or near-tetraploid clones with Other Genetic Abnormalities. The t(8;21) generates [46]. two fusion genes, AML1-ETO and ETO-AML1, but only the AML1-ETO transcript transcribed from the deriva- tive 8 chromosome is detectable by reverse transcriptase Mutations of KIT. Wang et al. characterized c-kit mutations polymerase chain reaction (RT-PCR). Simple reciprocal in a group of 54 AML patients with t(8;21), and they translocation is by far the most common abnormality observed mutations for 26 of these patients (Figure 3)[30]. for creating AML1-ETO fusions, but the fusion can also (i) 21 patients had abnormalities in the tyrosine kinase occurs through variant rearrangements (Figures 1(a), 2(a)). domain, four patients had mutations in the jux- The translocation can involve several chromosomes and tamembrane or extracellular domains, and the last occur together with inversion of the derivative 8 chro- patient had a mutation in the kinase insert sequence mosome (e.g., inv(8)(p21;q22)t(8;21), inv(8)(q22q24)) [21, between the adenosine triphosphate binding and 22]. AML1-ETO fusion can also be a result of insertion, phosphotransferase regions of the tyrosine kinase and both ins(21;8) and ins(8;21) have been described [23] domain. (Figure 2(b)). These variant rearrangements can be cryptic (ii) Seven different point mutations, three internal tan- and easily overlooked by conventional G-banding, and their dem duplications (ITD), and one amino acid deletion frequencies are therefore unknown. were detected. The t(8;21) abnormality is often detected together with additional cytogenetic or molecular genetic abnormalities; a (iii) The most common KIT abnormality was the N822K majority of the patients seem to have additional abnormal- mutation (10/26) followed by three variants of D816 ities (Table 1)[3]. These abnormalities are often numerical, mutations (9/26); this is similar to another study but other translocations or deletions can also be detected. [31]. Thus, many different KIT mutations have been detected Chromosome 9 Alternations. Deletion of chromosome 9q, in combination with t(8;21), but mutations in the tyrosine the del(9q) abnormality, is recurrent but uncommon in kinase domain predominate [30–32]. The incidence of KIT AML, and it was detected only in 81 out of more than 5000 mutations in t(8;21) AML varies between 6%–31% in patients that entered 3 MRC studies [26]. The deletion was most clinical studies [30–41], and one exceptional study in then detected in combination with t(8;21) for 29 out of these children reported an incidence of 43% [47]. 81 patients, and the karyotyping indicated that a common The biological impact of different KIT mutations was area of deletion in region 9q21-22 was present in more than investigated in a recent experimental study [48]. These 90% of the cases. Targeted analysis against AML1-ETO was authors compared the effects of coexpressing either (i) the not performed in this study. del(9q) has also been found more common KITD 814V mutation within the tyrosine cooccurring with fusion due to insertion [44]. Based on the kinase domain or (ii) the less common deletion within Exon results from several clinical studies, the del(9q) abnormality 8 (E8D419) with AML1-ETO in an experimental animal seems to be present in 15%–35% of AML patients with model. Their observations suggested that the KIT mutations t(8;21) [24, 26]. There was no indication from the MRC wereimportantforthediseasephenotypeandtheKIT data for an adverse prognostic impact of this additional deletion was associated with a less aggressive disease. Journal of Biomedicine and Biotechnology 3

177aa RHD NHR1 NHR2 NHR3 NHR4 A1-E 1 752

(a) Full-length AML1-ETO (A1-E) protein RHD NHR1 NHR2 NHR3 A1-E 11a 1 661 + 27

A1-E 9a 1 574 + 1

A1-E 6a 1 395

A1-E 6a sh 1 223

(b) Alternative AML1-ETO (A1-E) proteins

Figure 1: Domain organization of the full-length and alternative AML1-ETO fusion proteins. (a) The full-length AML1-ETO (A1-E) protein is shown, where most of the ETO (RUNX1T1) gene is fused into the N-terminal 177aa of AML1 (RUNX1) gene giving rise to a transcript coding for a protein of 752 amino acids (aa). The AML1 gene encodes the Runt homology domain (RHD) which is a DNA-binding protein, while ETO encodes four highly conserved functional domains called nervy homology domains (NHR1-4). (b) Different fusion transcripts arise due to alternative exon usage and splicing, which give rise to truncated proteins lacking NHR domains. Protein size (i.e., number of aa) is shown on the right with the number of additional aa that were not included in the original sequence. These alternative A1-E transcripts can be coexpressed alongside the full-length transcript and have different leukemogenic capabilities.

1234512 3 4 5 12 3 4 5

678 9101112 678 9101112 678 9101112

13 14 15 16 17 18 13 14 15 16 17 18 13 14 15 16 17 18 y 19 20 21 22 X Y 19 20 21 22 X Y 19 20 21 22 X Y

(a) (b) (c)

Figure 2: Cytogenetic analysis of AML blasts by G-banding and FISH. (a) The derivative chromosomes from a simple reciprocal translocation between 8q22 and 21q22 are detectable by G-banding (upper panel) and the translocation can be verified using FISH probes (lower panel) against ETO and AML1. With this particular probe (Vysis LSI ETV6(TEL)/RUNX1(AML1) ES Dual Color) fusion signals will appear both on derivative 8 and derivative 22. (b) In rare cases, AML1-ETO fusion occurs as a result of insertion. Small insertions can only be detected using FISH probes. In this case, the translocation t(7;8)(q11;q22) between chromosome 7 and 8 and the 9q deletion del(9)(q12q22) were detected. As deletion 9q is rare in AML and can coexist with AML1-ETO fusion, FISH analysis was, therefore, performed. Only one fusion signal on derivative 22 was detected, indicating an ins(21;8)(q22;q22q22) insertion. (c) AML1 can also be involved in translocations with other partners mimicking complex t(8;21). In this case, there is a translocation between 9q22 and 21q22. FISH analysis using in-house split-signal probes against AML1 verified the involvement of these genes, whereas the gene on derivative 9 is unknown. 4 Journal of Biomedicine and Biotechnology

Table 1: Genetic abnormalities commonly detected in combination with t(8;21).

Abnormality Frequency in t(8;21) AML Documented prognostic impact Reference Chromosomal abnormalities -X in female patients 30%–40% None [7, 24, 25] -Y in male patients 50%–60% Possible improved [7, 24, 25] 15%–35%; most studies Del(9q) None [7, 24–26] state 15%–20% Trisomy 8 8% [27] Complex abnormalities 9%–23% Adverse prognosis [27–29] Molecular abnormalities KIT mutations 25%–50% Possible adverse prognosis [30–41] JAK2V617F 6%–8% [36, 42] Flt3 -ITD 5% Adverse prognosis [24, 33, 43] Flt3 D853 3%–7% [24, 43]

Extracellular domains Intracellular domains

Exon 8 Exon 11 Exon 17 TM

N Ig-like domains JMD TK1 KIS TK2 C

502(AYFNF) repeat I571 +14 I748T D816Y, D816V D419 del Q575 +17 D816H, N822K V825I, L773S Figure 3: General architecture of the c-kit receptor and the mutations described in combination with the t(8;21) abnormality in the study by Wang et al. [30]. The c-kit type III receptor tyrosine kinase consists of an extracellular ligand-binding portion comprising five immunoglobulin-(Ig-) like repeats, a single transmembrane (TM) domain, a juxtamembrane domain (JMD), and a cytoplasmic portion containing and a split tyrosine kinase domain (TK1 and TK2) with a kinase insert sequence (KIS). Locations of c-kit abnormalities found in t(8;21) AML are indicated by the arrows. c-kit mutations are found more frequently within the extracellular fifth immunoglobulin-like domain (exon 8) and the second tyrosine kinase domain which contains the activation loop (exon 17).

The possible prognostic impact of KIT mutations has JAK2V617F Mutations. Only three studies have investigated been investigated in several relatively small studies including these mutations in t(8;21) AML, and they occurred in less 33–54 patients [30, 32, 34, 36] that all have described an than 10% of the patients [35, 36, 42]. adverse impact on relapse rate and/or long-term survival. Relapse rates as high as 70%–80% have been observed Ras Mutations. Mutations in NRas and KRas appear to be [31, 33, 34]. An adverse impact on overall survival was more frequent in pediatric than in adult patients, but they also described in the study reported by Boissel et al. that do not seem to have any prognostic impact in either group included 56 patients [33]. However, several recent studies [11, 33, 35, 38]. Even though Ras mutations, thus, do not seem to have any impact on chemosensitivity, experimental have described no prognostic impact of the KIT mutations studies suggest that these mutations are important in leuke- in t(8;21) AML both for adult patients [35, 38, 39]andin mogenesis and promote progression towards transformation children AML [40, 47]. in cells expressing the t(8;21) fusion protein [50].

Flt3-Abnormalities. Flt3-ITD occurs at a relatively low fre- PDGF Receptor Mutations. Results from animal models quency in t(8;21) AML and seems to have an adverse suggest that PDGF-receptor (PDGFR) mutations may coop- prognostic impact also in these patients (Table 1)[33]. erate with AML1-ETO in leukemogenesis (see below), Animal models suggest that both AML1-ETO and Flt3-ITD and PDGFRA seems to be frequently expressed in t(8;21) alone are insufficient to cause leukemogenesis, but they may AML cells at least for pediatric patients [51]. However, cooperate in inducing AML [49]. Flt3 mutations seem to PDGFRA mutations seem to be very uncommon in these be associated with an adverse prognosis in patients with patients although a N870S mutation has been described t(8;21); a recent preliminary report described a 3-year overall in the homologous domain of the activating KIT and Flt3 survival of only 26% [35]. mutations. Journal of Biomedicine and Biotechnology 5

Other Molecular-Genetic Abnormalities. Mutations in AML1 to as CBFA2T is also a nuclear protein and functions and in the hematopoietic transcription factor PU-1 have as a transcriptional repressor through its binding to both been described in exceptional patients with t(8;21) AML histone deacetylases and transcription factors [60, 61]. The [25]. The t(8;21) abnormality does not seem to coexist with full-length fusion protein contains all except the 31 N- CEBPA mutations [52], or any of the recently described terminal amino acids. The NHR-2 domain is important for mutations in IDH 1/2 [53, 54] or DNMT3A [54]. homodimerization and interactions with components of the repressor complexes and seems to be responsible for the 2.3. t(8;21) in Secondary AML. Approximately 10%–20% of reduced intranuclear mobility of the fusion protein [62– all cases of t(8;21) AML are secondary [25, 27]andcanbe 64]. Thus, the final result of this combination will often detected after treatment for hematologic malignancies (e.g., be binding to AML1 target gene promoters resulting in T-ALL, Hodgkin’s disease, and non-Hodgkin’s lymphoma) as suppression [63]. In addition, the fusion protein is directed well as solid tumors (e.g., breast, lung, prostate, esophageal, to nuclear microenvironments distinct from those where the and thyroid cancer) [55–57]. Secondary AML seems most AML1 molecule resides and for this reason may not bind to common after chemotherapy, but it has also been described all AML1 targets [18, 19]. the fusion protein also colocalizes after radiotherapy alone [55]. The median latency until with core-binding factor β (CBFβ) within the nucleus; this diagnosis was 37 months in one study, varying from 11 to colocalization results in a reduced intranuclear mobility of 126 months [55]. CBFβ that probably disturbs myeloid differentiation [64]. The secondary form is associated with significantly higher age (median 59 versus 41 years) and higher peripheral 3.2. AML1-ETO Has Several Splice Variants. Several splice blood blast counts than the de novo variant [55]. Secondary variants of the AML1-ETO gene are present in t(8;21) patient forms are also of the M2-subtype according to the FAB cells, and these are all variants in the ETO part of the classification, Auer rods are detected only for certain patients, molecule [65]. It is generally agreed that the full-length and the immunophenotype is similar to de novo forms variant alone does not have a leukemogenic effect; this usually being CD33+CD34+CD117+CD19+CD56+ [55]. A conclusion is based on studies using cell lines as well as in recent study described loss of the Y-chromosome in only animal models (see Section 6). However, analyses of primary 12% of all secondary cases compared with 36% of the AML cells with t(8;21) have demonstrated that numerous in- de novo t(8;21) subset, whereas the frequencies of other frame and out-of-frame transcript variants exist, and these abnormalities were similar for secondary and de novo forms variants seem to result from alternative splicing, internal [25]. The overall survival of patients with secondary t(8;21) deletions, or breakpoint region insertions [65]. The full- seems to be significantly inferior to patients with de novo length molecule encodes a protein of 752 amino acids, t(8;21) AML [55]. However, even though secondary t(8;21) whereas the variants are generally shorter (Figure 1(b)). AML has a reduced frequency of -Y, this decreased frequency (i) The AML1-ETO9a variant includes the alternative of a favorable marker cannot explain the adverse prognosis ETO9a exon and results in a truncated molecule of of secondary t(8;21) AML, because the prognostic impact of 575 amino acids that lacks the NHR3 and NHR4 -Y in the de novo group is relatively weak [7]. domains [66, 67]. In contrast to the full-length variant, this molecule alone is leukemogenic in a 3. Molecular Genetics of t(8;21) mouse model [66, 67], but this does not seem to be true for an alternative model [68]. A possible 3.1. The AML1-ETO Fusion Gene. As described above explanation for this difference could be that the (Section 2.2, Figure 2), simple reciprocal translocation is the levels of transcript/fusion protein seem to be lower in most common abnormality. The fusion gene can also be the nonleukemic model. The AML1-derived domains formed through complex genetic abnormalities that can be together with the ETO-derived NHR-2 domain seem detected by cytogenetic analysis, but these abnormalities may to be critical for this leukemogenic activity. Coex- also be cryptic and easily overlooked by conventional G- pression of the full-length molecule together with banding. the AML1-ETO9a variant results in earlier onset of Thein-framefusionofAML1(RUNX1)toETO leukemia and blockade of myeloid differentiation at (RUNX1T1) generally occurs with break-point in AML1 in an earlier stage. Thus, the various splice variants seem intron 5-6 and in ETO in intron 1b-2 [24, 58]. The molecular to cooperate in leukemogenesis. effects on the fusion protein are given by its structure as illustrated in Figure 1(a) and Table 2.AML1isatranscrip- (ii) Another variant contains an alternative exon at tion factor that is crucial for hematopoietic differentiation, the C-terminal end instead of NH4R/Mynd; this and binds to enhancers and promoters through its aminoter- exon encodes 27 amino acids in-frame. The variant minal Runt domain; this domain is also present in the is expressed in primary human t(8;21) AML cells AML1-ETO fusion-protein and the protein can, therefore, and the encoded protein seems to reduce repressor bind to AML1 target gene promoters. However, even though activity and tends to form multimeres [69]. the fusion protein has binding similarities with AML1, it (iii) ETO-exon 6a can also be incorporated, potentially causes an altered transcriptional activation and has another giving rise to two different truncated transcripts pre- subnuclear localization than the normal AML1 transcription dicted to encode proteins of 223 and 395 amino acids, factor [59]. The ETO/RUNX1T1-encoded protein referred respectively [70]. The shorter variant lacks all four 6 Journal of Biomedicine and Biotechnology

Table 2: Molecular structure of the t(8;21) fusion protein, the origin of various domains, and the localization of important molecular interactions. Origin Domain (alternative nomenclature) Molecular interactions N-terminal DNA binding AML1 Runt Binding to CBFβ with formation of heterodimers Binding of other transcriptional regulators Interacts with the nuclear hormone receptor corepressor NHR1 (eTAFH) Interaction with the activation domain of E-proteins (E2A and HEB) Mediates oligomerization with itself or other ETO NHR2 (HHR) molecules Interacts with the corepressors Sin3, Gfi1, and histone deacetylases 1 and 3 Interacts with the regulatory subunit of type II cAMP- RUNX1T1-derived domains NHR3 (Nervy) dependent protein kinase This domain together with the NHR4 domain is absent in the leukemogenic AE9a splice variant that naturally occurs in primary human AML cells with t(8;21) N-CoR and the silencing mediator of retinoid and thyroid hormone receptor (SMRT); these are associated NHR4 (MYND) with HDACs SON, an RNA/DNA-binding protein This domain is absent in the leukemogenic AE9a splice variant C-Terminal

NHR domains whereas the longer variant (referred through interaction with DNA methyltransferase. Several of to as AML1-ETO6a) retains the NHR-1 domain. The these partner molecules are expected to increase viability, AML1-ETO6a variant alone is not leukemogenic in and proliferation and/or decrease differentiation, but their animal models but seems to modulate the activity of relative contribution to leukemogenesis seems to vary and for the full-length fusion protein. example the E-protein interaction seems to be less important (iv) The two variants A1bETO and A1cETO were identi- [79]. The last two partner molecules mentioned in Table 3 fied in primary human AML cells and have additional include SON that shows a cytoplasmic localization and is sequences upstream to the first AML1 exon. Several also involved in regulation of proliferation and apoptosis, in-frame variants of these forms have been identified, and protein kinase A (PKA) that based on the initial study and their final effects on the expression of AML1 does not seem to have any major role in leukemogenesis [78]. responsive genes seem to vary from repressive to Finally, the biological functions and thereby the leukemic activating [65]. activity of the fusion protein can probably be modulated through two mechanisms as described in the lower part of To summarize, several molecular variants of the AML1- Table 3, either through proteolytic cleavage by calpains or ETO fusion protein exist, and the final effect of this through alternative splicing. chromosomal translocation thus depends on the balance Even though many biological effects of the fusion between these various isoforms. molecule seem to depend on altered expression of AML1- regulated genes [62–64], other mechanisms involving the 3.3. The Fusion Protein Has Several Binding Partners. The ETO portion of the fusion protein may also be important. AML1/ETO fusion molecule has several partner molecules For example, ETO2(MTG16) has corepressor activity and [60, 71–78]; nine important partners are listed in the upper binds to the transcriptional repressor N-CoR; this binding is part of Table 3. Seven of these partner molecules are involved inhibited by the fusion protein probably through occupation in the regulation of gene transcription; the molecular of the ETO2 binding site by the Mynd/NHR4 domain [80]. mechanisms behind these effects vary between the partners, This effect seems to be important for the myeloid differ- but involve (i) altered histone deacetylation, for example, entiation block. Another example is the oligomerization regulation of histone acetylation through recruitment of domain of ETO that is important for the AML1/ETO- histone deacetylases or the E-protein interaction with the mediated regulation of cell-cycle progression and apoptosis histone acetyltransferase; and (ii) altered DNA methylation [81]. Journal of Biomedicine and Biotechnology 7

Table 3: Important proteins that directly interact with or modulate the t(8;21) fusion protein.

Function of Molecule Structure: mechanism of interaction Function/biological effect the molecule Molecular interaction with the fusion molecule as a partner molecules GF35N and GF36S variant alleles have repressor activity. The fusion protein colocalizes and GFI1 is a regulator of myeloid differentiation, and Transcription interacts with the more common GFI136S, and its the interaction and effect of the fusion protein GFI1 [71] repressor repressor activity is thereby inhibited; the fusion vary between patients and depend on genetic protein does not colocalize or inhibit the differences GFI135N repressor activity Animal models suggest that CBPβ is important Forms heterodimers with the t(8;21) fusion for contribution to the fusion proteins inhibition Transcription CBPβ [72] protein through binding to the Runt domain of neutrophil differentiation, is essential for its repressor from AML1/RUNX1 growth-enhancing effect and cooperation with receptor-initiated signaling DNA-bound E-proteins interact with the histone acetyl transferase p300/CREB binding protein, E-proteins are important regulators of growth, Transcription leading to histone acetylation and initiation of differentiation and apoptosis and these functions E-proteins [60] factor transcription. This effect is silenced by the fusion are probably inhibited through a stable binding to protein through (i) preventing E-protein/p300 the NHR4 domain of the fusion protein activation and (ii) local recruitment of HDACs Binding of the complex together with their Contributes to the differentiation block and atten- SMRT/N-CoR Transcriptional associated HDACs to AML1 target genes through uates the effect of the fusion protein on cell complex [73] regulators the fusion protein causes aberrant repression of proliferation transcription UBF1 binds ribosomal DNA and regulates RNA Transcription Modulation of RNA polymerase 1-mediated ribo- UBF1 [74] polymerase 1 activity (see below); the fusion factor somal RNA transcription during interphase protein associates with UBF1 SON shows an abnormal cytoplasmic localization Binding to the NHR4 domain and is possibly Growth in t(8;21) cells; the functions are largely unknown SON [75] involved in the antiproliferative signaling regulation but it seems to be involved in regulation of mediated by this domain proliferation and apoptosis Histone There is physical binding between the fusion Acetylation of Direct recruitment of HDACs with silencing of deacetylases protein and HDAC1, the final functional effect histones AML1-target hematopoietic genes [73] being regarded as a leukemia-enhancing effect DNA methyl- DNA Silencing of gene expression through methylation, Contributes to the silencing of gene expression, transferase 1 [76] methylation probably functionally linked to HDACs andisinvolvedinthereducedIL3expression Even though PKA is important for regulation Protein kinase A Protein Binding to the NHR-3 domain of the fusion of cell proliferation, the interaction with AML1- (PKA) [78] phosphorylation protein ETO does not seem to have any major impact on proliferation or in vivo leukemogenesis Modulation of the fusion molecule Calpains cleave a restricted set of protein sub- strates; one hypothesis is that the enzyme cleaves Calpains Proteolytic Calpain is required for the induction of blood the fusion protein, and thereby generates a more [77] cleavage disorders by the fusion protein in Drosophilia potent inducer of leukemia similar to the leukemic splice variant. Alternatively calpains may affect leukemic cell migration In contrast to the full-length variant this alterna- One of the splice variants lacks the two tively spliced molecule alone can induce leukemic Alternative AML1/ETO splicing [62] carboxyterminal ETO domains transformation in experimental models without additional genetic abnormalities

3.4. The Fusion Protein Affects a Wide Range of Biological DNA repair [20]; this is combined with decreased expression Functions. The fusion molecule affects a wide range of of the p53 tumor suppressor, and the final effect is probably cellular molecules, and the data summarized in Table 4 an increased risk of new leukemogenic events [104]. A recent illustrates the complexity of the AML1/ETO effects [20, 62, study in Drosophila described that the fusion molecule 74, 76, 82–103]. Firstly, gene expression as well as ribosomal induced increased levels of reactive oxygen species (ROS); function are affected. Secondly, the fusion protein can reduce these high ROS levels are important for the development 8 Journal of Biomedicine and Biotechnology of the AML1-ETO associated phenotype and may also ligand [116, 117]. On the other hand, the effect of AML1- contribute to leukemogenesis through an increased risk of ETO depletion has been investigated by electroporating the developing additional genetic abnormalities [105]. Thirdly, t(8;21) carrying Kasumi-1 cell line with specific siRNA [118]. the responses to hematopoietic growth factors are altered; This depletion severely diminished the cell clonogenicity, this is due to altered cytokine release, receptor expression, inhibited G1-S transition, reduced apoptosis and induced and probably also downstream intracellular signaling. These senescence. The presence of exogenous G-CSF or GM-CSF events, together with altered cell-cycle regulation, will alter could not rescue these cells from senescence but partly the proliferative capacity of the cells. Finally, the regulation counteracted the antiproliferative effect. of apoptosis is altered, and the cells show activation of stress The effects of AML1-ETO on leukemic stem-cells have responses. Most of these alterations are in favor of increased not been investigated in detail. However, the effect of AML1 proliferation and survival and decreased differentiation alone on normal hematopoietic stem-cell homeostasis was (Tables 3 and 4), but the fusion protein also has opposite investigated in a recent study [119], and an enrichment of effects, and this may explain why the fusion protein alone quiescent stem-cells was observed in AML1-deficient bone cannot induce leukemic transformation (see above). marrow. These results suggest a negative regulatory effect of Two studies have shown that the fusion protein upreg- AML1 on normal stem-cells. Thus, the AML1-ETO fusion ulates Connexin 43 (Cx43) (Table 4). Cx43 forms gap molecule may then have an opposite effect of AML1 on junctions and is thereby involved in communication between leukemic stem-cells and cause an enrichment of quiescent cells; it has a role both in normal and leukemic hematopoiesis AML stem-cells similar to the AML1 deficiency through its and may also function as an intracellular signaling molecule suppression of AML1 target genes (see Section 3.1). independent of its role in gap junction formation [106, 107]. Thus, the effect on Cx43 may represent an additional 4. Alternative Methods for Detection of leukemogenic mechanism in t(8;21) AML. t(8;21) in Human AML The fusion protein seems to preferentially bind those AML1 target genes with duplicated binding sites in the Cytogenetic analysis by G-banding is highly recommended regulatory elements, and this selectivity may be an important at the time of diagnosis of all AML patients [120]. Although mechanism for dysregulated gene expression and leukemo- this time-consuming method requires the leukemic cells to genesis [108]. Another selective regulatory mechanism is be captured in mitosis, it is still the best screening method possibly the epigenetic structure at the fusion protein’s target for detection of leukemia-specific chromosomal aberrations. sites; a recent study described that the most downregulated t(8;21) is readily detectable by G-banding (Figure 2), but genes were characterized by aberrant repressive histone it can also occur due to variant rearrangements (complex tailchangesbothattheAML1consensusaswellasthe translocations, inversion, and insertion) that may be over- transcription start site [109]. looked if additional fusion-specific analyses like fluorescence Intracellular signaling is altered in t(8;21) AML. WT1- in situ hybridization (FISH) or reverse transcriptase poly- mediated signaling may contribute to leukemogenesis, and merasechainreaction(RT-PCR)arenotused(Figure 2) these patients seem to have increased WT1 levels [110]. [121, 122]. Detection of the fusion protein is less common; Proteomic studies suggest that the t(8;21) abnormality also the protein can then be detected by Western blotting, but interacts with the p53 network [111]. The survival and a recently described method using immunobeads for flow growth of t(8;21) AML cells depend on autocrine loops cytometric detection seems promising and may represent a between vascular endothelial growth factor (VEGF) and future alternative [123]. its receptors (VEGFR) that activate various downstream FISH analysis for AML1-ETO fusion should be per- pathways like PI-3 kinase, Akt, or MEK cascades [112, formed using locus-specific probes. The advantage with this 113]. Both VEGFR1 and VEGFR2 monoclonal antibodies method is that there is no need for cells in metaphase, and suppressed the growth of primary AML cells with t(8;21), it can, therefore, be performed also in bone marrow biopsies an effect mainly mediated through reduced phosphorylation or bone marrow/blood smears. Commercially available dual of Akt and MEK [114]. In addition, inhibition of VEGFR2 color probes against AML1 and ETO resulting in fusion- potentiated the growth inhibitory effect of idarubicin for signals are most commonly used (Figure 2). Particular care the t(8;21) Kasumi-1 cell line though the mechanisms of has to be taken when interpreting the signaling patterns from this effect are not fully elucidated yet [114]. Another study interphase analyses, and dual-color double-fusion probes suggests that VEGF receptor type-2-mediated signaling stim- should be used in order to reduce the false-positive rate. ulates proliferation of t(8;21) AML cells, an effect mediated Althoughrare,onehastobeawarethatvariantAML1-ETO through increased phosphorylation of Akt, and inhibition rearrangements can give only one fusion signal (Figure 2). of this signaling seems to potentiate the effect of cytarabine Probes covering the whole AML1 gene will also detect other [115]. AML1 rearrangements, and instead of fusion signals, the The global gene expression profiles of U937 AML cells AML1 rearrangements will then be seen as two weaker when expressing different AML-associated fusion proteins signals that can be misinterpreted as trisomy 21 in interphase were compared in a recent study [116]. The analysis revealed analyses. The chromosomal band 21q22 where the AML1 a role of AML1-ETO in downstream pathways known to gene is situated, has been reported involved in 55 different regulate DNA repair and stem-cell maintenance, including rearrangements, and several of these can be overlooked by activation of the Notch signaling pathway through Jagged-1 G-banding, and the majority of these abnormalities have Journal of Biomedicine and Biotechnology 9

Table 4: Important molecular mechanisms involved in AML1/ETO-induced leukemic transformation.

Molecule Function Effect of AML1/ETO on the molecule Final effect on t(8;21) cells Altered gene transcription PU.1 [82] Transcription factor Decreased expression by AML1/ETO Inhibition of differentiation Downregulation of C/EBPα;the normal function of this factor is Increased proliferation and inhibition of differen- C/EBPα [83, 84] Transcription factor regulation of differentiation and tiation inhibition of proliferation The normal function is transcriptional Altered regulation of differentiation and prolifera- C/EBP β [85] Transcription factor upregulation of C/EBPα tion through reduced expression of C/EBPα The POU4F1 levels are significantly correlated with the fusion protein levels. One study described differential POU4F1 probably contribute to the gene expres- POU4F1 [86] Transcription factor regulation of 140 genes by this factor, sion signature associated with t(8;21) AML and half of them are also AML1/ETO targets Increased expression at the mRNA and Aberrant expression of B lymphocyte markers, PAX5 [87, 88] Transcription factor protein level including CD19, CD79a RNA-rependent mechanisms and ribosomal functions The fusion protein selects a set of μRNAs (miR); it occupies the miR-24-23-27 locus and upregulates their expression Modulation of proliferation and differentiation miR24 downregulates the through the effects on miR24 Regulatory RNA mitogen-activated protein kinase μRNA [62, 89] molecules phosphatase 7 and enhances the downstream signaling through phosphorylation of c-jun and p38 kinases Silencing of miR223 through Altered regulation of myelopoiesis through effects epigenetic mechanisms on mir223 The fusion protein seems to localize to the nucleolar organizing regions In contrast to AML1 the fusion protein seems during mitosis, associates with to be a positive regulator of rDNA transcription. RNA polymerase I Transcriptional metaphase chromosomes and occupies Transcription regulated by RNA polymerase 1 [74] regulators ribosomal DNA repeats during seems to increase the proliferation of transformed interphase together with UBF1 (see cells (discussed in [74]) Table 3) DNA damage and repair OGG1 is an important part of the High OGG1 levels are associated with an adverse DNA base excision repair pathway, its OGG1[20]DNArepair prognosis; the downregulation may increase che- expression is downregulated by the mosensitivity fusion protein Increased formation of aromatic hydrocarbon-DNA adducts and Carcinogen-DNA This effect may contribute to an increased suscep- DNA damage [90] upregulation of the cytochrome P450 adducts tibility to additional genetic damage 1A1 enzyme that metabolizes polycyclic aromatic hydrocarbons AML1-ETO causes increased ROS are important for induction of the AML1- Increased intracellular Altered signalling. intracellular levels of reactive oxygen ETO associated phenotype and may also increase ROS [105] DNA damage? species (ROS) in Drosophila the risk of additional genetic abnormalities Increased mutation Predisposed for additional genetic effects that are Predisposition to leukemia progression frequency [91] required for leukemogenesis Cytokine-mediated growth regulation Hematopoietic IL3 [76] Decreased gene expression Decreased growth factor-dependent proliferation growth factor M-CSF is a growth-enhancing Increased cytokine-dependent AML cell prolifer- M-CSF receptor [92]Growthfactor hematopoietic growth factor ation 10 Journal of Biomedicine and Biotechnology

Table 4: Continued. Molecule Function Effect of AML1/ETO on the molecule Final effect on t(8;21) cells G-CSF is a growth-enhancing Increased cytokine-dependent AML cell prolifer- G-CSF receptor [93]Growthfactor hematopoietic growth factor ation Antiapoptotic Upregulation by the AML1-ETO BCL2 [94] Increased antiapoptotic signaling signaling fusion protein Induction of G-CSF receptor Increased growth factor receptor expression and Transcriptional expression; upregulation of the C/EBPε [92, 93] thereby increased cytokine-dependent prolifera- regulator myeloid-specific promoter for the tion by t(8;21) cells M-CSF receptor Decreased expression of the Decreased protein levels are associated with NF1 [95] Tumor suppressor Neurofibromatosis1 (NF1) tumor increased response of primary AML cells to GM- suppressor CSF NGF is released by bone marrow stromal cells; Apartofthenerve Tyrosine receptor Upregulation of this growth factor in addition, AML1-ETO expressing cells show growth factor kinase A [96] both at the mRNA and protein level increased proliferation in response to growth receptor (NGF) factors Cell-cycle regulation p21 is a cell-cycle inhibitor, this effect may con- Negative cell-cycle Increased mRNA and protein levels of p21 [97] tribute to the absence of leukemogenesis in the regulator p21 presence of t(8;21) alone Increased expression caused by either a Negative cell-cycle p27kip [98] direct effect of the fusion protein or by Cell-cycle inhibition regulator Cx43 Low expression of this molecule is associated with low expression of Altered cell-cycle regulation, increased risk of SSX21P [99] Cell-cycle regulation? CDC20; possibly causing attenuation aneuploidy? of the spindle checkpoint Disrupted spindle Disruption of the spindle checkpoint Aneuploidy Increased risk of aneuploidy checkpoint [100] during cell-cycle progression Regulation of apoptosis and stress responses Proapoptotic, Downregulated at the gene expression The molecule has proapoptotic and antiprolifera- Annexin A1 [101] antiproliferative level by the fusion protein tive effects; these functions are thus inhibited Increased expression of Connexin 43 Cx43 often inhibits cell proliferation both through Connexin 43 (Cx43) Gap junction in cells with t(8;21), possibly both a gap junction dependent and independent mech- [98, 102] component direct and an indirect effect mediated anisms; this effect may contribute to the lack of via c-Jun leukemogenesis by the full-length fusion protein Possibly increased chemosensitivity and thereby p53 [91] Tumor suppressor Activation of the p53 pathway contribution to the good prognosis of these patients Involved in reactive oxygen stress responses, AML cells with t(8;21) have High levels inhibit the proliferation of myeloid Part of stress TXNIP [103] increased protein levels of this progenitor cells; this may contribute to the good responses molecule. The mechanism is not prognosis of these patients known

been found in AML/MDS [124]. If only interphases are RT-PCRs are capable to detect one leukemic cell in 105- available, for analyses, the methodological alternative is to 106 normal cells [126], and this demands precautions to verify AML1 rearrangements by using AML1 dual color split- avoid cross-contamination leading to false positive results. signal probes (Figure 2(c)). Thus, due to the possibility of Furthermore, the presence of leukemia-specific fusion tran- other less common AML1 rearrangements, the detection of scripts has been detected in tissue from healthy donors t(8;21) may require a careful interpretation of additional when using nested PCR. Single round PCR should, therefore, molecular analyses before a final conclusion can be reached. be sufficient at diagnosis [127].Falsenegativeresultscan RT-PCR is a rapid and sensitive method for detection occur if the assay is not designed to detect all differ- of the fusion transcript. Although simple to perform, the ent known fusion and transcript variants. As described method is not without challenges. RNA is readily degraded, above (Section 3.2), several AML1-ETO variants have been and tests for RNA quality have to be performed [125]. described due to alternative promoters and splicing, and Journal of Biomedicine and Biotechnology 11 different variants can occur in the same patient. However, see [137]). Other common sites are head and neck soft and most variants include exon 3–5 in AML1 and exon 2–4 in subcutaneous tissue and the orbits, whereas intrathoracic ETO [17]. These regions can thus be used for design of the manifestation is uncommon [138, 139]. Such tumors can primers; the problem of false-negative results can thereby be be the first manifestation and precede the primary bone reduced, and standardized protocols for RT-PCR have now marrow manifestation by several months, or it can represent been published [128–131]. RT-PCR should thus be regarded the first manifestation of a relapse [137–141]. Myeloid as a rapid and sensitive methodology, and it can even be sarcoma has been reported in 15% of patients with t(8;21) used for simultaneous screening for several prognostically AML [27]. However, t(8;21) is a relatively rare cytogenetic important fusion transcripts [132]. abnormality in myeloid sarcomas; a recent cytogenetic study of 74 patients with such sarcomas reported that the t(8;21) 5. The Biological and Clinical Characteristics of abnormality was detected only in 2%-3% of these cases Human t(8;21) AML [137]. The sarcomas in patients with t(8;21) can be located to uncommon regions, including (i) intracerebral tumors [142] 5.1. The Diagnostic Criteria for AML in Patients with t(8;21). or intraspinal sarcoma with spinal cord compression [143] The general diagnostic criterium for AML is detection of at (ii) abdominal affection either as ovarial infiltration with least 20% blasts in the bone marrow. However, t(8;21) AML ascites [144] or compression of nerves or nerve plexuses (e.g., shows morphological signs of neutrophil maturation. Rare presacral tumors) with neurological symptoms [145]; (iii) cases can, therefore, be seen with bone marrow blast counts skeletal or heart muscle affection [146]; or (iv) pulmonary below 20%; according to the WHO classification, such cases involvement with initial symptoms resembling nodular or should also be classified and treated as AML and not as interstitial pneumonia [133, 139]. Even though these lesions myelodysplastic syndrome [3]. may give serious local symptoms at the time of diagnosis, at least in children detection of granulocytic sarcoma in t(8;21) 5.2. Morphological and Immunophenotypic Characteristics of AML does not seem to have a major impact on the long-term t(8;21) AML. The morphology of the leukemic cells has been survival [147]. described by Arber et al. [3], the most common features being relatively large blasts with basophilic cytoplasm, often 5.4. Myelomastocytosis and Myelomastocytic Leukemia. Sys- numerous azurophilic granules and a perinuclear clearing. temic mastocytosis and AML, including the t(8;21) variant of Auer rods are common and may be detected in blasts or AML, can show similarities. Firstly, activating KIT mutations immature neutrophils. The cells show maturing to promye- are common both in t(8;21) AML and in systemic mas- locytes and myelocytes, and mature neutrophils, possibly tocytosis [1]. Secondly, systemic mastocytosis can occur in with morphological signs of dysplasia, are also present combination with other hematological malignancies, usually in the marrow. Among the dysplastic signs are abnormal myeloid malignancies (AML, myelodysplastic syndrome or nuclear segmentation (e.g., pseudo-Pelger-Huet anomaly) chronic myeloproliferative neoplasms) and in the WHO and cytoplasmic staining abnormalities like pink staining classification, this is termed systemic mastocytosis with in mature neutrophils. Eosinophilic precursors are often associated hematological nonmast cell disease [1]. Thirdly, increased; basophils and/or mast cells are also increased even though the combination of mastocytosis and t(8;21) sometimes. The erythroid cells and megakaryocytes are AML seems rare [148], the t(8;21) AML variant can show morphologically normal. The abnormal differentiation of phenotypic similarities with mastocytosis and has increased the leukemic cells may even cause a morphological picture serum tryptase levels (see below). The KIT mutations are similar to chronic myeloproliferative neoplasias. Lee et al. detected both in AML and mast cells in those rare cases [133] described a patient with variant t(8;21) as a complex when mastocytosis is associated with AML; this observation t(8;10;21) (q22;q24;q22) abnormality; this patient presented demonstrate that both cell types then are derived from the with morphological findings in blood and bone marrow same clone [149–151]. mimicking atypical chronic myeloid leukemia. Due to the low number of published cases, it is not The blasts express myeloperoxidase and are typically possible to give general guidelines about the treatment of the CD13+CD34+HLA-DR+ [134]. There are also immunophe- myelomastocytic leukemia variants. The bone marrow mast notypic signs of granulocyte maturation with subpopula- cells seem to become more prominent after intensive AML tions expressing CD15 or CD65, eventually as a part of therapy, but this may simply be due to mast cell chemoresis- asynchronous maturation with concomitant expression of tance as evidenced by their persistence after chemotherapy. CD34 [134, 135]. Aberrant expression of the lymphoid Some patients have been treated with allogeneic stem-cell markers CD19, PAX5, and eventually cytoplasmic CD79a transplantation, and the very limited experience with this is common [87]. CD56 can also be expressed especially therapeutic strategy suggests that the type of conditioning for patients with KIT mutations [134, 135], whereas CD19 therapy may be important for eradication of both AML and expression is uncommon for patients with this mutation mast cells [149, 150]. [136]. A recent study investigated serum tryptase levels in AML [152]. Increased levels were detected in nearly half of AML 5.3. Extramedullary Manifestations of AML. Myeloid sar- patients and were associated with t(8;21) and KIT mutations. coma is a rare condition that can involve almost any site of The levels decreased after chemotherapy [150, 152], suggest- the body, but especially lymph nodes and skin (for references, ing that serum tryptase can be used as a marker of treatment 12 Journal of Biomedicine and Biotechnology response in these patients. Thus, altered tryptase levels was then significantly lower in lymphoid cells than in seem relatively common in t(8;21) AML, but morphological myeloid progenitors. This observation underlines the asso- myelomastocytosis is rare. One possible explanation for the ciation between AML1-ETO expression and myelopoiesis. increased levels could be tryptase release by the AML cells as Furthermore, transgenic mice that express the AML1-ETO an ectopic phenotypic characteristic. Alternatively, the levels fusion molecule specifically in myeloid cells appeared to may reflect an activation/stimulation of tryptase release by be healthy and developed AML only if they in addition normal mast cells. The association with KIT mutations were exposed to a mutagen [154]. These observations are suggests that AML cell release is most likely. consistent with the hypothesis that the AML1-ETO fusion protein alone is not sufficient for development of AML; 5.5. Differences between Core-Binding Factor AML with additional abnormalities have to be present [154]. Similar t(8;21) and inv(16)/t(16;16). Even though t(8;21) and observations have been made in other conditional knock-in inv(16)/t(16;16) are both regarded as core-binding factor models and models based on retroviral transduction to the AMLs with good prognosis, the two forms show several stem-cell compartment; the fusion protein alone often results differences in their pretreatment features. This has been only in increased proliferative capacity and altered regulation reviewed in detail by Mrozek´ and Bloomfield [43]. Firstly, of differentiation. In one of these abnormalities an increase t(8;21) AML is more frequent in African than white Ameri- in immature eosinophils similar to the human t(8;21) AML cans, it has lower white blood cell counts and lower percent- was observed (discussed in detail in [153]). ages of blasts in the bone marrow. Secondly, extramedullary Other chimeric models based on retroviral transduction disease is less frequent in t(8;21), especially lymphadenopa- have also been published (reviewed in [153]). Transfection thy, splenomegaly, gingival hypertrophy, and skin/mucosa of the AML1-domain alone from the fusion protein had involvement. Thirdly, the frequency and patterns of sec- no effect on hematopoiesis, showing that the ETO-derived ondary cytogenetic abnormalities differ. A secondary chro- part of the molecule is required for development of the mosomal abnormality is detected in 70% of patients with hematopoietic abnormalities. Furthermore, the AML1-ETO t(8;21) but only in one-third of inv(16) patients. As described molecule has also been transfected to mice with other abnor- above (Section 2.2), the most frequent secondary abnormal- malities, including (i) deficiency of the myelosuppressive ities in t(8;21) is loss of sex chromosomes and deletion Interferon regulatory factor (IRF), (ii) mutations in receptor of 9q, whereas in inv(16), the most common are +22, +8, tyrosine kinases such as TEL/PDGFβR and Flt3; and (iii) del7q, and +21. For mutations detected by molecular genetic downregulation of the p21 cell-cycle inhibitor. All these methods, both KIT and Ras mutations occur, but they are combinations resulted in development of AML. Thus, the more frequent in inv(16), than in t(8;21) leukemia [33]. additional abnormalities cooperated with AML1-ETO in These pretreatment differences suggest that the molecular leukemogenesis. mechanisms in the leukemogenesis differ between these two groups. 7. The Global Gene Expression Profile, Mrozek´ and Bloomfield [43] also discussed possible microRNA (MIR) Expression, and prognostic differences between t(8;21) and inv(16)/t(16;16) Epigenomic Profile in Human t(8;21) AML AML. Observations from several studies suggest that relapse of t(8;21) is less responsive to salvage treatment, and these Global gene expression profiling in AML has revealed that patients, therefore, have a lower overall survival. This differ- major prognostic subgroups based on genetic markers are ence may be caused by the additional genetic abnormalities; recapitulated in large-scale gene expression patterns [4, 155, the KIT mutations associated with t(8;21) AML seem to have 156]. These global profiles have identified specific signatures adverse prognostic effects whereas +22 in inv(16) has been for patients with the t(8;21) abnormality [4, 155, 156], and associated with lower relapse risk in some studies. Finally, its prediction can be made with almost 100% specificity and there is possibly also an influence of genetic factors/race on sensitivity [157]. There is an overlap between the expression the response to chemotherapy in t(8;21) patients. profiles for the t(8;21) and inv(16) abnormalities [119], but approximately one third of the transcripts are specific for 6. Animal Models of t(8;21) AML the t(8;21)-associated profile [119]. RUNX1T1/ETO itself has been identified as the most discriminative gene for Several animal models of t(8;21) AML have been developed, the t(8;21) cluster [4, 155], but several other genes are including transgenic and knock-in models, conditional also frequently up- or downregulated. Of special interest is knock-in,aswellaschimericmodels[153]. The models are probably the transcription factor POU4F1 that is important important for our current understanding of the role of the for embryonic brain development but without any known AML1-ETO fusion protein in leukemogenesis (for detailed role in normal or leukemic hematopoiesis. This gene is fre- discussion and references see [153]). AML1 knock-out causes quently upregulated in t(8;21) AML [156]; this upregulation embryonic death due to bleeding complications, and knock- is probably not directly caused by the AML1/ETO fusion in models of the AML1-ETO fusion gene resulted in a similar protein [86] but the unique transcription profile of t(8;21) embryonic phenotype, suggesting that repression of AML1- AML is probably largely attributed to POU4F1 [86]. Finally, regulated genes are important in the fusion model. Fur- AML1-ETO downregulates genes involved in multiple DNA thermore, one of the transgenic models directed the fusion repair pathways, a possible explanation for the increased gene into the stem-cell compartment and its expression in vitro DNA damage and p53 activation in these cells Journal of Biomedicine and Biotechnology 13

[91, 104]. Based on the results summarized in Table 4 we that the microRNA signature seems to be different in the conclude that the t(8;21) fusion protein alters the expression CD34+CD38− AML cell subset which is believed to harbor levels of a wide range of molecules, and thereby affects the a major part of leukemic stem-cells [172]. regulation of several intracellular processes; this conclusion DNA methylation and histone modifications are impor- is also supported by the t(8;21)-associated microarray profile tant epigenetic mechanisms of gene regulation [173]. These (e.g., altered transcriptional regulation and DNA repair). mechanisms seem to play essential roles both independently Luck¨ and coworkers identified two distinct gene expres- and cooperatively in malign transformation and progression sion signatures among t(8;21) and inv(16) AML based on [173]. This is also true for AML, where different cytogenetic the presence of KIT mutations [158]. The KIT mutated cases subgroups, including t(8;21), seem to be characterized by were then characterized by deregulation of genes belonging distinct epigenetic modifications [174–176]. However, the to the NFκB signaling pathway [159]. On the other hand, clustering seems to be less pronounced based on methylation Bullinger and coworkers classified t(8;21) and inv(16) AMLs data compared to gene expression data [174]. The t(8;21) in favorable and unfavorable prognostic subsets based on DNA methylation cluster harbors patients not having the supervised analysis of gene expression, the two distinct AML1-ETO fusion gene, even though they seem to have groups being characterized by altered expression of genes a similar prognosis and also share other features with involved in the MAP-kinase and the mTOR pathways, t(8;21) patients [175]. Furthermore, human hematopoietic respectively [160]. All these pathways are suggested to play stem-cells transduced with the AML1/ETO fusion gene a role in leukemogenesis and are considered as potential failed to reproduce the epigenetic signature [176], sup- therapeutic targets [161, 162]. porting the theory that other mutations are needed to A major part of the published clinical studies do not create the fully malign phenotype [154]. In contrast to find any significant prognostic impact of KIT mutations data from methylation studies, modification of histone H3 (Section 2.2). The observations from the studies of global Lysine 9 methylation was recently demonstrated to show gene expression profiles described above and the different only minor differences between different cytogenetic groups effects on intracellular signaling pathways for KIT mutations [177]. (the NFκBpathwayisaffected) compared with chemosensi- tivity (MAP kinase)/chemoresistance (mTOR) are consistent 8. The Prognostic Impact of with the hypothesis that KIT mutations do not have any t(8;21) in Human AML major prognostic impact. This may be true at least for the chemotherapy regimen used in these German/Austrian 8.1. Patients Receiving Conventional Intensive Chemotherapy. studies [158, 160]. A possible explanation for the different t(8;21) is usually associated with a relatively low risk of prognostic impact between various studies may be that relapse. A recent MRC report analyzed the survival data for the prognostic impact depends on differences between the 5876 AML patients (median age 44 years) including 421 chemotherapy regimen. patients with t(8;21) [7]. The long-term disease-free survival The global gene expression analyses have identified addi- for this subset was 61%, and a similar high survival has also tional genes than those summarized in Table 4,whosealtered been observed in other studies [178, 179]. No difference in expression may be clinically relevant [4, 155, 156]. Firstly, overall survival was then observed when comparing patients PRAME (preferentially expressed antigen of melanoma) is with t(8;21) alone versus patients with additional cytogenetic upregulated, and this AML-associated antigen is now used abnormalities the only possible exception being loss of in vaccination trials and may also be a candidate marker the Y chromosome that was associated with an improved for detection of minimal residual disease (MRD) [163, 164]. survival of borderline significance in the MRC study. A Secondly, the structural membrane protein CAV1 is also French study investigated elderly patients (median age 67 upregulated, and this molecule is possibly important for years) with CBF-AML, including 60 patients with t(8;21) chemosensitivity [165]. Among the down-regulated genes [27]. These patients received induction treatment with an are the cystein protease CTSW cathepsin W, the cancer- anthracycline combined with cytarabine; 80% of the patients associated actin-bundling protein LCP1 (lymphocyte cytoso- achieved complete remission after one induction cycle and lic protein 1), the actin-regulatory protein CAPG (capping 88% after two cycles. However, despite this high remission protein, gelsolin-like) and the semaphorin receptor PLXNB2 rate, the median 5-year overall survival for these patients (plexin B2). These genes seem to be involved in cancer cell was only 31%. A high white blood cell count (WBC) at migration/invasion, cancer-associated angiogenesis or tumor diagnosis, poor performance status, and del(9q) were all progression [166–169]. associated with an adverse prognosis, whereas administra- It has been demonstrated that patient-derived AML tion of intensive consolidation treatment was associated with cells express a specific signature of microRNA, a class of better survival. High WBC is in general considered as an small noncoding RNAs involved in regulation of protein adverse prognostic factor in t(8;21); this is mainly based coding mRNA [170, 171]. Most microRNAs seem to be on clinical studies indicating an unfavorable outcome for downregulated in t(8;21) AML except the miR126/126∗ that patients with high WBC alone [27] or high WBC plus a is upregulated [170]. miR126/126∗ can inhibit apoptosis, high percentage of bone marrow blasts [180]. AML t(8;21) increase cell viability, and enhance colony formation pos- with high WBC (usually defined as >20 × 109/L) is often sibly by interacting with AML1-ETO itself [171]. Finally, considered to have a less favorable prognosis similar to studies in the t(8;21) positive Kasumi-1 cell line suggest the intermediate prognostic group in clinical studies [181] 14 Journal of Biomedicine and Biotechnology

(e.g., the HOVON 102 AML/SAKK 30/09 study; EudraCT for t(8;21) patients in first complete remission. However, number 2009-011613-24). Finally, it should also be men- the presence of additional KIT mutations, high WBC tioned that the adverse prognostic impact of KIT mutations counts and secondary leukemia have been associated with that is observed in certain studies may be explained by an adverse prognosis (see Sections 2.2, 2.3,and8.1), an association between KIT mutations and high peripheral suggesting that allotransplantation should be considered blood blast counts [37]. even in first complete remission for the younger subsets A recent study described an adverse prognostic impact of of these patients at least when an optimal donor is avail- high bone marrow cellularity in patients with t(8;21) [182]. able. The authors found that the bone marrow cellularity was The possible prognostic impact of KIT mutations the single most important prognostic parameter in these in combination with t(8;21) was discussed in detail in patients, and they classified their patients in three groups Section 2.2. This question has been addressed in several with (i) neither leukocytosis nor increased bone marrow clinical studies, and both adverse prognosis and no prog- cellularity (ii) only leukocytosis (cutoff 9.1 × 109/L),and (iii) nostic impact have been observed [30–36, 38–40, 47]. It patients with increased marrow cellularity with or without was recently recommended that core-binding factor AML leukocytosis. The survival after chemotherapy was lowest with KIT mutations should be classified as intermediate with (32% overall 5-years survival) for the last group. These regard to prognosis [191]. However, it is in our opinion, results strongly suggest that bone marrow cellularity should difficult to recommend allogeneic transplantation for these be further evaluated as a possible prognostic parameter in patients with its risk of early transplant-related mortality as these patients. long as the results are conflicting and several studies show no t(8;21) is also regarded as a good prognostic marker in prognostic impact of the KIT mutations after conventional pediatric AML. The complete remission rate close to 100%, chemotherapy. eventfree survival exceeding 69% and overall survival exceed- ing 80% have recently been reported for children included in 8.3. Disease-Stabilizing Therapy in t(8;21) AML. The com- the MRC-AML10, MRC-AML12 and AML-BFM 98 studies bination of all-trans retinoicacid(ATRA)togetherwith and with no effect of additional chromosomal abnormalities valproic acid or another histone deacetylase inhibitor is now on prognosis [183, 184]. Other pediatric protocols have tried for disease-stabilization in human AML [192, 193]. reported eventfree survival below 50% [15, 185, 186], and Most of the patients included in these studies have not the reasons for this discrepancy remain to be identified. been suitable for intensive chemotherapy; many of them However, children with relapsed t(8;21) AML seem to have hadrelapseddisease,andonlyasmallminorityhadt(8;21). achancetobecuredbysalvagetherapy[183, 184]. Experiments in the t(8;21) positive Kasumi-1 cell line have demonstrated that the AML1/ETO fusion protein recruits 8.2. Experiences with Allogeneic Stem-Cell Transplantation an HDAC-containing repressor complex to the promoters in t(8;21) AML. Two large studies each including more of AML1 target genes [73]. Valproic acid and probably also than 300 patients have investigated the outcome after other HDAC inhibitors cause a dissociation of the fusion allogeneic stem-cell transplantation for AML patients with molecule from the HDACs. Histone acetylation thereby leads inv(16) and t(8;21) [187, 188]. Kuwatsuka et al. described to transcriptional reactivation and increased proapoptotic no difference between patients in first remission receiving signaling [73, 101]. allogeneic and autologous stem-cell transplantation, and Only a few clinical studies have investigated the effect a long-term disease-free survival of 15%–20% was seen of ATRA in t(8;21) AML, and the results are conflicting. even for 85 patients undergoing allotransplantation not Treatment with ATRA alone for 40 days induced complete in complete remission [187]. As for patients receiving hematological remission in one patient [194], whereas others conventional therapy, additional cytogenetic abnormalities have reported that coexpression of the t(15;17), and the did not have any prognostic impact for these patients either. t(8;21) encoded fusion proteins can be associated with ATRA Similarly, Gorin et al. observed a comparable survival for resistance [195]. auto- and allotransplanted patients of approximately 60%, and additional cytogenetic abnormalities had no significant 9. Detection of Minimal Residual Disease prognostic impact, but high white blood cell counts had an in t(8;21) AML adverse impact [188]. The smaller study by Schlenk et al. showed no advantage 9.1. Methodological Strategies for Detection of MRD. of allotransplantation compared with conventional inten- Although detection of the AML1-ETO fusion transcripts sive chemotherapy [189], thus supporting the two studies represent a favorable prognostic marker, up to 30% of described above. In contrast, Shin et al. observed that patients will experience a relapse of the disease [7, 178, 179]. the survival for allotransplanted patients had improved MRD means remaining leukemia cells in a patient judged duringthelastyearsandwassignificantlybetterthanfor to be in complete hematological remission according patients receiving high-dose cytarabine in a retrospective to conventional morphological criteria. AML1-ETO- multicenter study based on distribution of questionnaires transcripts can persist in patients with t(8;21) even after to each participating center [190]. In our opinion, most stem-cell transplantation with GVHD and in long-time of the currently available data suggest that allogeneic stem- CR [196–200],butanincreaseinthefusiontranscript cell transplantation usually should not be recommended expression seems to be predictive of relapse [201]. Journal of Biomedicine and Biotechnology 15

RT-PCR is a sensitive approach which identifies leukemic serial determinations; the detection of increasing AML-ETO cells in 105-106 normal cells. By using quantitative RT-PCR it transcript levels or eventually the kinetics of the increase is easy to follow the patient through the course of the disease maybemorereliabletoevaluatetheriskofanimminent [202]. Leroy et al. assessed the prognostic value of real-time relapse. quantitative PCR in 21 AML1-ETO patients treated by the same protocol and who all achieved CR. Blood and bone 10. Concluding Remarks marrow were collected at diagnosis, at CR, after intensive consolidation therapy and every 3–6 months thereafter; the The t(8;21) variant of human AML is a heterogeneous median followup time being 15 months. The relapse rate was subset characterized by a common disease-specific molecular higher in patients with high pretreatment fusion transcript translocation. This variant is often referred to as core- expression, and the absence of recurrent disease correlated binding factor AML together with the inv(16)/t(16;16) vari- with posttherapeutic absolute transcript levels below 10−3 ants, but these two cytogenetically identified AML subsets compared to the Kasumi-1 cell line, or more than 3 log show several biological and clinical differences. In contrast decrease of transcript levels compared to the levels at the time to other AML patients the diagnosis of t(8;21) AML can be of diagnosis [202]. made even when less than 20% leukemic blasts are present in In a study by Ommen et al. various chromosomal thebonemarrow.Thediseaseischaracterizedby(i)ectopic aberrations appeared to have different relapse kinetics and expression of B-cell associated molecules; (ii) additional therefore optimal sampling intervals might differ; the best genetic abnormalities are common; (iii) the leukemic cells MRD sampling interval for AML1-ETO seems to be every show specific global gene expression and microRNA profiles; fourth month [203]. However, clinical utility of monitoring and (iv) usually there is a low risk of leukemia relapse MRD with such high sensitivity is still under investigation after high-dose cytarabine therapy. Despite the common and standardization of sampling procedures, handling and fundamental cytogenetic characteristics, it should always shipment of samples as well as the PCR analyses are required. be remembered that this specific cytogenetic abnormality Standardization of the assays is also necessary to allow identifies a heterogeneous subset of patients. comparison of results in different studies and for setting a threshold for AML1-ETO-transcript expression that defines Conflict of Interests molecular relapse [120, 204]. Multiparameter flow cytometry is less sensitive, but can The authors report no potential conflict of interest. be applied in the evaluation of MRD in most AML-cases and provides additional information about remaining cells Acknowledgment (reviewed in [204]). The method is rapid and detects the presence of 10−4 leukemic cells, but it is not as specific as The authors received financial support for their scientific PCR due to the possibility of phenotypic shifts in relapsed work from the Norwegian Cancer Society and the Helse-Vest disease. Tandem analysis with RT-PCR and flow cytometry Foundation. can improve MRD detection [205]. Interphase FISH may also have a potential as an adjunct analysis to cytomorphology, References cytogenetics, or multiparameter flow cytometry in the identification of MRD, since strong agreement between these [1] WHO, World Health Organization Classification of Tumors of methods has been described in large cohorts [206–208]. Haematopoietic and Lymphoid Tissues, International Agency for Cancer, Lyon, France, 4th edition, 2008. 9.2. Clinical Consequences of MRD Detection. Benefit from [2] J. D. Rowley, “Identification of a translocation with quinacrine fluorescence in a patient with acute leukemia,” preemptive treatment has been shown in PML-RARA acute Annales de Genetique, vol. 16, no. 2, pp. 109–112, 1973. promyelocytic leukemias [209, 210], but for other acute [3]D.A.Arber,A.S.Stein,N.H.Carter,D.Ikle,S.J.Forman, myeloid leukemia variants, few investigators have taken andM.L.Slovak,“Prognosticimpactofacutemyeloid clinical action on detection of molecular relapse. For clinical leukemia classification: importance of detection of recurring utility, it has been shown that kinetics of the AML1-ETO cytogenetic abnormalities and multilineage dysplasia on decline correlate to relapse rate and outcome [202, 205, 211]. survival,” American Journal of Clinical Pathology, vol. 119, no. Monitoring the different alternative splice variants of the 5, pp. 672–680, 2003. fusion transcript has also shown that persistence of the [4]P.J.M.Valk,R.G.W.Verhaak,M.A.Beijenetal.,“Prog- exon9a variant is indicative for later relapse [131]. nostically useful gene-expression profiles in acute myeloid We previously described that the translocation can be leukemia,” The New England Journal of Medicine, vol. 350, no. detected on Guthrie cards and may thus occur in utero 16, pp. 1617–1628, 2004. (Section 2.1), the fusion protein alone is not sufficient [5] Y. Cheng, Y. Wang, H. Wang et al., “Cytogenetic profile of de novo acute myeloid leukemia: a study based on 1432 patients for leukemogenesis (Section 6) and (iii) the translocation in a single institution of China,” Leukemia, vol. 23, no. 10, pp. can persist for years after allotransplantation without any 1801–1806, 2009. signs of leukemia relapse (Section 9.1). Taken together, [6]R.N.Sanderson,P.R.E.Johnson,A.V.Moormanetal., these observations further support the hypothesis that “Population-based demographic study of karyotypes in 1709 detection of the fusion transcript is not sufficient for patients with adult acute myeloid leukemia,” Leukemia,vol. evaluation of the relapse risk. One should rather use 20, no. 3, pp. 444–450, 2006. 16 Journal of Biomedicine and Biotechnology

[7]D.Grimwade,R.K.Hills,A.V.Moormanetal.,“Refinement myeloid leukaemia,” Oncogene, vol. 29, no. 13, pp. 2005– of cytogenetic classification in acute myeloid leukemia: 2012, 2010. determination of prognostic significance of rare recurring [21]L.Vieira,V.Oliveira,A.P.Ambrosio´ et al., “Translocation chromosomal abnormalities among 5876 younger adult (8;17;15;21)(q22;q23;q15;q22) in acute myeloid leukemia patients treated in the United Kingdom Medical Research (M2): a four-way variant of t(8;21),” Cancer Genetics and Council trials,” Blood, vol. 116, no. 3, pp. 354–365, 2010. Cytogenetics, vol. 128, no. 2, pp. 104–107, 2001. [8]M.Klaus,T.Haferlach,S.Schnittger,W.Kern,W.Hid- [22] L. Anelli, F. Albano, A. Zagaria et al., “Pericentric chromo- demann, and C. Schoch, “Cytogenetic profile in de novo some 8 inversion associated with the 5 RUNX1/3 CBFA2T1 acute myeloid leukemia with FAB subtypes M0, M1, and gene in acute myeloid leukemia cases,” Annals of Hematology, M2: a study based on 652 cases analyzed with morphology, vol. 84, no. 4, pp. 245–249, 2005. cytogenetics, and fluorescence in situ hybridization,” Cancer [23] G. Specchia, F. Albano, L. Anelli et al., “Insertions generating Genetics and Cytogenetics, vol. 155, no. 1, pp. 47–56, 2004. the 5RUNX1/3 C8FA2T1 gene in acute myeloid leukemia [9]U.Bacher,W.Kern,S.Schnittger,W.Hiddemann,T.Hafer- cases show variable breakpoints,” Genes Chromosomes and lach, and C. Schoch, “Population-based age-specific inci- Cancer, vol. 41, no. 1, pp. 86–91, 2004. dences of cytogenetic subgroups of acute myeloid leukemia,” [24]L.F.Peterson,A.Boyapati,E.Y.Ahnetal.,“Acutemyeloid Haematologica, vol. 90, no. 11, pp. 1502–1510, 2005. leukemia with the 8q22;21q22 translocation: secondary [10]Ø.Bruserud,R.Hovland,L.Wergeland,T.S.Huang,and mutational events and alternative t(8;21) transcripts,” Blood, B. T. Gjertsen, “Flt3-mediated signaling in human acute vol. 110, no. 3, pp. 799–805, 2007. myelogenous leukemia (AML) blasts: a functional character- [25] F. Kuchenbauer, S. Schnittger, T. Look et al., “Identification of ization of the effects of Flt3-ligand in AML cell populations additional cytogenetic and molecular genetic abnormalities with and without genetic Flt3 abnormalities,” Haematologica, in acute myeloid leukaemia with t(8;21)/AML1-ETO,” British vol. 88, no. 4, pp. 416–428, 2003. Journal of Haematology, vol. 134, no. 6, pp. 616–619, 2006. [11] K. Mrozek,´ G. Marcucci, P. Paschka, and C. D. Bloomfield, [26] A. J. Peniket, J. Wainscoat, L. Side et al., “Del(9q) AML: “Advances in molecular genetics and treatment of core- clinical and cytological characteristics and prognostic impli- binding factor acute myeloid leukemia,” Current Opinion in cations,” British Journal of Haematology, vol. 129, no. 2, pp. Oncology, vol. 20, no. 6, pp. 711–718, 2008. 210–220, 2005. [12] J. E. Rubnitz, S. C. Raimondi, A. R. Halbert et al., [27] T. Prebet,´ N. Boissel, S. Reutenauer et al., “Acute myeloid “Characteristics and outcome of t(8;21)-positive childhood leukemia with translocation (8;21) or inversion (16) in acute myeloid leukemia: a single institution’s experience,” elderly patients treated with conventional chemotherapy: a Leukemia, vol. 16, no. 10, pp. 2072–2077, 2002. collaborative study of the French CBF-AML intergroup,” [13]S.C.Raimondi,M.N.Chang,Y.Ravindranathetal., Journal of Clinical Oncology, vol. 27, no. 28, pp. 4747–4753, “Chromosomal abnormalities in 478 children with acute 2009. myeloid leukemia: clinical characteristics and treatment [28] F. R. Appelbaum, K. J. Kopecky, M. S. Tallman et al., outcome in a Cooperative Pediatric Oncology Group study- “The clinical spectrum of adult acute myeloid leukaemia POG 8821,” Blood, vol. 94, no. 11, pp. 3707–3716, 1999. associated with core binding factor translocations,” British [14] A. Pession, R. Rondelli, G. Basso et al., “Treatment and long- Journal of Haematology, vol. 135, no. 2, pp. 165–173, 2006. term results in children with acute myeloid leukaemia treated [29] H. Narimatsu, M. Iino, T. Ichihashi et al., “Clinical signif- according to the AIEOP AML protocols,” Leukemia, vol. 19, icance of minimal residual disease in patients with t(8;21) no. 12, pp. 2043–2053, 2005. acute myeloid leukemia in Japan,” International Journal of [15] Y. Perel, A. Auvrignon, T. Leblanc et al., “Treatment Hematology, vol. 88, no. 2, pp. 154–158, 2008. of childhood acute myeloblastic leukemia: dose inten- [30]Y.Y.Wang,G.B.Zhou,T.Yinetal.,“AML1-ETOandC-KIT sification improves outcome and maintenance therapy mutation/overexpression in t(8;21) leukemia: implication in is of no benefit—multicenter studies of the French stepwise leukemogenesis and response to Gleevec,” Proceed- LAME (Leucemie´ AigueMy¨ eloblastique´ Enfant) Cooperative ings of the National Academy of Sciences of the United States of Group,” Leukemia, vol. 19, no. 12, pp. 2082–2089, 2005. America, vol. 102, no. 4, pp. 1104–1109, 2005. [16] J. L. Wiemels, Z. Xiao, P. A. Buffler et al., “In utero origin [31] P. Paschka, G. Marcucci, A. S. Ruppert et al., “Adverse of t(8;21) AML1-ETO translocations in childhood acute prognostic significance of KIT mutations in adult acute myeloid leukemia,” Blood, vol. 99, no. 10, pp. 3801–3805, myeloid leukemia with inv(16) and t(8;21): a Cancer and 2002. Leukemia Group B study,” Journal of Clinical Oncology,vol. [17] K. M. LaFiura, D. M. Bielawski, N. C. Posecion et al., 24, no. 24, pp. 3904–3911, 2006. “Association between prenatal pesticide exposures and the [32] A. Shimada, T. Taki, K. Tabuchi et al., “KIT mutations, generation of leukemia-associated t(8;21),” Pediatric Blood and not FLT3 internal tandem duplication, are strongly and Cancer, vol. 49, no. 5, pp. 624–628, 2007. associated with a poor prognosis in pediatric acute myeloid [18] M. Manvelyan, P. Kempf, A. Weise et al., “Preferred co- leukemia with t(8;21): a study of the Japanese Childhood localization of chromosome 8 and 21 in myeloid bone AML Cooperative Study Group,” Blood, vol. 107, no. 5, pp. marrow cells detected by three dimensional molecular cyto- 1806–1809, 2006. genetics,” International Journal of Molecular Medicine, vol. 24, [33] N. Boissel, H. Leroy, B. Brethon et al., “Incidence and no. 3, pp. 335–341, 2009. prognostic impact of c-Kit, FLT3, and Ras gene mutations [19] M. Stuardo, M. Martinez, K. Hidalgo et al., “Altered chro- in core binding factor acute myeloid leukemia (CBF-AML),” matin modifications in AML1/RUNX1 breakpoint regions Leukemia, vol. 20, no. 6, pp. 965–970, 2006. involved in (8;21) translocation,” Journal of Cellular Physiol- [34] R. Cairoli, A. Beghini, G. Grillo et al., “Prognostic impact of ogy, vol. 218, no. 2, pp. 343–349, 2009. c-KIT mutations in core binding factor leukemias: an Italian [20]K.Liddiard,R.Hills,A.K.Burnett,R.L.Darley,and retrospective study,” Blood, vol. 107, no. 9, pp. 3463–3468, A. Tonks, “OGG1 is a novel prognostic indicator in acute 2006. Journal of Biomedicine and Biotechnology 17

[35] P. Paschka, J. Du, R. F. Schlenk et al., “Mutations in the of AML1-ETO associated neoplasia,” ASH Annual Meeting Fms-related tyrosine kinase 3 (FLT3) gene independently Abstracts, vol. 116, no. 21, 2010, abstract no. 4195. predict poor outcome in acute myeloid leukemia (AML) with [49]C.Schessl,V.P.S.Rawat,M.Cusanetal.,“TheAML1- t(8;21): a study of the outcome in acute myeloid leukemia ETOfusiongeneandtheFLT3lengthmutationcollaborate (AML) with t(8;21): a study of the German-Austrian AML in inducing acute leukemia in mice,” Journal of Clinical Study Group (AMLSG),” ASH Annual Meeting Abstracts,vol. Investigation, vol. 115, no. 8, pp. 2159–2168, 2005. 114, no. 22, 2009, abstract no 825. [50]F.-S.Chou,M.Wunderlich,A.Griesinger,andJ.C.Mulloy, [36]S.Schnittger,U.Bacher,W.Kern,T.Haferlach,andC. “N-RasG12D induces features of stepwise transformation in Haferlach, “JAK2V617F as progression marker in CMPD and preleukemic human umbilical cord blood cultures expressing as cooperative mutation in AML with trisomy 8 and t(8;21): the AML1-ETO fusion gene,” Blood, vol. 117, no. 7, pp. 2237– a comparative study on 1103 CMPD and 269 AML cases,” 2240, 2011. Leukemia, vol. 21, no. 8, pp. 1843–1845, 2007. [51]M.Hiwatari,T.Taki,M.Tsuchidaetal.,“Novelmissense [37] N. Sritana and C. U. Auewarakul, “KIT and FLT3 receptor mutations in the tyrosine kinase domain of the platelet- tyrosine kinase mutations in acute myeloid leukemia with derived growth factor receptor α (PDGFRA) gene in child- favorable cytogenetics: two novel mutations and selective hood acute myeloid leukemia with t(8;21) (q22;q22) or occurrence in leukemia subtypes and age groups,” Experi- inv(16) (p13q22) [10],” Leukemia, vol. 19, no. 3, pp. 476–477, mental and Molecular Pathology, vol. 85, no. 3, pp. 227–231, 2005. 2008. [52] H. Leroy, C. Roumier, P. Huyghe, V. Biggio, P. Fenaux, and [38]B.F.Goemans,CH.M.Zwaan,M.Milleretal.,“Mutations C. Preudhomme, “CEBPA point mutations in hematological in KIT and RAS are frequent events in pediatric core-binding malignancies,” Leukemia, vol. 19, no. 3, pp. 329–334, 2005. factor acute myeloid leukemia,” Leukemia, vol. 19, no. 9, pp. [53] P.Paschka, R. F. Schlenk, V.I. Gaidzik et al., “IDH1 and IDH2 1536–1542, 2005. mutations are frequent genetic alterations in acute myeloid [39]R.S.Care,P.J.M.Valk,A.C.Goodeveetal.,“Incidence leukemia and confer adverse prognosis in cytogenetically and prognosis of c-KIT and FLT3 mutations in core binding normal acute myeloid leukemia with NPM1 mutation with- factor (CBF) acute myeloid leukaemias,” British Journal of out FLT3 internal tandem duplication,” Journal of Clinical Haematology, vol. 121, no. 5, pp. 775–777, 2003. Oncology, vol. 28, no. 22, pp. 3636–3643, 2010. [40] J. A. Pollard, T. A. Alonzo, R. B. Gerbing et al., “Prevalence [54]T.J.Ley,L.Ding,M.J.Walteretal.,“DNMT3Amutationsin and prognostic significance of KIT mutations in pediatric acute myeloid leukemia,” New England Journal of Medicine, patients with core binding factor AML enrolled on serial vol. 363, no. 25, pp. 2424–2433, 2010. [55] S. A. Gustafson, P. Lin, S. U. S. Chen et al., “Therapy- pediatric cooperative trials for de novo AML,” Blood, vol. 115, related acute myeloid leukemia with t(8;21) (q22;q22) shares no. 12, pp. 2372–2379, 2010. many features with de novo acute myeloid leukemia with [41] S. Schnittger, T. M. Kohl, T. Haferlach et al., “KIT-D816 t(8;21)(q22;q22) but does not have a favorable outcome,” mutations in AML1-ETO-positive AML are associated with American Journal of Clinical Pathology, vol. 131, no. 5, pp. impaired event-free and overall survival,” Blood, vol. 107, no. 647–655, 2009. 5, pp. 1791–1799, 2006. [56] H. Chang, C. L. Chuang, and K. C. Hsien, “Therapy-related [42] K. Dohner,¨ J. Du, A. Corbacioglu, C. Scholl, R. F. Schlenk, acute myeloid leukemia after concurrent chemoradiotherapy and H. Dohner,¨ “JAK2V617F mutations as cooperative for esophageal cancer: report of two cases,” Tumori, vol. 95, genetic lesions in t(8;21)-positive acute myeloid leukemia,” no. 3, pp. 371–373, 2009. Haematologica, vol. 91, no. 11, pp. 1569–1570, 2006. [57] S. Owatari, M. Otsuka, K. Uozumi, T. Takeshita, and S. [43] K. Mrozek´ and C. D. Bloomfield, “Clinical significance of Hanada, “Two cases of secondary acute myeloid leukemia the most common chromosome translocations in adult acute accompanying adult T-cell leukemia/lymphoma,” Interna- myeloid leukemia,” Journal of the National Cancer Institute— tional Journal of Hematology, vol. 85, no. 1, pp. 32–35, 2007. Monographs, no. 39, pp. 52–57, 2008. [58]P.Erickson,J.Gao,K.S.Changetal.,“Identificationof [44] M. Urioste, A. Martınez-Ram´ ırez,J.C.Cigudosaetal.,´ breakpoints in t(8;21) acute myelogenous leukemia and “Identification of ins(8;21) with AML1/ETO fusion in acute isolation of a fusion transcript, AML1/ETO, with similarity myelogenous leukemia M2 by molecular cytogenetics,” Can- to Drosophila segmentation gene, runt,” Blood, vol. 80, no. 7, cer Genetics and Cytogenetics, vol. 133, no. 1, pp. 83–86, 2002. pp. 1825–1831, 1992. [45] D. A. Sweetser, A. J. Peniket, C. Haaland et al., “Delineation of [59] C. R. Dowdy, R. Xie, D. Frederick et al., “Definitive the minimal commonly deleted segment and identification of hematopoiesis requires Runx1 C-terminal-mediated sub- candidate tumor-suppressor genes in del(9q) acute myeloid nuclear targeting and transactivation,” Human Molecular leukemia,” Genes Chromosomes and Cancer, vol. 44, no. 3, pp. Genetics, vol. 19, no. 6, pp. 1048–1057, 2009. 279–291, 2005. [60]M.J.Plevin,J.Zhang,C.Guo,R.G.Roeder,andM.Ikura, [46]Z.Xiao,S.Liu,X.Liu,M.Yu,andY.Hao,“Tetraploidy “The acute myeloid leukemia fusion protein AML1-ETO or near-tetraploidy clones with double 8;21 translocation: a targets E proteins via a paired amphipathic helix-like TBP- non-random additional anomaly of acute myeloid leukemia associated factor homology domain,” Proceedings of the with t(8;21)(q22;q22),” Haematologica,vol.90,no.3,pp. National Academy of Sciences of the United States of America, 413–414, 2005. vol. 103, no. 27, pp. 10242–10247, 2006. [47] L. Y. Shih, D. C. Liang, C. F. Huang et al., “Cooperating [61] B. A. Hug and M. A. Lazar, “ETO interacting proteins,” mutations of receptor tyrosine kinases and Ras genes in Oncogene, vol. 23, no. 24, pp. 4270–4274, 2004. childhood core-binding factor acute myeloid leukemia and [62] S. K. Zaidi, C. R. Dowdy, A. J. Van Wijnen et al., “Altered a comparative analysis on paired diagnosis and relapse Runx1 subnuclear targeting enhances myeloid cell prolif- samples,” Leukemia, vol. 22, no. 2, pp. 303–307, 2008. eration and blocks differentiation by activating a miR- [48] H. J. Coppersmith, H.-G. Kimand, and C. Klug, “Differential 24/MKP-7/MAPK network,” Cancer Research, vol. 69, no. 21, contributions of c-kit activating mutations to promotion pp. 8249–8255, 2009. 18 Journal of Biomedicine and Biotechnology

[63] J. Wildonger and R. S. Mann, “The t(8;21) translocation [78] T. Corpora, L. Roudaia, M. Oo et al., “Structure of the AML1- converts AML1 into a constitutive transcriptional repressor,” ETO NHR3-PKA(RIIalpha) complex and its contribution to Development, vol. 132, no. 10, pp. 2263–2272, 2005. AML1-ETO activity,” Journal of Molecular Biology, vol. 402, [64] J. Qiu, J. Wong, D. J. Tweardy, and S. Dong, “Decreased no. 3, pp. 560–577, 2010. intranuclear mobility of acute myeloid leukemia 1- [79] S. Park, W. Chen, T. Cierpicki et al., “Structure of the containing fusion proteins is accompanied by reduced AML1-ETO eTAFH domain-HEB peptide complex and its mobility and compartmentalization of core binding factor contribution to AML1-ETO activity,” Blood, vol. 113, no. 15, β,” Oncogene, vol. 25, no. 28, pp. 3982–3993, 2006. pp. 3558–3567, 2009. [65] K. M. Lafiura, H. Edwards, J. W. Taub et al., “Identification [80] V. Ibanez,˜ A. Sharma, S. Buonamici et al., “AML1-ETO and characterization of novel AML1-ETO fusion transcripts decreases ETO-2 (MTG16) interactions with nuclear recep- in pediatric t(8;21) acute myeloid leukemia: a report from tor corepressor, an effect that impairs granulocyte differenti- the Children’s Oncology Group,” Oncogene, vol. 27, no. 36, ation,” Cancer Research, vol. 64, no. 13, pp. 4547–4554, 2004. pp. 4933–4942, 2008. [81]C.Wichmann,L.Chen,M.Heinrichetal.,“Targetingthe [66] M. Yan, E. Kanbe, L. F. Peterson et al., “A previously oligomerization domain of ETO interferes with RUNX1/ETO unidentified alternatively spliced isoform of t(8;21) tran- oncogenic activity in t(8;21)-positive leukemic cells,” Cancer script promotes leukemogenesis,” Nature Medicine, vol. 12, Research, vol. 67, no. 5, pp. 2280–2289, 2007. no. 8, pp. 945–949, 2006. [82] R. K. Vangala, M. S. Heiss-Neumann, J. S. Rangatia et al., [67] M. Yan, E. Y. Ahn, S. W. Hiebert, and D. E. Zhang, “The myeloid master regulator transcription factor PU.1 “RUNX1/AML1 DNA-binding domain and ETO/MTG8 is inactivated by AML1-ETO in t(8;21) myeloid leukemia,” NHR2-dimerization domain are critical to AML1-ETO9a Blood, vol. 101, no. 1, pp. 270–277, 2003. leukemogenesis,” Blood, vol. 113, no. 4, pp. 883–886, 2009. [83] O. Fuchs, D. Provaznikova, M. Kocova et al., “CEBPA poly- ff [68] O. Tsoulaki, G. Lacaudand, and V. Kousko , “Characterisa- morphisms and mutations in patients with acute myeloid tion of AML1-ETO9A leukaemiogenesis using an inducible leukemia, myelodysplastic syndrome, multiple myeloma and murine model,” Haematologica, vol. 95, no. s2, 2010, abstract non-Hodgkin’s lymphoma,” Blood Cells, Molecules, and Dis- no 0025. eases, vol. 40, no. 3, pp. 401–405, 2008. [69]T.Kozu,T.Fukuyama,T.Yamami,K.Akagi,andY.Kaneko, [84] J. J. Westendorf, C. M. Yamamoto, N. Lenny, J. R. Downing, “MYND-less splice variants of AML1-MTG8 (RUNX1- M.E.Selsted,andS.W.Hiebert,“Thet(8;21)fusion CBFA2T1) are expressed in leukemia with t(8;21),” Genes product, AML-1-ETO, associates with C/EBP-α, inhibits Chromosomes and Cancer, vol. 43, no. 1, pp. 45–53, 2005. C/EBP-α-dependent transcription, and blocks granulocytic [70] D. Mannari, D. Gascoyne, J. Dunne, T. Chaplin, and B. differentiation,” Molecular and Cellular Biology, vol. 18, no. Young, “A novel exon in AML1-ETO negatively influences 1, pp. 322–333, 1998. the clonogenic potential of the t(8;21) in acute myeloid [85] J. J. Rochford, R. K. Semple, M. Laudes et al., “ETO/MTG8 leukemia,” Leukemia, vol. 24, no. 4, pp. 891–894, 2010. is an inhibitor of C/EBPβ activity and a regulator of early [71] C. Khandanpour, C. Thiede, P. J. M. Valk et al., “Avariant adipogenesis,” Molecular and Cellular Biology, vol. 24, no. 22, allele of growth factor independence 1 (GFI1) is associated pp. 9863–9872, 2004. with acute myeloid leukemia,” Blood, vol. 115, no. 12, pp. 2462–2472, 2010. [86]J.M.Fortier,J.E.Payton,P.Cahan,T.J.Ley,M.J.Walter, [72] L. Roudaia, M. D. Cheney, E. Manuylova et al., “CBFβ is and T. A. Graubert, “POU4F1 is associated with t(8;21) critical for AML1-ETO and TEL-AML1 activity,” Blood,vol. acute myeloid leukemia and contributes directly to its unique 113, no. 13, pp. 3070–3079, 2009. transcriptional signature,” Leukemia, vol. 24, no. 5, pp. 950– [73] S. Liu, R. B. Klisovic, T. Vukosavljevic et al., “Targeting 957, 2010. AML1/ETO-histone deacetylase repressor complex: a novel [87] E. Tiacci, S. Pileri, A. Orleth et al., “PAX5 expression in mechanism for valproic acid-mediated gene expression and acute leukemias: higher B-lineage specificity than CD79a cellular differentiation in AML1/ETO-positive acute myeloid and selective association with t(8;21)-acute myelogenous leukemia cells,” Journal of Pharmacology and Experimental leukemia,” Cancer Research, vol. 64, no. 20, pp. 7399–7404, Therapeutics, vol. 321, no. 3, pp. 953–960, 2007. 2004. [74] R. Bakshi, S. K. Zaidi, S. Pande et al., “The leukemogenic [88] J. R. Valbuena, L. J. Medeiros, G. Z. Rassidakis et al., t(8;21) fusion protein AML1-ETO controls rRNA genes “Expression of B cell-specific activator protein/PAX5 in acute and associates with nucleolar-organizing regions at mitotic myeloid leukemia with t(8;21)(q22;q22),” American Journal chromosomes,” JournalofCellScience, vol. 121, no. 23, pp. of Clinical Pathology, vol. 126, no. 2, pp. 235–240, 2006. 3981–3990, 2008. [89] F. Fazi, S. Racanicchi, G. Zardo et al., “Epigenetic silenc- [75] E. Y. Ahn, M. Yan, O. A. Malakhova et al., “Disruption of ing of the myelopoiesis regulator microRNA-223 by the the NHR4 domain structure in AML1-ETO abrogates SON AML1/ETO oncoprotein,” Cancer Cell, vol. 12, no. 5, pp. 457– binding and promotes leukemogenesis,” Proceedings of the 466, 2007. National Academy of Sciences of the United States of America, [90]M.Xu,D.Li,Y.Lu,andG.Q.Chen,“LeukemogenicAML1- vol. 105, no. 44, pp. 17103–17108, 2008. ETO fusion protein increases carcinogen-DNA adduct for- [76] S. Liu, T. Shen, L. Huynh et al., “Interplay of RUNX1/MTG8 mation with upregulated expression of cytochrome P450- and DNA methyltransferase 1 in acute myeloid leukemia,” 1A1 gene,” Experimental Hematology, vol. 35, no. 8, pp. 1249– Cancer Research, vol. 65, no. 4, pp. 1277–1284, 2005. 1255, 2007. [77]D.Osman,V.Gobert,F.Ponthan,O.Heidenreich,M. [91] O. Krejci, M. Wunderlich, H. Geiger et al., “P53 signaling Haenlin, and L. Waltzer, “A Drosophila model identifies in response to increased DNA damage sensitizes AML1-ETO calpains as modulators of the human leukemogenic fusion cells to stress-induced death,” Blood, vol. 111, no. 4, pp. 2190– protein AML1-ETO,” Proceedings of the National Academy of 2199, 2008. Sciences of the United States of America, vol. 106, no. 29, pp. [92] K. L. Rhoades, C. J. Hetherington, J. D. Rowley et al., 12043–12048, 2009. “Synergistic up-regulation of the myeloid-specific promoter Journal of Biomedicine and Biotechnology 19

for the macrophage colony-stimulating factor receptor by [106] B. Foss, T. Hervig, and Ø. Bruserud, “Connexins are active AML1 and the t(8;21) fusion protein may contribute to participants of hematopoietic stem cell regulation,” Stem leukemogenesis,” Proceedings of the National Academy of Cells and Development, vol. 18, no. 6, pp. 807–812, 2009. Sciences of the United States of America, vol. 93, no. 21, pp. [107] B. Foss, K. J. Tronstad, and Ø. Bruserud, “Connexin-based 11895–11900, 1996. signaling in acute myelogenous leukemia (AML),” Biochimica [93] K. Shimizu, I. Kitabayashi, N. Kamada et al., “AML1-MTG8 et Biophysica Acta, vol. 1798, no. 1, pp. 1–8, 2010. leukemic protein induces the expression of granulocyte [108] A. J. Okumura, L. F. Peterson, F. Okumura, A. Boyapati, and colony-stimulating factor (G-CSF) receptor through the up- D. E. Zhang, “T(8;21)(q22;q22) fusion proteins preferentially regulation of CCAAT/enhancer binding protein epsilon,” bind to duplicated AML1/RUNX1 DNA-binding sequences Blood, vol. 96, no. 1, pp. 288–296, 2000. to differentially regulate gene expression,” Blood, vol. 112, no. [94]L.Klampfer,J.Zhang,A.O.Zelenetz,H.Uchida,and 4, pp. 1392–1401, 2008. S. D. Nimer, “The AML1/ETO fusion protein activates [109] S. Rossetti, A. T. Hoogeveen, P. Liang, C. Stanciu, P. van transcription of BCL-2,” Proceedings of the National Academy der Spek, and N. Sacchi, “A distinct epigenetic signature at of Sciences of the United States of America, vol. 93, no. 24, pp. targets of a leukemia protein,” BMC Genomics,vol.8,article 14059–14064, 1996. 38, 2007. [95] G. Yang, W. Khalaf, L. Van De Locht et al., “Transcriptional [110] P. C. Rodrigues, S. N. Oliveira, M. B. Viana et al., “Prognostic repression of the neurofibromatosis-1 tumor suppressor by significance of WT1 gene expression in pediatric acute the t(8;21) fusion protein,” Molecular and Cellular Biology, myeloid leukemia,” Pediatric Blood and Cancer, vol. 49, no. vol. 25, no. 14, pp. 5869–5879, 2005. 2, pp. 133–138, 2007. [96] J. C. Mulloy, V. Jankovic, M. Wunderlich et al., “AML1- [111] M. Y. Balkhi, A. K. Trivedi, M. Geletu et al., “Proteomics ETO fusion protein up-regulates TRKA mRNA expression in of acute myeloid leukaemia: cytogenetic risk groups dif- human CD34+ cells, allowing nerve growth factor-induced fer specifically in their proteome, interactome and post- expansion,” Proceedings of the National Academy of Sciences of translational protein modifications,” Oncogene,vol.25,no. the United States of America, vol. 102, no. 11, pp. 4016–4021, 53, pp. 7041–7058, 2006. 2005. [112] A. Hiramatsu, H. Miwa, M. Shikami et al., “Disease-specific [97] L. F. Peterson, M. Yan, and D. E. Zhang, “The p21 pathway expression of VEGF and its receptors in AML cells: possible is involved in blocking leukemogenesis by the t(8;21) fusion autocrine pathway of VEGF/type1 receptor of VEGF in protein AML1-ETO,” Blood, vol. 109, no. 10, pp. 4392–4398, t(15;17) AML and VEGF/type2 receptor of VEGF in t(8;21) 2007. AML,” Leukemia and Lymphoma, vol. 47, no. 1, pp. 89–95, [98] X. I. Li, Y. A. B. Xu, Q. Wang et al., “Leukemogenic AML1- 2006. ETO fusion protein upregulates expression of connexin 43: [113] S. Dias, K. Hattori, Z. Zhu et al., “Autocrine stimulation theroleinAML1-ETO-inducedgrowtharrestinleukemic of VEGFR-2 activates human leukemic cell growth and cells,” Journal of Cellular Physiology, vol. 208, no. 3, pp. 594– migration,” Journal of Clinical Investigation, vol. 106, no. 4, 601, 2006. pp. 511–521, 2000. [99] B. A. Guinn, A. Mohamedali, K. I. Mills et al., “Leukemia [114] N. Imai, H. Miwa, M. Shikami et al., “Growth inhibition associated antigens: their dual role as biomarkers and of AML cells with specific chromosome abnormalities by immunotherapeutic targets for acute myeloid leukemia,” monoclonal antibodies to receptors for vascular endothelial Biomark Insights, vol. 2, pp. 69–79, 2007. [100] A. Boyapati, M. Yan, L. F. Peterson, J. R. Biggs, M. M. Le growth factor,” Leukemia Research, vol. 33, no. 12, pp. 1650– Beau, and D. E. Zhang, “Aleukemia fusion protein attenuates 1657, 2009. the spindle checkpoint and promotes aneuploidy,” Blood,vol. [115] N. Imai, M. Shikami, H. Miwa et al., “t(8;21) acute myeloid 109, no. 9, pp. 3963–3971, 2007. leukaemia cells are dependent on vascular endothelial growth [101] Y. Tabe, L. Jin, R. Contractor et al., “Novel role of HDAC factor (VEGF)/VEGF receptor type2 pathway and phospho- inhibitors in AML1/ETO AML cells: activation of apoptosis rylation of Akt,” British Journal of Haematology, vol. 135, no. and phagocytosis through induction of annexin A1,” Cell 5, pp. 673–682, 2006. Death and Differentiation, vol. 14, no. 8, pp. 1443–1456, 2007. [116] M. Alcalay, N. Meani, V. Gelmetti et al., “Acute myeloid [102] F. H. Gao, Q. Wang, Y. L. Wu, XI. Li, KE. W. Zhao, and leukemia fusion proteins deregulate genes involved in stem G. Q. Chen, “c-Jun N-terminal kinase mediates AML1-ETO cell maintenance and DNA repair,” Journal of Clinical protein-induced connexin-43 expression,” Biochemical and Investigation, vol. 112, no. 11, pp. 1751–1761, 2003. Biophysical Research Communications, vol. 356, no. 2, pp. [117] E. Ersvaer, K. Hatfield, H. Reikvam, and O. Bruserud, “Future 505–511, 2007. perspectives: therapeutic targeting of NOTCH signalling [103] S. J. Erkeland, K. K. Palande, M. Valkhof, J. Gits, A. D. V. may become a strategy in patients receiving stem cell Oorschot, and I. P. Touw, “The gene encoding thioredoxin- transplantation for hematologic malignancies,” Bone Marrow interacting protein (TXNIP) is a frequent virus integration Research, vol. 2011, Article ID 570796, 2011. site in virus-induced mouse leukemia and is overexpressed in [118] N. Martinez, B. Drescher, H. Riehle et al., “The oncogenic a subset of AML patients,” Leukemia Research, vol. 33, no. 10, fusion protein RUNX1-CBFA2T1 supports proliferation and pp. 1367–1371, 2009. inhibits senescence in t(8;21)-positive leukaemic cells,” BMC [104] M. Shikami, H. Miwa, K. Nish II et al., “Low p53 expression Cancer, vol. 4, article 44, 2004. of acute myelocytic leukemia cells with t(8;21) chromosome [119] H. Ichikawa, K. Tanabe, H. Mizushima et al., “Common gene abnormality: association with low p14 expression,” Leukemia expression signatures in t(8;21)- and inv(16)-acute myeloid Research, vol. 30, no. 4, pp. 379–383, 2006. leukaemia,” British Journal of Haematology, vol. 135, no. 3, [105] S. A. Sinenko, T. Hung, T. Moroz et al., “Genetic manipu- pp. 336–347, 2006. lation of AML1-ETO-induced expansion of hematopoietic [120] H. Dohner,¨ E. H. Estey, S. Amadori et al., “Diagnosis precursors in a Drosophila model,” Blood, vol. 116, no. 22, and management of acute myeloid leukemia in adults: pp. 4612–4620, 2010. recommendations from an international expert panel, on 20 Journal of Biomedicine and Biotechnology

behalf of the European LeukemiaNet,” Blood, vol. 115, no. 3, [134] D. A. Arber, C. Glackin, G. Lowe, L. J. Medeiros, and M. L. pp. 453–474, 2010. Slovak, “Presence of t(8;21)(q22;q22) in myeloperoxidase- [121] D. Rowe, S. J. Cotterill, F. M. Ross et al., “Cytogenetically positive, myeloid surface antigen-negative acute myeloid cryptic AML1—ETO and CBFβ—MYH11 gene rearrange- leukemia,” American Journal of Clinical Pathology, vol. 107, ments: incidence in 412 cases of acute myeloid leukaemia,” no. 1, pp. 68–73, 1997. British Journal of Haematology, vol. 111, no. 4, pp. 1051– [135] J. Zheng, X. Wang, Y. U. Hu et al., “A correlation study 1056, 2000. of immunophenotypic, cytogenetic, and clinical features of [122] J. E. Sarriera, M. Albitar, Z. Estrov et al., “Comparison 180 AML patients in China,” Cytometry Part B—Clinical of outcome in acute myelogenous leukemia patients with Cytometry, vol. 74, no. 1, pp. 25–29, 2008. translocation (8;21) found by standard cytogenetic analysis [136] J. De, R. Zanjani, M. Hibbard, and B. H. Davis, and patients with AML1/ETO fusion transcript found only “Immunophenotypic profile predictive off KIT activating by PCR testing,” Leukemia, vol. 15, no. 1, pp. 57–61, 2001. mutations in AML1-ETO leukemia,” American Journal of [123] F. Weerkamp, E. Dekking, Y. Y. Ng et al., “Flow cytometric Clinical Pathology, vol. 128, no. 4, pp. 550–557, 2007. immunobead assay for the detection of BCR-ABL fusion [137] S. A. Pileri, S. Ascani, M. C. Cox et al., “Myeloid sarcoma: proteins in leukemia patients,” Leukemia,vol.23,no.6,pp. clinico-pathologic, phenotypic and cytogenetic analysis of 92 1106–1117, 2009. adult patients,” Leukemia, vol. 21, no. 2, pp. 340–350, 2007. [124] E. De Braekeleer, N. Douet-Guilbert, F. Morel, M.-J. Le Bris, [138] R. S. Neiman, M. Barcos, and C. Berard, “Granulocytic C. Ferec,´ and M. De Braekeleer, “RUNX1 translocations and sarcoma: a clinicopathologic study of 61 biopsied cases,” fusion genes in malignant hemopathies,” Future Oncology, Cancer, vol. 48, no. 6, pp. 1426–1437, 1981. vol. 7, no. 1, pp. 77–91, 2011. [139] P. D. Kottaridis, N. Ketley, K. Peggs et al., “An unusual [125] B. T. Gjertsen, A. M. Øyan, B. Marzolf et al., “Analysis of acute case of intrapulmonary granulocytic sarcoma presenting as myelogenous leukemia: preparation of samples for genomic interstitial pneumonitis following allogeneic bone marrow and proteomic analyses,” Journal of Hematotherapy and Stem transplantation for acute myeloid leukaemia and responding Cell Research, vol. 11, no. 3, pp. 469–481, 2002. to donor lymphocyte infusion,” Bone Marrow Transplanta- [126] Ø. Bruserud, G. Tjønnfjord, B. T. Gjertsen, B. Foss, and P. tion, vol. 24, no. 7, pp. 807–809, 1999. Ernst, “New strategies in the treatment of acute myelogenous [140] P. Chevallier, M. Mohty, B. Lioure et al., “Allogeneic leukemia: mobilization and transplantation of autologous hematopoietic stem-cell transplantation for myeloid sar- peripheral blood stem cells in adult patients,” Stem Cells,vol. coma: a retrospective study from the SFGM-TC,” Journal of 18, no. 5, pp. 343–351, 2000. Clinical Oncology, vol. 26, no. 30, pp. 4940–4943, 2008. [127] D. Rowe, N. P. Bown, M. Albitar, and E. Estey, “Diagnostic [141] A. M. Tsimberidou, H. M. Kantarjian, S. Wen et al., “Myeloid detection of AML1/ETO gene fusion by polymerase chain sarcoma is associated with superior event-free survival and reaction,” Leukemia, vol. 16, no. 8, pp. 1576–1577, 2002. overallsurvivalcomparedwithacutemyeloidleukemia,” [128] J. J.M. Van Dongen, E. A. Macintyre, J. A. Gabert et al., Cancer, vol. 113, no. 6, pp. 1370–1378, 2008. “Standardized RT-PCR analysis of fusion gene transcripts [142] N. Colovic,´ M. Colovic,´ V. Cemerikicetal.,“Granulocytic´ from chromosome aberrations in acute leukemia for detec- sarcoma of the brain in a patient with acute myeloid tion of minimal residual disease. Report of the BIOMED-1 leukemia,” Acta chirurgica Iugoslavica., vol. 51, no. 3, pp. 129– Concerted Action: investigation of minimal residual disease 131, 2004. in acute leukemia,” Leukemia, vol. 13, no. 12, pp. 1901–1928, 1999. [143] E. M. Al-Sobbi, T. M. Jeha, and M. I. Al-Taher, “Granulocytic [129] J. Gabert, E. Beillard, V. H.J. van der Velden et al., “Standard- sarcoma causing cord compression in a pregnant woman ization and quality control studies of ’real time’ quantitative with acute myeloid leukemia and t(8;21),” Saudi Medical reverse transcriptase polymerase chain reaction of fusion Journal, vol. 29, no. 11, pp. 1658–1661, 2008. gene transcripts for residual disease detection in leukemia—a [144] H. Tamaki, S. Yoshihara, T. Fujioka, M. Kawakami, Y. Europe Against Cancer Program,” Leukemia, vol. 17, no. 12, Oka, and H. Ogawa, “Molecular detection of AML1-MTG8- pp. 2318–2357, 2003. positive cells in peripheral blood from a patient with isolated [130] K. Tobal and J. A. Liu Yin, “Diagnosis and monitoring extramedullary relapse of t(8;21) acute myeloid leukemia,” of AML1-MTG8 (ETO)-positive acute myeloid leukemia by Leukemia, vol. 23, no. 2, pp. 424–426, 2009. qualitative and real-time quantitative RT-PCR,” Methods in [145] K. F. Wong, L. L. P. Siu, and W. S. Wong, “Aleukaemic molecular medicine., vol. 125, pp. 149–161, 2006. acute myeloid leukaemia with t(8;21)(q22;q22): images in [131] H. B. Ommen, M. Østergaard, M. Yan, K. Brændstrup, D. E. haematology,” British Journal of Haematology, vol. 146, no. Zhang, and P. Hokland, “Persistent altered fusion transcript 4, p. 345, 2009. splicing identifies RUNX1-RUNX1T1+ AML patients likely [146] E. Jost, J. Lorenzen, P. Haage et al., “Heart and muscle to relapse,” European Journal of Haematology,vol.84,no.2, involvement by extra-medullary myeloid leukemia: a case pp. 128–132, 2010. report and review of the literature,” Leukemia and Lym- [132] N. Pallisgaard, P. Hokland, D. C. Riishøj, B. Pedersen, and phoma, vol. 46, no. 12, pp. 1819–1824, 2005. P. Jørgensen, “Multiplex reverse transcription-polymerase [147] M. S. Felice, P. A. Zubizarreta, E. M. Alfaro et al., “Good chain reaction for simultaneous screening of 29 translo- outcome of children with acute myeloid leukemia and cations and chromosomal aberrations in acute leukemia,” t(8;21)(q22;q22), even when associated with granulocytic Blood, vol. 92, no. 2, pp. 574–588, 1998. sarcoma: a report from a single institution in Argentina,” [133] D. A. Lee, C. P. Harris, V. M. Gresik, P. Rao, and C. C. Cancer, vol. 88, no. 8, pp. 1939–1944, 2000. Lau, “Granulocytic sarcoma presenting as pneumonia in a [148] S. T. Pullarkat, V. Pullarkat, S. H. Kroft et al., “Systemic child with t(8;21) acute myelogenous leukemia: diagnosis mastocytosis associated with t(8;21)(q22;q22) acute myeloid by flourescent in situ hybridization,” Journal of Pediatric leukemia,” Journal of Hematopathology,vol.2,no.1,pp.27– Hematology/Oncology, vol. 26, no. 7, pp. 431–434, 2004. 33, 2009. Journal of Biomedicine and Biotechnology 21

[149] V. Pullarkat, V. Bedell, Y. Kim et al., “Neoplastic mast cells in [164] K. Liseth, E. Ersvaer, T. Hervig, and Ø. Bruserud, “Combi- systemic mastocytosis associated with t(8;21) acute myeloid nation of intensive chemotherapy and anticancer vaccines leukemia are derived from the leukemic clone,” Leukemia in the treatment of human malignancies: the hematological Research, vol. 31, no. 2, pp. 261–265, 2007. experience,” Journal of Biomedicine and Biotechnology,vol. [150] W. R. Sperr, J. Drach, A. W. Hauswirth et al., “Myelomas- 2010, Article ID 692097, 2010. tocytic leukemia: evidence for the origin of mast cells from [165] A. Pang, W. Y. Au, and Y. L. Kwong, “Caveolin-1 gene is the leukemic clone and eradication by allogeneic stem cell coordinately regulated with the multidrug resistance 1 gene transplantation,” Clinical Cancer Research,vol.11,no.19I, in normal and leukemic bone marrow,” Leukemia Research, pp. 6787–6792, 2005. vol. 28, no. 9, pp. 973–977, 2004. [151] S. T. Pullarkat, F. Sedarat, R. Paquette, and J. Said, “Systemic [166] C. Stoeckle, C. Gouttefangeas, M. Hammer, E. Weber, A. mastocytosis with plasma cell dyscrasia: report of a case,” Melms, and E. Tolosa, “Cathepsin W expressed exclusively Leukemia Research, vol. 32, no. 7, pp. 1160–1163, 2008. in CD8+ T cells and NK cells, is secreted during target cell killing but is not essential for cytotoxicity in human CTLs,” [152] R. Cairoli, C. B. Ripamonti, A. Beghini et al., “Total serum Experimental Hematology, vol. 37, no. 2, pp. 266–275, 2009. tryptase: a predictive marker for KIT mutation in acute [167] T. Park, . Zong Ping Chen, and J. Leavitt, “Activation of the myeloid leukemia,” Leukemia Research,vol.33,no.9,pp. leukocyte plastin gene occurs in most human cancer cells,” 1282–1284, 2009. Cancer Research, vol. 54, no. 7, pp. 1775–1781, 1994. [153] E. McCormack, O. Bruserud, and B. T. Gjertsen, “Review: [168] P. Silacci, L. Mazzolai, C. Gauci, N. Stergiopulos, H. L. Yin, genetic models of acute myeloid leukaemia,” Oncogene,vol. and D. Hayoz, “Gelsolin superfamily proteins: key regulators 27, no. 27, pp. 3765–3779, 2008. of cellular functions,” Cellular and Molecular Life Sciences, [154] Y. Yuan, L. Zhou, T. Miyamoto et al., “AML1-ETO expression vol. 61, no. 19-20, pp. 2614–2623, 2004. is directly involved in the development of acute myeloid [169] G. Neufeld and O. Kessler, “The semaphorins: versatile leukemia in the presence of additional mutations,” Proceed- regulators of tumour progression and tumour angiogenesis,” ings of the National Academy of Sciences of the United States of Nature Reviews Cancer, vol. 8, no. 8, pp. 632–645, 2008. America, vol. 98, no. 18, pp. 10398–10403, 2001. [170] M. Jongen-Lavrencic, S. U. M. Sun, M. K. Dijkstra, P. J. M. [155] L. Bullinger, K. Dohner,¨ E. Bair et al., “Use of gene-expression Valk, and B. Lowenberg,¨ “MicroRNA expression profiling profiling to identify prognostic subclasses in adult acute in relation to the genetic heterogeneity of acute myeloid myeloid leukemia,” The New England Journal of Medicine,vol. leukemia,” Blood, vol. 111, no. 10, pp. 5078–5085, 2008. 350, no. 16, pp. 1605–1616, 2004. [171] Z. Li, J. Lu, M. Sun et al., “Distinct microRNA expression profiles in acute myeloid leukemia with common transloca- [156] B. G. Miller and J. A. Stamatoyannopoulos, “Integrative tions,” Proceedings of the National Academy of Sciences of the meta-analysis of differential gene expression in acute myeloid United States of America, vol. 105, no. 40, pp. 15535–15540, leukemia,” PLoS ONE, vol. 5, Article ID e9466, 2010. 2008. [157] R. G. W. Verhaak, B. J. Wouters, C. A. J. Erpelinck et al., [172] L. Pedranzini, F. Mottadelli, S. Ronzoni et al., “Differential “Prediction of molecular subtypes in acute myeloid leukemia cytogenomics and miRNA signature of the Acute Myeloid based on gene expression profiling,” Haematologica, vol. 94, Leukaemia Kasumi-1 cell line CD34(+)38(-) compartment,” no. 1, pp. 131–134, 2009. Leukemia Research, vol. 34, no. 10, pp. 1287–1295, 2010. [158] S. C. Luck,¨ A. C. Russ, J. Du et al., “KIT mutations confer [173] M. Esteller, “Molecular origins of cancer: epigenetics in a distinct gene expression signature in core binding factor cancer,” The New England Journal of Medicine, vol. 358, no. leukaemia: research paper,” British Journal of Haematology, 11, pp. 1148–1096, 2008. vol. 148, no. 6, pp. 925–937, 2010. [174] L. Bullinger, M. Ehrich, K. Dohner¨ et al., “Quantitative [159] H. Reikvam, A. M. Olsnes, B. T. Gjertsen, E. Ersvar, and DNA methylation predicts survival in adult acute myeloid O. Bruserud, “Nuclear factor-B signaling: a contributor in leukemia,” Blood, vol. 115, no. 3, pp. 636–642, 2010. leukemogenesis and a target for pharmacological interven- [175] M. E. Figueroa, S. Lugthart, Y. Li et al., “DNA methylation tion in human acute myelogenous leukemia,” Critical Reviews signatures identify biologically distinct subtypes in acute in Oncogenesis, vol. 15, no. 1-2, pp. 1–41, 2009. myeloid leukemia,” Cancer Cell, vol. 17, no. 1, pp. 13–27, [160] L. Bullinger, F. G. Rucker,¨ S. Kurz et al., “Gene-expression 2010. profiling identifies distinct subclasses of core binding factor [176] S. Alvarez, J. Suela, A. Valencia et al., “DNA methylation acute myeloid leukemia,” Blood, vol. 110, no. 4, pp. 1291– profiles and their relationship with cytogenetic status in adult 1300, 2007. acute myeloid leukemia,” PLoS ONE, vol. 5, no. 8, 2010. [177] C. Muller-Tidow,¨ H.-U. Klein, A. Hascher et al., “Profiling of [161] H. Reikvam, K. Hatfield, E. Ersvaer, A. Ryningen, and histone H3 lysine 9 trimethylation levels predicts transcrip- Ø. Bruserud, “Pharmacological targeting of the PI3K- tion factor activity and survival in acute myeloid leukemia,” AKT/PKB-mTOR pathway alters local angioregulation in Blood, vol. 116, no. 18, pp. 3564–3571, 2010. acute myelogenous leukemia,” Haematologica, vol. 95, no. s2, [178] H. Narimatsu, T. Yokozawa, H. Iida et al., “Clinical charac- 2010, abstract no 0634. teristics and outcomes in patients with t(8;21) acute myeloid [162] K. T. Doepfner, D. Boller, and A. Arcaro, “Targeting receptor leukemia in Japan,” Leukemia, vol. 22, no. 2, pp. 428–432, tyrosine kinase signaling in acute myeloid leukemia,” Critical 2008. Reviews in Oncology/Hematology, vol. 63, no. 3, pp. 215–230, [179] P. Lin, L. Chen, R. Luthra, S. N. Konoplev, X. Wang, 2007. and L. J. Medeiros, “Acute myeloid leukemia harboring [163] S. Paydas, K. Tanriverdi, S. Yavuz, U. Disel, F. Baslamisli, t(8;21)(q22;q22): a heterogeneous disease with poor out- and R. Burgut, “PRAME mRNA levels in cases with acute come in a subset of patients unrelated to secondary cytoge- leukemia: clinical importance and future prospects,” Amer- netic aberrations,” Modern Pathology, vol. 21, no. 8, pp. 1029– ican Journal of Hematology, vol. 79, no. 4, pp. 257–261, 2005. 1036, 2008. 22 Journal of Biomedicine and Biotechnology

[180] S. Nguyen, T. Leblanc, P. Fenaux et al., “A white blood cell [192] Ø. Bruserud, C. Stapnes, E. Ersvær, B. T. Gjertsen, and A. index as the main prognostic factor in t(8;21) acute myeloid Ryningen, “Histone deacetylase inhibitors in cancer treat- leukemia (AML): a survey of 161 cases from the French AML ment: a review of the clinical toxicity and the modulation intergroup,” Blood, vol. 99, no. 10, pp. 3517–3523, 2002. of gene expression in cancer cells,” Current Pharmaceutical [181] J. J. Cornelissen, W. L. J. Van Putten, L. F. Verdonck et Biotechnology, vol. 8, no. 6, pp. 388–400, 2007. al., “Results of a HOVON/SAKK donor versus no-donor [193] A. Ryningen, C. Stapnes, K. Paulsen, P. Lassalle, B. T. Gjert- analysis of myeloablative HLA-identical sibling stem cell sen, and Ø. Bruserud, “In vivo biological effects of ATRA transplantation in first remission acute myeloid leukemia in in the treatment of AML,” Expert Opinion on Investigational young and middle-aged adults: benefits for whom?” Blood, Drugs, vol. 17, no. 11, pp. 1623–1633, 2008. vol. 109, no. 9, pp. 3658–3666, 2007. [194] Z. Chen, Y. Wang, W. Wang, J. Gong, and Y. Xue, “All-trans [182] H.-J. Shin, J. Chung, H. J. Kim et al., “Bone marrow retinoic acid as a single agent induces complete remission in cellularity is a single most important independent prognostic a patient with acute leukemia of M subtype,” Chinese Medical factor in AML patients with t(8;21),” ASH Annual Meeting Journal, vol. 115, no. 1, pp. 58–61, 2002. Abstracts, vol. 116, no. 21, 2010, abstract no 1707. [195] R. S. Abreu E Lima, M. Rozera Baruffi,A.S.GouveiaDeLima α [183] C. J. Harrison, R. K. Hills, A. V. Moorman et al., “Cytogenet- et al., “The co-expression of PML/RAR and AML1/ETO ics of childhood acute myeloid leukemia: United Kingdom fusion genes is associated with ATRA resistance,” British Medical Research Council Treatment Trials AML 10 and 12,” Journal of Haematology, vol. 128, no. 3, pp. 407–409, 2005. Journal of Clinical Oncology, vol. 28, no. 16, pp. 2674–2681, [196] R. Kusec, K. Laczika, P. Knobl¨ et al., “AML1/ETO fusion 2010. mRNA can be detected in remission blood samples of all patients with t(8;21) acute myeloid leukemia after [184] C. Von Neuhoff,D.Reinhardt,A.Sanderetal.,“Prognostic chemotherapy or autologous bone marrow transplantation,” impact of specific chromosomal aberrations in a large group Leukemia, vol. 8, no. 5, pp. 735–739, 1994. of pediatric patients with acute myeloid leukemia treated uniformly according to trial AML-BFM 98,” Journal of [197] T. Miyamoto, K. Nagafuji, K. Akashi et al., “Persistence of Clinical Oncology, vol. 28, no. 16, pp. 2682–2689, 2010. multipotent progenitors expressing AML1/ETO transcripts in long-term remission patients with t(8;21) acute myeloge- [185] F. O. Smith, T. A. Alonzo, R. B. Gerbing, W. G. Woods, and R. nous leukemia,” Blood, vol. 87, no. 11, pp. 4789–4796, 1996. J. Arceci, “Long-term results of children with acute myeloid [198] G. Nucifora, R. A. Larson, and J. D. Rowley, “Persistence leukemia: a report of three consecutive Phase III trials by of the 8;21 translocation in patients with acute myeloid the Children’s Cancer Group: CCG 251, CCG 213 and CCG leukemia type M2 in long-term remission,” Blood, vol. 82, no. 2891,” Leukemia, vol. 19, no. 12, pp. 2054–2062, 2005. 3, pp. 712–715, 1993. ff [186] N. Entz-Werle, S. Suciu, J. van der Wer ten Bosch et al., [199] M. J. Saunders, K. Tobal, and J. A. Liu Yin, “Detection of “Results of 58872 and 58921 trials in acute myeloblastic t(8;21) by reverse transcriptase polymerase chain reaction leukemia and relative value of chemotherapy vs allogeneic in patients in remission of acute myeloid leukaemia type bone marrow transplantation in first complete remission: the M2 after chemotherapy or bone marrow transplantation,” EORTC Children Leukemia Group report,” Leukemia,vol. Leukemia Research, vol. 18, no. 12, pp. 891–895, 1994. 19, no. 12, pp. 2072–2081, 2005. [200] J. Jurlander, M. A. Caligiuri, T. Ruutu et al., “Persistence [187] Y. Kuwatsuka, K. Miyamura, R. Suzuki et al., “Hematopoietic of the AML1/ETO fusion transcript in patients treated stem cell transplantation for core binding factor acute with allogeneic bone marrow transplantation for t(8;21) ff myeloid leukemia: T(8;21) and inv(16) represent di erent leukemia,” Blood, vol. 88, no. 6, pp. 2183–2191, 1996. clinical outcomes,” Blood, vol. 113, no. 9, pp. 2096–2103, [201] S. Schnittger, M. Weisser, C. Schoch, W. Hiddemann, T. 2009. Haferlach, and W. Kern, “New score predicting for prognosis [188] N.-C. Gorin, M. Labopin, F. Frassoni et al., “Identi- in PML-RARA+, AML1-ETO+, or CBFB-MYH11 acute cal outcome after autologous or allogeneic genoidentical myeloid leukemia based on quantification of fusion tran- hematopoietic stem-cell transplantation in first remission of scripts,” Blood, vol. 102, no. 8, pp. 2746–2755, 2003. acute myelocytic leukemia carrying inversion 16 or t(8;21): [202] H. Leroy, S. de Botton, N. Gradel-Duflos et al., “Prognostic a retrospective study from the European Cooperative Group value of real-time quantitative PCR (RQ-PCR) in AML with for Blood and Marrow Transplantation,” Journal of Clinical t(8;21),” Leukemia, vol. 19, no. 3, pp. 367–372, 2005. Oncology, vol. 26, no. 19, pp. 3183–3188, 2008. [203] H. B. Ommen, S. Schnittger, J. V. Jovanovic et al., [189] R. F. Schlenk, M. C. Pasquini, W. S. Perez´ et al., “HLA- “Strikingly different molecular relapse kinetics in NPM1c, identical sibling allogeneic transplants versus chemotherapy PML-RARA, RUNX1-RUNX1T1, and CBFB-MYH11 acute in acute myelogenous leukemia with t(8;21) in first complete myeloid leukemias,” Blood, vol. 115, no. 2, pp. 198–205, 2010. remission: collaborative study between the German AML [204] A. Al-Mawali, D. Gillis, and I. Lewis, “The role of multipa- Intergroup and CIBMTR,” Biology of Blood and Marrow rameter flow cytometry for detection of minimal residual Transplantation, vol. 14, no. 2, pp. 187–196, 2008. disease in acute myeloid leukemia,” American Journal of [190] H. J. Shin, H. J. Kim, S. K. Sohn et al., “Re-analysis of Clinical Pathology, vol. 131, no. 1, pp. 16–26, 2009. the outcomes of post-remission therapy for acute myeloid [205] G. Perea, A. Lasa, A. Aventın´ et al., “Prognostic value of leukemia with core binding factor according to years of minimal residual disease (MRD) in acute myeloid leukemia patient enrollment,” Japanese journal of clinical oncology,vol. (AML) with favorable cytogenetics [t(8;21) and inv(16)],” 40, no. 6, pp. 556–566, 2010. Leukemia, vol. 20, no. 1, pp. 87–94, 2006. [191] J. M. Foran, “New prognostic markers in acute myeloid [206] M. C. Cox, P. Panetta, A. Venditti et al., “Comparison leukemia: perspective from the clinic,” Hematology American between conventional banding analysis and FISH screening Society of Hematology Education Program, vol. 2010, no. 1, pp. with an AML-specific set of probes in 260 patients,” Hema- 47–55, 2010. tology Journal, vol. 4, no. 4, pp. 263–270, 2003. Journal of Biomedicine and Biotechnology 23

[207] U. Bacher, W. Kern, C. Schoch, S. Schnittger, W. Hiddemann, and T. Haferlach, “Evaluation of complete disease remission in acute myeloid leukemia: a prospective study based on cyto- morphology, interphase fluorescence in situ hybridization, and immunophenotyping during follow-up in patients with acute myeloid leukemia,” Cancer, vol. 106, no. 4, pp. 839–847, 2006. [208] G. H. Vance, H. Kim, G. A. Hicks et al., “Utility of interphase FISH to stratify patients into cytogenetic risk categories at diagnosis of AML in an Eastern Cooperative Oncology Group (ECOG) clinical trial (E1900),” Leukemia Research, vol. 31, no. 5, pp. 605–609, 2007. [209] D. Grimwade, J. V. Jovanovic, R. K. Hills et al., “Prospective minimal residual disease monitoring to predict relapse of acute promyelocytic leukemia and to direct pre-emptive arsenic trioxide therapy,” Journal of Clinical Oncology, vol. 27, no. 22, pp. 3650–3658, 2009. [210] J. Esteve, L. Escoda, G. Martın´ et al., “Outcome of patients with acute promyelocytic leukemia failing to front-line treat- ment with all-trans retinoic acid and anthracycline-based chemotherapy (PETHEMA protocols LPA96 and LPA99): benefit of an early intervention,” Leukemia, vol. 21, no. 3, pp. 446–452, 2007. [211] F. Morschhauser, J. M. Cayuela, S. Martini et al., “Evalua- tion of minimal residual disease using reverse-transcription polymerase chain reaction in t(8;21) acute myeloid leukemia: a multicenter study of 51 patients,” Journal of Clinical Oncology, vol. 18, no. 4, pp. 788–794, 2000. Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2011, Article ID 691493, 7 pages doi:10.1155/2011/691493

Methodology Report Employment of Oligodeoxynucleotide plus Interleukin-2 Improves Cytogenetic Analysis in Splenic Marginal Zone Lymphoma

Antonella Bardi,1 Francesco Cavazzini,1 Gian Matteo Rigolin,1 Elisa Tammiso,1 Eleonora Volta,1 Elisa Pezzolo,1 Luca Formigaro,1 Olga Sofritti,1 Giulia Daghia,1 Cristina Ambrosio,1 Lara Rizzotto,1 Awad E. Abass,1 Fiorella D’Auria,2 Pellegrino Musto,2 and Antonio Cuneo1

1 Section of Haematology, Department of Bio-Medical Sciences and Advanced Therapies, University of Ferrara, Ferrara, Italy 2 Department of Onco-Hematology, IRCCS, Centro di Riferimento Oncologico della Basilicata, Via Padre Pio 1, 85028 Rionero in Vulture (Pz), Italy

Correspondence should be addressed to Pellegrino Musto, [email protected]

Received 16 October 2010; Revised 21 February 2011; Accepted 15 March 2011

Academic Editor: Anita M. Oberbauer

Copyright © 2011 Antonella Bardi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

To com pare the efficiency of novel mitogenic agents and traditional mitosis inductors, 18 patients with splenic marginal zone lymphoma (SMZL) were studied. Three cultures using oligodeoxynucleotide (ODN) plus interleukin-2 (IL-2), or TPA, or LPS were setup in each patient. Seventeen/18 cases with ODN + IL2 had moderate/good proliferation (94, 4%) as compared with 10/18 cases with TPA and LPS (55%) (P = .015); 14/18 (77, 7%) cases with ODN + IL2 had sufficient good quality of banding as compared with 8/18 cases (44, 4%) with TPA and LPS. The karyotype could be defined from ODN + IL2-stimulated cultures in all 18 patients, 14 of whom (77, 7%) had a cytogenetic aberration, whereas clonal aberrations could be documented in 9 and in 3 cases by stimulation with LPS and TPA, respectively. Recurrent chromosome aberrations in our series were represented by aberrations of chromosome 14q in 5 patients, by trisomy 12 and 7q deletion in 4 cases each, and by abnormalities involving 11q and 13q in two cases each. These findings show that stimulation with ODN + IL2 offers more mitotic figures of better quality and results in an increased rate of clonal aberrations in SMZL, making this method ideal for prospective studies aiming at the definition of the prognostic impact of cytogenetic aberrations in this disorder.

1. Introduction [3–8] revealing abnormal karyotypes in 43–72% of the cases [5, 9]. Indeed, the combination of data derived from Splenic marginal zone lymphoma (SMZL) is an indolent conventional cytogenetic analysis, along with data derived disease, representing <2% of the lymphoid neoplasms, which from the application of fluorescence in situ hybridization was recognized as separate clinicopathological entity in (FISH) and comparative genomic hybridization (CGH) [10, the World Health Organization 2008 (WHO) classification 11], allowed for the definition of a cytogenetic profile of [1]. Studies using conventional cytogenetic analysis and SMZL. Deletion of the long arm of chromosome 7 is regarded molecular cytogenetic techniques disclosed a number of as the most characteristic anomaly of SMZL [12]; other recurrent chromosome and genetic lesions in this disorder recurrent aberrations are represented by total/partial trisomy [2]. Due to low spontaneous mitotic activity, stimulation 3q in 20–40% of the cases and by 14q32/IgH translocations, using 12-O-tetradecanoylphorbol 12-myristate 13-acetate +12, 17p/TP53 deletion, 6q−, +12, and +18 in 5–10% of (TPA), or a combination of TPA and lipopolysaccharide the cases, as documented in a recent large multicentre study (LPS) in parallel cultures, was employed in previous studies using the traditional TPA mitogen stimulation [13]. 2 Journal of Biomedicine and Biotechnology

Because conventional karyotype analysis is the only Table 1: Clinical features at presentation in 18 cases of SMZL. method allowing for the visualization in a single experiment of any type of chromosomal defect, including gains, losses, Median age, y (range) 74 (56–85) and balanced translocations, attention was recently devoted Sex, male/female 13/5 to the development of efficient mitogenic stimulation. In Splenomegaly yes/no 11/7 chronic lymphocytic leukemia (CLL), the introduction of Lymphadenopathy (yes/no) 1/14 stimulation by CpG oligodeoxynucleotide (ODN-DSP30) >40% lymphs in the BM aspirate 11/4 combined with IL2 allowed for the identification of more Lymphocytosis ≥5 × 109/L yes/no 11/7 cases with clonal aberrations than in previous analyses using 0.68–31.49 Absolute lymphocyte count (×109/L) other mitogens and showed that a fraction of cases with (median 6,63) apparently normal FISH results may carry chromosome Villous lymphocytes yes/no 6/9 lesions in regions not covered by conventional probe panels 5/13 [14, 15]. Because the identification of an optimal mitogen Hb < 12 g/dL yes/no stimulation can be expected to reduce the rate of nor- (8.6–15.2) 4/14 mal results in low-grade lymphoproliferative disorder, we Platelet count ≤100 × 109/L yes/no designed this study which aimed at analyzing the impact of (52–239) the innovative combination of immunostimulatory ODN + CD5 expression yes/no 5/13 IL2 in cell culture in 18 cases of well-documented SMZL. Sigma-Aldrich), (ii) lipopolysaccharide (LPS; 40 µg/mL– 2. Design and Methods Sigma-Aldrich), and (iii) immunostimulatory CpG-olig- onucleotide DSP30 plus IL2 (2 µmol/L GpC-ODN-TCG- 2.1. Patients and Samples. Eighteen cases of SMZL seen at TCGCTGTCTCCGCTTCTTCTTGCC) (TibMolBiol, Berlin, our Institution between 2008 and June 2010 were included Germany/IL2 100 U/mL Stem Cell Technologies Inc) in the present analysis (Table 1). All the patients were studied according to the method described by Dicker et al. [14]. by cytogenetic analysis as part of diagnostic workup. Samples Whenever possible, an additional 72 h unstimulated control from 13 patients were obtained at disease presentation, culture was setup (6 cases). All cultures were setup with whereas 5 patients were sent for cytogenetic analysis 5–12 a cell concentration of 2 × 106/mL and incubated at months after initial presentation. ◦ 37 Cina5%CO2 fully humidified atmosphere under Diagnosis was made according to the WHO [1]histo- standard conditions which have remained unchanged at pathologic criteria in one patient in whom splenectomy our laboratories during the study period. Colcemid (Kario was performed for diagnostic purposes; in the remaining Max Colcemid Solution 0,05 µg/mL Gibco, Invitrogen) was 17 patients, diagnosis was based on the combination of added for four hours before harvest. Harvesting and slide presentation features, morphologic and immunologic fea- preparation were performed by the same technician (ET) tures, and bone marrow findings [16]. Minimal require- throughout the study period using hypotonic treatment (20 ments were represented by (a) peripheral and bone marrow minutes incubation in 0,075 mol/L potassium chloride); lymphocytosis (i.e., >5 × 109/L B-lymphocytes in the PB > a classical 3 : 1 methanol/acetic acid solution was used as and/or 40% lymphocytes in the BM aspiration or lymphoid fixative. Slides were prepared using a predetermined volume infiltrate on biopsy sections), with or without splenomegaly (i.e., 20 µl) of fixed cell suspension, and metaphases were and minimal adenopathy, (b) morphology consistent with G-banded with Wright’s stain [19]. Whenever possible, 20 SMZL (i.e., small-to-medium-sized lymphocytes, with or or more metaphases were analyzed from each culture, and without villous lymphocytes and/or plasmacytoid features, karyotypes were described according to the International and (c) immunophenotype consistent with chronic B-cell ≤ System for Human Cytogenetics Nomenclature (ISCN 2005) proliferation with a Matutes score 3[17]. [20]. Complex karyotype was defined by the presence of 3 or more cytogenetic aberrations in the same clone. To compare 2.2. Conventional Cytogenetic Analysis. Conventional cytoge- the efficiency of the 3 different mitogens, the following netic analysis was performed on cells obtained from periph- cytogenetic features were assessed in the different culture eral blood (PB) in 14 cases, from BM aspirate in 3 cases, types by visualization at the microscope of the metaphases and from a spleen sample in 1 case (Table 2). Methods for present on one slide. cytogenetic analysis used in our laboratories were previously published [18]. Spleen samples were minced with a scalpel to (a) Proliferation. Based on the number of mitotic figures, the obtain a single cell suspension. After separation by centrifu- following score was adopted. gation over Ficoll-Hypaque, PB, BM, and splenic cells were Score 1: failure, definedbythepresenceof0-1mitoticfigures. cultured for 72 h in 10 ml RPMI 1640 (Gibco-Invitrogen) supplemented with 20% fetal calf serum (FCS-Gibco- Score 2: poor proliferation, defined by the presence of 2–10 Invitro-gen), 2 mmol/L GlutaMAX (Gibco-Invitro-gen), mitotic figures. 100 U/mL penicillin, and 100 µg/mL streptomycin (Gibco- Score 3: moderate proliferation, definedbythepresenceof11– Invitrogen). Three separate cell cultures were setup in all 19 mitotic figures. patients, using the 3 different mitogens: (i) 12-O-tetrade- Score 4: good proliferation, defined by the presence of ≥20 canoylphorbol 12-myristate 13-acetate (TPA; 50 ng/mL– mitotic figures. Journal of Biomedicine and Biotechnology 3 ] 17 ] 5 ]/46, XY [ 3 ] ] 21 1 ]/47, XY, del (7)(q32), der (12) t(3;12)(p11;p11), 2 ] 7 ]/46, XY [ ]/46, XX [ 4 19 ] 17 ]/46, XY [ ] 13 8 ]/46, XY [ ] ] ] 1 5 17 12 ] ]/46, XY [ 15 ]/47, XY, add (5)(p15), del (7)(q22),i(8)(p10), +del (14)(q24) [ 12 ] ] 15 ] 5 18 ]/46,XX [ 16 ]/46, XY [ ]/46, XY [ 16 3 8 ]/46, XY [ 5 ]/46, XY [ ]/46,XX [ 2 ]/46, XX [ 15 4 ] ] ] ] 20 20 20 20 Karyotype del (13)(q14q22), +mar1 +mar2 [

erent mitogens and karyotypes in 18 patients with SMZL.

ff

ciency E ffi Proliferation

ciency of di ffi Quality

2: E ciency E ) ffi

∗∗ Proliferation

Table

Score ( Quality

ciency E ffi Proliferation

TPA LPS ODN + IL2 Quality /L at the time of cytogenetic investigation, or % BM infiltration, as appropriate. NA: not available. 9 10 ) × ∗ See materials and methods for details; A: abnormal, N: normal, and F: failure. Absolute lymphocyte count Patient Age Sample ( 1 70 Pb (21.9) 3 3 N 3 2 N 3 3 N 46, XY [ 23 78 BM (38%) 77 2 Pb (7.28) 3 0 N 1 2 F 3 1 A 3 3 A 3 3 A 3 47, XX, +12 [ A 47, XY, add(5)(p15),+22 [ 4 75 BM (35%) 3 3 N 3 4 A 3 2 A Near tetraploid: 91, XXY, idic (1)(p11), del (11)(q21), add(14)(q32), +mar1, +mar2 [ 8 84 Pb (20) 0 1 F 3 3 A 4 3 A 46, XX, -9, t(14;19)(q32;q13), +add (14)(q32) [ 56 767 69 Pb (8.63) 55 Pb 0 (34.8) 1 Pb 0 (16.1) F 1 3 0 F 3 1 3 N F 3 3 2 N 2 3 3 A 3 3 A 3 N 46, XY, der (3)(p26), del (7)(q32), del A (13)(q22) 46, [ XY [ 46, XY, t(3;13)(q21;q13), del (11)(q12) [ 9 76 Pb (4.5) 3 3 A 3 3 A 4 4 A 47, XY, +12 [ 1011 6312 86 Pb (NA)13 76 Pb (6.1) 2 75 4 Spleen 3 N Pb (23.1) 3 0 2 A 3 1 3 1 3 F N N 2 0 2 A 1 1 4 2 3 F N N 3 2 3 46, XY A [ 3 4 46,XX,del(14) (q22) [ N A 46, XX [ 48, XY, +12, +15 [ 14 83 BM (30%) 2 3 N 2 3 N 2 4 A 46, XY, del (3)(p13) [ 15 85 Pb (4.2) 0 1 F 3 3 A 3 3 A 47, XY, +12, del (14)(q24) [ 16 7217 Pb (2.9)18 56 0 82 Pb 1 (4.9) F Pb (7.1) 3 0 3 3 1 A 2 F 3 N 4 4 0 3 A 1 3 F A 3 3 46, XY, dup (1)(q21q32), del (7)(q32), del 3 (13)(q14q22) A [ A 46, XY, del (7)(q32) [ 47, XX, +3 [ ∗ ∗∗ 4 Journal of Biomedicine and Biotechnology

(b) Quality of Banding. The number of chromosomal bands 14 per haploid set of chromosomes was counted referring to the ideograms of banding patterns present in the guidelines of 12 ISCN 2005 [20]. The following score was adopted. 10 Score 1: insufficient quality for karyotyping (<100 visible chromosome bands). 8 Score 2: poor quality (<200 visible chromosome bands).

Patients 6 Score 3: sufficient quality (200–300 visible chromosome bands). 4 Score 4: good quality (>300 visible chromosome bands). 2 (c) Stimulation Efficiency. The number of metaphases with 0 clonal abnormalities in each culture system was evaluated, TPA LPS ODN + IL2 and the karyotypes were divided in three groups:. Failure Moderate Score 1: failure, less than 10 analyzable metaphases. Poor Good Score 2: normal, absence of clonal abnormalities. Figure 1: No. of patients with failure, poor, moderate, and good Score 3: abnormal I, karyotype with clonal chromosomal proliferation following stimulation by different mitogens. abnormalities, that is, the same structural rearrange- ment or chromosome gain in at least two mitotic figures, or chromosome loss in at least three mitoses. 12

3. Results 10 3.1. Hematologic and Clinical Features. All 18 patients had an unequivocal diagnosis of SMZL with PB and/or 8 BM involvement by a clonal expansion of B-lymphocytes consistent with a marginal zone phenotype as assessed by 6 immunophenotyping. The patients had 2,9–34,8 × 109/L PB lymphocytes at time of sampling for cytogenetic analysis, 4 and no patient had cytologic and/or histologic features suggestive of transformation into high-grade lymphoma. BM involvement with >40% lymphocytes was detected in 11/15 2 cases, splenomegaly was present in 11/18 cases. A minority of patients had anemia or thrombocytopenia. Demographics 0 and hematologic data in our patients are presented in Table 1. TPA LPS ODN + IL2

3.2. Outcome of Cytogenetic Investigations. The karyotype Insufficient Sufficient could be defined in all 18 cases. No analyzable mitoses were Poor Good obtained from 72 h unstimulated parallel culture in 6 cases. ff Figure 2: Quality of banding: black-coloured column corresponds The outcome of cytogenetic investigations using di erent to insufficient chromosome quality, grey-coloured column corre- mitogensisshowninFigures1–5. sponds to poor quality, light grey and white correspond to sufficient and good quality, respectively, in every stimulation procedure. 3.3. Proliferation. Proliferation with at least 1 mitogen was assessable in all 18 cases. The number of cases with failure, low, moderate, and good proliferation is shown in Figure 1. More cases with score 3-4 were seen in ODN + IL2- (score 4) was observed in 3/18 cases with ODN + IL2 and stimulated cultures (17 cases = 94,4%) as compared with TPA in no case with TPA or LPS. Overall, 14/18 cases with and LPS (10 cases each; 55,5%) (P = .015). ODN + IL2 had score 3-4 (77,7%) as compared with 8/18 P = . Seven/18 patients (38,8%) with TPA and 4/18 patients cases (44,4%) with TPA and LPS ( 067). An example (22,2%) with LPS had score 1 (failure), whereas no failure of the quality of chromosome banding is shown in Figure 3. was observed in ODN + IL2-stimulated culture. 3.5. Stimulation Efficiency. The karyotypes are described 3.4. Quality of Banding. The quality of banding expressed as in Table 2, along with outcome measures (i.e., quality of number of bands in mitotic figures from the different cell banding and proliferation score) using different mitogens. cultures is shown in Figure 2. A good quality of banding The karyotype could be defined from ODN + IL2-stimulated Journal of Biomedicine and Biotechnology 5

1 2345 123 45 123 45

6 7 8 9 10 11 12 6 7 8 9 10 11 12 6 7 8 9 10 11 12

13 14 15 16 17 18 13 14 15 16 17 18 13 14 15 16 17 18

19 20 21 22 X Y

19 20 21 22 X Y 19 20 21 22 X Y (a) (b) (c)

Figure 3: G-banding karyotypes showing some examples of poor quality (score2—(a), patient 14), sufficient quality (score3—(b), patient 4), and good quality (score4—(c), patient 16).

cultures in all 18 patients, 14 of whom (77,7%) had a 14 cytogenetic aberration. Clonal aberrations could be documented in 9 cases 12 (50%) and in 3 cases (16,6%) by stimulation with LPS and 10 TPA, respectively, whereas in the remaining cases, normal 8 karyotype or failure was observed with these mitogens as 6 shown in Figure 4. Patients Five patients had a complex karyotype (pat. 3, 4, 5, 8, 4 and 16 in Table 2), with numerical gains and structural 2 abnormalities. One case was in the near-tetraploid range 0 (pat. 4). The most frequent abnormalities (see Figure 5)were TPA LPS ODN + IL2 represented by aberrations of chromosome 14q in 5 patients, 3 of whom had a 14q interstitial deletion (nos. 3, 11, and 15). Failure Abnormal Normal In patient 8 a t(14; 19)(q32; q13) translocation was detected. Trisomy 12 and 7q deletion were observed in 4 cases each. Figure 4: Stimulation efficiency: grey colour column represents Abnormalities involving 11q and 13q were observed in two abnormal cells, and dark and white colour columns represent failure cases each. and normal, respectively, in every stimulation procedure.

4. Discussion 5 Cytogenetic analysis has an established role in the diagnostic 4.5 workup [21] and risk assessment of chronic lymphoprolif- 4 erative disorders [13, 22, 23]. Because the mitotic index in 3.5 these indolent disorders is low, stimulation with LPS and TP 3 was widely employed [3, 24]. Evidence was recently provided 2.5 that conventional karyotyping may allow for the detection 2

of aberrations, especially translocations, not detectable by Number of cases 1.5 molecular cytogenetic methods [25]andthatODN+IL2 1 stimulation may disclose more cytogenetically abnormal 0.5 cases than was previously thought in CLL [14, 26]. In 0 particular, in a CLL Research Consortium study, more clonal abnormalities were observed after culture of CLL cells with Gain 12 Del (7q) Del (11q) Gain (3q)

ODN than with the traditional pokeweed mitogen (PWM) Abn (13q) Abn (14q) Other abn. plus TPA [27]. All clonal abnormalities in PWM + TPA Single cultures were observed in ODN cultures, whereas ODN Plus other abn. identified some clones not found by PWM + TPA. These results were reproducible in five different laboratories, and Figure 5: Total clonal chromosome abnormalities: distribution of all abnormalities were concordant with FISH. recurrent abnormalities if they were found as single aberration or in association with other abnormalities. In this study, we were able to show that improved mitotic stimulation can be obtained in SMZL, a low- grade lymphoproliferative disorder, by using ODN + IL2 in cultures, which offered chromosomes of better quality with analogy with CLL. Indeed, a significantly greater number of more clonal aberrations with respect to TPA/LPS-stimulated mitotic figures could be observed in ODN + IL2-stimulated cultures. The karyotype could be defined in 100% of 6 Journal of Biomedicine and Biotechnology

ODN + IL2-stimulated cultures, 77,7% of which showed a lesions, this cytogenetic method may be ideal for prospective clonal abnormality, as compared with 50% karyotypically studied aiming at the definition of the prognostic impact of abnormal cases obtained by a combination of results from chromosome aberrations in SMZL. LPS/TPA-stimulated cultures in the same patients. The percentage of cytogenetically abnormal cases in LPS/TPA- stimulated cultures was in line with previous reports [5, Acknowledgments 9, 13]. It is worth noting that at the time of sampling for This work was supported by MIUR PRIN, by Fondi Regionali cytogenetic analysis the majority of our patients were at ER, and by AIL-FE to A. Cuneo. L. Rizzotto is a fellow of AIL- an initial stage of the disease with moderate lymphocytosis FE A. Bardi and F. Cavazzini contributed equally. P. Musto and splenomegaly, no lymph node involvement, and absence and A. Cuneo shared senior authorship. of anemia or thrombocytopenia in the majority of them. Interestingly, the capability to detect abnormal clones was independent of the degree of lymphocytosis and BM involve- References ment, since all cases with <5 × 109/L lymphocytes in the PB and with <40% BM lymphocytes could be shown to have an [1]S.H.Swerdlow,E.Campo,N.L.Harrisetal.,World Health abnormal karyotype (Table 2). Organization Classification of Tumours of Haematopoietic and Thus, our data demonstrate that ODN + IL2 is the Lymphoid Tissues, International Agency for Research on method of choice to enhance cell divisions of good quality for Cancer, Lyon, France, 2008. karyotyping in SMZL, in keeping with a recent analysis docu- [2] V. Franco, A. M. Florena, and E. Iannitto, “Splenic marginal menting a 97% rate of aberrant karyotypes in 29 SMZL [28]. zone lymphoma,” Blood, vol. 101, no. 7, pp. 2464–2472, The cytogenetic profile in our patients confirms that 7q 2003. deletion, 3q abnormalities, +12, and 14q32 translocations [3] D. G. Oscier, E. Matutes, A. Gardiner et al., “Cytogenetic are frequently encountered in this disease. Interestingly, a studies in splenic lymphoma with villous lymphocytes,” 14q22-24 deletion occurred as single abnormality in 2 cases British Journal of Haematology, vol. 85, no. 3, pp. 487–491, 1993. and as additional aberration in 1, resulting in a 16,6% incidence for this aberration. Only 3% of the SMZL studies [4] J. Dierlamm, L. Michaux, I. Wlodarska et al., “Trisomy 3 in marginal zone B-cell lymphoma: a study based on cytogenetic by Salido and coworkers [13] were found to carry 14q analysis and fluorescence in situ hybridization,” British Journal deletions, which showed a 1,5% overall incidence in a study of Haematology, vol. 93, no. 1, pp. 242–249, 1996. of 3054 mature B-cell neoplasms [29]. The majority of cases [5] F. Sole,´ S. Woessner, L. Florensa et al., “Frequent involvement with 14q deletion in the latter analysis were represented by of chromosomes 1, 3, 7 and 8 in splenic marginal zone B-cell atypical CLL cases having a therapy-demanding disease. Our lymphoma,” British Journal of Haematology,vol.98,no.2,pp. 3 SMZLs with 14q deletion also had a therapy-demanding 446–449, 1997. disease, requiring treatment after 1, 8, and 13 months from [6] F. Sole,´ M. Salido, B. Espinet et al., “Splenic marginal zone B- cytogenetic analysis. cell lymphomas: two cytogenetic subtypes, one with gain of One case in this study with a t(14;19)(q32;q13) adds to 3q and the other with loss of 7q,” Haematologica,vol.86,no. a previous report of 4/330 cases carrying this translocation 1, pp. 71–77, 2001. [13]. The 14;19 translocation involving IgH and BCL3 is [7]S.Gazzo,L.Baseggio,L.Coignetetal.,“Cytogeneticand a rare aberration usually associated with a heterogeneous molecular delineation of a region of chromosome 3q com- group of B-cell malignancies [30], including an atypical monly gained in marginal zone B-cell lymphoma,” Haemato- form of CLL with aggressive clinical features [31]. The logica, vol. 88, no. 1, pp. 31–38, 2003. identification of this subtle rearrangement may be difficult [8] A. Cuneo, R. Bigoni, M. G. Roberti et al., “Molecular when banding quality is suboptimal, and it is possible cytogenetic characterization of marginal zone B-cell lympho- that improved resolution obtained in ODN + IL2-stimulated nia: correlation with clinicopathologic findings in 14 cases,” cultures made the detection of this subtle rearrangement Haematologica, vol. 86, no. 1, pp. 64–70, 2001. easier. In line with previous studies [32], our case had a [9] X. Troussard, L. Mauvieux, I. Radford-Weiss et al., “Genetic rapidly progressive disease requiring treatment 3 months analysis of splenic lymphoma with villous lymphocytes: a after diagnosis due to rapid lymphocyte doubling time. Groupe Francais d’Hematologie Cellulaire (GFHC) study,” In conclusion, we have shown that stimulation of mitosis British Journal of Haematology, vol. 101, no. 4, pp. 712–721, with ODN + IL2 offers more mitotic figures of better quality 1998. and results in an increased rate of clonal aberrations in [10] J. M. Hernandez,´ J. L. Garcıa,N.C.Guti´ errez´ et al., SMZL, in analogy with CLL. The profile of chromosome “Novel genomic imbalances in b-cell splenic marginal zone lymphomas revealed by comparative genomic hybridization lesions obtained with this mitogen was in line with previous and cytogenetics,” American Journal of Pathology, vol. 158, no. data, confirming that cytogenetic findings may be useful 5, pp. 1843–1850, 2001. for the diagnosis of this lymphoid neoplasia. The detection [11] F. Vega, J. H. Cho-Vega, P. A. Lennon et al., “Splenic marginal of subtle rearrangements, such as 14q deletion and 14;19 zone lymphomas are characterized by loss of interstitial translocations, might have been facilitated by improved regions of chromosome 7q, 7q31.32 and 7q36.2 that include banding resolution. Although more sensitive molecular the protection of telomere 1 (POT1) and sonic hedgehog genetic techniques using array CGH technology [33]may (SHH) genes,” British Journal of Haematology, vol. 142, no. 2, be of value for the detection of subtle unbalanced genetic pp. 216–226, 2008. Journal of Biomedicine and Biotechnology 7

[12] A. James Watkins, Y. Huang, H. Ye et al., “Splenic marginal [27] N. A. Heerema, J. C. Byrd, P. S. Dal Cin et al., “Stimulation of zone lymphoma: characterization of 7q deletion and its value chronic lymphocytic leukemia cells with CpG oligodeoxynu- in diagnosis,” Journal of Pathology, vol. 220, no. 4, pp. 461–474, cleotide gives consistent karyotypic results among labora- 2010. tories: a CLL Research Consortium (CRC) Study,” Cancer [13] M. Salido, C. Baro,´ D. Oscier et al., “Cytogenetic aberrations Genetics and Cytogenetics, vol. 203, no. 2, pp. 134–140, 2010. and their prognostic value in a series of 330 splenic marginal [28] A. Meloni-Ehrig, J. Meck, N. Christacos, J. Kelly, L. zone B-cell lymphomas: a multicenter study of the Splenic B- Matyakhina, and S. Schonberg, “Stimulation of B-cell Cell Lymphoma Group,” Blood, vol. 116, no. 9, pp. 1479–1488, mature malignancies with the CpG-oligonucleotide DSP30 2010. and interleukin-2 for improved detection of chromosome [14] F. Dicker, S. Schnittger, T. Haferlach, W. Kern, and C. abnormalities,” Blood, vol. 114, 2009, ASH Annual Meeting Schoch, “Immunostimulatory oligonucleotide-induced meta- Abstracts. Abs no. 1955. phase cytogenetics detect chromosomal aberrations in 80% of [29] L. Reindl, U. Bacher, F. Dicker et al., “Biological and clinical CLL patients: a study of 132 CLL cases with correlation to characterization of recurrent 14q deletions in CLL and other FISH, IgVH status, and CD38 expression,” Blood, vol. 108, no. mature B-cell neoplasms,” British Journal of Haematology,vol. 9, pp. 3152–3160, 2006. 151, no. 1, pp. 25–36, 2010. [15]C.Haferlach,F.Dicker,S.Schnittger,W.Kern,andT. [30] J. I. Martın-Subero,´ R. Ibbotson, W. Klapper et al., “A com- Haferlach, “Comprehensive genetic characterization of CLL: a prehensive genetic and histopathologic analysis identifies two study on 506 cases analysed with chromosome banding anal- subgroups of B-cell malignancies carrying a t(14;19)(q32;q13) ysis, interphase FISH, IgVH status and immunophenotyping,” or variant BCL3-translocation,” Leukemia,vol.21,no.7,pp. Leukemia, vol. 21, no. 12, pp. 2442–2451, 2007. 1532–1544, 2007. [16] M. Mollejo, J. Menarguez, E. Lloret et al., “Splenic marginal [31] Y. O. Huh, L. V. Abruzzo, G. Z. Rassidakis et al., “The zone lymphoma: a distinctive type of low-grade B-cell lym- t(14;19)(q32;q13)-positive small B-cell leukaemia: a clini- phoma: a clinicopathological study of 13 cases,” American copathologic and cytogenetic study of seven cases,” British Journal of Surgical Pathology, vol. 19, no. 10, pp. 1146–1157, Journal of Haematology, vol. 136, no. 2, pp. 220–228, 2007. 1995. [32]L.Michaux,J.Dierlamm,I.Wlodarska,V.Bours,H.VanDen [17] E. Matutes, D. Oscier, C. Montalban et al., “Splenic marginal Berghe, and A. Hagemeijer, “t(14;19)/BCL3 rearrangements in zone lymphoma proposals for a revision of diagnostic, staging lymphoproliferative disorders: a review of 23 cases,” Cancer and therapeutic criteria,” Leukemia, vol. 22, no. 3, pp. 487–495, Genetics and Cytogenetics, vol. 94, no. 1, pp. 36–43, 1997. 2008. [33] C. Robledo, J. L. Garcıa,´ D. Caballero et al., “Array comparative [18] G. L. Castoldi, F. Lanza, and A. Cuneo, “Cytogenetic aspects genomic hybridization identifies genetic regions associated of B-cell chronic lymphocytic leukemia: their correlation with outcome in aggressive diffuse large B-cell lymphomas,” with clinical stage and different polyclonal mitogens,” Cancer Cancer, vol. 115, no. 16, pp. 3728–3737, 2009. Genetics and Cytogenetics, vol. 26, no. 1, pp. 75–84, 1987. [19] D. E. Rooney, Human Cytogenetics: Malignancy and Acquired Abnormalities, Oxford university Press, 2001. [20] M. F. Karger, “Guidelines for Cancer Cytogenetics: Supple- ment to an International System for Human Cytogenetics Nomenclature ISCN,” Basel, Switzerland, 2005. [21] J. M. Hernandez, C. Mecucci, A. Criel et al., “Cytogenetic analysis of B cell chronic lymphoid leukemias classified according to morphologic and immunophenotypic (FAB) criteria,” Leukemia, vol. 9, no. 12, pp. 2140–2146, 1995. [22] A. M. Gruszka-Westwood, R. A. Hamoudi, E. Matutes, E. Tuset, and D. Catovsky, “p53 abnormalities in splenic lymphoma with villous lymphocytes,” Blood, vol. 97, no. 11, pp. 3552–3558, 2001. [23] T. Zenz, H. Dohner,¨ and S. Stilgenbauer, “Genetics and risk-stratified approach to therapy in chronic lymphocytic leukemia,” Best Practice and Research, vol. 20, no. 3, pp. 439– 453, 2007. [24] G. Juliusson, D. G. Oscier, M. Fitchett et al., “Prognostic subgroups in B-cell chronic lymphocytic leukemia defined by specific chromosomal abnormalities,” New England Journal of Medicine, vol. 323, no. 11, pp. 720–724, 1990. [25] C. Haferlach, F. Dicker, T. Weiss et al., “Toward a compre- hensive prognostic scoring system in chronic lymphocytic leukemia based on a combination of genetic parameters,” Genes Chromosomes and Cancer, vol. 49, no. 9, pp. 851–859, 2010. [26] R. Buhmann, C. Kurzeder, J. Rehklau et al., “CD40L stimu- lation enhances the ability of conventional metaphase cyto- genetics to detect chromosome aberrations in B-cell chronic lymphocytic leukaemia cells,” British Journal of Haematology, vol. 118, no. 4, pp. 968–975, 2002.