Iran. J. Ichthyol. (March 2021), 8(1): 67-75 Received: January 24, 2021 © 2021 Iranian Society of Ichthyology Accepted: March 28, 2021 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.22034/iji.v8i1.615 http://www.ijichthyol.org Research Article Documentation of the Turkestan barbel, Luciobarbus conocephalus (Kessler, 1872) in the Iranian part of Hari River basin (Teleostei: Cyprinidae: Barbinae) Soheil EAGDERI*1, Atta MOULUDI-SALEH1, Seyed Vali HOSSEINI1, Hamed MOUSAVI-SABET2 1Department of Fisheries, Faculty of Natural Resources, University of Tehran, Karaj, Iran. 2Department of Fisheries, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Iran. *Email: [email protected] Abstract: The Turkestan barbel, Luciobarbus conocephalus (Kessler, 1872), is documented from the Iranian Part of Hari River basin by providing its morphometric and molecular characteristics based on the nine collected specimens in July 2016. In addition, the ichthyofauna of the Hari river basin was discussed and an up-to-date inventory was provided. Based on the results, L. conocephalus was clustered in a clade as sister group of L. capito with K2P genetic distance of 1.8% in the mtDNA cytb region. Luciobarbus conocephalus probably has entered the Hari River from the Karakum Canal in Turkmenistan (diversion from the Amu Darya River) that in recent years was connected to the channels collecting the Hari River water. Also, a misidentified specimen of L. conocephalus sequence in the GenBank sequences is discussed. Keywords: Tedzhen River, Iran, Zoogeography, Cyprinidae. Citation: Eagderi, S.; Mouludi-Saleh, A.; Hosseini, S.V. & Mosavi-Sabet, H. 2021. Documentation of the Turkestan barbel, Luciobarbus conocephalus (Kessler, 1872) in the Iranian part of Hari River basin (Teleostei: Cyprinidae: Barbinae). Iranian Journal of Ichthyology 8(1): 64-75. Introduction The Turkestan barbel, Luciobarbus conocephalus Iran harbors high diversity in freshwater fishes with (Kessler, 1872) was described originally from the more than 297 species, distributing in 19 endorheic Zeravshan River, Uzbekistan. The Zeravshan River and exorheic basins (Esmaeili et al. 2018). Within does not quite reach to the Amu Darya, of which it Iranian members of the subfamily Barbinae was formerly its tributary. Turkestan barbel was (Cyprinidae), there are five genera, including reported from Amu Darya basin (Aliev et al. 1988; Arabibarbus (one species), Barbus (five species), Coad 2014), and the Karakum Canal, Kopetdag Luciobarbus (nine species), Mesopotamichthys (one Reservoir and Uzboi Lakes (Shakirova et al. 1994; species) and Schizothorax (three species) (Eagderi et Sal'nikov et al. 1995) in Turkmenistan. Coad (2014, al. 2013, 2019; Khaefi et al. 2017; Esmaeili et al. 2016) mentioned that this species may eventually 2018). The nine reported species of the genus reach the Caspian Sea basin and the Hari River basin Luciobarbus from Iran include: L. barbulus Heckel, of Iran but till now there is no record of this species 1847, L. brachycephalus (Kessler, 1872), L. capito in Iranian freshwater basins. We collected this (Güldenstädt, 1773), L. caspius (Berg, 1914), species from the Iranian part of the Hari River basin L. esocinus Heckel, 1843, L. kersin (Heckel, 1843), during an expedition in July 2016. Therefore, this L. mursa (Güldenstädt, 1773), L. subquincunciatus study was aimed to document the presence of (Günther, 1868) and L. xanthopterus Heckel, 1843 L. conocephalus by providing its morphological (Esmaeili et al. 2018). characteristics and mtDNA cytb barcode regionin. 67 Iran. J. Ichthyol. (March 2021), 8(1): 67-75 Fig. 1. Lateral view of Luciobarbus conocephalus collected from the Hari River. Fig. 2. Hari River, natural habitat of Luciobarbus conocephalus, in the border between Iran and Turkmenistan. (2014) were used to identify specimens. Counts and Materials and Methods measurements follow Armbruster (2012). Meristic Nine specimens of L. conocephalus were collected characteristics of the specimens were counted using Hari River near Pol-e Khatoun bridge in the a stereomicroscope and the morphometric features Khorasan-e Razavi Province, Hari River basin, Iran were measured using a caliper to the nearest 0.1mm (35°57'54.8"N 61°07'05.5"E) July 2016 during (Tables 1 and 2). Standard length (SL) was measured fieldwork on the ichthyofauna of Hari River basin from the tip of the upper jaw to the end of the hypural using an electrofishing device (Figs. 1, 2). The complex. Lateral-line scale count includes pierced collected specimens were preserved in 10% buffered scales, from the first one just behind the formaldehyde after anesthetizing with 1% clove supracleithrum to the posteriormost one at the base of solution and transferred to the laboratory for further the caudal-fin rays. The last two branched rays processing. Pectoral-fin tissues were directly fixed in articulated on a last compound pterygiophore in the 99% ethanol. The taxonomic key given by Coad dorsal and anal fins are noted as “1”. 68 Eagderi et al.- Documentation of the Turkestan barbel DNA extraction and PCR: DNA was extracted from across sites and a proportion of invariable sites fin clips using a modified phenol-chloroform method (GTR). For BI, we ran four simultaneous Monte (Sambrook et al. 1989). The primers used to amplify Carlo Markov Chains for 7000000 generations, the cytochrome b gene were GluF (5′ - AACCACCG sample frequency every 1000 generations, chain TTGTATTCAACTACAA - 3′) and ThrR (5′ - temperature 0.2. Log-likelihood stability was ACCTCCGATCTTCGGATTACAAGACCG - 3′) attained after 10000 generations, and we excluded (Machordom & Doadrio 2001). the first 1000 trees as burn-in. The remaining trees Polymerase chain reaction (PCR) conditions were were used to compute a 50% majority rule consensus as follows: a 50μl final reaction volume containing tree. For ML analyses, we conducted heuristic 5μl of 10X Taq polymerase buffer, 1μl of (50mM) searches (1000 runs) under HKY+F+G4 model. MgCl2,1μl of (10mM) deoxynucleotide triphosphate Uncorrected pairwise genetic distances (p-distances) (dNTP), 1μl (10μm) of each primer, 1μl of Taq were investigated based on Kimura two-parameter polymerase (5Uμl-1), 7μl of total DNA and 33μl of (K2P) distances (Tamura et al. 2013). As outgroups, H2O. Amplification cycles were as follows: Cyprinus carpio (accession numbers: AB158807) denaturation for 5min at 94°C; 35 cycles at 94°C for retrieved from GenBank. 1min, 50°C for 1:15min, 72°C for 1:30min and a final Abbreviations used: TL, total length; SL, standard extension for 10min at 72°C. PCR products were length; HL, lateral head length; K2P, Kimura 2- purified using purification Kit (Expin Combo GP – parameter. Collection codes: IMNRF-UT, mini; Macrogen incorporation, Korea). The PCR Ichthyological Museum of Natural Resources products were sequenced using Sanger method by a Faculty, University of Tehran; STL, Saint Louis robotic ABI-3130xl sequencer using manufacturer’s University. protocol. The forward and reverse primers were used to single strand sequencing. Results Molecular data analysis: The retrieved sequences Nine specimens of L. conocephalus ranging 115.1- of the other members of the genus Luciobarbus from 153.6mm (Fig. 1) were collected from Hari River. GenBank database (NCBI) following a blast search The Morphometric measurements and meristic are shown in Table 3 (Altschul et al. 1990). counts of the preserved specimens are presented in Cytochrome b sequences were aligned together with Tables 1 and 2. Meristic and morphometric GenBank sequences with CLUSTAL W using characteristics of the collected specimen were in the default parameters (Larkin et al. 2007). We range of those reported by Coad (2014). The determined the best-fit model of molecular evolution specimens were deposited in Ichthyological Museum for the gene dataset using the Bayesian information of Natural Resources Faculty, University of Tehran criterion (BIC) in IQTREE 1.6.0 (Kalyaanamoorthy as: IMNRF-1003-10-18. et al. 2017). The model with the lowest BIC scores We were able to generate one new cytb sequence (Bayesian Information Criterion) was considered to of fish identified as L. conocephalus (accession best describe the substitution pattern (Nei & Kumar numbers: MZ063684) and in addition, 11 other 2000; Posada & Crandall 2001). For phylogenetic Luciobarbus sequences retrieved from GenBank. reconstructions, the datasets were analysed by Both the ML and BI phylogenetic trees were mostly Bayesian Inference (BI) using MrBayes 3.1.2 similar in their topology, therefore only the BI tree (Ronquist et al. 2012) and maximum likelihood (ML) including the posterior probability values from the method in IQTREE 1.6.0 (Hoang et al. 2018). Maximum Likelihood phylogram were presented MrBayes was run with 6 substitution types (nst=6) (Fig. 3). Table 4 presents the average estimates of and considered gamma-distributed rate variation evolutionary divergence based on the mtDNA cytb 69 Iran. J. Ichthyol. (March 2021), 8(1): 67-75 Table 1. Morphometric data for Luciobarbus conocephalus recorded from Hari River, Hari basin, Iran and Turkmenistan border. (SD =standard deviation; Min = minimum; Max = maximum). Characters min max mean SD Standard length (mm) 115.1 153.6 In Standard length Body depth maximal 24.70 29.09 26.30 1.37 Caudal peduncle depth 10.61 11.41 10.91 0.28 Predorsal length 50.16 51.73 51.25 0.59 Postdorsal length 51.43 53.26 52.37 0.72 Prepelvic length 50.41 54.18 52.55 1.20 Preanal length 74.43 77.78 75.92 1.18 Caudal peduncle length 17.49 19.67