DOCSLIB.ORG

Research Article Documentation of the Turkestan Barbel, Luciobarbus Conocephalus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Research Article Documentation of the Turkestan Barbel, Luciobarbus Conocephalus Iran. J. Ichthyol. (March 2021), 8(1): 67-75 Received: January 24, 2021 © 2021 Iranian Society of Ichthyology Accepted: March 28, 2021 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.22034/iji.v8i1.615 http://www.ijichthyol.org Research Article Documentation of the Turkestan barbel, Luciobarbus conocephalus (Kessler, 1872) in the Iranian part of Hari River basin (Teleostei: Cyprinidae: Barbinae) Soheil EAGDERI*1, Atta MOULUDI-SALEH1, Seyed Vali HOSSEINI1, Hamed MOUSAVI-SABET2 1Department of Fisheries, Faculty of Natural Resources, University of Tehran, Karaj, Iran. 2Department of Fisheries, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Iran. *Email: [email protected] Abstract: The Turkestan barbel, Luciobarbus conocephalus (Kessler, 1872), is documented from the Iranian Part of Hari River basin by providing its morphometric and molecular characteristics based on the nine collected specimens in July 2016. In addition, the ichthyofauna of the Hari river basin was discussed and an up-to-date inventory was provided. Based on the results, L. conocephalus was clustered in a clade as sister group of L. capito with K2P genetic distance of 1.8% in the mtDNA cytb region. Luciobarbus conocephalus probably has entered the Hari River from the Karakum Canal in Turkmenistan (diversion from the Amu Darya River) that in recent years was connected to the channels collecting the Hari River water. Also, a misidentified specimen of L. conocephalus sequence in the GenBank sequences is discussed. Keywords: Tedzhen River, Iran, Zoogeography, Cyprinidae. Citation: Eagderi, S.; Mouludi-Saleh, A.; Hosseini, S.V. & Mosavi-Sabet, H. 2021. Documentation of the Turkestan barbel, Luciobarbus conocephalus (Kessler, 1872) in the Iranian part of Hari River basin (Teleostei: Cyprinidae: Barbinae). Iranian Journal of Ichthyology 8(1): 64-75. Introduction The Turkestan barbel, Luciobarbus conocephalus Iran harbors high diversity in freshwater fishes with (Kessler, 1872) was described originally from the more than 297 species, distributing in 19 endorheic Zeravshan River, Uzbekistan. The Zeravshan River and exorheic basins (Esmaeili et al. 2018). Within does not quite reach to the Amu Darya, of which it Iranian members of the subfamily Barbinae was formerly its tributary. Turkestan barbel was (Cyprinidae), there are five genera, including reported from Amu Darya basin (Aliev et al. 1988; Arabibarbus (one species), Barbus (five species), Coad 2014), and the Karakum Canal, Kopetdag Luciobarbus (nine species), Mesopotamichthys (one Reservoir and Uzboi Lakes (Shakirova et al. 1994; species) and Schizothorax (three species) (Eagderi et Sal'nikov et al. 1995) in Turkmenistan. Coad (2014, al. 2013, 2019; Khaefi et al. 2017; Esmaeili et al. 2016) mentioned that this species may eventually 2018). The nine reported species of the genus reach the Caspian Sea basin and the Hari River basin Luciobarbus from Iran include: L. barbulus Heckel, of Iran but till now there is no record of this species 1847, L. brachycephalus (Kessler, 1872), L. capito in Iranian freshwater basins. We collected this (Güldenstädt, 1773), L. caspius (Berg, 1914), species from the Iranian part of the Hari River basin L. esocinus Heckel, 1843, L. kersin (Heckel, 1843), during an expedition in July 2016. Therefore, this L. mursa (Güldenstädt, 1773), L. subquincunciatus study was aimed to document the presence of (Günther, 1868) and L. xanthopterus Heckel, 1843 L. conocephalus by providing its morphological (Esmaeili et al. 2018). characteristics and mtDNA cytb barcode regionin. 67 Iran. J. Ichthyol. (March 2021), 8(1): 67-75 Fig. 1. Lateral view of Luciobarbus conocephalus collected from the Hari River. Fig. 2. Hari River, natural habitat of Luciobarbus conocephalus, in the border between Iran and Turkmenistan. (2014) were used to identify specimens. Counts and Materials and Methods measurements follow Armbruster (2012). Meristic Nine specimens of L. conocephalus were collected characteristics of the specimens were counted using Hari River near Pol-e Khatoun bridge in the a stereomicroscope and the morphometric features Khorasan-e Razavi Province, Hari River basin, Iran were measured using a caliper to the nearest 0.1mm (35°57'54.8"N 61°07'05.5"E) July 2016 during (Tables 1 and 2). Standard length (SL) was measured fieldwork on the ichthyofauna of Hari River basin from the tip of the upper jaw to the end of the hypural using an electrofishing device (Figs. 1, 2). The complex. Lateral-line scale count includes pierced collected specimens were preserved in 10% buffered scales, from the first one just behind the formaldehyde after anesthetizing with 1% clove supracleithrum to the posteriormost one at the base of solution and transferred to the laboratory for further the caudal-fin rays. The last two branched rays processing. Pectoral-fin tissues were directly fixed in articulated on a last compound pterygiophore in the 99% ethanol. The taxonomic key given by Coad dorsal and anal fins are noted as “1”. 68 Eagderi et al.- Documentation of the Turkestan barbel DNA extraction and PCR: DNA was extracted from across sites and a proportion of invariable sites fin clips using a modified phenol-chloroform method (GTR). For BI, we ran four simultaneous Monte (Sambrook et al. 1989). The primers used to amplify Carlo Markov Chains for 7000000 generations, the cytochrome b gene were GluF (5′ - AACCACCG sample frequency every 1000 generations, chain TTGTATTCAACTACAA - 3′) and ThrR (5′ - temperature 0.2. Log-likelihood stability was ACCTCCGATCTTCGGATTACAAGACCG - 3′) attained after 10000 generations, and we excluded (Machordom & Doadrio 2001). the first 1000 trees as burn-in. The remaining trees Polymerase chain reaction (PCR) conditions were were used to compute a 50% majority rule consensus as follows: a 50μl final reaction volume containing tree. For ML analyses, we conducted heuristic 5μl of 10X Taq polymerase buffer, 1μl of (50mM) searches (1000 runs) under HKY+F+G4 model. MgCl2,1μl of (10mM) deoxynucleotide triphosphate Uncorrected pairwise genetic distances (p-distances) (dNTP), 1μl (10μm) of each primer, 1μl of Taq were investigated based on Kimura two-parameter polymerase (5Uμl-1), 7μl of total DNA and 33μl of (K2P) distances (Tamura et al. 2013). As outgroups, H2O. Amplification cycles were as follows: Cyprinus carpio (accession numbers: AB158807) denaturation for 5min at 94°C; 35 cycles at 94°C for retrieved from GenBank. 1min, 50°C for 1:15min, 72°C for 1:30min and a final Abbreviations used: TL, total length; SL, standard extension for 10min at 72°C. PCR products were length; HL, lateral head length; K2P, Kimura 2- purified using purification Kit (Expin Combo GP – parameter. Collection codes: IMNRF-UT, mini; Macrogen incorporation, Korea). The PCR Ichthyological Museum of Natural Resources products were sequenced using Sanger method by a Faculty, University of Tehran; STL, Saint Louis robotic ABI-3130xl sequencer using manufacturer’s University. protocol. The forward and reverse primers were used to single strand sequencing. Results Molecular data analysis: The retrieved sequences Nine specimens of L. conocephalus ranging 115.1- of the other members of the genus Luciobarbus from 153.6mm (Fig. 1) were collected from Hari River. GenBank database (NCBI) following a blast search The Morphometric measurements and meristic are shown in Table 3 (Altschul et al. 1990). counts of the preserved specimens are presented in Cytochrome b sequences were aligned together with Tables 1 and 2. Meristic and morphometric GenBank sequences with CLUSTAL W using characteristics of the collected specimen were in the default parameters (Larkin et al. 2007). We range of those reported by Coad (2014). The determined the best-fit model of molecular evolution specimens were deposited in Ichthyological Museum for the gene dataset using the Bayesian information of Natural Resources Faculty, University of Tehran criterion (BIC) in IQTREE 1.6.0 (Kalyaanamoorthy as: IMNRF-1003-10-18. et al. 2017). The model with the lowest BIC scores We were able to generate one new cytb sequence (Bayesian Information Criterion) was considered to of fish identified as L. conocephalus (accession best describe the substitution pattern (Nei & Kumar numbers: MZ063684) and in addition, 11 other 2000; Posada & Crandall 2001). For phylogenetic Luciobarbus sequences retrieved from GenBank. reconstructions, the datasets were analysed by Both the ML and BI phylogenetic trees were mostly Bayesian Inference (BI) using MrBayes 3.1.2 similar in their topology, therefore only the BI tree (Ronquist et al. 2012) and maximum likelihood (ML) including the posterior probability values from the method in IQTREE 1.6.0 (Hoang et al. 2018). Maximum Likelihood phylogram were presented MrBayes was run with 6 substitution types (nst=6) (Fig. 3). Table 4 presents the average estimates of and considered gamma-distributed rate variation evolutionary divergence based on the mtDNA cytb 69 Iran. J. Ichthyol. (March 2021), 8(1): 67-75 Table 1. Morphometric data for Luciobarbus conocephalus recorded from Hari River, Hari basin, Iran and Turkmenistan border. (SD =standard deviation; Min = minimum; Max = maximum). Characters min max mean SD Standard length (mm) 115.1 153.6 In Standard length Body depth maximal 24.70 29.09 26.30 1.37 Caudal peduncle depth 10.61 11.41 10.91 0.28 Predorsal length 50.16 51.73 51.25 0.59 Postdorsal length 51.43 53.26 52.37 0.72 Prepelvic length 50.41 54.18 52.55 1.20 Preanal length 74.43 77.78 75.92 1.18 Caudal peduncle length 17.49 19.67
Load more

Recommended publications
  • Review and Updated Checklist of Freshwater Fishes of Iran: Taxonomy, Distribution and Conservation Status
    Iran. J. Ichthyol. (March 2017), 4(Suppl. 1): 1–114 Received: October 18, 2016 © 2017 Iranian Society of Ichthyology Accepted: February 30, 2017 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.7508/iji.2017 http://www.ijichthyol.org Review and updated checklist of freshwater fishes of Iran: Taxonomy, distribution and conservation status Hamid Reza ESMAEILI1*, Hamidreza MEHRABAN1, Keivan ABBASI2, Yazdan KEIVANY3, Brian W. COAD4 1Ichthyology and Molecular Systematics Research Laboratory, Zoology Section, Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran 2Inland Waters Aquaculture Research Center. Iranian Fisheries Sciences Research Institute. Agricultural Research, Education and Extension Organization, Bandar Anzali, Iran 3Department of Natural Resources (Fisheries Division), Isfahan University of Technology, Isfahan 84156-83111, Iran 4Canadian Museum of Nature, Ottawa, Ontario, K1P 6P4 Canada *Email: [email protected] Abstract: This checklist aims to reviews and summarize the results of the systematic and zoogeographical research on the Iranian inland ichthyofauna that has been carried out for more than 200 years. Since the work of J.J. Heckel (1846-1849), the number of valid species has increased significantly and the systematic status of many of the species has changed, and reorganization and updating of the published information has become essential. Here we take the opportunity to provide a new and updated checklist of freshwater fishes of Iran based on literature and taxon occurrence data obtained from natural history and new fish collections. This article lists 288 species in 107 genera, 28 families, 22 orders and 3 classes reported from different Iranian basins. However, presence of 23 reported species in Iranian waters needs confirmation by specimens.
    [Show full text]
  • Uzbekistan: Tashkent Province Sewerage Improvement Project
    Initial Environmental Examination May 2021 Uzbekistan: Tashkent Province Sewerage Improvement Project Prepared by the Joint Stock Companies “Uzsuvtaminot” for the Asian Development Bank. ..Þ,zýUçâÛ,ÜINÞâ'' .,UzSUVTAMINoT" »KSIYADORLIK J°¼IY»ÂI JoINT ýâÞáÚ áÞÜà°ItÓr 1¾¾¾35, O'zbekiston Respublikasi l0OO35, Republic of Uzbekistan Toshkent shahri, Niyozbek yo'li ko'chasi 1-çã Tashkent ciý, Niyozbek 5ruli stÛÕÕt 1 apt. telefon: +998 55 5Þ3 l2 55 telephone: +998 55 503 12 55 uzst14,exat.uz, infcl(rtluzsuv. çz æzst{o exat. uz, iÛ[Þ(Ð æzsçç, æz _ 2 Ñ 1,1AÙ 202l Nq 4l2L 1 4 2 Ò ÂÞ: ¼r. Jung ½Þ ºim Project Officer SÕßiÞr UrÌÐß Development Specialist ÁÕßtrÐl and West Asia DÕàÐÓtmÕßt UrÌÐß Development and Water Division °siÐß Development ²Ðßk Subject: Project 52045-001 Tashkent ÀrÞçißáÕ Sewerage lmprovement Project - Revised lnitial Environmental Examination Dear ¼r. Kim, We hÕrÕÌà endorse the final revised and updated version of the lnitial µßvirÞßmÕßtÐl Examination (lEE) àrÕàÐrÕd fÞr the Tashkent ÀrÞçißáÕ Sewerage lmprovement ÀrÞjÕát. The lEE has ÌÕÕß discussed and reviewed Ìã the Projecls Coordination Unit ußdÕr JSc "UZSUVTAMlNoT". We ÕßSçrÕ, that the lEE will ÌÕ posted Þß the website of the JSC "UZSUVTAMlNoT" to ÌÕ available to the project affected àÕÞà|Õ, the printed áÞàã will also ÌÕ delivered to Ñ hokimiyats for disclosure to the local people. FuÓthÕr, hereby we submit the lEE to ADB for disclosure Þß the ÔD² website. Sincerely, Rusta janov Deputy irman of the Board CURRENCY EQUIVALENTS (as of 1 May 2021) Currency unit – Uzbekistan Sum (SUM)
    [Show full text]
  • Environmental and Social Impact Assessment Public Disclosure Authorized Nurek Hydropower Rehabilitation Project Phase 2 Republic of Tajikistan
    Public Disclosure Authorized Public Disclosure Authorized Public Disclosure Authorized FINAL Environmental and Social Impact Assessment Public Disclosure Authorized Nurek Hydropower Rehabilitation Project Phase 2 Republic of Tajikistan May 2020 Environmental and Social Impact Assessment Nurek HPP Rehabilitation Contents 1 Introduction .................................................................................................................................... 1 1.1 Background ........................................................................................................................... 1 1.2 Purpose of the ESIA ............................................................................................................... 3 1.3 Organization of the ESIA ....................................................................................................... 3 2 Project description .......................................................................................................................... 4 2.1 Description of Nurek HPP ..................................................................................................... 4 2.2 The Project ............................................................................................................................ 7 Dam Safety ............................................................................................................... 9 Details of work to be performed ............................................................................. 9 Refurbishment
    [Show full text]
  • Alburnoides Taeniatus) Ecological Risk Screening Summary
    Striped Bystranka (Alburnoides taeniatus) Ecological Risk Screening Summary U.S. Fish and Wildlife Service, March 2011 Revised, May 2018 Web Version, 6/22/2018 1 Native Range and Status in the United States Native Range From Froese and Pauly (2012): “Former USSR [Kazakhstan, Kyrgyzstan, Tajikistan, Turkmenistan, Uzbekistan; also Afghanistan]: Amu-Darya, Zeravshan, Syr-Darya and Chu River.” Status in the United States This species has not been reported as introduced or established in the United States. No documentation was found of trade in this species in the United States. Means of Introductions in the United States This species has not been reported as introduced or established in the United States. 1 2 Biology and Ecology Taxonomic Hierarchy and Taxonomic Standing From ITIS (2012): “Kingdom Animalia Subkingdom Bilateria Infrakingdom Deuterostomia Phylum Chordata Subphylum Vertebrata Infraphylum Gnathostomata Superclass Actinopterygii Class Teleostei Superorder Ostariophysi Order Cypriniformes Superfamily Cyprinoidea Family Cyprinidae Genus Alburnoides Species Alburnoides taeniatus (Kessler, 1874)” “Taxonomic current standing: Valid.” Size, Weight, and Age Range From Froese and Pauly (2012): “Max length : 9.0 cm TL male/unsexed; [Berg 1964]” Environment From Froese and Pauly (2012): “Benthopelagic; freshwater; pH range: 7.0 - 7.7; dH range: 20 - ?. […] 10°C - 20°C [Baensch and Riehl 1985]” (presumed to be aquarium temperature) Climate/Range From Froese and Pauly (2010): “Temperate; […]” Distribution Outside the United States Native From Froese and Pauly (2012): “Former USSR [Kazakhstan, Kyrgyzstan, Tajikistan, Turkmenistan, Uzbekistan; also Afghanistan]: Amu-Darya, Zeravshan, Syr-Darya and Chu River.” 2 Introduced Froese and Pauly (2012) report that A. taeniatus is introduced and established in Kyrgyzstan.
    [Show full text]
  • Three New Species of Alburnoides (Teleostei: Cyprinidae) from Euphrates River, Eastern Anatolia, Turkey
    Zootaxa 3754 (2): 101–116 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3754.2.1 http://zoobank.org/urn:lsid:zoobank.org:pub:33DCB673-BC7C-4DB2-84CE-5AC5C6AD2052 Three new species of Alburnoides (Teleostei: Cyprinidae) from Euphrates River, Eastern Anatolia, Turkey DAVUT TURAN1,3, CÜNEYT KAYA1, F. GÜLER EKMEKÇİ2 & ESRA DOĞAN1 1Recep Tayyip Erdoğan University, Faculty of Fisheries and Aquatic Sciences, 53100 Rize, Turkey. E-mail: [email protected]; [email protected]; [email protected] 2Department of Biology, Faculty of Sciences, Hacettepe University, Beytepe Campus, 06800 Ankara, Turkey. E-mail: [email protected] 3Corresponding author. E-mail: [email protected] Abstract Three new species of Alburnoides, Alburnoides emineae sp. n., Alburnoides velioglui sp. n., Alburnoides recepi sp. n., are described from the Euphrates River drainages (Persian Gulf basin) in eastern Anatolia, Turkey. Alburnoides emineae, from Beyazsu Stream (south-eastern Euphrates River drainage), is distinguished from all species of Alburnoides in Turkey and adjacent regions by a combination of the following characters (none unique to the species): a well developed ventral keel between pelvic and anal fins, commonly scaleless or very rarely 1–2 scales covering the anterior portion of the keel; a deep body (depth at dorsal-fin origin 31–36% SL); 37–43 + 1–2 lateral-line scales, 13½–15½ branched anal-fin rays; number of total vertebrae 41–42, modally 41, comprising 20–21 abdominal and 20–21 caudal vertebrae. Alburnoides velioglui, from Sırlı, Karasu, Divriği and Sultansuyu streams (northern and northeastern Euphrates River drainages), is distinguished by a poorly developed ventral keel, completely scaled; a moderately deep body (depth at dorsal-fin origin 24–29% SL); 45–53 + 1–2 lateral-line scales, 11½ –13½ branched anal-fin rays; number of total vertebrae 41–42, modally 42, comprising 20–22 abdominal and 20–21 caudal vertebrae.
    [Show full text]
  • Biodiversity Profile of Afghanistan
    NEPA Biodiversity Profile of Afghanistan An Output of the National Capacity Needs Self-Assessment for Global Environment Management (NCSA) for Afghanistan June 2008 United Nations Environment Programme Post-Conflict and Disaster Management Branch First published in Kabul in 2008 by the United Nations Environment Programme. Copyright © 2008, United Nations Environment Programme. This publication may be reproduced in whole or in part and in any form for educational or non-profit purposes without special permission from the copyright holder, provided acknowledgement of the source is made. UNEP would appreciate receiving a copy of any publication that uses this publication as a source. No use of this publication may be made for resale or for any other commercial purpose whatsoever without prior permission in writing from the United Nations Environment Programme. United Nations Environment Programme Darulaman Kabul, Afghanistan Tel: +93 (0)799 382 571 E-mail: [email protected] Web: http://www.unep.org DISCLAIMER The contents of this volume do not necessarily reflect the views of UNEP, or contributory organizations. The designations employed and the presentations do not imply the expressions of any opinion whatsoever on the part of UNEP or contributory organizations concerning the legal status of any country, territory, city or area or its authority, or concerning the delimitation of its frontiers or boundaries. Unless otherwise credited, all the photos in this publication have been taken by the UNEP staff. Design and Layout: Rachel Dolores
    [Show full text]
  • Phylogenetic Relationships of Eurasian and American Cyprinids Using Cytochrome B Sequences
    Journal of Fish Biology (2002) 61, 929–944 doi:10.1006/jfbi.2002.2105, available online at http://www.idealibrary.com on Phylogenetic relationships of Eurasian and American cyprinids using cytochrome b sequences C. C*, N. M*, T. E. D†, A. G‡ M. M. C*§ *Centro de Biologia Ambiental, Departamento de Zoologia e Antropologia, Faculdade de Cieˆncia de Lisboa, Campo Grande, Bloco C2, 3 Piso. 1749-016 Lisboa, Portugal, †Department of Biology, Arizona State University, Tempe, Arizona 85287-1501, U.S.A. and ‡Laboratoire d’Hydrobiology, Universite´ de Provence, 1 Place Victor Hugo, 1331 Marseille, France (Received 30 January 2002, Accepted 6 August 2002) Neighbour-joining and parsimony analyses identified five lineages of cyprinids: (1) European leuciscins (including Notemigonus)+North American phoxinins (including Phoxinus phoxinus); (2) European gobionins+Pseudorasbora; (3) primarily Asian groups [cultrins+acheilognathins+ gobionins (excluding Abbotina)+xenocyprinins]; (4) Abbottina+Sinocyclocheilus+Acrossocheilus; (5) cyprinins [excluding Sinocyclocheilus and Acrossocheilus]+barbins+labeonins. Relationships among these lineages and the enigmatic taxa Rhodeus were not well-resolved. Tests of mono- phyly of subfamilies and previously proposed relationships were examined by constraining cytochrome b sequences data to fit previous hypotheses. The analysis of constrained trees indicated that sequence data were not consistent with most previously proposed relationships. Inconsistency was largely attributable to Asian taxa, such as Xenocypris and Xenocyprioides. Improved understanding of historical and taxonomic relationships in Cyprinidae will require further morphological and molecular studies on Asian cyprinids and taxa representative of the diversity found in Africa. 2002 The Fisheries Society of the British Isles. Published by Elsevier Science Ltd. All rights reserved. Key words: Cyprinidae; molecular phylogeny; cytochrome b; monophyly of subfamilies.
    [Show full text]
  • Research Article Reproductive Biology of the Invasive Sharpbelly
    Iran. J. Ichthyol. (March 2019), 6(1): 31-40 Received: August 17, 2018 © 2019 Iranian Society of Ichthyology Accepted: November 1, 2018 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.22034/iji.v6i1.285 http://www.ijichthyol.org Research Article Reproductive biology of the invasive sharpbelly, Hemiculter leucisculus (Basilewsky, 1855), from the southern Caspian Sea basin Hamed MOUSAVI-SABET*1,2, Adeleh HEIDARI1, Meysam SALEHI3 1Department of Fisheries, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Guilan, Iran. 2The Caspian Sea Basin Research Center, University of Guilan, Rasht, Iran. 3Abzi-Exir Aquaculture Co., Agriculture Section, Kowsar Economic Organization, Tehran, Iran. *Email: [email protected] Abstract: The sharpbelly, Hemiculter leucisculus, an invasive species, has expanded its range throughout much of Asia and into the Middle East. However, little is known of its reproductive information regarding spawning pattern and season that could possibly explain its success as an invasive species. This research is the first presentation of its reproductive characteristics, which was conducted based on 235 individuals collected monthly throughout a year from Sefid River, in the southern Caspian Sea basin. Age, sex ratio, fecundity, oocytes diameter and gonado-somatic index were calculated. Regression analyses were used to find relations among fecundity and fish size, gonad weight (Wg) and age. The mature males and females were longer than 93.0 and 99.7mm in total length, respectively (+1 in age). The average egg diameter ranged from 0.4mm (April) to 1.1mm (August). Spawning took place in August, when the water temperature was 23 to 26°C.
    [Show full text]
  • Review of Freshwater Fish
    CMS Distribution: General CONVENTION ON MIGRATORY UNEP/CMS/Inf.10.33 1 November 2011 SPECIES Original: English TENTH MEETING OF THE CONFERENCE OF THE PARTIES Bergen, 20-25 November 2011 Agenda Item 19 REVIEW OF FRESHWATER FISH (Prepared by Dr. Zeb Hogan, COP Appointed Councillor for Fish) Pursuant to the Strategic Plan 2006-2011 mandating a review of the conservation status for Appendix I and II species at regular intervals, the 15 th Meeting of the Scientific Council (Rome, 2008) tasked the COP Appointed Councillor for Fish, Mr. Zeb Hogan, with preparing a report on the conservation status of CMS-listed freshwater fish. The report, which reviews available population assessments and provides guidance for including further freshwater fish on the CMS Appendices, is presented in this Information Document in the original form in which it was delivered to the Secretariat. Preliminary results were discussed at the 16 th Meeting of the Scientific Council (Bonn, 2010). An executive summary is provided as document UNEP/CMS/Conf.10.31 and a Resolution as document UNEP/CMS/Resolution 10.12. For reasons of economy, documents are printed in a limited number, and will not be distributed at the meeting. Delegates are kindly requested to bring their copy to the meeting and not to request additional copies. Review of Migratory Freshwater Fish Prepared by Dr. Zeb Hogan, CMS Scientific Councilor for Fish on behalf of the CMS Secretariat 1 Table of Contents Acknowledgements .................................................................................................................................3
    [Show full text]
  • Actinopterygii: Cyprinidae), from the Adriatic Sea Basin in Albania
    Caspian J. Env. Sci. 2015, Vol. 13 No.4 pp. 293~331 ©Copyright by University of Guilan, Printed in I.R. Iran [Research] Review of the genus Alburnoides Jeitteles, 1861 (Actinopterygii, Cyprinidae) from Iran with description of three new species from the Caspian Sea and Kavir basins H. Mousavi-Sabet1, 2*, S. Vatandoust3, I. Doadrio4 1. Department of Fisheries, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Guilan, Iran 2. The Caspian Sea Basin Research Center, University of Guilan, Rasht, Iran 3. Department of Fisheries, Babol Branch, Islamic Azad University, Babol, Iran 4. Biodiversity and Evolutionary Group. National Museum of Natural Sciences. CSIC. C/ José Gutiérrez Abascal, 2. 28006. Madrid. Spain * Corresponding author’s E-mail: [email protected] (Received: Apr. 22. 2015 Accepted: Nov. 10. 2015) ABSTRACT The genus Alburnoides Jeitteles, 1861 in Iran is reviewed, and diagnoses are presented for all eight recognized species. Alburnoides eichwaldii, A. holciki, A. idignensis, A. namaki, A. nicolausi, A. petrubanarescui, A. qanati and A. tabarestanensis are considered valid and three new species are described: Alburnoides coadi sp. n., from Namrud River in Kavir basin, A. parhami sp. n., from Atrak River in the south-eastern Caspian Sea basin, and A. samiii sp. n., from Sefidroud River in the southern Caspian Sea basin. All species, except unstudied A. petrubanarescui are illustrated and characterized morphologically. Key words: : New species, Taxonomy, Freshwater fishes, Alburnini, Spirlin INTRODUCTION The genus Alburnoides Jeitteles, 1861, is Bogutskaya, 2012; Mousavi-Sabet et al., 2015; characterized by presenting small black spots Stierandová et al., 2016). Recent studies have near the pores located on each side of the lateral shown that at least eight species of the genus line outlining the canal at least along its anterior Alburnoides are found in Iran (Coad & portion (Bogutskaya & Coad, 2009).
    [Show full text]
  • The Phylogenetic Relationships and Species Richness of Host-Specific Dactylogyrus Parasites Shaped by the Biogeography of Balkan
    www.nature.com/scientificreports OPEN The phylogenetic relationships and species richness of host-specifc Dactylogyrus parasites shaped Received: 23 February 2018 Accepted: 17 August 2018 by the biogeography of Balkan Published: xx xx xxxx cyprinids Michal Benovics1, Yves Desdevises2, Jasna Vukić3, Radek Šanda4 & Andrea Šimková1 Parasites exhibiting a high degree of host specifcity are expected to be intimately associated with their hosts. Therefore, the evolution of host-specifc parasites is at least partially shaped by the evolutionary history and distribution of such hosts. Gill ectoparasites of Dactylogyrus (Monogenea) are specifc to cyprinid fsh. In the present study, we investigated the evolutionary history of 47 Dactylogyrus species from the Balkan Peninsula, the Mediteranean region exhibiting the highest cyprinid diversity in Europe, and from central European cyprinids. Phylogenetic analyses revealed four well-supported clades of endemic and non-endemic Dactylogyrus spp. with four basal taxa. Endemic cyprinids with a limited distribution range were parasitized by endemic Dactylogyrus species, but some of them shared several Dactylogyrus species with central European cyprinids. Species delimitation analyses based on molecular data suggest that Dactylogyrus diversity is higher than that defned from morphology. Some endemic cyprinid species harboured Dactylogyrus species of diferent origins, this probably resulting from multiple host switching. Our results support the view that the evolution of Dactylogyrus in the Balkans has been infuenced not only by the historical dispersion and distribution of their cyprinid hosts, but also by recent contacts of non-native cyprinid species with endemic cyprinid fauna in this region. Te species richness of parasitic taxa and their distribution in host species is usually closely related to the history, dispersion and diversity of their hosts1–3.
    [Show full text]
  • Actinopterygii, Cyprinidae) En La Cuenca Del Mediterráneo Occidental
    UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS BIOLÓGICAS TESIS DOCTORAL Filogenia, filogeografía y evolución de Luciobarbus Heckel, 1843 (Actinopterygii, Cyprinidae) en la cuenca del Mediterráneo occidental MEMORIA PARA OPTAR AL GRADO DE DOCTOR PRESENTADA POR Miriam Casal López Director Ignacio Doadrio Villarejo Madrid, 2017 © Miriam Casal López, 2017 UNIVERSIDAD COMPLUTENSE DE MADRID Facultad de Ciencias Biológicas Departamento de Zoología y Antropología física Phylogeny, phylogeography and evolution of Luciobarbus Heckel, 1843, in the western Mediterranean Memoria presentada para optar al grado de Doctor por Miriam Casal López Bajo la dirección del Doctor Ignacio Doadrio Villarejo Madrid - Febrero 2017 Ignacio Doadrio Villarejo, Científico Titular del Museo Nacional de Ciencias Naturales – CSIC CERTIFICAN: Luciobarbus Que la presente memoria titulada ”Phylogeny, phylogeography and evolution of Heckel, 1843, in the western Mediterranean” que para optar al grado de Doctor presenta Miriam Casal López, ha sido realizada bajo mi dirección en el Departamento de Biodiversidad y Biología Evolutiva del Museo Nacional de Ciencias Naturales – CSIC (Madrid). Esta memoria está además adscrita académicamente al Departamento de Zoología y Antropología Física de la Facultad de Ciencias Biológicas de la Universidad Complutense de Madrid. Considerando que representa trabajo suficiente para constituir una Tesis Doctoral, autorizamos su presentación. Y para que así conste, firmamos el presente certificado, El director: Ignacio Doadrio Villarejo El doctorando: Miriam Casal López En Madrid, a XX de Febrero de 2017 El trabajo de esta Tesis Doctoral ha podido llevarse a cabo con la financiación de los proyectos del Ministerio de Ciencia e Innovación. Además, Miriam Casal López ha contado con una beca del Ministerio de Ciencia e Innovación.
    [Show full text]