ISSN 1346-7565 Acta Phytotax. Geobot. 70 (1): 1–17 (2019) doi: 10.18942/apg.201815
Biosystematic Studies on the Family Piperaceae (Piperales) I. Plastid DNA Phylogeny and Chromosome Number of Peperomia subgenus Micropiper
* Yukihiro H. Kobayashi , Shizuka Fuse and Minoru N. Tamura
Department of Botany, Graduate School of Science, Kyoto University, Kitashirakawa-oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan. * [email protected] (author for correspondence)
To evaluate the evolutionary relationships among species of Peperomia subg. Micropiper, a phylogenet- ic analysis based on the DNA sequences of plastid regions atpB-rbcL, psbK-I, rpL16, rpS16, trnG, trnK (including matK), trnL-L-F, and trnS-G was conducted using 20 species, in addition to four outgroup species. The trnK sequences of 46 species and trnL-L-F sequence of one species were quoted from Gen- Bank and also included in the analysis. The results showed that P. subg. Micropiper includes seven major clades, which are also supported by morphological characteristics. They are recognized as section- equivalent plant groups, namely Alatoid, Blandoid, Glabelloid, Glaucoid, Japonicoid, Lanceolatoid, and Rotundifolioid. A chromosome analysis of the subgenus yielded nine new counts: 2n = 22 (diploid) for P. alata, P. bicolor, P. diaphanoides, P. flexicaulis, P. hylophila, P. polystachya and P. prosterata, 2n = 44 (tetraploid) for P. okinawensis and 2n = 132 (dodecaploid) for P. reticulata. Japonicoid, which occurs outside the Americas, i.e. in Asia, Africa, and the Pacific islands, is tetraploid, decaploid, and dodeca- ploid (not diploid), while the remaining six plant groups are native to the Americas and diploid (except Glaucoid, which is tetraploid). Further, P. diaphanoides is conspecific with P. glabella. Peperomia boninsimensis from the Ogasawara Islands, Japan, is more closely related to Polynesian species than to other Japanese species. Peperomia okinawensis should be regarded as a variety of P. japonica.
Key words: chromosome number, Micropiper, molecular phylogeny, Peperomia blanda, Peperomia boninsimensis, Peperomia diaphanoides, Peperomia japonica var. okinawensis, Piperaceae, plastid DNA, primitive angiosperms
Piperales Bercht. & J. Presl have long attract- Piperaceae Giseke, along with Saururaceae ed attention as primitive angiosperms (Cronquist Rich. ex T. Lestib. and Aristolochiaceae Juss., 1957, 1988, Takhtajan 1969, Tamura 1974, En- constitute the Piperales. (APG IV 2016). The dress & Friis 1994). They share apocarpy, mono- family is considered to be one of the more mor- sulcate pollen grains, ethereal oil cells, and rich phologically advanced of the Piperales (Tamura endosperm with other primitive angiosperms, 1974), because it has simple flowers with only one such as Magnoliales Juss. ex Bercht. & J. Presl, orthotropous ovule per ovary and lacks a peri- Canellales Cronq., and Chloranthales Mart., all of anth. Based on Samain et al. (2008), the Pipera- which (including Piperales) are included in the ceae include five genera: Piper L., Peperomia basal clades of angiosperms (APG IV 2016). Ruiz & Pav., Zippelia Blume, Manekia Trel., and Piperales may also be related to monocots. Burg- Verhuellia Miq. er (1977) reported the morphological similarity to The molecular phylogenetics of the Pepero- monocots; e.g. atactostele and 3-merous flowers. mia has been studied by Wanke et al. (2006), Nevertheless, the taxonomy of Piperales has not Smith et al. (2008), Samain et al. (2009), and been adequately studied. Frenzke et al. (2015). They analyzed the DNA se- 2 Acta Phytotax. Geobot. Vol. 70
Fig. 1. Morphology and habit of species of Peperomia subg. Micropiper. A, P. verticillata (Blandoid) [Kobayashi 90 (KYO)] with dimorphic leaves (a, b); B, P. prostrata (Alatoid) [Kobayashi 6 (KYO)] with shoot continuing to grow after flowering (c) and white-lined veins of leaves (d); C, P. bicolor [Kobayashi 96 (KYO)]; D, P. japonica (Japonicoid) [Tamura et al. 44019 (KYO)]; E, P. glabella (Glabelloid) [Kobayashi 34 (KYO)] with grooved veins of leaves (e); F, P. galioides (Glau- coid) [Kobayashi 86 (KYO)] with dimorphic leaves (f, g). quences of trnK (3,204 bp), trnL+trnL- distinguished from other subgenera by densely F+ndhF+g3pd (5,235 bp), trnK+ITS+26S (5,906 the viscid-papillose fruits. Based on Frenzke et bp), and trnK+trnK-psbA (4,870 bp), respectively, al. (2015) and Tropicos (2018), 419 of the 596 spe- and revealed the monophyly of the genus and the cies of P. subg. Micropiper are endemic to the subgeneric relationships. Frenzke et al. (2015) American tropics, while the remaining 177 spe- classified Peperomia (1,520 spp.) into 14 subgen- cies are distributed in Asia, Africa, and the Pa- era primarily based on molecular phylogenetic cific islands. In contrast, the 13 subgenera are en- data: Micropiper (Miq.) Miq. (596 spp.), Pseudo- demic to the Americas, with the exception of P. cupula Frenzke & Scheiris (157 spp.), Leptorhyn- tetraphylla of subg. Pseudocupula. Thus, molec- chum (Dahlst.) Trel. ex Samain (147 spp.), Multi- ular phylogenetic studies of P. subg. Micropiper palmata Scheiris & Frenzke (105 spp.), Tildenia are needed to improve our understanding of (Miq.) Miq. ex Dahlst. (58 spp.), Oxyrhynchum Asian Peperomia. In addition, few data regarding (Dahlst.) Samain (57 spp.), Fenestratae Pino (42 chromosome number and polyploidy are avail- spp.), Peperomia (18 spp.), Erasmia (Miq.) Dahlst. able (Table 1), although these are important char- (13 spp.), Pleurocarpidium Dahlst. (11 spp.), His- acters for tracing evolution along molecular phy- pidulae Frenzke & Scheiris (10 spp.), Perlucida logenetic trees. Scheiris & Frenzke (7 spp.), Phyllobryon (Miq.) In Japan, there are three species of Pepero- Scheiris & Frenzke (7 spp.), and Panicularia mia, P. boninsimensis, P. japonica and P. oki- Miq. (6 spp.). However, the remaining 286 spe- nawensis, all of which have taxonomic issues. cies have not been assigned to any of the subgen- Peperomia boninsimensis is endemic to the Oga- era. sawara Islands, which are ca. 1,000 km distant In this study, we focused on Peperomia subg. from Honshu, and its close relatives are unknown. Micropiper (Fig. 1), which was circumscribed by In Tseng et al. (1999), P. japonica is treated as a Frenzke et al. (2015). It consists of pantropically synonym of P. blanda; however, this synonymy distributed terrestrial or epiphytic herbs that are has not been confirmed by molecular methods. February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 3
Table 1. Present and previous cytological studies of the Peperomia subg. Micropiper species that were investigated here mo- lecular phylogenetically. Taxon Present count Previous count Reference (2n) (n) (2n) P. alata Ruiz & Pav. 22* P. bicolor Sodiro 22* 36 Jose et al. (1994) P. blanda (Jacq.) Kunth 22 22 Samuel & Morawetz (1989) P. boninsimensis Makino 110 Okada (1986) P. boninsimensis c.110 Ono (1977) P. diaphanoides Dahlst. 22* P. dindygulensis Miq. 44 Mathew et al. (1999) P. dindygulensis 44II Mathew et al. (1998) P. fenzlei Regel 44 Samuel & Morawetz (1989) P. fernandeziana Miq. 22+2 Valdebenito et al. (1992) P. fernandeziana 23+2, c.22 Spooner et al. (1987) P. fernandeziana c.22 Sanders et al. (1983) P. flexicaulis Wawra 22* P. galioides Kunth 44 c.22 Valdebenito et al. (1992) P. glabella (Sw.) A. Dietr. 22 22 Samuel & Morawetz (1989) P. glabella ‘Variegata’ 36 Jose et al. (1992) P. heyneana Miq. 22 Mathew et al. (1999) P. heyneana 22II Mathew et al. (1998) P. hylophila C. DC. 22* P. japonica Makino 44 Okada (1986) P. okinawensis T. Yamaz. 44* P. polystachya (Ait.) Hook. 22* P. portulacoides (Lam.) A. Dietr. 22 44 Mathew et al. (1999) P. portulacoides 22II Mathew et al. (1998) P. prostrata B. S. Williams 22* P. reticulata Balf. f. 132* P. rotundifolia (L.) Kunth 22 Jose et al. (1994) P. rubella Hook. 22 22 Bai & Subramanian. (1985), Samuel & Morawetz. (1989) P. skottsbergii C. DC. c.24 Valdebenito et al. (1992) P. skottsbergii c.23 Spooner et al. (1987) P. skottsbergii 22–24 Sanders et al. (1983) P. urvilleana A. Rich. 22 Beuzenberg & Hair (1983) P. urvilleana 44 Murray & Lange (1999) P. verticillata (L.) A. Dietr. 22 22 Samuel & Morawetz (1989) *These numbers are first counted.
Although the independence of P. okinawensis has species, second to accumulate information on been questioned (Yonekura 2015), its molecular chromosome number and ploidy level of P. subg. phylogeny has not been evaluated. Micropiper to assess the cytological diversity in The purpose of this study was first to con- the subgenus, and third to revise the previous struct a molecular phylogenetic tree of Pepero- species-level taxonomic treatments and deter- mia subg. Micropiper to show species-level reso- mine the evolutionary units within P. subg. Mi- lution and to reveal the relationships among the cropiper based on all available information. 4 Acta Phytotax. Geobot. Vol. 70
Table 2. Plant materials used in this study. All voucher specimens are preserved in the herbarium of Kyoto University (KYO). Taxon Source / Origin Chro- Voucher mosome Accession number observa- tion atpB-rbcL psbK-I rpL16 rpS16 trnG trnK trnL-L-F trnS-G Peperomia subg. Micropiper a P. alata Cult. KBG , America Kobayashi 92 ○ LC440976 LC440939 LC456943 LC456906 LC440902 LC457017 LC440693 LC456980 Cult. KBG, P. bicolor Kobayashi 96 America ○ LC440962 LC440925 LC456929 LC456892 LC440888 LC457003 LC440679 LC456966 Cult. KBG, P. blanda Kobayashi 75 America ○ LC440973 LC440936 LC456940 LC456903 LC440899 LC457014 LC440690 LC456977 Cult. KBG, P. blanda Kobayashi 88 America ○ LC440965 LC440928 LC456932 LC456895 LC440891 LC457006 LC440682 LC456969 Cult. KBG, P. blanda Kobayashi 89 America LC440967 LC440930 LC456934 LC456897 LC440893 LC457008 LC440683 LC456971 Cult. KBG, P. blanda Kobayashi 141 America LC440968 LC440931 LC456935 LC456898 LC440894 LC457009 LC440684 LC456972 Cult. TBGb (collected from P. boninsimensis Japan: Tokyo, Asia LC440957 LC440920 LC456924 LC456887 LC440883 LC456998 LC440674 LC456961 Hahajima Isl.), Kobayashi 35 Japan: Tokyo, Minami-Iwo- P. boninsimensis jima Isl., Asia LC440958 LC440921 LC456925 LC456888 LC440884 LC456999 LC440675 LC456962 Takayama 17061618 Thailand: Doi P. cochinensis Phu Wae, Asia C. DC. Tamura et al. LC440960 LC440923 LC456927 LC456890 LC440886 LC457001 LC440677 LC456964 T-30013 Cult. OCU, P. diaphanoides Kobayashi 21 America ○ LC440970 LC440933 LC456937 LC456900 LC440896 LC457011 LC440687 LC456974 Cult. KBG, P. flexicaulis Kobayashi 77 America ○ LC440978 LC440941 LC456945 LC456908 LC440904 LC457019 LC440695 LC456982 Cult. KBG, P. galioides Kobayashi 86 America ○ LC440982 LC440945 LC456949 LC456912 LC440908 LC457023 LC440699 LC456986 Cult. KBG, P. galioides Kobayashi 98 America LC440981 LC440944 LC456948 LC456911 LC440907 LC457022 LC440698 LC456985 Cult. KBG (collected from P. glabella Brazil), America LC440979 LC440942 LC456946 LC456909 LC440905 LC457020 LC440696 LC456983 Kobayashi 99 Cult. KBG, P. glabella America Kobayashi 87 LC440969 LC440932 LC456936 LC456899 LC440895 LC457010 LC440686 LC456973 Cult. KBG, America P. glabella Kobayashi 34 ○ LC440971 LC440934 LC456938 LC456901 LC440897 LC457012 LC440688 LC456975 Thailand: Doi Phu Wae, P. heyneana Tamura et al. Asia LC440961 LC440924 LC456928 LC456891 LC440887 LC457002 LC440678 LC456965 T-30631 Cult. KBG (collected from P. hylophila Guatemala), Amerca ○ LC440977 LC440940 LC456944 LC456907 LC440903 LC457018 LC440694 LC456981 Kobayashi 95 P. inaequalifolia Cult. KBG, Ruiz & Pav. Kobayashi 97 Amerca LC440980 LC440943 LC456947 LC456910 LC440906 LC457021 LC440697 LC456984 Cult. KBG (collected from Japan: Kagoshima Asia LC440952 LC440915 LC456919 LC456882 LC440878 LC456993 LC440669 LC456956 P. japonica Pref., Amami Oshima Isl.), Kobayashi 83 Cult. MBGc (collected from P. japonica Japan: Kochi Asia LC440951 LC440914 LC456918 LC456881 LC440877 LC456992 LC440668 LC456955 Pref.), Kobayashi 48 Cult. KBG (collected from Japan: Okinawa P. japonica Pref., Okinawa Asia LC440955 LC440918 LC456922 LC456885 LC440881 LC456996 LC440671 LC456959 Isl.), Kobayashi 73 February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 5
Table 2. Continued Taxon Source / Origin Chro- Voucher mosome Accession number observa- tion atpB-rbcL psbK-I rpL16 rpS16 trnG trnK trnL-L-F trnS-G Peperomia subg. Micropiper Cult. KBG (collected from Japan:Okinawa P. japonica Pref., Okinawa Asia LC440950 LC440913 LC456917 LC456880 LC440876 LC456991 LC440667 LC456954 Isl.), Kobayashi 74 Japan: Okinawa Pref.,Okinawa P. japonica Isl., Tamura et al. Asia LC440953 LC440916 LC456920 LC456883 LC440879 LC456994 LC440670 LC456957 44016 Japan: Okinawa Pref.,Okinawa P. japonica Isl., Tamura et al. Asia LC440954 LC440917 LC456921 LC456884 LC440880 LC456995 LC440672 LC456958 44019 d P. langsdorffii Cult. OCU , America (Miq.) Miq. Kobayashi 14 LC440966 LC440929 LC456933 LC456896 LC440892 LC457007 LC440685 LC456970 e Cult. KUS , P. okinawensis Kobayashi 8 Asia ○ LC440956 LC440919 LC456923 LC456886 LC440882 LC456997 LC440673 LC456960 Cult. KBG, P. polystachya Kobayashi 76 America ○ LC440972 LC440935 LC456939 LC456902 LC440898 LC457013 LC440689 LC456976 Cult. OCU, P. prostrata Kobayashi 6 America ○ LC440975 LC440938 LC456942 LC456905 LC440901 LC457016 LC440692 LC456979 Cult. KBG, P. reticulata Kobayashi 93 Africa ○ LC440959 LC440922 LC456926 LC456889 LC440885 LC457000 LC440676 LC456963 Cult. KBG, P. rubella Kobayashi 85 America ○ LC440974 LC440937 LC456941 LC456904 LC440900 LC457015 LC440691 LC456978 Cult. KBG, P. verticillata Kobayashi 90 America ○ LC440963 LC440926 LC456930 LC456893 LC440889 LC457004 LC440680 LC456967 Cult. KBG, P. verticillata Kobayashi 91 America LC440964 LC440927 LC456931 LC456894 LC440890 LC457005 LC440681 LC456968 Peperomia subg. Leptorhynchum P. incana (Haw.) Cult. OCU, America A. Dietr. Kobayashi 13 LC440985 LC440948 LC456952 LC456915 LC440911 LC457026 LC440702 LC456989 P. maculosa (L.) Cult. OCU, America Hook. Kobayashi 15 LC440986 LC440949 LC456953 LC456916 LC440912 LC457027 LC440703 LC456990 Peperomia subg. Multipalmata P. caperata Cult. OCU, America Yunck. Kobayashi 10 LC440984 LC440947 LC456951 LC456914 LC440910 LC457025 LC440701 LC456988 P. verschaffeltii Cult. OCU, America Lem. Kobayashi 25 LC440983 LC440946 LC456950 LC456913 LC440909 LC457024 LC440700 LC456987 a, Kyoto Botanical Gardens; b, Tsukuba Botanical Garden; c, The Kochi Prefectural Makino Botanical Garden; d, Botanical Gardens, Faculty of Science, Osaka City University; e, Botanical Gardens, Graduate School of Science, Kyoto University.
tion to our sequence data, for the phylogenetic re- Materials and Methods construction. Voucher specimens are preserved in the herbarium of Kyoto University (KYO). Plant materials The sources of the plant materials used for DNA extraction, PCR amplification and DNA se- DNA analysis and chromosome observations are quencing listed in Table 2, and some are shown in Fig. 1. The DNA sequences of the plastid regions of For the DNA analysis, we used Peperomia cape- atpB-rbcL intergenic spacer, psbK-I intergenic rata (subg. Multipalmata), P. incana (subg. Lep- spacer, rpl16 gene, rps16 gene, trnG gene, trnK torhynchum), P. maculosa (subg. Leptorhyn- gene (including matK), trnL gene, trnL-F inter- chum) and P. verschaffeltii (subg. Multipalmata) genic spacer, and trnS-G intergenic spacer for 24 as outgroups, with reference to Frenzke et al. species (36 OTUs) were determined in this study (2015). All sequence data are deposited in the (Table 2). Total DNA was extracted from fresh or DNA Data Bank of Japan (DDBJ). We quoted 53 silica gel-dried leaves using the modified CTAB sequences of trnK and two sequences of trnL-L-F method of Doyle & Doyle (1987). All regions from GenBank (Table 3), and used them, in addi- were amplified by polymerase chain reaction 6 Acta Phytotax. Geobot. Vol. 70
Table 3. DNA sequences obtained from GenBank. action mixture was prepared using TaKaRa Ex Accession Taxon number Reference Taq DNA polymerase, following the manufactur- [trnK] er’s instructions (TaKaRa Shuzo). We used the 20 P. alata KR002963.1 Frenzke et al. (2015) P. abyssinica Miq. KR002913.1 Frenzke et al. (2015) primers listed in Table 4 and the following PCR P. blanda DQ212763.1 Wanke et al. (2006) profile: a 35 cycle reaction with denaturation at P. ciliaris C. DC. KR002920.1 Frenzke et al. (2015) P. congona Sodiro KR003072.1 Frenzke et al. (2015) 94 °C for 0.5 min, annealing at 50 °C for 0.5 min, P. aff. emarginulata C. DC. KX451154.1 Frenzke et al. (2016) and extension at 72 °C for 0.5–2 min, in addition P. fenzlii KR003021.1 Frenzke et al. (2015) P. aff. fenzlii KX451164.1 Frenzke et al. (2016) to an initial denaturation at 94 °C for 5 min and a P. galioides DQ212748.1 Wanke et al. (2006) final extension at 72 °C for 7 min. We purified the P. glabella DQ212757.1 Wanke et al. (2006) P. glabella KR002962.1 Frenzke et al. (2015) PCR products by treating them with Exonuclease P. aff. glabella KX451152.1 Frenzke et al. (2016) I (Takara Bio) and Calf Intestine Alkaline Phos- P. glauca Pino KR002933.1 Frenzke et al. (2015) phatase (Toyobo) to degrade the remaining prim- P. hendersonensis Yunck. KR002973.1 Frenzke et al. (2015) P. humilis A. Dietr. KR002975.1 Frenzkeet al. (2015) ers and dephosphorylate the remaining dNTPs. P. hylophila DQ212758.1 Wanke et al. (2006) Direct sequencing was conducted using 25 prim- P. aff. hylophila KX451153.1 Frenzke et al. (2016) P. aff. ilaloensis Sodiro KX451157.1 Frenzke et al. (2016) ers (Table 4) on an ABI Prism 3130 Genetic Ana- P. inaequalifolia DQ212749.1 Wanke et al. (2006) lyzer (Applied Biosystems) with the BigDye Ter- P. inaequalifolia KR002976.1 Frenzke et al. (2015) P. inaequalifolia var. KR002932.1 Frenzke et al. (2015) minator v.3.1 Cycle Sequencing Kit (Applied Bio- galioides (Kunth)Pino systems), according to the manufacturer’s in- P. aff. inaequalifolia KX451158.1 Frenzke et al. (2016) P. lanceolata C. DC. KR003033.1 Frenzke et al. (2015) structions. We sequenced both strands, with the P. lanuginosa Pino KR003032.1 Frenzke et al. (2015) exception of the matK sequencing for which we P. leptostachya Hook. & Arn. KX451171.1 Frenzke et al. (2016) sequenced only a single strand. We aligned the P. aff. macrothyrsa Miq. KX451159.1 Frenzke et al. (2016) P. microphylla Kunth KR002943.1 Frenzke et al. (2015) obtained DNA sequences using MAFFT (Katoh P. molleri C. DC. KR003035.1 Frenzke et al. (2015) et al. 2005) and adjusted them manually. P. pallida Seem. KR002946.1 Frenzke et al. (2015) P. pedunculata C. DC. KR002985.1 Frenzke et al. (2015) P. pilicaulis C. DC. KR002947.1 Frenzke et al. (2015) Phylogenetic analysis P. pitcairnensis C. DC. DQ212762.1 Wanke et al. (2006) P. pitcairnensis KR002989.1 Frenzke et al. (2015) We employed the methods of maximum like- P. polystachya KR002948.1 Frenzke et al. (2015) lihood and Bayesian inference based on the com- P. polystachya FJ424468.1 Samain et al. (2009) P. puberulispica C. DC. KR002959.1 Frenzke et al. (2015) bined DNA sequences of plastid regions atpB-rbcL, P. ratticaudata G. Mathieu KR002958.1 Frenzke et al. (2015) psbK-I, rpL16, rpS16, trnG, trnK (including P. riocaliensis Trel. & Yunck. KR003009.1 Frenzke et al. (2015) P. rotundifolia KR002994.1 Frenzke et al. (2015) matK), trnL-L-F, and trnS-G to construct phylo- P. rotundifolia var. DQ212754.1 Wanke et al. (2006) rotundifolia genetic trees. All base substitutions were unor- P. rotundilimba C. DC. KR002995.1 Frenzke et al. (2015) dered and equally weighted. Gaps were treated as P. saxicola C. DC. KR002997.1 Frenzke et al. (2015) missing data. The DNA substitution model was P. skottsbergii KR002951.1 Frenzke et al. (2015) P. societatis J. W. Moore KR002999.1 Frenzke et al. (2015) selected by jModelTest (Darriba et al. 2012), and P. succulenta C. DC. KR003001.1 Frenzke et al. (2015) TPM1uf+G+I was the best model. For the maxi- P. trichophylla Baker KR003004.1 Frenzke et al. (2015) P. tuisana C. DC. ex Pittier DQ212756.1 Wanke et al. (2006) mum-likelihood (ML) analysis, we used RAx- P. vulcanica Baker & C.H. Wright KR003012.1 Frenzke et al. (2015) ML-ng 0.7.0 beta (Kozlov et al. 2018) and a boot- P. sp.* KR002971.1 Frenzke et al. (2015) strap (BS) analysis with 500 replications. The P. sp.298 DQ212760.1 Wanke et al. (2006) credibility of each clade was evaluated by Felsen- P. sp.3 KX451162.1 Frenzke et al. (2016) P. sp.4 KX451163.1 Frenzke et al. (2016) stein’s bootstrap expectation (FBE) and transfer [trnL-L-F] bootstrap expectation (TBE) (Lemoine et al. P. pitcairnensis EF422828.1 Wanke et al. (2007) P. pitcairnensis AY689145.1 Neinuis et al. (2005) 2018). Bayesian inference analysis was conducted *This sample was possibly erroneously named P. falanana using MrBayes v.3.2.6 (Ronquist et al. 2012). in Frenzke et al. (2015). Four simultaneous runs of 1,000,000 Markov chain Monte Carlo (MCMC) generations were (PCR) using a GeneAmp PCR System 2700 or performed and trees were sampled every 100 2720 (Applied Biosystems). The amplification re- generations. The convergence was examined February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 7
Table 4. Name, direction, sequence and reference for primers used in this study. The primers with an asterisk were used only for DNA sequencing, the others both for PCR amplification and DNA sequencing. Primer name Direction Sequence (5’-3’) Reference [aptB-rbcL intergenic spacer] atpB-1 Forward ACATCKARTACKGGACCAATAA Chiang et al. (1998) rbcL-1 Reverse AACACCAGCTTTRAATCCAA Chiang et al. (1998)
[psbK-I intergenic spacer] psbK-psbI(F) Forward TTAGCATTTGTTTGGCAAG Wang et al. (2010) psbK-psbI(R) Reverse AAAGTTTGAGAGTAAGCAT Wang et al. (2010)
[rpL16 gene] rpL16F71 Forward GCTATGCTTAGTGTGTGACTCGTTG Shaw et al. (2005) rpL16R1516 Reverse CCCTTCATTCTTCCTCTATGTTG Shaw et al. (2005)
[rpS16 gene] rpS16F Forward AAACGATGTGGTARAAAGCAAC Shaw et al. (2005) rpS16R Reverse AACATCWATTGCAASGATTCGAT Shaw et al. (2005)
[trnK gene (including matK)] trnK-11 Forward CTCAACGGTAGAGTACTCG Liston & Kadereit (1995) trnK-710F-mod-Pi Forward GTATCGCACTATGTATCMTTT Modified Johnson & Soltis (1995) trnK-710R* Reverse TCAAATGATACATAGTGCGATAC Johnson & Soltis (1995) matK-1470R Reverse AAGATGTTGATCGTAAATGA Johnson & Soltis (1995) matK-1805F Forward GGTAAGGAGTCAAATGCTAGAGAAT This study matK-2040R* Reverse TCCAAATACCAAATACGTTC This study matK-8F* Forward TCGACTTTCTTGTGCTAGAACTTT Steel & Vilgalys (1994) matK-8R Reverse AAAGTTCTAGCACAAGAAAGTCGA Ooi et al. (1995) trnK-2621 Reverse AACTAGTCGGATGGAGTAG Liston & Kadereit (1995)
[trnL gene & trnL-F intergenic spacer] trnL-c Forward CGAAATCGGTAGACGCTACG Taberlet et al. (1991) trnL-d* Forward GGTTCAAGTCCCTCTATCCC Taberlet et al. (1991) trnL-e* Reverse GGGGATAGAGGGACTTGAAC Taberlet et al. (1991) trnF-f Reverse ATTTGAACTGGTGACACGAG Taberlet et al. (1991)
[trnS-G intergenic spacer & trnG gene] trnSGCU Forward AGATAGGGATTCGAACCCTCGGT Shaw et al. (2005) trnG2S Reverse TTTTACCACTAAACTATACCCGC Shaw et al. (2005) trnG2G Forward GCGGGTATAGTTTAGTGGTAAAA Shaw et al. (2005) trnGUUC Reverse GTAGCGGGAATCGAACCCGCATC Shaw et al. (2005) with Tracer 1.7 (Rambaut & Drummond 2018). Results Consensus trees and the posterior probability (PP) of each clade were calculated after the first DNA sequence variation of Peperomia subg. Mi- 25% of sampled trees were discarded as burn-in. cropiper The DNA strands sequenced in this study (ex- Chromosome observation cept for the four outgroup species) ranged from Root tips for the examination of chromosomes 818 to 857 bp for the atpB-rbcL intergenic spacer were prepared by using a modification of the region, 439–463 bp for the psbK-I intergenic 8-hydroxyquinoline and lacto-propionic orcein spacer region, 743–859 bp for the rps16 gene re- squash method (Yamamoto et al. 2008). Voucher gion, 917–997 bp for the rpl16 gene region, 714– specimens are preserved in KYO. 728 bp for the trnS-G intergenic spacer region, 666–672 bp for the trnG gene region, 838–1,080
8 Acta Phytotax. Geobot. Vol. 70
Blandoid
Alatoid r e opip cr i M
. Japonicoid ubg s
a i m o er p e P
Glabelloid
Lanceolatoid
Rotundifolioid
Glaucoid
Fig. 2. Strict consensus of maximum-likelihood (ML) tree and Bayesian tree of Peperomia subg. Micropiper derived from analysis of sequences of atpB-rbcL, psbK-I, rpl16, rps16, trnG, trnK (including matK), trnL-L-F, and trnS-G. Numbers above branches indicate ML bootstrap support (Felsenstein’s bootstrap expectation/transfer bootstrap expectation; FBE/ TBE); numbers below branches are Bayesian posterior probability (PP). February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 9 bp for the region of the trnL gene and trnL-F in- culata, P. polystachya, P. puberulispica, P. ru- tergenic spacer, and 2,448 to 2,533 bp for the bella, and P. verticillata (59/93/0.81, Blandoid). trnK gene region. In the Glabelloid clade, Peperomia diapha- noides was embedded within P. glabella Phylogenetic analysis (100/100/1.00). In the Japonicoid clade, P. bonin- The aligned DNA-sequence dataset, includ- simensis was sister to the clade comprising P. ing the sequences determined in this study, those pallida, P. hendersonensis and P. societatis from GenBank, and the sequences of four out- (79/89/0.97); the four species formed a larger group species comprised 9,016 bp, of which 960 clade (100/100/1.00). Peperomia okinawensis was bp (10.6%) were variable, and 575 bp (6.4%) were embedded in P. japonica (96/98/1.00). In the parsimony informative. The consistency index Blandoid clade, P. langsdorffii and three individ- (CI), retention index (RI), and rescaled consisten- uals of P. blanda had identical DNA sequences cy index (RC) were 0.83, 0.93, and 0.76, respec- for all nine plastid regions analyzed (9,016 bp). tively. The strict consensus of the ML tree and the Chromosome examination Bayesian tree (Fig. 2) showed the monophyly of Chromosomes at the mitotic metaphase in the Peperomia subg. Micropiper, as supported by BS 14 species of Peperomia subg. Micropiper were values of 100/100 (FBE/TBE) and a PP value of examined (Figs. 3 & 4). The basic chromosome 1.00. A clade comprising P. congona, P. galioi- number of the 14 species was x = 11 (Table 1), in des, P. glauca, P. inaequalifolia, P. microphylla, agreement with the reports of Smith (1966) and P. skottsbergii and P. succulenta (FBE/TBE/PP = Okada (1986) for Peperomia. The number and 100/100/1.00, named Glaucoid) was sister to the size of the chromosomes of each species are de- remaining species of P. subg. Micropiper scribed as follows (Tables 1 & 5). (100/100/1.00). A clade comprising P. ciliaris and P. rotundifolia (64/74/0.96, Rotundifolioid) di- (1) Peperomia alata — 2n = 22, diploid (Fig. 3A): verged as the next branch. The clade of the re- This is the first report of the chromosome maining species (83/98/1.00) consisted of two number for this species. The pairs of chromo- smaller clades plus P. pilicaulis. One of the small- somes ranged from 2.2 to 4.4 μm in length in er clades (52/84/0.99) comprised a subclade of P. the same cell. lanceolata, P. riocaliensis, and P. saxicola (2) Peperomia bicolor — 2n = 22, diploid (Fig. (95/97/1.00, Lanceolatoid), a subclade of P. di- 3B): This is a new chromosome number for P. aphanoides and P. glabella (100/100/1.00, Gla- bicolor; it was reported as 2n = 36 by Jose et belloid), and P. tuisana. The other smaller clade al. (1994). The pairs of chromosomes ranged comprised the remaining species (90/99/1.00) from 1.8 to 2.5 μm in length in this study. from which a clade of P. abyssinica, P. boninsi- (3) Peperomia blanda — 2n = 22, diploid (Fig. mensis, P. cochinensis, P. hendersonensis, P. 3C, D): Two individuals from Kyoto Botanical heyneana, P. japonica, P. molleri, P. pallida, P. Gardens were examined; both were diploid pitcairnensis, P. ratticaudata, P. rotundilimba, P. with 2n = 22. The chromosomes ranged from trichophylla, and P. vulcanica (39/84/1.00, Japo- 1.8 to 2.8 μm in length in one individual (Fig. nicoid) diverged as the next branch. A clade of 3C), and from 1.8 to 2.9 μm in the other (Fig. the remaining species (35/93/0.70) consisted of 3D). two subclades and P. bicolor. One subclade was (4) Peperomia diaphanoides — 2n = 22, diploid composed of P. alata, P. emarginulata, P. flexi- (Fig. 3E): This is the first report of a chromo- caulis, P. hylophila, and P. prostrata (82/97/1.00, some number for this species. The chromo- Alatoid); and the other of P. blanda, P. fenzlei, P. some pairs ranged from 2.2 to 3.4 μm in length. humilis, P. ilaloensis, P. langsdorffii, P. lanugi- (5) Peperomia flexicaulis — 2n = 22, diploid (Fig. nosa, P. leptostachya, P. macrothyrsa, P. pedun- 3F): This is the first report of a chromosome 10 Acta Phytotax. Geobot. Vol. 70
Fig. 3. Somatic chromosomes of species of Peperomia subg. Micropiper. A, P. alata (2n = 22) [Kobayashi 92 (KYO)]; B, P. bicolor (2n = 22) [Kobayashi 96 (KYO)]; C, P. blanda (2n = 22) [Kobayashi 75 (KYO)]; D, P. blanda (2n = 22) [Kobayas- hi 88 (KYO)]; E, P. diaphanoides (2n = 22) [Kobayashi 21 (KYO)]; F, P. flexicaulis (2n = 22) [Kobayashi 77 (KYO)]; G, P. glabella (2n = 22) [Kobayashi 34 (KYO)]; H, P. hylophila (2n = 22) [Kobayashi 95 (KYO)]. Bars = 5μm. February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 11
Fig. 4. Somatic chromosomes of species of Peperomia subg. Micropiper. A, P. polystachya (2n = 22) [Kobayashi 76 (KYO)]; B, P. prostrata (2n = 22) [Kobayashi 6 (KYO)]; C, P. rubella (2n = 22) [Kobayashi 85 (KYO)]; D, P. verticillata (2n = 22) [Kobayashi 90 (KYO)]; E, P. okinawensis (2n = 44) [Kobayashi 8 (KYO)]; F, P. galioides (2n = 44) [Kobayashi 86 (KYO)]; G, P. reticulata (2n = 132) [Kobayashi 93 (KYO)]. Bars = 5μm. 12 Acta Phytotax. Geobot. Vol. 70
Table 5. Morphology, chromosomes, species and distribution of each section-equivalent plant group of Peperomia subg. Micropiper. Blandoid Alatoid Japonicoid Glabelloid Lanceolatoid Rotundifolioid Glaucoid Morphology Phyllotaxis opposite, mostly alternate opposite, mostly alternate mostly mostly alternate verticillate verticillate or verticillate or verticillate alternate alternate Leaf dimorphic monomorphic monomorphic monomorphic monomorphic monomorphic dimorphic dimorphism Leaf nerves upper leaves conspicuous conspicuous or conspicuous ? inconspicuous inconspicuous conspicuous, inconspicuous lower leaves inconspicuous Stem habit erect erect or procum- erect or erect erect procumbent erect bent procumbent Stem color reddish mostly reddish mostly green reddish mostly reddish green reddish Stolon present absent present or absent ? absent present absent Shoot withered after continuing to withered after continuing to continuing to continuing to withered after fruiting grow after fruiting grow after grow after grow after fruiting fruiting fruiting fruiting fruiting Chromosomes number 2n = 22 (2X) 2n = 22 (2X) 2n= 44, 110, 132 2n = 22 (2X) ? 2n = 22 (2X) 2n = 44 (4X) (4X, 10X, 12X) length (μm) 1.7-2.9 2.0-3.4 1.3-3.1 2.0-4.1 1.6-3.1 (P. polystachya) (P. flexicaulis) (P. okinawensis) (P. glabella) (P. galioides) 1.7-3.1 2.2-4.4 1.5-3.3 2.2-3.4 (P. verticillata) (P. alata) (P. reticulata) (P. diaphanoides) 1.8-2.9 2.3-4.1 (P. blanda) (P. prostrata) 1.8-2.9 2.4-3.9 (P. rubella) (P. hylophila) Species P. blanda P. alata P. abyssinica P. diaphanoides P. lanceolata P. cilialis P. congona P. fenzlii P. emarginulata P. boninsimensis P. glabella P. riocaliensis P. rotundifolia P. galioides P. humilis P. flexicaulis P. cochinensis P. saxicola P. glauca P. ilaloensis P. hylophila P. hendersonensis P. inaequalifolia P. langsdorffii P. prostrata P. heyneana P. microphylla P. lanuginosa P. velutina P. japonica P. skottsbergii P. leptostachya P. molleri P. succulenta P. macrothyrsa P. okinawensis P. pedunculata P. pallida P. polystachya P. pitcairnensis P. puberulispica P. ratticaudata P. rubella P. reticulata P. verticillata P. rotundilimba P. societatis P. trichophylla P. vulcanica Distribution America America Asia America America America America Africa the Pacific islands
number for this species. The chromosomes 3H): This is the first report of a chromosome were 2.0 to 3.4 μm in length. number for this species. The chromosomes (6) Peperomia galioides — 2n = 44, tetraploid ranged from 2.4 to 3.9 μm long. (Fig. 4F): The chromosomes were 1.6 to 3.1 (9) Peperomia okinawensis — 2n = 44, tetraploid μm in length. (Fig. 4E): This is the first report of a chromo- (7) Peperomia glabella — 2n = 22, diploid (Fig. some number for this Japanese species. The 3G): The chromosomes were 2.0 to 4.1 μm chromosomes were 1.3 to 3.1 μm long. long. (10) Peperomia polystachya — 2n = 22, diploid (8) Peperomia hylophila — 2n = 22, diploid (Fig. (Fig. 4A): This is the first report of a chromo- February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 13
some number for this species. The chromo- lotaxis, leaf dimorphism, conspicuousness of leaf somes were 1.7 to 2.9 μm long. nerves, stem habit (erect or procumbent), stem (11) Peperomia prostrata — 2n = 22, diploid (Fig. color, presence or absence of stolons, and growth 4B): This is the first report of a chromosome pattern of shoots (Table 5). Thus, we recognize number for this species. The chromosomes them as section-equivalent groups, which we were 2.3 to 4.1 μm long. name Alatoid, Blandoid, Glabelloid, Glaucoid, (12) Peperomia reticulata — 2n = 132, dodeca- Japonicoid, Lanceolatoid, and Rotundifolioid ploid (Fig. 4G): This is the first report of a (Fig. 2). Because we analyzed only 57 of the 596 chromosome number for this African species. species of P. subg. Micropiper, and three species The chromosomes were 1.5 to 3.3 μm long. were not included in any of the seven clades (Fig. (13) Peperomia rubella — 2n = 22, diploid (Fig. 2), we avoid using formal taxonomic names for 4C): The chromosomes were 1.8 to 2.9 μm the seven clades, instead using tentative informal long. names. (14) Peperomia verticillata — 2n = 22, diploid The seven clades are distinguishable not only (Fig. 4D): The chromosomes were 1.7 to 3.1 morphologically, but also by karyotype and geo- μm long. graphic distribution (Table 5), and appear to be discrete evolutionary entities. Among them, Ja- The metaphase chromosomes in somatic cells ponicoid, Blandoid, and Glaucoid have shoots were comparatively large in Peperomia alata, P. that wither immediately after fruiting. Japonicoid diaphanoides, P. flexicaulis, P. glabella, P. hy- is the only clade of Peperomia subg. Micropiper lophila, and P. prostrata. The shortest chromo- that occurs outside the Americas; i.e. in Asia, Af- somes in each cell were 2.0–2.4 μm long, and the rica and the Pacific islands. It consists primarily longest were 3.4–4.4 μm long. In contrast, the of totally greenish species (Fig. 1D), which are chromosomes of P. bicolor, P. blanda, P. galioi- tetraploid, decaploid, and dodecaploid (not dip- des, P. okinawensis, P. polystachya, P. reticulata, loid) with comparatively small chromosomes P. rubella, and P. verticillata were comparatively (1.3–3.3 μm). Blandoid and Glaucoid have dimor- small. The shortest chromosomes in each cell phic leaves (Fig. 1Aa, b, Ff, g) and small chromo- were 1.3–1.8 μm long, and the longest were 2.9– somes (1.6–3.1 μm); the former is diploid and pro- 3.3 μm long. These values are in good agreement duces stolons; the latter is tetraploid and lacks with the findings of Okada (1986), who reported stolons. the shortest chromosomes of P. japonica to be ca. The remaining four plant groups of Pepero- 1 μm long and the longest to be ca. 3 μm long. mia subg. Micropiper have shoots that continue to grow after fruiting (Fig. 1Bc). Plants of Lan- ceolatoid are usually reddish in part or overall with verticillate leaves, at least at a few nodes. Discussion Plants of Rotundifolioid are diploid and totally green, with procumbent stems and strictly alter- Section-equivalent plant groups of Peperomia nate leaves. Plants of Glabelloid and Alatoid are subg. Micropiper highly similar both morphologically and karyo- The resolution of our molecular phylogenetic logically. Both are diploid with comparatively tree (Fig. 2) was higher than in previous studies large chromosomes (2.0–4.4 μm). They have al- based on trnK and trnK-psbA regions (Frenzke et ternate leaves with conspicuous veins on the ad- al. 2015). Our tree of Peperomia subg. Micropip- axial surface; i.e. grooved (Fig. 1Ee) or white- er formed seven major clades. Each of the seven lined (Fig. 1Bd), and reddish and usually erect clades received more than 60% BS (FBE), 90% stems. Under cultivation, Glabelloid plants are BS (TBE), or 1.00 PP. The clades were also sup- quite vigorous, while those of Alatoid are not. ported by morphological features, such as phyl- However, it is difficult to distinguish them in the 14 Acta Phytotax. Geobot. Vol. 70 wild. Further studies are needed to know why Thai species, P. cochinensis and P. heyneana, as- they are so similar morphologically, although signed to P. subg. Micropiper, were included in a they are remotely positioned in our plastid phylo- molecular analysis for the first time, and all were genetic tree (Fig. 2). An artificial key to each sec- revealed to be in the same clade, Japonicoid (Fig. tion-equivalent group of P. subg. Micropiper is 2), confirming that the Japonicoid clade consists provided below. exclusively of species from outside the Americas (Table 5). Peperomia bicolor Peperomia japonica is sometimes considered Peperomia bicolor was not included in any of a synonym of P. blanda (Tseng et al. 1999). In our the seven groups, but was positioned as a sister to analysis, however, they appeared in different sec- the common Blandoid and Alatoid clades (Fig. 2). tion-equivalent plant groups: Japonicoid and Peperomia bicolor (Fig. 1C) is morphologically Blandoid, respectively (Fig. 2). They also differed similar to plants of the Alatoid group (Fig. 1B). in chromosome number: 2n = 22 for P. blanda Further, although its chromosome number was and 2n = 44 for P. japonica (Table 1). Thus, we reported as 2n = 36 (Jose et al. 1994), we con- consider them different species. Peperomia oki- firmed that it is 2n = 22 (Table 1), as in Alatoid. nawensis was embedded within the clade of P. The only difference between P. bicolor and Ala- japonica (Fig. 2). Although P. japonica is hairy toid is in chromosome size: the chromosomes of while P. okinawensis is glabrous, there are no P. bicolor (Fig. 3B) are much smaller than in Ala- other remarkable differences between them; they toid (Figs. 3A, F, H, & 4B). also have the same chromosome number, 2n = 44 (Table 1). Thus, we consider P. okinawensis to be New findings on American species of Peperomia a glabrous variety of P. japonica occurring in the In this study, the molecular sequences of four central Ryukyu and Daito islands, Japan. Further, species of Peperomia subg. Micropiper from P. boninsimensis, which is endemic to the Ogas- America, P. diaphanoides, P. flexicaulis, P. awara Islands, Japan, was not in a clade with oth- langsdorffii, and P. verticillata, were analyzed for er Japanese species, but rather with species from the first time and their phylogenetic positions are the Pacific islands; i.e. P. pallida, P. henderso- reported here. Peperomia langsdorffii had DNA nensis, and P. societatis (Fig. 2). Thus, we con- sequences identical to P. blanda (Blandoid; Fig. sider P. boninsimensis of the Ogasawara Islands 2) for all nine of the plastid regions analyzed to have originated from a common ancestor with (9,016 bp). This study therefore supports the treat- species from the Pacific islands rather than those ments of Trelease & Yuncker (1950), Yuncker from Japan. (1953) and Zuloaga et al. (2008), who considered P. langsdorfii to be conspecific with P. blanda. Peperomia diaphanoides was shown to be em- Taxonomic treatment bedded within the clade of P. glabella (Glabel- Peperomia japonica Makino var. okinawensis loid) (Fig. 2), which is highly similar morphologi- (T. Yamaz.) Y. H. Kobay. & M. N. Tamura, stat. cally to P. diaphanoides. Thus, P. diaphanoides nov. should be placed in synonym under P. glabella. Further, two American species, P. flexicaulisand Basionym: Peperomia okinawensis T. Yamaz. P. verticillata, were included in Alatoid and Blan- in J. Jap. Bot. 67: 15, f. 1a, 2 & 3 (1992).—Type: doid, respectively (Fig. 2). Japan, Okinawa Isl., the peak of Hedoishiyama, 80 m alt., in shady crevice on rock, 26 June 1955, New findings on Asian, including Japanese, spe- S. Hatusima 1844 (TI). cies of Peperomia Peperomia japonica Makino f. glabra Hatus., Three Japanese species, Peperomia boninsi- Fl. Ryukyus: 217 (1971), nom. nud. mensis, P. japonica and P. okinawensis, and two Peperomia japonica Makino f. okinawensis February 2019 Kobayashi & al. –Cp Phylogeny of Peperomia subg. Micropiper 15
(T. Yamaz.) Hatus. in Hatusima & Amano, Fl. other staff members of Tsukuba Botanical Garden, Dr. Ryukyus, 2 ed.: 29 (1994), nom. nud. Akihiro Seo and other staff members of The Kochi Pre- fectural Makino Botanical Garden, and staff members of the Botanical Gardens, Graduate School of Science, Kyo- to University for supplying us with the plant materials used in this study. We are much indebted to Mr. Manop We express our sincere gratitude to Dr. Koji Takayama Poopath and other members of BKF, Department of Na- for his comments. We extend our hearty thanks to Dr. No- tional Parks, Wildlife and Plant Conservation, Thailand, buko Yamamoto for her help in observing the chromo- and Prof. Tetsuo Denda for their assistance during our somes. Our cordial thanks are due to Dr. Hiroshi Tobe, fieldwork. This study was supported in part by JSPS KA- Mr. Junichi Nagasawa and other staff members of the KENHI (Grants-in-Aid for Scientific Research) Grant Kyoto Botanical Gardens, Dr. Satoshi Koi and other Number JP16H05763. members of the staff of the Botanical Gardens, Faculty of Science, Osaka City University, Dr. Chie Tsutsumi and
Key to the section-equivalent plant groups of Peperomia subg. Micropiper
1a. Leaves dimorphic, lower leaves 2/3 times as large as upper leaves; lower leaves highly succulent, 2 mm thick or more, upper leaves less succulent, ca. 1 mm thick ...... 2 1b. Leaves not all alike ...... 3 2a. Stolons present; leaves verticillate or opposite at least at middle of stem; diploid (2n = 22) ...... Blandoid 2b. Stolons absent; leaves strictly verticillate; tetraploid (2n = 44) ...... Glaucoid 3a. Shoots withering after fruiting; stems usually green; tetraploid, decaploid, dodecaploid (2n=44, 110, 132); Asia, Africa and Pacific islands ...... Japonicoid 3b. Shoots continuing to grow after fruiting; stems reddish or sometimes green; diploid (2n = 22) or chromosome number unknown; America ...... 4 4a. At least several leaves verticillate; stem usually reddish; chromosome number unknown ...... Lanceolatoid 4b. Leaves alternate; stem reddish or green; diploid (2n = 22) ...... 5 5a. Nerves on adaxial surface of leaves not conspicuous; stems green, procumbent ...... Rotundifolioid 5b. Nerves on adaxial surface of leaves conspicuous; stems reddish, usually erect ...... 6 6a. Most species prominently vigorous in cultivation ...... Glabelloid 6b. Most species growing poorly in cultivation ...... Alatoid
Cronquist, A. 1957. Outline of a new system of families and orders of dicotyledons. Bull. Jard. Bot. État. References Bruxelles. 27: 13–40. Cronquist, A. 1988. The Evolution and Classification of APG IV. 2016. An update of the Angiosperm Phylogeny Flowering Plants, 2nd ed. The New York Botanical Group classification for the orders and families of Garden, New York. flowering plants: APG IV. Bot. J. Linn. Soc. 181: Darriba, D., G. L. Taboada, R. Doallo & D. Posada. 2012. 1–20. jModelTest 2: more models, new heuristics and paral- Bai, G. V. S. & D. Subramanian. 1985. Cytotaxonomical lel computing. Nature, Meth. 9: 772. studies of south Indian Piperaceae. Cytologia 50: Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA isolation 583–592. procedure for small quantities of fresh leaf tissue. Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a Phytochem. Bull. 19: 11–15. chromosome atlas of the New Zealand flora – 25 mis- Endress, P. K. & E. M. Friis. 1994. Introduction – Major cellaneous species. New Zealand J. Bot. 21: 13–20. trends in the study of early flower evolution. Pl. Syst. Burger, W. C. 1977. The Piperales and the monocots: al- Evol., Suppl. 8: 1–6. ternate hypotheses for the origin of monocotyledon- Frenzke, L., E. Scheiris, G. Pino, L. Symmank, P. Goet- ous flowers. Bot. Rev. (Lancaster). 43: 345-393. ghebeur, C. Neinhuis, S. Wanke & M. S. Samain. Chiang, T. Y., A. S. Barbara & P. I. Ching. 1998. Univer- 2015. A revised infrageneric classification of the ge- sal primers for amplification and sequencing a non- nus Peperomia (Piperaceae). Taxon 64: 424–444. coding spacer between the atpB and rbcL genes of Frenzke, L., P. Goetghebeur, C. Neinhuis, M. S. Samain chloroplast DNA. Bot. Bull. Acad. Sin. 39: 245–250. & S. Wanke. 2016. Evolution of Epiphytism and Fruit 16 Acta Phytotax. Geobot. Vol. 70
Traits Act Unevenly on the Diversification of the Spe- & J. P. Huelsenbeck. 2012. MRBAYES 3.2: Efficient cies-Rich Genus Peperomia (Piperaceae). Front. Pl. Bayesian phylogenetic inference and model selection Sci. 7: 1145. across a large model space. Syst. Biol. 61: 539–542. Johnson, L. A. & D. E. Soltis. 1995. Phylogenetic infer- Samain M. S., S. Wanke, G. Mathieu, C. Neinhuis & P. ence using matK sequences. Ann. Missouri Bot. Goetghebeur. 2008. Verhuellia revisited–unravelling Gard. 82: 149–175. an intricate taxonomical history and a new subfamil- Jose, J., J. E. Thoppil & L. Mathew. 1992. Chromosome ial classification of Piperaceae. Taxon 57:583–587. complement analysis in five species of Peperomia Samain M. S., L. Vanderschaeve, P. Chaerle, P. Goetghe- Ruiz and Pav. Cytologia 57: 227–229. beur, C. Neinhuis & S. Wanke. 2009. Is morphology Jose, J., J. E. Thoppil & L. Thomas. 1994. Karyotype telling the truth about the evolution of the species rich analysis in Peperomia Ruiz & Pav. Caryologia 47: genus Peperomia (Piperaceae)? Pl. Syst. Evol. 278: 75–79. 1–21. Katoh, K., K. Kuma, H. Toh & T. Miyata. 2005. MAFFT Samuel, R. & W. Morawetz. 1989. Chromosomal evolu- version 5: improvement in accuracy of multiple se- tion within Piperaceae. Pl. Syst. Evol. 166: 105–117. quence alignment. Nucl. Acids Res. 33: 511–518. Sanders, R. W., T. F. Stuessy & R. Rodriguez. 1983. Chro- Kozlov, A. M., D. Darriba, T. Flouri, B. Morel & A. Sta- mosome numbers from the flora of the Juan Fernan- matakis. 2018. RAxML-NG: A fast, scalable, and us- dez Islands. Amer. J. Bot. 70: 799–810. er-friendly tool for maximum likelihood phylogenetic Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. inference. bioRxiv. doi:10.1101/447110. Miller, K. C. Siripun, C. T. Winder, E. E. Schilling & Lemoine, F., J. B. Entfellner, E. Wilkinson, D. Correia, R. L. Small. 2005. The tortoise and the hare II: rela- M. D. Felipe, T. D. Oliveira & O. Gascuel. 2018. Re- tive utility of 21 noncoding chloroplast DNA se- newing Felsenstein’s phylogenetic bootstrap in the quences for phylogenetic analysis. Amer. J. Bot. 92: era of big data. Nature 556: 452–456. 142–166. Liston, A. & J. W. Kadereit. 1995. Chloroplast DNA evi- Smith, J. B. 1966. Chromosome numbers in Peperomia dence for introgression and long distance dispersal in Ruiz & Pav. (Piperaceae) and a note on chromosome the desert annual Senecio flavus (Asteraceae). Pl. number of Piper magnificum Trelease. Kew Bull. 20: Syst. Evol. 197: 33–41. 521–526. Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1998. Smith, J. F., A. Stevens, E. J. Tepe & C. Davidson. 2008. Cytological studies in south Indian Piperaceae II. Placing the origin of two species-rich genera in the Peperomia. J. Cytol. Genet. 33: 155–158. late cretaceous with later species divergence in the Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1999. tertiary: a phylogenetic, biogeographic and molecular Cytology and its bearing on the systematics and phy- dating analysis of Piper and Peperomia (Piperaceae). logeny of the Piperaceae. Cytologia 64: 301–307. Pl. Syst. Evol. 275: 9–30. Murray, B. G. & P. J. Lange. 1999. Contributions to a Spooner, D. M., T. F. Stuessy, D. J. Crawford & M. Silva. chromosome atlas of the New Zealand flora – 35. Mis- 1987. Chromosome numbers from the flora of the cellaneous families. New Zealand J. Bot. 37: 511–521. Juan Fernandez Islands II. Rhodora 89: 351–356. Neinhuis, C., K. W. Hilu, K. Müller & T. Borsch. 2005. Steele, K. P. & R. Vigalys. 1994. Phylogenetic analyses of Phylogeny of Aristolochiaceae based on parsimony, Polemoniaceae using nucleotide sequences of the likelihood, and Bayesian analyses of trnL-trnF se- plastid gene matK. Syst. Bot. 19: 126–142. quences. Pl. Syst. Evol. 250: 7–26. Taberlet, P., L. Gielly, G. Pautou & J. Bouvet. 1991. Uni- Okada, H. 1986. Karyomorphology and relationships in versal primers for amplification of three non-coding some genera of Saururaceae and Piperaceae. Bot. regions of chloroplast DNA. Pl. Molec. Biol. 17: Mag. (Tokyo) 99: 289–299. 1105–1109. Ono, M. 1977. Cytotaxonomical studies on the flowering Takhtajan, A. 1969. Flowering Plants, Origin and Disper- plants endemic to the Bonin Islands. Mem. Nat. Sci. sal, Eng. ed. Oliver & Boyd, Edinburgh. Mus., no. 10: 63–76. (in Japanese with English sum- Tamura, M. 1974. Phylogeny and Classification of the An- mary). giosperms. Sanseido, Tokyo (in Japanese). Ooi, K., Y. Endo, J. Yokoyama & N. Murakami. 1995. Trelease, W. & G. T. Yuncker. 1950. The Piperaceae of Useful primer designs to amplify DNA fragment of northern South America. University of Illinois Press, the plastid gene matK from angiosperm plants. J. Jap. Urbana, Illinois. Bot. 70: 328–333. Tropicos.org. Missouri Botanical Garden.
1992. Evolution of Peperomia (Piperaceae) in the Bot. 99: 1231–1238. Juan Fernandez Islands, Chile. Pl. Syst. Evol. 182: White, T. J., T. D. Bruns, S. B. Lee & J. W. Taylor. 1990. 107–119. Amplification and direct sequencing of fungal ribo- Wang, W., Y. Wu, Y. Yan, M. Ermakova, R. Kerstetter & somal RNA genes for phylogenetics. In: Innis, M. A., J. Messing. 2010. DNA barcoding of the Lemnaceae, D. H. Gelfand, J. J. Sninsky, & T. J. White (eds.), PCR a family of aquatic monocots. B. M. C. Pl. Biol. 10: Protocols: A Guide to Methods and Applications, pp. 205. 315–322. Academic Press, San Diego. Wanke, S., M. S. Samain, L. Vanderschaeve, G. Mathieu, Yamamoto, N., H. Ikeda & T. Hoshino. 2008. Cytotaxo- P. Goetghebeur & C. Neinhuis. 2006. Phylogeny of nomical studies of flowering plants in Yakushima Is- the genus Peperomia (Piperaceae) inferred from the land, Kagoshima Prefecture, Japan. Part I: dwarf trnK/matK region (cpDNA). Pl. Biol. (Stuttgart). 8: taxa. J. Phytogeogr. Taxon. 56: 79–93. 93–102. Yonekura, K. 2015. Piperaceae. In: Ohashi, H., Y. Kadota, Wanke, S., M. A. Jaramillo, T. Borsch, M. S. Samain, D. J. Murata & K. Yonekura (eds.), Wild Flowers of Ja- Quandt & C. Neinhuis. 2007. Evolution of Piperales pan 1, pp. 55–56. Heibonsha, Tokyo (in Japanese). – matK gene and trnK intron sequence data reveal lin- Yuncker, T. G. 1953. The Piperaceae of Argentina, Bo- eage specific resolution contrast. Molec. Phylogen. livia and Chile. Lilloa 27: 97–303. Evol. 42: 477–497. Zuloaga, F. O., O. Morrone & M. J. Belgrano. 2008. Wanke, S., L. Vanderschaeve, G. Mathieu, C. Neinhuis, P. Piperaceae. In: Zuloaga, F. O., O. Morrone & M. J. Goetghebeur & M. S. Samain. 2007. From forgotten Belgrano (eds.), Catálogo de las plantas vasculares taxon to a missing link? The position of the genus del Cono Sur. Monogr. Syst. Bot. Missouri Bot. Gard. Verhuellia (Piperaceae) revealed by molecules. Ann. 107: 2712–2730.
Received May 7, 2018; accepted August 21, 2018