Xenosensor Regulation of Enzymes and Transporters in Drug Exposure and Disease

Item Type text; Electronic Dissertation

Authors Merrell, Matthew David

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 28/09/2021 02:15:49

Link to Item http://hdl.handle.net/10150/194051

XENOSENSOR REGULATION OF ENZYMES AND TRANSPORTERS IN DRUG EXPOSURE AND DISEASE

Matthew D. Merrell

______

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF PHARMACOLOGY AND TOXICOLOGY

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2011 2

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Matthew D. Merrell entitled XENOSENSOR REGULATION OF ENZYMES AND TRANSPORTERS IN DRUG EXPOSURE AND DISEASE and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy

______Date: Jan. 5, 2011 Nathan J. Cherrington

______Date: Jan. 5, 2011 A. Jay Gandolfi

______Date: Jan. 5, 2011 Donna D. Zhang

______Date: Jan. 5, 2011 Catharine L Smith

______Date: Jan. 5, 2011 Qin M. Chen

Final approval and acceptance of this dissertation is contingent upon the candidate's submission of the final copies of the dissertation to the Graduate College. I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.

______Date: Jan. 5, 2011

Dissertation Director: Nathan J Cherrington

STATEMENT BY THE AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgement of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment the proposed use of the material is in the interest of scholarship. In all other instances, however, permission must be obtained from the author.

SIGNED:

Matthew Merrell 4

FUNDING ACKNOWLEDGEMENTS

The research presented in this dissertation was supported in part by grants from the

National Institutes of Health (ES011646, DK068039, ES007091, ES006694, ES09716,

ES09649, and DK46546) and the Health Research Alliance Arizona.

ACKNOWLEDGEMENTS

I would like to express my gratitude to several people who have been instrumental in helping me complete this dissertation and survive graduate school.

Members of the department of Pharmacology and Toxicology (students, staff, and faculty) provided friendship, knowledge, and support, without which these five years would have been much more difficult, and much less pleasant. Special thanks go to

Nancy Colbert for her help in navigating the red tape of graduate school. I also greatly appreciate the support and help of my committee members, especially Dr. Donna Zhang and the members of her lab who shared their expertise and their equipment.

During these last five years, my growth as a scientist and as a professional has been shaped by the examples and friendship of those I worked with everyday. To Andy,

Craig, Lisa, Rhiannon, April, Mark and Lisa; thanks for making the Cherrington lab such a great place to work. Most importantly, I would like to recognize the support, mentoring, and friendship of Dr. Nathan Cherrington. In working with Dr. Cherrington, I have been able to acquire and develop techniques and skills that will serve me well long after I have left the bench. I am thankful for the opportunities that he has opened and the things that he has taught. I know that without his active participation in my scientific and professional development, I would not be where I am today.

DEDICATION

This dissertation is dedicated to Naomi, Gabriel, Andrew, and most of all to

Valerie, who provide me with the purpose for pursuing this degree, the motivation to get through the hard times, and the perspective to realize how importance this work really is.

I love you.

TABLE OF CONTENTS

LIST OF FIGURES ...... 12

ABSTRACT ...... 13

INTRODUCTION ...... 15

Pharmacokinetics and Xenobiotic Exposure ...... 15

Hepatic Structure and Hepatocyte Polarity ...... 16

Hepatic Metabolism ...... 18

Cytochrome P450 Metabolism ...... 19

Conjugative Metabolism ...... 21

Hepatic Transport ...... 22

Hepatic Uptake Transport...... 23

Hepatic Efflux Transport ...... 25

Xenosensors ...... 27

Nuclear Receptors ...... 29

Constitutive Androstane Receptor ...... 32

Pregnane X Receptor ...... 36

Aryl Hydrocarbon Receptor ...... 38

Nuclear Factor (erythroid-derived 2)-like 2 ...... 41

Impact of Hepatic Diseases on Xenosensors and Drug Processing ...... 44

Cholestasis ...... 44

Nonalcoholic Fatty Liver Disease ...... 48

PRESENT STUDY ...... 54

FUTURE DIRECTIONS ...... 57

REFERENCES ...... 60 8

TABLE OF CONTENTS - Continued

APPENDIX A: INDUCTION OF DRUG METABOLISM ENZYMES

AND TRANSPORTERS BY OLTIPRAZ IN RATS ...... 70

Abstract ...... 70

Introduction ...... 71

Materials and Methods ...... 73

Results ...... 75

Discussion ...... 77

References ...... 81

Figures ...... 85

APPENDIX B: THE NRF2 ACTIVATOR OLTIPRAZ ALSO ACTIVATES

THE CONSTITUTIVE ANDROSTANE RECEPTOR ...... 90

Abstract ...... 90

Introduction ...... 91

Materials and Methods ...... 94

Results ...... 97

Discussion ...... 99

References ...... 104

Figures ...... 108

APPENDIX C: INVOLVEMENT OF THE NRF2/KEAP1

ANTI-OXIDANT RESPONSE IN THE REGULATION OF ABCC3 ...... 115

Abstract ...... 115

Introduction ...... 116

Materials and Methods ...... 118 9

TABLE OF CONTENTS - Continued

Results ...... 121

Discussion ...... 123

References ...... 128

Tables and Figures ...... 133

APPENDIX D: DRUG METABOLISM ALTERATIONS DURING

NONALCHOHOLIC FATTY LIVER DISEASE ...... 138

Abstract ...... 138

Nonalcoholic Fatty Liver Disease ...... 139

Prevalence ...... 139

Histology/Etiology...... 141

Diagnosis ...... 143

Effects ...... 145

Modeling Human Disease ...... 146

Drug Metabolism in NAFLD ...... 148

Phase I ...... 149

CYP1A ...... 149

CYP2A ...... 151

CYP2B ...... 151

CYP2C ...... 152

CYP2D6 ...... 153

CYP2E1 ...... 153

CYP3A ...... 155

Minor Enzymes ...... 156 10

TABLE OF CONTENTS - Continued

Phase II ...... 157

Sulfotransferases ...... 157

UDP-Glucuronosyltransferases ...... 158

Glutathione and Glutathione-S-Transferases ...... 159

Glutathione Content and Synthesis ...... 160

Mechanisms ...... 161

Cytokines ...... 161

Nuclear Receptors ...... 162

CAR/PXR ...... 162

Hnf4α ...... 163

Oxidative Stress Signaling ...... 163

Conclusions ...... 164

References ...... 167

Tables ...... 181

APPENDIX E: ACETAMINOPHEN DISPOSITION: METABOLOMIC

BIOMARKER FOR NON-ALCOHOLIC FATTY LIVER DISEASE ...... 187

Abstract ...... 187

Introduction ...... 188

Materials and Methods ...... 191

Results ...... 193

Discussion ...... 194

References ...... 200

Table and Figures ...... 205 11

TABLE OF CONTENTS - Continued

APPENDIX F: THE CONSTITUTIVE ANDROSTANE RECEPTOR:

PHARMACOLOGICAL AND TOXICOLOGICAL INTERACTIONS ...... 210

Abstract ...... 210

Nuclear Receptors ...... 210

Constitutive Androstane Receptor ...... 214

CAR Regulation ...... 215

Nuclear Interactions ...... 218

CAR Activity Modulators ...... 221

Clinical Significance ...... 222

References ...... 227

APPENDIX G: HUMAN SUBJECTS AND ANIMAL RESEARCH APPROVAL ...... 234

LIST OF FIGURES

Figure 1. Hepatic architecture and functional zones ...... 17

Figure 2. Generic nuclear receptor structure and DNA binding motifs ...... 31

ABSTRACT

A large and varied array of xenobiotics (foreign chemicals) enters into our bodies every day. In order to prevent toxicity resulting from xenobiotic accumulation, the body has developed a complex and integrated network of enzymes and transporters to promote and control the metabolism and excretion of drugs and other compounds. Drug metabolizing enzymes are classified as oxidative (Phase I) or conjugative (Phase II), and generally result in increased hydrophilicity of their substrates. Drug transporters actively route xenobiotics into (Phase 0) or out of (Phase III) the cells.

The expression of the proteins involved in drug metabolism and transport are coordinately regulated by xenosensing transcription factors, including the constitutive androstane receptor, the pregnane X receptor, the aryl hydrocarbon receptor, and Nrf2.

Through the activation of these xenosensors, chemical exposure itself induces the processes which help to remove the xenobiotics from the body. The liver is the major organ of drug metabolism in the body. Chronic hepatic diseases impact the activity of xenosensors and the expression of their enzyme and transporter gene targets.

Nonalcoholic fatty liver disease (NAFLD) is the most prevalent liver disease in the United

States, affecting 20-30% of the populations. This profoundly underdiagnosed disease has significant effects on hepatic gene expression and may increase the risk of adverse drug reactions and xenobiotic toxicity in affected patients.

This manuscript presents original research which contributes to our understanding of xenosensor function in the contexts of chemical exposure and liver disease. Manuscripts in this dissertation investigate 1) the induction profile and mechanisms of the experimental therapeutic agent oltipraz, 2) the xenosensor-regulated mechanisms of induction of the drug transporter ABCC3, 3) the impact of NAFLD on the 14

expression of major drug metabolizing enzymes, and 4) the utility of altered drug disposition as a biomarker for NAFLD progression. The findings of these studies highlight the clinical importance of xenosensor activation and the potential pharmacological and toxicological consequences of hepatic disease.

INTRODUCTION

Pharmacokinetics and Xenobiotic Exposure

The human body is exposed to numerous and diverse chemicals every day, contained in the food we eat and the medicines and supplements we ingest. These compounds, either naturally occurring or synthetic, may be toxic and must be eliminated from the body to prevent accumulation and damage. In order to control the clearance of these xenobiotics (foreign compounds), several overlapping and dependent processes have been adapted from the inherent physiological mechanisms responsible for the metabolism and transport of endogenous compounds. The combined effect that these physiological processes have upon the accumulation, biotransformation and elimination of xenobiotics is termed pharmacokinetics.

The pharmacokinetics of any compound is dependent upon (1) the physical and chemical characteristics of the compound and (2) the activity of metabolic and transport processes within the body. Each of these parameters is influenced by the principles of lipophilicity and hydrophilicity. In general, non-polar compounds interact unfavorably with polar compounds (such as water), while polar compounds interact unfavorably with non- polar chemicals (such as lipids). Because cellular membranes are lipid in nature, hydrophilic compounds are unable to pass through the membranes, while lipophilic compounds passively diffuse into and out of tissues and cells. Hydrophilic compounds are instead dependent on cellular transport processes to enter and exit the cell.

The body is able to chemically modify xenobiotics through the activity of metabolic enzymes. In general, xenobiotic metabolizing enzymes (or drug metabolizing enzymes) act to convert substrates to more hydrophilic metabolites. This occurs through processes such as oxidation, reduction, hydrolysis, or through conjugation to a set of 16

endogenous molecules (discussed below). In addition to increasing the hydrophilicity of xenobiotics, conjugation can provide increased substrate specificity with cellular transporters. These metabolic processes in effect trap the metabolized compound within the cell and allow the cellular transport proteins to better control the movement and distribution of the metabolite. Because oxidative metabolism may precede conjugative metabolism, the process of drug metabolism is often divided into two categories: Phase I

(oxidative) and Phase II (conjugative). Because of the importance of transport to metabolism and drug clearance, some have integrated transport processes into this paradigm and have termed drug uptake as Phase 0 and drug efflux as Phase III.

Hepatic Structure and Hepatocyte Polarity

Drugs and other xenobiotics entering the body from the digestive tract are carried in the blood by the portal vein to the liver. This exposes the liver to these compounds prior to their entering systemic circulation. The liver is the major site of drug metabolism in the body, and drug metabolizing enzymes and transport proteins are highly expressed in hepatocytes. A brief description of liver architecture and hepatocyte polarity may be useful in understanding the role of the liver in determining pharmacokinetics.

At the histological level, the liver is divided into lobules, each lobule containing a centrally located hepatic venule which is commonly known as the central vein (see

Figure 1a). Surrounding this central vein are several portal triads, each containing a single portal venule, hepatic arteriole, and bile duct. Hepatic capillaries (known as sinusoids) drain blood from the hepatic artery and portal vein to the central vein. These sinusoids are lined by loosely joined endothelial cells and pass through and around interconnected plates of hepatocytes, the primary cell type of the liver. Within the plates 17

Figure 1. Hepatic architecture and functional zones. (a) The histological structure of the liver lobule includes a central vein surrounded by several portal triads. (b) The functional zones (1-3) of the liver. Adapted from Zorn (2008).

of hepatocytes, bile canaliculi are formed by the tight junctions connecting individual hepatocytes. Bile in the canaliculi flows from the region of the central vein toward the bile duct located at the portal triad. Bile formation is largely dependent upon the vectorial transport of bile acids and other solutes from the blood, across the hepatocytes, and into the bile ducts.

Functionally, hepatocytes are defined most appropriately by their relative proximity to the source of blood flow and by their metabolic function. Gradients of blood oxygenation, bile acid concentration, and metabolic activity are found between the portal triad and the central vein (see Figure 1B). Cells in the region nearest the portal triad

(termed periportal or zone 1 hepatocytes) experience the highest levels of oxygen and are the site of fatty acid oxidation, gluconeogenesis, and bile salt extraction. At the other end of the gradient, cells surrounding the central vein (termed centrilobular or zone 3 hepatocytes) receive the lowest levels of oxygen, and are the major site of xenobiotic and drug metabolism.

Hepatic Metabolism

As mentioned above, both Phase I and Phase II drug metabolism usually generate more hydrophilic compounds which then require controlled transport processes to pass through cellular membranes. An estimated 90% of Phase I metabolism is carried out by enzymes belonging to the cytochrome P450 (CYP) superfamily (Lewis and Ito,

2009). Approximately 60 distinct CYP genes exist in humans, and these have been divided into families and subfamilies based on gene homology. The major drug metabolizing enzymes are members of three families, namely CYP1, CYP2, and CYP3.

It is estimated that 75% of all drug metabolism involves CYP enzymes (Guengerich,

2008). 19

Conjugation reactions of Phase II metabolism involve the transfer of one of several endogenous molecules to a functional group (-COOH, -OH, -SH, -NH2) on the drug. The most relevant Phase II processes involve conjugations with glutathione, glucuronide, and sulfonate, though other reactions conjugating amino acids, methyl- or acetyl-groups, do occur. Enzymes which catalyze these reactions are termed transferases.

Cytochrome P450 Metabolism

Among hepatic CYP enzymes, CYP3A has the highest levels of expression, as well as the largest number of clinical substrates. Following CYP3A in the percent of drugs metabolized are CYP2C9, 2D6, 2C19, and 1A2. Other CYP enzymes, including

2A6 and 2E1, metabolize only 6% of clinically relevant drugs (Zanger et al., 2005). As part of this introduction, relevant details about these drug metabolizing CYPs will be briefly discussed.

CYP1A2 and CYP2B6 account for less than 20% of total hepatic CYP content

(13% and 6%, respectively), yet because of their inducibility both are well studied. The details of their induction are described below. CYP1A2 is responsible for the metabolism of approximately 15% of therapeutic drugs including adenosine receptor inhibitors, analgesics, antiarrhythmic drugs, anticancer drugs, anticoagulants, antidepressants, antihistamines, antihypertensive drugs, antipsychotics, -blockers, cyclooxygenase-2 inhibitors, anesthetics, and drugs from several other classes (Zhou et al., 2009).

CYP2B6 plays a minor role in the metabolism of around 10% of therapeutic drugs, and substrate specificity for this enzyme overlaps significantly with several other CYP2 family members. 20

Three distinct isoforms of the CYP2C family are expressed in the human liver, namely CYP2C8, CYP2C9 and CYP2C19. Though these three enzymes together account for only 20% of the total hepatic CYP content (Hewitt et al., 2007), they are able to metabolize over one-half of commonly prescribed drugs (Nebert and Russell, 2002).

These isoforms are differentially expressed and have important differences in their selectivity toward substrates. CYP2C9 is the most clinically important family member, followed by CYP2C19. CYP2C drug substrates include anticonvulsant drugs, anticoagulants, antidiabetic drugs, proton pump inhibitors, anticancer drugs, and nonsteroidal anti-inflammatory drugs.

While CYP2D6 comprises only 2-8% of hepatic CYPs, it metabolizes 25% of therapeutic drugs, including antidepressants, neuroleptics, opioids, antiemetics, antiarrhythmics, -blockers, antihistamines, and anti-HIV drugs (Wang et al., 2009).

CYP2D6 is significantly polymorphic and has been the subject of extensive pharmacogenetic research. Large interindividual variations in CYP2D6 occur in the population, with varying percentages of ultrarapid, extensive, intermediate, and poor metabolizing phenotypes observed.

CYP2E1 plays a relatively minor role in drug metabolism, as less than 5% of all drugs are metabolized by the enzyme. These drug substrates include several anesthetics, as well as acetaminophen, phenobarbital, fluoxetine, theophyline, and chlorzoxazone (Tanaka et al., 2000). However, CYP2E1 plays an important role in several liver diseases, and has been shown to metabolize several non-drug substrates including alcohol, acetone, benzene, fatty acids, carbon tetrachloride, and nitrosamines

(Lu and Cederbaum, 2008). CYP2E1 activity is increased by exposure to its own 21

substrates. Interestingly, this induction is caused by increased stabilization of substrate- bound enzyme, often without increased mRNA expression (Gonzalez, 2007).

As mentioned above, CYP3A is the most important CYP enzyme in the liver.

Multiple CYP3A isoforms exist in humans, including CYP3A4, CYP3A5, CYP3A7, and

CYP3A43. CYP3A4 is the most clinically relevant, due to the low expression of the other isoforms (Daly, 2006). CYP3A4/5 accounts for some 30% of hepatic CYPs and is responsible for the metabolism of over 50% of drugs (Hewitt et al., 2007). Drugs metabolized by CYP3A4 belong to almost all drug classes (reviewed by Zhou, 2008).

CYP3A4 expression and activity are highly variable, due to both genetic and environmental factors.

Conjugative Metabolism

Sulfotransferase (SULT) enzymes catalyze the transfer of sulfonate from the cofactor 3’-phosphoadenosine 5’-phosphosulphate (PAPS) to substrate compounds including drugs and endogenous hormones. Sulfonation is a high affinity, low capacity process, and is the major detoxication mechanism in fetal and neonatal livers. Drug metabolizing SULTs belong to SULT1 and SULT2 families (Nowell and Falany, 2006).

There is significant overlap in the substrate selectivity between sulfonation and glucuronidation, with sulfonation predominating at low level exposures (Zamek-

Gliszczynski et al., 2006b). Common SULT substrates include acetaminophen, albuterol, terbutaline, methyldopa, and hormonal contraceptives (Liston et al., 2001;Edelman et al.,

2010).

The conjugation of uridine diphosphate (UDP)-glucuronide to xenobiotics is catalyzed by UDP-glucuronosyltransferases (UGT). In comparison to sulfonation, glucuronide conjugation is a low affinity, high capacity process, and predominates at 22

high substrate concentrations (Zamek-Gliszczynski et al., 2006b). Two UGT families exist in humans, UGT1 and UGT2, and hepatic drug metabolizing isoforms belong to

UGT1A and UGT2B subfamilies. It has been reported that significant substrate overlap exists between UGT isoforms. Several NSAIDS and opioids have been characterized as

UGT substrates, as well as anxiolytics, antidepressants, and antipsychotics (Liston et al.,

2001). UGTs are also involved in the metabolism of endogenous compounds, such as bilirubin, bile acids, and hormones.

Glutathione is a relatively stable tripeptide (glutamate, cysteine, and glycine) present in high concentrations in hepatocytes. Glutathione-S-transferases (GST) catalyze the conjugation of glutathione with electrophilic compounds, including parent drugs and Phase I metabolites. In comparison to other Phase II processes which conjugate reactive cofactors to stable substrates, GSTs conjugate a stable cofactor to reactive substrates (Zamek-Gliszczynski et al., 2006b). Drug metabolizing GST enzymes are largely cytosolic, and the human enzymes have been grouped into multiple classes named alpha, pi, mu, theta, and kappa (Hayes et al., 2005).

Hepatic Transport

The proteins responsible for hepatic transport can be defined by a number of characteristics including location, mechanism, and direction. As mentioned before, hepatocytes are polarized cells with the basolateral membrane facing the sinusoidal blood and the apical membrane facing the bile canaliculi. Hepatic transporters are differentially expressed at one or the other of these membranes. These proteins generally transport their substrates in one specific direction, either promoting the uptake of compounds into the hepatocyte or the efflux of compounds out of the hepatocyte.

Finally, two general mechanisms are employed by these drug transporters, either 23

primary or secondary active transport. Primary active transport utilizes energy derived from the direct hydrolysis of ATP. Secondary active transport utilizes the linked transport of a cosubstrate down its electrochemical gradient. In summary, hepatic transporters are either sinusoidal or canalicular, uptake or efflux, and primary or secondary active transporters.

As expected from the general vectorial flow of solutes from the blood, across hepatocytes, and into the bile, uptake transporters are localized at the sinusoidal membrane of the cells. These uptake transporters are members of the solute carrier

(SLC) superfamily and often utilize existing ionic gradients as energy to transport their substrates. Conversely, hepatic efflux transporters are located at both the sinusoidal or canalicular membrane and are powered by direct hydrolysis of ATP. These efflux transporters belong to the ATP binding cassette (ABC) superfamily.

Hepatic Uptake Transport

Organic Anion Transporting Polypeptides (OATP) are members of the SLCO family located on the basolateral membrane of hepatocytes and are responsible for substrate uptake from the sinusoidal blood. OATP1B1 and OATP1B3 are the primary isoforms expressed in human livers. There is some evidence for zone specific expression of OATP members within the lobule, with OATP1B3 expression observed to be mainly contrilobular. While OATP substrates are varied, they often contain steroidal or peptide structural backbones and may be anionic or cationic (Klaassen and

Aleksunes, 2010). Identified OATP substrates include endogenous compounds (DHEA- sulfate, estrone-3-sulfate, bilirubin conjugates, cholic acid, thyroxine) as well as a number of therapeutic drugs (fexofenadine, fluvastatin, rosuvastatin, saquinavir, 24

benzylpenicillin, rifampicin, paclitaxel, irinotecan, valsartan) (Klaassen and Aleksunes,

2010).

Organic Cation Transporters (OCT) belong to the SLC22A family and include members OCT1, OCT2, and OCT3. OCT1 is highly expressed in centrilobular hepatocytes and is the only family member significantly expressed in the liver. Identified substrates of OCT1 include neurotransmitters acetylcholine and serotonin, antiviral drugs acyclovir and ganciclovir, antimalarial drug quinine, antidiabetic drug metformin, and histamine receptor antagonists ranitidine and cimetidine (Klaassen and Aleksunes,

2010).

Organic Anion Transporters (OAT) are close relatives of OCTs, and also belong to the SLC22A family. OAT2 is the primary liver OAT in humans and is expressed at the sinusoidal membrane. OAT2 is able to transport drugs (methotrexate, valproic acid, allopurinol, acetylsalicylate, paclitaxel, tetracycline) and endogenous compounds (cyclic

AMP, DHEA-sulfate, estrone-3-sulfate, prostaglandins) (Klaassen and Aleksunes, 2010).

The sodium taurocholate cotransporting polypeptide (NTCP, SLC10A1) is responsible for the basolateral uptake of several bile acids. While this transporter is not a major drug transporter, it plays a vital role in the maintenance of bile flow that is required for efficient hepatic elimination of drugs and other xenobiotics. The sodium dependent transport of NTCP is thought to be the major mechanism of bile acid transport into hepatocytes (Kosters and Karpen, 2008). Combined with uptake from OATP family members, it is estimated that more than 75% of bile acids passing through the liver are taken up into hepatocytes.

Hepatic Efflux Transport

Hepatic efflux transporters are generally members of the ATP-binding cassette

(ABC) transporter family. ABC transporters have undergone several changes in naming conventions, but are now grouped according to gene homology. The major hepatic drug efflux transporters include members of the ABCB, ABCC, and ABCG family. Aberrant expression of these ABC transporters can result in multidrug resistance to cancer chemotherapy, by increasing the efflux of anticancer drugs from tumor cells (Chen,

2010).

The ABCB1 gene encodes the first described drug transporter, commonly known as P-glycoprotein (PGP) or MDR1. ABCB1 resides on the canalicular membrane of hepatocytes, and is responsible for effluxing substrate drugs for elimination in the bile.

ABCB1 was discovered because of its activity towards anticancer drugs, yet a large variety of other drug classes are substrates of this transporter. These include statins, antivirals, antiparasitics, antidiarrheals, hypertension drugs, allergy drugs, and antiepileptics (Klaassen and Aleksunes, 2010).

The other hepatic ABCB family members are principally responsible for the canalicular efflux of endogenous substrates. ABCB4 (MDR3) is a primary transporter of phospholipids such as phospatidylcholine, while ABCB11 (also known as the bile salt export pump) transports conjugated bile acids (Klaassen and Aleksunes, 2010).

Mutation of either of these transporters can significantly impact the volume or composition of bile flow, resulting in a genetic disorder known as progressive familiar intrahepatic cholestasis (PFIC) (Davit-Spraul et al., 2009).

Members of the ABCC transporter family are commonly known as Multidrug

Resistance-Associated Proteins or MRPs. Clinically relevant hepatic family members 26

include ABCC2, ABCC3, and ABCC4. Like ABCB1 and ABCB4, ABCC2 is expressed on the apical membrane of hepatocytes, effluxing substrates into the bile. A major subset of

ABCC2 substrates are phase II metabolites, including conjugates of glutathione, glucuronide, and sulfonate. Parent drugs transported by ABCC2 include antibiotics, antivirals, and anticancer drugs (Klaassen and Aleksunes, 2010). The genetic disorder resulting from loss of ABCC2 function, known as Dubin-Johnson syndrome, consists of accumulation of conjugated bilirubin (chronic jaundice) and is relatively benign.

In contrast to ABCC2, ABCC3 and ABCC4 are expressed on the basolateral membrane of hepatocytes. While drug elimination often follows bile flow from the sinusoids into the canaliculi, the expression of ABCC3 and ABCC4 at the sinusoidal membrane provides an alternate pathway back into systemic circulation. Compounds effluxed by ABCC3 and ABCC4 would then be available to undergo urinary elimination.

There is considerable overlap between these two transporters and ABCC2. Like ABCC2, they are capable of transporting endogenous substrates such as folate, bilirubin, and conjugated bile acids (Klaassen and Aleksunes, 2010). While sinusoidal efflux of sulfonate conjugates is performed by both ABCC3 and ABCC4, it appears that the sinusoidal efflux of glucuronide conjugates is solely a function of ABCC3 (Zamek-

Gliszczynski et al., 2006a). Other substrates of these transporters include furosemide, etoposide, methotrexate, leucovorin, adefovir, and tenofovir.

The final major drug transporter in hepatocytes is ABCG2, also known as the breast cancer resistance protein (BCRP). ABCG2 is located on the apical membrane of hepatocytes and, with ABCC2, is responsible for the canalicular efflux of a numbers of compounds including anticancer drugs, antibiotics, antivirals, statins, and carcinogens, 27

as well as both glucuronide- and sulfonate-conjugated metabolites (Klaassen and

Aleksunes, 2010).

Xenosensors

The prevention of toxic xenobiotic accumulation in the body requires significant cooperation between processes of drug metabolism and transport. Uptake transporters introduce substrates for both metabolic enzymes and efflux transporters, while metabolic enzymes produce additional substrates for efflux from the cells. The expression and activity of the proteins involved in Phase 0, I, II, and III drug elimination are coordinately regulated by several distinct transcription factors. These factors belong to diverse gene families and have varied mechanisms of activation, but have evolved significant overlap in both xenobiotic recognition and genes targeted.

Nuclear receptors such as the constitutive androstane receptor (CAR, NR1I3),

and the pregnane X receptor (PXR, NR1I2), as well as transcription factors such as the

aryl hydrocarbon receptor (AhR, AHR) and the nuclear factor (erythroid-derived 2)-like 2

(Nrf2, NFE2L2), each play an integral role in regulating the cellular response to

xenobiotic exposure. These xenosensing transcription factors, or xenosensors, are

exceptional in their ability to detect a diverse library of xenobiotic compounds and to

generate a coordinated response that protects the exposed cell from any toxic effects of

the compound. While the specific details of the responses differ somewhat between

xenosensors, induction of hepatic drug metabolism and transport are central to each.

The following are a few clinical examples of the impact that activation of these

xenosensors can have on the activity of drug metabolism and transport with significant

results in therapeutic outcome. 28

Alterations in the expression of metabolic enzymes by CAR can affect the metabolism and elimination of a number of drugs, possibly increasing the potential for adverse drug reactions or increased toxicity. CAR has been shown to modulate the toxicity of the popular analgesic acetaminophen (APAP) (Zhang et al., 2002). High levels of APAP are capable of activating CAR, which then can induce CYP enzymes. The metabolism of APAP, the majority of which occurs in the liver, has been well characterized. Oxidative metabolism by CYP enzymes results in the generation of the toxic metabolite, N-acetyl parabenzoquinone imine (NAPQI). NAPQI is conjugated to glutathione, detoxicating the molecule and allowing for increased clearance. However, high levels of NAPQI may deplete the cellular glutathione stores, and excess unconjugated NAPQI covalently binds to cellular proteins and nucleic acids (Henderson et al., 2000). Following APAP treatment, CAR-null mice exhibited decreased production of CYP enzymes compared to wild type mice. Furthermore, the CAR-null animals were more resistant to NAPQI toxicity, and CAR inhibition reversed the hepatotoxicity in wild type but not in CAR-null mice (Zhang et al., 2002).

PXR activation is responsible for the induction of CYP3A and ABCB1 by a number of compounds, and exposure to these PXR activators can significantly affect drug clearance and efficacy. The herbal medicine St John's wort (Hypericum perforatum), used in the treatment of mild depression, is a known activator of PXR.

Consumption of this compound significantly increases the clearance of HIV drugs, antidepressants, and oral contraceptives, increasing the risk of therapeutic failure (Xie and Kim, 2005)

Because of its ability to induce protective enzymes and transporters, Nrf2 activators have been investigated as chemopreventitive agents (chemicals which 29

prevent toxicity and carcinogenesis). Interestingly, in several types of cancer aberrant overexpression of Nrf2 confers resistance to anticancer drugs (Lau et al., 2008). This dual role of Nrf2 in cancer prevention and in cancer survival illustrates the significant effect that Nrf2 activation can have in the response to toxic xenobiotic exposure.

As a final example, activation of both CAR and PXR play a role in the treatment of cholestasis (Teng and Piquette-Miller, 2007;Jenkins and Boothby, 2002). A potential mechanism for this protection is the increased clearance of the responsible toxic bile acids. Lithocholic acid (LCA) is a secondary bile acid, capable of causing intrahepatic cholestasis. The clearance pathways of LCA include hydroxylation by CYP3A, sulfation by SULT2A1, glucuronidation by UGT1A1, and excretion by ABCC2 and ABCC3, all genes induced by both CAR and PXR. LCA induced hepatotoxicity is more severe in

CAR-null or PXR-null mice than in wild type mice (Zhang et al., 2004;Teng and Piquette-

Miller, 2007).

Nuclear Receptors

CAR and PXR are closely related members of the nuclear hormone receptor superfamily, and share similar structural domains with other nuclear receptors. In the nucleus both receptors heterodimerize with the retinoid X receptor α (RXRα) and bind to the promoter regions of their specific gene targets. The conformational changes caused by ligand-receptor interactions promote recruitment of co-activators and the release of co-repressors, leading to the transcriptional activation of downstream genes (Pascussi et al., 2003).

Nuclear receptors generally share a common structure containing several functional domains (A-F) (Tsai and O'Malley, 1994). Domains A and B contain the first activation function (AF-1) whose activity is independent of ligand binding (see Figure 2). 30

The DNA-binding domain is the next region (domain C), and it contains two zinc finger motifs that are responsible for the specificity of the DNA binding of the nuclear receptor.

The D domain is a hinge region, and the E/F domain is the ligand-binding region. This domain also includes regions responsible for dimerization, heat-shock protein (HSP) interactions, and a second activating function (AF-2) that is ligand dependent (Dennis and O'Malley, 2005).

The DNA response elements for nuclear receptor binding consist of imperfect copies of a six-nucleotide motif (5’-AGGTCA-3’) arranged as direct (DR), inverted (IR), and/or everted (ER) repeats (Forman and Evans, 1995). These paired motifs are separated by a short sequence of intervening nucleotides. The response element of a particular nuclear receptor is designated by the directionality followed by the intervening sequence length (see Figure 2c). For example, the estrogen receptor recognizes and binds to IR-3 (Klein-Hitpass et al., 1989).

In addition to interactions with their dimerization partner and binding to their DNA response element, nuclear receptors interact with a number of co-regulator proteins.

These coregulators are generally divided into two classifications based on their effect on transcription, with co-activators increasing transcription and co-repressors decreasing transcription. Co-regulators have a specific LXXLL motif which is able to interact with the

AF-2 region of the nuclear receptor. This interaction is dependent on a correct conformation of the AF-2 region. Agonist ligands bound in the ligand binding pocket promote this active conformation through direct interaction with helix 12 of the AF-2 domain (Bourguet et al., 2000). Conversely, in the absence of agonist or the presence of antagonist, helix 12 assumes a conformation capable of recruiting co-repressors (Zhang et al., 1999). 31

Figure 2. Generic nuclear receptor structure and DNA binding motifs. (a) Nuclear receptors share a common structure containing several functional domains (A-F) which are responsible for DNA-binding, ligand-binding, dimerization, and transactivation. (b)

The DNA response elements for consist of imperfect paired motifs (5’-AGGTCA-3’) arranged as direct (DR), inverted (IR), and/or everted (ER) repeats separated by a short sequence of intervening nucleotides. Adapted from Privalsky (2004).

Constitutive Androstane Receptor

The constitutive androstane receptor (CAR) responds to a number of stimuli, including xenobiotic exposure, and acts as a master regulator of all four phases of xenobiotic elimination. As with other xenosensors, CAR activity is regulated by a variety of exogenous compounds including therapeutic drugs and environmental toxicants.

While early CAR research characterized the induction of metabolic genes by phenobarbital, CAR is now understood to be activated by a number of structurally diverse compounds. This diversity of CAR modulators is ascribed to both the relative promiscuity of CAR’s ligand recognition and to the multiple mechanisms of CAR activation.

In the absence of CAR-activators, CAR is sequestered from the nucleus by molecular chaperones. Ligand-receptor interaction allows conformational changes in the receptor itself, leading to dissociation from the chaperone complex and translocation to the nucleus (Pascussi et al., 2003). However, the majority of CAR activators do not appear to be CAR ligands. The precise mechanisms involved in the ligand-independent nuclear translocation of CAR are still under investigation, and are discussed below. As mentioned previously, CAR forms a heterodimer with its obligate binding partner RXRα upon nuclear translocation.

Interestingly, CAR’s transcriptional activity is also independent of direct ligand interaction. As mentioned above, coactivator recruitment to most other nuclear receptors depends upon the position of the C-terminal helix 12, which is dependent on ligand binding to achieve a stable conformation and form the AF-2 coactivator binding surface

(Wright et al., 2007). In the case of CAR, important differences in the sequence (and therefore structure) of helix 12 promote the active conformation independent of ligand 33

binding. Through internal amino acid linkages in the CAR protein, the helix is held rigidly in an active conformation (Xu et al., 2004;Suino et al., 2004).

Though several CAR ligands have been identified, they often act to suppress the constitutive activity of CAR. These compounds are classified not as antagonists, but as inverse agonists. While an antagonist blocks the activity of an agonist, an inverse agonist blocks the basal activity of the target (Moore, 2005). The first CAR ligands identified, androstanol (5α-androstan-3α-ol) and androstenol (5α-androst-16-en-3α-ol)

(Forman et al., 1998), are inverse agonists. Binding of inverse agonists such as androstane disrupts the active conformation of helix 12, while agonists such as

TCPOBOP stabilize it (Tzameli et al., 2000;Moore, 2005;Shan et al., 2004).

While CAR constitutively assumes an active conformation, its target genes are not constitutively expressed, indicating that the other mechanisms of its regulation are closely controlled in the cell. The first and most obvious form of regulation is the retention of CAR in the cytosol. The CAR cytoplasmic retention protein (CCRP), in conjunction with heat shock protein 90 (HSP90), is responsible for preventing CAR from translocating to the nucleus. The interaction between CAR and these protein chaperones is caused by binding of CCRP to the CAR ligand binding domain (Squires et al., 2004;Kobayashi et al., 2003). While CAR ligands such as TCPOBOP in mice or

CITCO in humans are able to disrupt this interaction directly through binding, the ability of non-ligand CAR activators such as phenobarbital to interfere with CAR sequestration provide evidence for additional indirect mechanisms.

Investigation has established a clear involvement of phosphorylation in the regulation of CAR translocation. Treatment with CAR activators recruits protein phosphatase 2A (PP2A) to the CAR-CCRP complex, and co-treatment with PP2A 34

inhibitor okadaic acid blocks nuclear translocation (Yoshinari et al., 2003). Additionally, kinases including the AMP-activated protein kinase (AMPK), the extracellular signal- regulated kinase (ERK), and the Ca2+/calmodulin-dependent kinase have been implicated in CAR modulation (Shindo et al., 2007;Koike et al., 2007;van den Hurk et al.,

2008).

In addition to cytoplasmic retention, protein interactions within the nucleus are also reported to modulate CAR’s transactivating ability. As mentioned previously, dimerization with RXRα is required for CAR activity. This dimerization allows binding to the promoter of CAR target genes at the Phenobarbital-Responsive Enhancer Module

(PBREM) (Honkakoski and Negishi, 1997). It has been reported that that RXRα agonists can inhibit the ability of CAR ligands TCPOBOP and androstenol to affect coactivator binding (increase and decrease, respectively) (Tzameli et al., 2000). Other studies have found inhibition of CAR transactivation by retinoids (Kakizaki et al., 2002), though more studies are needed to clarify the effects of RXRα agonists on CAR activity. Additionally, the availability of RXRα in the cell has been shown to play an important role in the regulation of nuclear receptors, due to the fact that RXRα is an obligate binding partner of so many other receptors. For example, activation of the nuclear receptor PPARβ was shown to repress the induction of LXR-driven genes through competition for RXRα

(Matsusue et al., 2006).

Competition for nuclear protein binding partners besides RXRα may also help regulate CAR activity. Modulation of the availability of shared co-activators is a reported mechanism of nuclear receptor regulation. The ability of one nuclear receptor to reduce the transactivating ability of another is termed “squelching”, and was an early indication of the existence of co-activators. CAR itself was observed to inhibit gene transactivation 35

by the estrogen receptor through competition for the co-activator GRIP1 (Min et al.,

2002). The inhibition was potentiated by CAR activator TCPOBOP, and returned by CAR inhibitor androstenol, indicating that this inhibition was dependent upon the CAR activation. Furthermore, both PXR and CAR have been shown to inhibit the activity of

HNF-4 by competing for available specific coactivators (PGC-1α, GRIP1) (Bhalla et al.,

2004;Miao et al., 2006).

As with other xenosensors, CAR activity is modulated by a variety of structurally diverse compounds, including therapeutic drugs (clotrimazole, meclizine, acetaminophen, phenobarbital, phenytoin, valproic acid, oltipraz, atorvastatin, simvastatin, fluvastatin, flofibrate) and natural products (diallyl sulfide, estrogen, DHEA).

Environmental pollutants are also able to modulate CAR activity, including DDE (a metabolite of the pesticide DDT), nonylphenols, degradation products of alkylphenol ethoxylates, and plasticizer and solvent di-n-butyl phthalate. Interestingly, CAR ligands appear to be species specific. TCPOBOP is a high affinity ligand for mouse CAR, yet has no effect on human CAR activity. Contrastingly, CITCO directly binds human CAR and not mouse CAR (Tolson and Wang, 2010).

As mentioned above, nuclear receptors recognize and bind to specific DNA sequences with the sequence 5’-AGGTCA-3’. The CAR response element for CYP2B6, the prototypical CAR target gene, was termed the Phenobarbital-Responsive Enhancer

Module (PBREM). The PBREM is composed of a pair of DR-4 nuclear receptor binding sites (NR1 and NR2) each of which can bind to CAR-RXRα. More recent investigation has identified DR-3, IR-0, ER-6 and ER-8 motifs capable of interacting with CAR (Tolson and Wang, 2010). 36

The majority of drug metabolizing CYP enzymes are regulated by CAR including

CYP1A, CYP2A, CYP2B, CYP2C, and CYP3A (Tolson and Wang, 2010). These enzymes are responsible for the metabolism of over 60% of all prescription drugs

(Hodgson and Rose, 2007). Additionally, several phase II enzyme family members are regulated by CAR. Gene targets identified to date include UGT1A1, 1A6, 1A9, 2B1, and

2B5; SULT1B1, 2A1, 1E1, and 2A2; and GSTA1 (Tolson and Wang, 2010). The induction of several of the major hepatic transporters is also regulated by CAR. CAR activation by phenobarbital resulted in the induction of hepatic efflux transporters

ABCC2, ABCC3, and ABCC4, in addition to ABCG2 (BCRP), ABCB1, (MDR1), and

ABCB11 (BSEP) (Klaassen and Aleksunes, 2010). Conversely, expression of NTCP,

OATP1B3, OAT2, and OCT1 were decreased by phenobarbital exposure.

Pregnane X Receptor

The closest relative to the CAR gene is the pregnane X receptor (PXR), also known in humans as the steroid and xenobiotic receptor (SXR). Like CAR, PXR is remarkable compared to other nuclear receptors. While CAR differs from conventional nuclear receptors in its diverse mechanisms of activation, PXR contains an unusually large and promiscuous ligand binding cavity. Notably, studies of bound and unbound

PXR have revealed the structural flexibility of this cavity, as it can be induced to adapt in shape and size, or to form novel conformational structures (Tolson and Wang, 2010). An additional characteristic of the PXR ligand-binding domains is the relative lack of conservation between species, and the resulting differences in ligand recognition. This evolutionary difference has been indicated to be a result of positive selection, indicating the important role that ligand-diversity plays in the function of PXR (Krasowski et al.,

2005). 37

In contrast to CAR, PXR activation appears to proceed through conventional mechanisms. PXR has been reported to localize predominantly to the nucleus

(Hernandez et al., 2009), though others have described cytoplasmic retention in the uninduced state (Squires et al., 2004). Inactive nuclear PXR may be inhibited by corepressors such as the silencing mediator of retinoid and thyroid hormones (SMRT) or small heterodimer partner (SHP).

PXR also forms a heterodimer with RXRα, binding to the xenobiotic responsive enhancer module (XREM). Ligand-binding induces conformational changes in PXR, which promote the release of co-repressors and the recruitment of transcriptional coactivators. The association of co-activators to ligand-bound PXR has been demonstrated to play a vital role in modulating the transactivation of several genes by PXR, specifically in defining tissue specific patterns of gene induction by PXR (Tolson and Wang, 2010).

Co-activators identified to perform such a function include steroid receptor coactivator 1

(SRC-1), glucocorticoid receptor interacting protein 1 (GRIP-1), and peroxisome proliferator-activated receptor coactivator 1 (PGC-1).

PXR ligand are often also activators of CAR, and as with CAR, ligand recognition may be species specific. For example, mouse PXR is responsive to pregnenolone 16α- carbonitrile (PCN) exposure, but unresponsive to human PXR-ligand rifampicin.

Conversely, human PXR does not respond to PCN treatment (Tolson and Wang, 2010).

Several herbal products activate PXR, including components of St. John's Wort

(hyperforin), Kava Kava (desmethoxyyangonin and dihydromethysticin), Coleus forskohlii (forskolin), and Qing hao (artemisinin) (Staudinger et al., 2006). Other known

PXR ligands include pharmaceutic drugs (dexamethasone, rifampicin, spironolactone,

RU486, taxol), industrial chemicals (bisphenol-A, phthalates, nonylphenol, 38

polychlorinated biphenols), pesticides (DDE, DDT, methoxychlor), and endogenous steroids (5α-pregnane-3,20-dione, progesterone, 17α-hydroxypregnenolone, corticosterone) (Hernandez et al., 2009).

In addition to its wide range of ligands, PXR has also been identified as a master regulator of a wide range of gene targets. The list of PXR regulated genes significantly overlaps with the CAR gene battery, due in part to the ability of PXR and CAR to recognize many of the same response elements. Identified PXR gene targets include

CYP2A, CYP2B, CYP2C, and CYP3A, as well as UGT1A1, 1A3, and 1A6, and GSTA1.

Additionally, SULT1A1, 1B1, 1E1, 2A1 and 2A2 are induced by PXR activation (Tolson and Wang, 2010). The subset of transporter genes regulated by PXR is also similar to that of CAR. PXR activation induces expression of ABCC2, ABCC3, ABCB1, and

ABCG2, and downregulates expression of NTCP, OAT2, and OCT1 (Klaassen and

Aleksunes, 2010). In contrast to the CAR-induced upregulation of ABCG11, PXR activation downregulated the expression of this transporter in human hepatocytes

(Jigorel et al., 2006).

Aryl Hydrocarbon Receptor

Unlike xenosensors CAR and PXR, the aryl hydrocarbon receptor (AhR) is not a nuclear receptor. Instead, AhR belongs to the bHLH/PAS family of transcription factors, and like other family members, contains the two characteristic motifs, the basic Helix-

Loop-Helix (bHLH) domain and the PAS (PER-ARNT-SIM) domain (Abel and

Haarmann-Stemmann, 2010). The AhR protein can be divided into three main regions, each with individual functions. The first, the bHLH domain, is responsible for DNA- binding (Gu et al., 2000). Next, the PAS domain is responsible for protein-protein interaction with other members of the PAS family (PER, ARNT, SIM) as well as the 39

molecular chaperone HSP90. Additionally, the PAS domain contains a ligand binding site, which partially overlaps with the HSP90 binding region. Finally, AhR contains a transactivation domain (TAD) which interacts with transcriptional co-activators to recruit the transcriptional machinery to the AhR target gene (Abel and Haarmann-Stemmann,

2010).

In the absence of ligand-binding, AhR is sequestered in the cytoplasm by a complex of several proteins including HSP90, p23, and the AhR-interacting protein

(AIP). HSP90 proteins cover both the ligand binding domain and the nuclear localization signal. AIP has been reported to prevent AhR ubiquitination and degradation

(Kazlauskas et al., 2000). The co-chaperone p23 directly interacts with HSP90 and plays an important role in ligand responsiveness and the process of AhR activation

(Kazlauskas et al., 1999).

Following ligand-binding, conformational changes of the AhR protein allows dissociation from the chaperone complex. AhR rapidly translocates to the nucleus, where it dimerizes with another PAS protein, the AhR nuclear translocator (ARNT), through interaction with the PAS domains of both proteins (Abel and Haarmann-

Stemmann, 2010). This heterodimer is able to bind to the AhR response element, termed the xenobiotic response element (XRE), which contains sequence 5’-TnGCGTG-

3’ (Bock and Kohle, 2006). This DNA-binding allows association with a number of coactivators, and recruitment of the transcriptional machinery to the promoters of AhR target genes (Hankinson, 2005).

Following ligand elimination, AhR signaling can be rapidly terminated by multiple mechanisms, including proteasomal degradation (Abel and Haarmann-Stemmann,

2010). The rapid turnover of nuclear AhR following ligand exposure is blocked following 40

treatment with a proteasome inhibitor (Davarinos and Pollenz, 1999). Interestingly, there is evidence that this ligand-induced degradation may also be responsible for the proteasomal degradation of steroid receptors, and AhR may itself be a member of the

E3 ubiquitin ligase complex.

In addition to the proteasomal degradation of AhR, the AhR repressor (AhRR) is capable of terminating AhR signaling. AhRR is another member of the bHLH/PAS family, and is induced by AhR activation (Abel and Haarmann-Stemmann, 2010). Because of its similar structure with AhR, AhRR is able to dimerize with ARNT and interact with XREs.

However, because AhRR lacks a TAD, AhRR represses the transcription of bound genes, and even recruits co-repressors to the promoter (Oshima et al., 2007). In this way, AhRR acts as a negative feedback and competes with the AhR both for a dimerization partner (ARNT) and for a response element (XRE).

Most of the described AhR ligands are synthetic chemicals including halogenated aromatic hydrocarbons (polychlorinated biphenyls, dibenzo p-furans, dibenzo-p-dioxins), polycyclic aromatic hydrocarbons (benzo(a)pyrene, 3-methylcholanthrene, and 7,12- dimethyl-benz(a)anthracene), and prototypical agonist benzflavone β-naphthoflavone.

Other identified ligands include pharmaceutic agents (omeprazole, sulindac, diclofenac) and pesticides thiabendazole and carbaryl) (Abel and Haarmann-Stemmann, 2010).

A distinct source of AhR ligands are naturally occurring chemicals found in plants, specifically flavonoids and related polyphenols, alkaloids and indole derivates.

The majority of these types of ligands inhibit AhR signaling and are regarded as chemopreventive agents. Notable examples include quercetin, resveratrol, and curcumin

(Abel and Haarmann-Stemmann, 2010). 41

The prototypical AhR-regulated gene is CYP1A1; however, recent research has identified the regulation of additional genes involved in drug metabolism and disposition.

Other drug metabolizing enzymes shown to be regulated by AhR include CYP1A2,

CYP1B1, NQO1, GSTA2, UGT1A1, UGT1A3, UGT1A4, and UGT1A6 (Bock and Kohle,

2006;Tolson and Wang, 2010). AhR ligands have also been reported to alter expression of hepatic transporters, though not to the extent of other xenosensors. As with the nuclear receptors CAR and PXR, AhR activation generally downregulates the expression of uptake transporters such as OAT and OATP (Klaassen and Aleksunes,

2010). Following treatment with TCDD, investigators observed a decrease in ABCB11

(BSEP) expression and induction of ABCB1 (MDR1) (Jigorel et al., 2006), and a functional XRE was described in ABCG2 (BCRP) (Tan et al., 2010).

Interestingly, a significant linkage has been reported between AhR and the transcription factor Nrf2. Activated AhR induces expression of Nrf2, and in turn is a target gene of Nrf2. Furthermore, there is significant overlap in their respective gene batteries, with response elements for both transcription factors identified in the promoters of NQO1, GSTA2, and UGT1A6.

Nuclear Factor (erythroid-derived 2)-like 2

The transcription factor Nrf2 is a basic leucine zipper transcription factor containing regions of homology with the Cap ‘n’ collar protein. While Nrf2 has clear DNA- binding capabilities, unlike the ligand-mediated activation observed in the other xenosensors discussed previously, Nrf2 is regulated without any direct interaction with chemical activators. Indeed, Nrf2 protein contains no ligand binding domain. Instead, xenobiotic exposure is recognized by the actin-binding protein Keap1, which interacts with Nrf2 through binding to the second of several Nrf2-ECH homology (Neh) domains. 42

This Nrf2/Keap1 signaling pathway coordinates the cellular response to several stimuli, including oxidative stress.

Under unstressed/untreated conditions, Nrf2 is excluded from the nucleus through its interaction with Keap1. In addition to sequestering Nrf2, Keap1 has been identified as a key mediator of Nrf2 proteasomal degradation. Keap1 has been identified as a member of an E3 ubiquitin-ligase complex, which polyubiquitinates Nrf2 and marks it for degradation by the 26s proteasome (Zhang, 2006). Recent studies of the specific structural requirements of Nrf2 association and inhibition by Keap1 have revealed that two Keap1-binding motifs in Nrf2 allow interaction with a Keap1 homodimer. Under normal conditions this pair of Keap2 proteins is able to maintain Nrf2 in a stable conformation that promotes interaction with the ubiquitination complex, leading to Nrf2 degradation (Tong et al., 2006).

However, exposure to certain xenobiotics or conditions of oxidative stress can disrupt this stable conformation. Keap1 is a cysteine-rich protein, and thiol-modification of Keap1 at these cysteine residues is hypothesized to induce conformational changes which inhibit the stable conformation necessary for Nrf2 ubiquitination and degradation.

Accumulating free Nrf2 is able to translocate to the nucleus and associate with its dimerization partner, the small Maf protein. Together, this heterodimer interacts with specific DNA response elements termed the antioxidant response element or electrophilic response element (ARE/EpRE).

The consensus ARE sequence was originally identified as 5’-TGACnnnGC-3’, based largely on the sequence of the prototypical Nrf2-target gene NQO1 (Rushmore et al., 1991). More recent studies comparing a large number of identified AREs resulted in a slight modification of this consensus sequence to 5’-(a/g)TGActcaGCa-3’, where 43

uppercase letters are highly conserved and lowercase letters are more variable

(Malhotra et al., 2010).

Xenobiotics which have been observed to activate the Nrf2/Keap1 signaling pathway have the ability to react with sulfhydryl groups. Hayes et al. (2010) notes that

Nrf2 activators are grouped into ten distinct chemical classes, (Michael acceptors, oxidizable diphenols and diamines, conjugated polyenes, hydroperoxides, trivalent arsenicals, heavy metals, isothiocyanates, dithiocarbamates, dithiolethiones, and vicinal dimercaptans). Numerous dietary components have been identified as Nrf2 activators, including sulforaphane, -carotene, lycopene, curcumin, coumarin, indoles, and diallyl sulfide. Synthetic analogs of these activators include -naphthoflavone, ethoxyquin, oltipraz, butylated hydroxytoluene, butylated hydroxyanisole, and triterpenoids (Hayes et al., 2010). Therapeutic administration of several of these compounds has been investigated for use in chemoprevention, or protection against toxicity and carcinogenesis. This chemoprevention is possible because of the genes upregulated by this antioxidant response.

Research into the role of Nrf2 has greatly expanded the Nrf2 gene battery beyond antioxidant genes. Nrf2 is now known to regulate the expression of several oxidative CYP enzymes, in addition to the numerous conjugative metabolic enzymes previously reported. Expression studies comparing Nrf2-null mice with wild type mice have revealed a role for Nrf2 in the regulation of CYP2A, CYP2B, and CYP2C, as well as SULT and UGT family members (Hayes et al., 2010;Shen and Kong, 2009). Nrf2 is also responsible for the induction of glutathione production and conjugation, through effects on GCLC and GCLM as well as GSTA, GSTM, and GSTP families (Hayes et al.,

2010). 44

As with other xenosensors, regulation of metabolic enzymes is accompanied by regulation of transport proteins. The Nrf2/Keap1 signaling pathway controls induction of

ABCC2, ABCC3, and ABCC4, as well as ABCB1, ABCG2 (Jigorel et al., 2006), and

ABCB11 (Klaassen and Aleksunes, 2010). Several of the uptake transporters were downregulated in human hepatocytes following treatment with Nrf2 activators, including

OATP8, OAT2, and NTCP.

Impact of Hepatic Diseases on Xenosensors and Drug Processing

Due to the important role that the liver plays in drug metabolism and disposition, hepatic diseases can have significant impacts on the therapeutic efficacy or toxicity of drugs and other xenobiotics. Infection and inflammation have repeatedly been observed to alter the activity of drug metabolizing enzymes, often through the modulation of xenosensors such as CAR and PXR. The impact of two diseases in particular, cholestasis and non-alcoholic fatty liver disease, provide excellent examples of the clinical importance of xenosensor regulation.

Cholestasis

Dysregulation of bile acid metabolism and export results in loss of bile flow and hepatic accumulation of bile acids in a condition known as cholestasis. Several distinct cholestatic diseases exist, including primary biliary cirrhosis (PBC), progressive familial intrahepatic cholestasis (PFIC), intrahepatic cholestasis of pregnancy (ICP), and primary sclerosing cholangitis (PSC). In most of these cholestatic conditions, irrespective of the source, cholestasis results in hepatocellular injury and fibrosis.

Cholestasis can result from disruption of bile excretion from within the hepatocytes, or from destruction of the bile ducts. Genetic mutation and loss of function of hepatocellular bile exporter proteins is one identified cause of PFIC (Davit-Spraul et 45

al., 2009). Similarly, evidence suggests that inhibition of ABCB11 and/or ABCC2 (MRP2) by reproductive hormones may lead to ICP (Geenes and Williamson, 2009). Other diseases such as PBC target the small interlobular bile ducts, while PSC affects both intrahepatic and extrahepatic bile ducts (Hohenester et al., 2009;Geonzon-Gonzales,

2007).

Inflammation plays an important role in the both PBC and PSC. PBC, described as a model autoimmune disease, is a chronic progressive inflammatory disease which results in damage to the small interlobular bile ducts, leading to progressive cholestasis, fibrosis and cirrhosis (Hohenester et al., 2009). Untreated PBC will result in liver failure and require liver transplantation. The cause of PSC is unknown, though the disease is closely associated with ulcerative colitis. Based on this association, it is hypothesized that chronic bacteremia may cause infection of the biliary tract itself, leading to inflammation and obstructive fibrosis, though such a mechanism has not been observed

(Geonzon-Gonzales, 2007).

The prevalence of these conditions is not well established. PBC primarily affects women and occurs in around 1 in 1000 women over 40 years of age (Hohenester et al.,

2009). While ICP also obviously targets women, a number of factors have been reported to impact disease incidence, including the time of year (increased in winter), age

(increased over 35 years of age), and geographical location and ethnicity. Incidences range from 1% in Europe to over 10% in South America (Geenes and Williamson, 2009).

The precise prevalence of PFIC is unknown, but is estimated to be between 1/50,000 and 1/100,000 births (Davit-Spraul et al., 2009). PSC is more prevalent in males, with an estimated rate of around 15 per 100,000 persons (Silveira and Lindor, 2008). 46

Hepatic damage resulting from cholestasis is generally caused by the toxic constituents of the accumulated bile. Bile is a mixture of both endogenous and exogenous compounds including bile acids, bilirubin, cholesterol, phospholipids, and xenobiotics. Bile acids are the most toxic components of the bile, because of the detergent activity inherent in their physiological role in dietary lipid emulsification. The cellular membranes of hepatocytes are protected from this emulsification through several mechanisms. Maintained bile flow limits the exposure time of hepatocytes and cholangiocytes to toxic bile acids. In the bile, bile acids form micelles with phospholipids and cholesterol, reducing detergent activity. Canalicular excretory pump ABCB4 (MDR3) plays an important role in exporting phosphatidylcholine from the inner leaflet of the hepatocellular membrane to the outer leaflet for eventual integration into these bile salt micelles (Oude Elferink and Paulusma, 2007). Other hepatic canalicular transporters are responsible for bicarbonate secretion, promoting hydration and proper alkalinization of the bile and preventing inspissated bile and bile duct injury (Trauner et al., 2008).

Several related mechanisms for the pathogenesis of bile acid toxicity have been investigated. Bile acids have been observed to induce the generation of reactive oxygen species (ROS) and proinflammatory mediators by hepatocytes. Infiltrating immune cells also generate ROS which further damage hepatocytes. Hepatocytes undergoing necrosis release specific markers which perpetuate and amplify the inflammatory response. ROS also stimulates lipid peroxidation, which been reported to induce hepatic stellate cells to produce collagen, resulting in fibrosis (Copple et al., 2010).

Xenosensor activation plays an important role in cholestasis both as a physiological response to the disease, and as a therapeutic target in the clinical management of affected patients. Bile acid metabolism and transport shares several 47

enzymes and proteins with drug metabolism and transport. While bile acid synthesis from cholesterol is dependent on several CYP enzymes that are not involved in drug metabolism (including CYP7A, CYP8B, and CYP27A), subsequent bile acid detoxication within hepatocytes involves hydroxylation by CYP3A (the prominent drug metabolizing

CYP). Bile acid conjugation by sulfonation and glucuronidation involving SULT2A1,

UGT2B4, and UGT2B7 are important in further detoxicating the molecules and creating increased specificity to hepatocellular efflux proteins like ABCC2, ABCC3, and ABCC4.

Other hepatic bile acid transporters include uptake transporters OATP and NTCP, and efflux transporters OSTα/ and ABCB11 (BSEP) (Zollner et al., 2006).

As discussed, activation of CAR and PXR induces the expression of CYP3A,

UGTs, SULTs, and ABCC transporters, in addition to downregulating most OATP transporters. The demonstrated activation of PXR and CAR by bile acids reveals the homeostatic feedback mechanisms in bile acid regulation (Fiorucci et al., 2010;Zollner et al., 2006). Increased bile acid levels recognized by xenosensors modulate enzyme and transporter expression to limit bile acid uptake, and increase bile acid detoxication and efflux. Furthermore, oxidative stress caused by accumulated bile acids may induce many of these same genes through the Nrf2/Keap1 signaling pathway, in addition to antioxidant specific genes (Tanaka et al., 2009).

Several effective therapeutic interventions in cholestasis appear to target these xenosensors. Phenobarbital and rifampicin were used to treat the effects of cholestasis before they were characterized as activators of CAR and PXR, respectively (Zollner et al., 2006). Traditional Chinese herbal medicines (such as Yin Chin) that are used in treating jaundice contain chemicals that have been shown to activate these xenosensors

(Huang et al., 2004). Bear bile, also used in traditional treatment of jaundice, contains 48

ursodeoxycholic acid (UDCA) at high levels. UDCA is the only FDA approved treatment for PBC and has been shown to induce hepatoprotective genes through Nrf2 activation

(Okada et al., 2008).

Nonalcoholic Fatty Liver Disease

Nonalcoholic fatty liver disease is the most common chronic liver disease in the industrial world, and is thought to affect between 20 and 30% of the U.S. population. The initial stage of the disease is simple fat accumulation in the liver, termed steatosis, and is generally benign. This stage is the most prevalent, comprising the vast majority of

NAFLD cases. However, it is estimated that over half of these patients will progress to inflammatory nonalcoholic steatohepatitis (NASH), and around 40% will develop hepatic fibrosis after 3-14 years (Hashimoto and Tokushige, 2010).

NAFLD is closely linked with obesity and insulin resistance. The prevalence of

NAFLD in obese patients increases to over 90%, and the prevalence of NASH in obese populations is estimated to be between 20-30% (Tiniakos et al., 2010). Alarmingly, the prevalence of both obesity and insulin resistance has been rapidly increasing and these increases are projected to continue. The prevalence of obesity in the U.S. is projected to reach more than 50% by 2030 (Wang et al., 2008). Similarly, the prevalence of diabetes in the U.S. is estimated to increase from 14% in 2007 up to 33% by 2050 (Boyle et al.,

2010). The implications of these projected increases on the prevalence of NAFLD are enormous.

Steatosis is a central feature of all stages of NAFLD, and is commonly defined as hepatic triglyceride accumulation exceeding 5% by weight (Neuschwander-Tetri and

Caldwell, 2003). Lipid accumulation is usually localized in zone 3 hepatocytes (see 49

Figure 1), and can appear as large droplets filling the cytoplasm (macrovessicular), as small droplets (microvessicular), or a combination of the two.

Histologically, NASH livers exhibit evidence of steatosis, lobular inflammation, and hepatocellular damage. As with the lipid accumulation, these features most often occur in zone 3 hepatocytes. Hepatocellular damage appears as ballooning degeneration, Mallory-Denk bodies, apoptosis, and/or necrosis. Fibrotic initiation in

NAFLD is reported to assume a characteristic “chicken wire” pattern, also originating in zone 3. This fibrosis may impact portal and periportal regions and eventually progress to bridging fibrosis and cirrhosis (Tiniakos et al., 2010).

Hepatic steatosis arises from a disruption of normal triglyceride synthesis and transport. Normal hepatic processes for lipid metabolism consist of hepatocyte uptake of free fatty acids (FFA), de novo lipogenesis, metabolic transformation of FFA, and triglyceride export in very low density lipoproteins (VLDL) (Jou et al., 2008). While both circulating plasma FFAs and dietary FFAs provide sources of hepatic lipid influx, it has been reported that 60% of hepatic fat uptake comes from circulating fatty acids

(Donnelly et al., 2005). It is hypothesized that peripheral insulin resistance play a role in the levels of circulating FFAs through effects on adipocyte lipolysis.

Metabolism of FFAs within hepatocytes consists of esterification to triglycerides for packaging and export into the circulation as VLDL, or utilization as metabolic fuel by oxidation. Hyperinsulinemia and hyperglycemia can also cause activation of lipogenic transcription factors such as sterol regulatory element binding protein (SREBP1), which increases de novo lipogenesis and inhibits free fatty acid oxidation. Interestingly, in

NAFLD the accumulation of hepatic triglycerides appears to be a compensatory mechanism to protect the liver for toxic FFAs, as inhibition of triglyceride synthesis in 50

experimental NAFLD relieved steatosis, but increased liver injury and fibrosis (Jou et al.,

2008). This imbalance in FFA accumulation over triglyceride export, and the resulting steatosis, is generally considered the first hit in the progression of NAFLD (Jou et al.,

2008).

Further progression in NAFLD requires a second hit, generally thought to be a combination of oxidative stress and cytokine imbalance. Oxidative metabolism of FFAs is known to generate reactive oxygen species, which can eventually overwhelm the antioxidant defenses and cause cellular damage. Additionally, cytokine and adipokine signaling from visceral adipose tissue are increased in NAFLD, activating and recruiting inflammatory cells to the liver. The resulting hepatocellular damage exacerbates inflammatory signaling, leading to activation of hepatic stellate cells and the fibrotic repair response (Jou et al., 2008).

In addition to their high and increasing prevalence, it is now recognized that

NAFLD and NASH are diseases with significant and severe morbidity and mortality.

NASH has been identified as the most common cause of cryptogenic cirrhosis (Clark and Diehl, 2003;Kojima et al., 2006), and researchers have projected that 30 to 50% of

NASH patients will progress to cirrhosis within 10 years (Jou et al., 2008). Additionally,

NASH is responsible for an estimated 13% of all hepatocellular carcinoma cases

(Marrero et al., 2002;Bugianesi et al., 2002). NASH is the underlying cause of 10% of liver transplants and liver disease is a leading cause of death in NAFLD and NASH

(Preiss and Sattar, 2008;Hashimoto and Tokushige, 2010).

Because of the serious and severe pathological effects of NAFLD, clinical intervention and pharmacotherapy are important in the effective management and prevention of disease progression. Since NAFLD is largely a lifestyle-related disease, 51

interventions of dietary restriction and exercise are central to most standards of care. In morbidly obese patients, more aggressive approaches such as bariatric surgery have been suggested and are largely effective at reducing steatosis.

Pharmacological intervention has targeted several aspects of the disease, but has met with limited success to date. Agents such as pentoxifylline act to inhibit TNFα, a key cytokine in NASH progression (Ali and Cusi, 2009). Antioxidants such as vitamins E and C target oxidative stress, while orlistat limits absorption of dietary lipids.

Ursodeoxycholic acid, generally thought to be cytoprotective in liver diseases, was investigated in NAFLD, as was the insulin sensitizer metformin, but clinical effects of each of these treatments were minimal. Recently, the use of PPAR activators

(thiazolidinediones) as a treatment for NASH resulted in improvement in several clinical parameters of NAFLD, including liver histology. A major complication to the investigation of all of these treatments is the difficulty in accurately diagnosing the stage of NAFLD.

Despite the large percentage of the population with both NAFLD and NASH, identification of research subjects with fully diagnosed NAFLD is difficult, as is accurately following the resolution of symptoms following treatment.

Histological features of NAFLD have been described above, and histological examination of liver biopsies remains the most definitive method of accurately staging the disease. However, the inherent risks and discomfort associated with liver biopsy precludes its use as a screening tool. Clinical diagnosis of NAFLD generally results from elevated serum aminotransferase (ALT, AST) levels in the absence of indications of other liver conditions which cause fatty liver (significant alcohol intake, viral hepatitis, administration of certain drugs) (Ali and Cusi, 2009). However, levels of ALT and AST 52

can fluctuate and normal levels are often observed even in advanced stages of the disease (Wieckowska and Feldstein, 2008).

The lack of an accurate and noninvasive method for detecting NAFLD results in a significant underdiagnosis of the disease. Several alternate approaches have been proposed and investigated, including various imaging modalities. However, the inability of these imaging techniques to detect the presence or stage of fibrosis limits their usefulness in those NASH patients who would benefit most from close observation.

Other systemic biomarkers are currently under investigation, but an effective and noninvasive test for NASH is still represents an important clinical need.

In addition to the overt pathological risks described previously, it has been hypothesized that NAFLD patients may be at increased risk for adverse drug reactions and other xenobiotic toxicities. A number of alterations in both drug metabolizing enzymes and drug transporters have been reported in the progression of NAFLD. Obese patients exhibit altered pharmacokinetics of hormonal contraceptives (Edelman et al.,

2010;Skouby, 2010), as well as a number of other drugs (Lloret et al., 2009). Animal models of NAFLD have been used to demonstrate the toxic effects of decreased metabolism of the antipsychotic drugs clozapine (Zhang et al., 2007) and haloperidol

(Hanagama et al., 2008). Increased risk for adverse drug reactions, specifically drug induced liver disease, have been reported in NAFLD patients (Tarantino et al.,

2007;Tarantino et al., 2009).

These changes in pharmacokinetics are often direct results of pathogenic modulations in the expression and activity of drug metabolizing enzymes and transport proteins. The first described and most well studied change occurring in NAFLD is 53

upregulation of CYP2E1. Other studies have reported effects of NAFLD on CYP1A,

CYP2A, CYP2B, CYP2C, and CYP3A. Details of these effects are covered in Chapter 4.

Drug transport proteins are also modified in NAFLD. Lickteig et al. (2007) reported several changes in efflux transporter expression in experimental NAFLD. Rats fed NAFLD-inducing diets had increased levels of sinusoidal transporters ABCC3 and

ABCC4 and canalicular transporters ABCC5 and ABCG2, and decreased expression of

ABCC6 and ABCB11. Hepatic uptake transporters are also affected by NAFLD.

Experimental NAFLD resulted in significant downregulation of OAT2, OAT3, NTCP,

OATP1A1, OATP1A4, OATP1B2, and OATP2B1 (Fisher et al., 2009).

As expected, these alterations in drug metabolism and transport may be caused by modulations in the activity of xenosensors. Two studies of experimental NAFLD have reported increased mRNA expression of PXR, with increased expression of CYP3A

(Yoshinari et al., 2006;Fisher et al., 2008). Polyunsaturated fatty acids are reported to modulate PXR activtiy to some extent, and CAR to an even greater degree (Finn et al.,

2009). Similarly, the insulin sensitive transcription factor FOXO1 impacts the activity of both CAR and PXR (Kodama, et al., 2004), as does the SREBP1 (Roth et al., 2008).

Recent research has also focused in the potential for CAR activation to protect against

NAFLD (Gao and Xie, 2010).

The oxidation/xenobiotic responsive transcription factor Nrf2 is also activated by

NAFLD, due to the increased oxidative stress inherent in the disease (Hardwick et al.,

2010). Kitteringham et al (Kitteringham et al., 2010) recently reported that Nrf2 may play a role in hepatic lipid disposition. As with CAR, Nrf2 activation has also been suggested as a potential drug target in the treatment of NAFLD (Chowdhry et al., 2010;Sugimoto et al., 2010;Zhang et al., 2010). 54

PRESENT STUDY

Xenosensors such as CAR, PXR, AhR, and Nrf2 coordinately regulate the expression of numerous metabolic (Phase I and Phase II) and transporter (Phase 0 and

Phase III) genes. The activity of these transcription factors is modulated in the presence of xenobiotic exposure as well as certain hepatic diseases. The subsequent appendices in this dissertation will explore aspects of this modulation including 1) the activation of enzymes and transporters by the chemopreventative agent oltipraz (OPZ), 2) the dual activation of CAR and Nrf2 by OPZ, 3) the regulation of the ABCC3 gene by a novel intronic response element, 4) the modulation of metabolic enzymes in NAFLD, 5) the effect of NAFLD on the disposition of acetaminophen and its major metabolites.

Chapter 1 investigates the response of Wistar-Kyoto rats to treatment with the known CAR activator phenobarbital (PB) and the known Nrf2 activator OPZ. Wistar-

Kyoto rats are sexually dimorphic in their expression of CAR, with higher levels found in male rats than in females. Induction by PB of CAR-target gene CYP2B is elevated in these male rats compared to female rats. The expression of several drug metabolizing enzymes, as well as uptake and efflux transporters were measured in an attempt to identify genes that may be induced by OPZ through CAR rather than Nrf2.

The second chapter of this dissertation is the result of several mechanistic studies into the activation of CAR by OPZ. As discussed above, several types of chemicals are able to activate multiple xenosensors. The known Nrf2 activator OPZ was observed to activate several known CAR-target genes. Experiments in this chapter include the use of CAR- and Nrf2-knockout animals, in vivo luciferase assays, and androstenol inhibition studies. In this chapter, OPZ treatment is shown to induce the nuclear translocation of CAR protein, and to significantly increase the expression of 55

CYP2B in a CAR-dependant manner. This published study was the first mechanistic demonstration of the activation of CAR by OPZ.

The studies included in Chapter 3 focus on the transcriptional regulation of

ABCC3 by the Nrf2/Keap1 signaling pathway. ABCC3 is a sinusoidal efflux transporter which is generally expressed at low levels in the liver. However, under treatment with

Nrf2 activators, or in certain disease states, the expression and activity of ABCC3 is significantly increased. As explained earlier, gene induction by Nrf2 requires DNA binding of the transcription factor to a specific response element, termed the antioxidant response element (ARE). While Nrf2 control over the induction of ABCC3 has been demonstrated, the functional ARE of ABCC3 has not been characterized. This chapter identifies a novel intronic ARE located 26kb downstream of the transcriptional start site.

In silico analysis, chromatin immunoprecipitation, and luciferase reporter gene assays are employed in the characterization of this response element.

The fourth chapter consists of a comprehensive review of the published literature addressing the alterations in drug metabolism in NAFLD. As introduced above, fatty liver disease has a significant impact on the expression and activity of both Phase I and

Phase II metabolism. However, results from both animal and clinical studies are often inconsistent, due in part to the numerous distinct animal models employed, the diverse patient population studied, and inherent variability of these enzymes. Chapter 4 summarizes the findings of these studies, discusses the disease and difficulties associated with its study, and highlights a few potential mechanisms responsible for altering gene expression.

Chapter 5 is a culmination of this dissertation and a direct clinical application of the principles discussed herein. This manuscript reports the results of a clinical study 56

investigating a potential clinical biomarker for NASH. NASH affects over 10 million

Americans, yet is severely underdiagnosed. As discussed in both the previous

Introduction and Chapter 4, NAFLD and especially NASH significantly alter the expression of drug metabolizing enzymes and drug transporters. As presented in

Chapter 3 and the Introduction, ABCC3 is regulated by Nrf2/Keap1 signaling and Nrf2 is significantly upregulated in NAFLD (Hardwick et al., 2010). ABCC3 is the major transporter responsible for sinusoidal efflux of glucuronide metabolites, including acetaminophen-glucuronide (APAP-gluc). An experimental rat model of NASH exhibited elevated plasma levels of APAP-gluc compared to both normal and steatotic rats

(Lickteig et al., 2007). If this distinctive alteration in APAP-gluc disposition is also observed in human NASH patients, it may prove a useful biomarker and an effective clinical tool in the identification of NASH patients.

In summary, drug metabolizing enzymes and transport proteins play a vital role in protecting us from the toxic accumulation of drugs and other xenobiotics. The expression of these proteins is regulated by the activity of xenosensors, including CAR, PXR, AhR, and Nrf2. The activity of these xenosensors is in turn controlled by exposure to numerous drugs, xenobiotics, and disease states. This dissertation presents information and research demonstrating the clinical effects of these processes and shows the potential clinical benefit of this field of study. Finally, a detailed summary of the regulation and activity of CAR is presented in Appendix A.

FUTURE DIRECTIONS

While the studies included in this dissertation have advanced our understanding of xenosensor regulation, there are several clear directions for future investigation.

The dithiolethione oltipraz (studied in Appendices A and B) was used clinically in the treatment of schistosomiasis. However, mice treated with oltipraz exhibited elevated levels of glutathione and glutathione transferases. This upregulation protected the mice from toxicity associated with known hepatotoxicants (Ansher et al., 1983). It is now known that this induction of glutathione activity is due to the activation of the xenosensor

Nrf2. Subsequent studies by Miao et al. (2003) revealed that this compound was also capable of activating the aryl hydrocarbon receptor.

In addition to the induction of antioxidant genes (such as those involved in glutathione synthesis and activity) oltipraz has been observed to activate several drug metabolizing enzymes, including the known CAR target gene CYP2B. The published papers included in this dissertation investigated the ability of oltipraz to activate the nuclear receptor CAR in rats and mice. Interestingly, while the induction of Cyp2b10 in mice was found to be CAR-dependant, induction by oltipraz of Cyp2B1/2 in rats was not affected by differential CAR expression. Since the completion of these studies, others have further investigated oltipraz in human hepatocytes. Piton et al. (2010) reported that induction of CYP2B6 oltipraz was mediated by activation of the pregnane X receptor.

These findings highlight two conflicting aspects of xenosensor activation. With respect to xenobiotic recognition, while there is often broad overlap between different xenosensors, there are also significant interspecies differences within the same xenosensor. One potential area of future investigation is a comprehensive comparison of the activity of oltipraz between human, mouse, and rat cultured cells. In place of the 58

knockout studies employed in Chapter 2, siRNA knockdown of CAR, PXR, and AhR in human, rat, and mouse cells would be appropriate. Nuclear localization of AhR and CAR would be determined by immunoblotting proteins from nuclear extracts of oltipraz treated cells.

Chapter 3 describes the identification of an intronic response element in the

ABCC3 gene. As detailed in the discussion of that chapter, two additional experiments would greatly add to those results. First, recent advances in molecular biology allow the detection of long range chromatin interactions, such as those that are hypothesized to occur between the intronic element of ABCC3 and the transcriptional start site.

Secondly, the experiments detailed in this section employed a human lung cancer cell line. It would be important to determine if ABCC3 in human hepatocytes is similarly regulated.

Other potential experiments in ABCC3 regulation focus on other transcription factors. As described in Chapter 3, several other transcription factors besides Nrf2 have been identified as ABCC3 regulators, including CAR (Wagner et al., 2005), PXR (Teng and Piquette-Miller, 2007), and PPAR (Maher et al., 2008). However, no response element has been identified for any of these factors in the ABCC3 gene. A similar set of experiments to that of Chapter 3, with a modified experimental design, would be required. While ChIP-seq experiments would rapidly and precisely identify important regions to test, they are often more costly than would be feasible for experiments such as these. Instead, in silico identification of putative response elements in the promoter region would be combined with sequential deletions and mutations of an ABCC3- promoter driven reporter gene construct. Once identified, functional response elements can be further confirmed using ChIP assays. 59

Chapter 5 provides evidence that APAP-gluc may provide a useful biomarker for clinical NASH. However, as stated in that section, the size of our pediatric NASH group is insufficient for appropriate statistical tests. An important future direction of this study is the recruitment and participation of additional patients. Furthermore, this preliminary study has only investigated pediatric patients. Expansion of this study into adult NAFLD patients, with a similar experimental design, is another clear option for future research.

REFERENCES

Abel J and Haarmann-Stemmann T (2010) An Introduction to the Molecular Basics of Aryl Hydrocarbon Receptor Biology. Biol Chem 391:1235-1248.

Ali R and Cusi K (2009) New Diagnostic and Treatment Approaches in Non-Alcoholic Fatty Liver Disease (NAFLD). Ann Med 41:265-278.

Ansher SS, Dolan P and Bueding E (1983) Chemoprotective Effects of Two Dithiolthiones and of Butylhydroxyanisole Against Carbon Tetrachloride and Acetaminophen Toxicity. Hepatology 3:932-935.

Bhalla S, Ozalp C, Fang S, Xiang L and Kemper J K (2004) Ligand-Activated Pregnane X Receptor Interferes With HNF-4 Signaling by Targeting a Common Coactivator PGC- 1alpha. Functional Implications in Hepatic Cholesterol and Glucose Metabolism. J Biol Chem 279:45139-45147.

Bock KW and Kohle C (2006) Ah Receptor: Dioxin-Mediated Toxic Responses As Hints to Deregulated Physiologic Functions. Biochem Pharmacol 72:393-404.

Bourguet W, Germain P and Gronemeyer H (2000) Nuclear Receptor Ligand-Binding Domains: Three-Dimensional Structures, Molecular Interactions and Pharmacological Implications. Trends Pharmacol Sci 21:381-388.

Boyle JP, Thompson T J, Gregg E W, Barker L E and Williamson D F (2010) Projection of the Year 2050 Burden of Diabetes in the US Adult Population: Dynamic Modeling of Incidence, Mortality, and Prediabetes Prevalence. Popul Health Metr 8:29.

Bugianesi E, Leone N, Vanni E, Marchesini G, Brunello F, Carucci P, Musso A, De P P, Capussotti L, Salizzoni M and Rizzetto M (2002) Expanding the Natural History of Nonalcoholic Steatohepatitis: From Cryptogenic Cirrhosis to Hepatocellular Carcinoma. Gastroenterology 123:134-140.

Chen T (2010) Overcoming Drug Resistance by Regulating Nuclear Receptors. Adv Drug Deliv Rev.

Chowdhry S, Nazmy M H, Meakin P J, nkova-Kostova A T, Walsh S V, Tsujita T, Dillon J F, Ashford M L and Hayes J D (2010) Loss of Nrf2 Markedly Exacerbates Nonalcoholic Steatohepatitis. Free Radic Biol Med 48:357-371.

Clark JM and Diehl A M (2003) Nonalcoholic Fatty Liver Disease: an Underrecognized Cause of Cryptogenic Cirrhosis. JAMA 289:3000-3004.

Copple BL, Jaeschke H and Klaassen C D (2010) Oxidative Stress and the Pathogenesis of Cholestasis. Semin Liver Dis 30:195-204. 61

Daly AK (2006) Significance of the Minor Cytochrome P450 3A Isoforms. Clin Pharmacokinet 45:13-31.

Davarinos NA and Pollenz R S (1999) Aryl Hydrocarbon Receptor Imported into the Nucleus Following Ligand Binding Is Rapidly Degraded Via the Cytosplasmic Proteasome Following Nuclear Export. J Biol Chem 274:28708-28715.

Davit-Spraul A, Gonzales E, Baussan C and Jacquemin E (2009) Progressive Familial Intrahepatic Cholestasis. Orphanet J Rare Dis 4:1.

Dennis AP and O'Malley B W (2005) Rush Hour at the Promoter: How the Ubiquitin- Proteasome Pathway Polices the Traffic Flow of Nuclear Receptor-Dependent Transcription. J Steroid Biochem Mol Biol 93:139-151.

Donnelly KL, Smith C I, Schwarzenberg S J, Jessurun J, Boldt M D and Parks E J (2005) Sources of Fatty Acids Stored in Liver and Secreted Via Lipoproteins in Patients With Nonalcoholic Fatty Liver Disease. J Clin Invest 115:1343-1351.

Edelman AB, Cherala G and Stanczyk F Z (2010) Metabolism and Pharmacokinetics of Contraceptive Steroids in Obese Women: a Review. Contraception 82:314-323.

Finn RD, Henderson C J, Scott C L and Wolf C R (2009) Unsaturated Fatty Acid Regulation of Cytochrome P450 Expression Via a CAR-Dependent Pathway. Biochem J 417:43-54.

Fiorucci S, Cipriani S, Mencarelli A, Renga B, Distrutti E and Baldelli F (2010) Counter- Regulatory Role of Bile Acid Activated Receptors in Immunity and Inflammation. Curr Mol Med 10:579-595.

Fisher CD, Jackson J P, Lickteig A J, Augustine L M and Cherrington N J (2008) Drug Metabolizing Enzyme Induction Pathways in Experimental Non-Alcoholic Steatohepatitis. Arch Toxicol 82:959-964.

Fisher CD, Lickteig A J, Augustine L M, Oude Elferink R P, Besselsen D G, Erickson R P and Cherrington N J (2009) Experimental Non-Alcoholic Fatty Liver Disease Results in Decreased Hepatic Uptake Transporter Expression and Function in Rats. Eur J Pharmacol 613:119-127.

Forman BM and Evans R M (1995) Nuclear Hormone Receptors Activate Direct, Inverted, and Everted Repeats. Ann N Y Acad Sci 761:29-37.

Forman BM, Tzameli I, Choi H S, Chen J, Simha D, Seol W, Evans R M and Moore D D (1998) Androstane Metabolites Bind to and Deactivate the Nuclear Receptor CAR-Beta. Nature 395:612-615.

Gao J and Xie W (2010) PXR and CAR at the Crossroad of Drug Metabolism and Energy Metabolism. Drug Metab Dispos. 62

Geenes V and Williamson C (2009) Intrahepatic Cholestasis of Pregnancy. World J Gastroenterol 15:2049-2066.

Geonzon-Gonzales MR (2007) Primary Sclerosing Cholangitis. Gastroenterol Nurs 30:102-105.

Gonzalez FJ (2007) The 2006 Bernard B. Brodie Award Lecture. Cyp2e1. Drug Metab Dispos 35:1-8.

Gu YZ, Hogenesch J B and Bradfield C A (2000) The PAS Superfamily: Sensors of Environmental and Developmental Signals. Annu Rev Pharmacol Toxicol 40:519-561.

Guengerich FP (2008) Cytochrome P450 and Chemical Toxicology. Chem Res Toxicol 21:70-83.

Hanagama M, Inoue H, Kamiya M, Shinone K and Nata M (2008) Gene Expression on Liver Toxicity Induced by Administration of Haloperidol in Rats With Severe Fatty Liver. Leg Med (Tokyo) 10:177-184.

Hankinson O (2005) Role of Coactivators in Transcriptional Activation by the Aryl Hydrocarbon Receptor. Arch Biochem Biophys 433:379-386.

Hardwick RN, Fisher C D, Canet M J, Lake A D and Cherrington N J (2010) DIVERSITY IN ANTIOXIDANT RESPONSE ENZYMES IN PROGRESSIVE STAGES OF HUMAN NON-ALCOHOLIC FATTY LIVER DISEASE. Drug Metab Dispos.

Hashimoto E and Tokushige K (2010) Prevalence, Gender, Ethnic Variations, and Prognosis of NASH. J Gastroenterol.

Hayes JD, Flanagan J U and Jowsey I R (2005) Glutathione Transferases. Annu Rev Pharmacol Toxicol 45:51-88.

Hayes JD, McMahon M, Chowdhry S and nkova-Kostova A T (2010) Cancer Chemoprevention Mechanisms Mediated Through the Keap1-Nrf2 Pathway. Antioxid Redox Signal 13:1713-1748.

Henderson CJ, Wolf C R, Kitteringham N, Powell H, Otto D and Park B K (2000) Increased Resistance to Acetaminophen Hepatotoxicity in Mice Lacking Glutathione S- Transferase Pi. Proc Natl Acad Sci U S A 97:12741-12745.

Hernandez JP, Mota L C and Baldwin W S (2009) Activation of CAR and PXR by Dietary, Environmental and Occupational Chemicals Alters Drug Metabolism, Intermediary Metabolism, and Cell Proliferation. Curr Pharmacogenomics Person Med 7:81-105.

Hewitt NJ, Lecluyse E L and Ferguson S S (2007) Induction of Hepatic Cytochrome P450 Enzymes: Methods, Mechanisms, Recommendations, and in Vitro-in Vivo Correlations. Xenobiotica 37:1196-1224. 63

Hodgson E and Rose R L (2007) The Importance of Cytochrome P450 2B6 in the Human Metabolism of Environmental Chemicals. Pharmacol Ther 113:420-428.

Hohenester S, Oude-Elferink R P and Beuers U (2009) Primary Biliary Cirrhosis. Semin Immunopathol 31:283-307.

Honkakoski P and Negishi M (1997) Characterization of a Phenobarbital-Responsive Enhancer Module in Mouse P450 Cyp2b10 Gene. J Biol Chem 272:14943-14949.

Huang W, Zhang J and Moore D D (2004) A Traditional Herbal Medicine Enhances Bilirubin Clearance by Activating the Nuclear Receptor CAR. J Clin Invest 113:137-143.

Jenkins JK and Boothby L A (2002) Treatment of Itching Associated With Intrahepatic Cholestasis of Pregnancy. Ann Pharmacother 36:1462-1465.

Jigorel E, Le V M, Boursier-Neyret C, Parmentier Y and Fardel O (2006) Differential Regulation of Sinusoidal and Canalicular Hepatic Drug Transporter Expression by Xenobiotics Activating Drug-Sensing Receptors in Primary Human Hepatocytes. Drug Metab Dispos 34:1756-1763.

Jou J, Choi S S and Diehl A M (2008) Mechanisms of Disease Progression in Nonalcoholic Fatty Liver Disease. Semin Liver Dis 28:370-379.

Kakizaki S, Karami S and Negishi M (2002) Retinoic Acids Repress Constitutive Active Receptor-Mediated Induction by 1,4-Bis[2-(3,5-Dichloropyridyloxy)]Benzene of the CYP2B10 Gene in Mouse Primary Hepatocytes. Drug Metab Dispos 30:208-211.

Kazlauskas A, Poellinger L and Pongratz I (1999) Evidence That the Co-Chaperone P23 Regulates Ligand Responsiveness of the Dioxin (Aryl Hydrocarbon) Receptor. J Biol Chem 274:13519-13524.

Kazlauskas A, Poellinger L and Pongratz I (2000) The Immunophilin-Like Protein XAP2 Regulates Ubiquitination and Subcellular Localization of the Dioxin Receptor. J Biol Chem 275:41317-41324.

Kitteringham NR, Abdullah A, Walsh J, Randle L, Jenkins R E, Sison R, Goldring C E, Powell H, Sanderson C, Williams S, Higgins L, Yamamoto M, Hayes J and Park B K (2010) Proteomic Analysis of Nrf2 Deficient Transgenic Mice Reveals Cellular Defence and Lipid Metabolism As Primary Nrf2-Dependent Pathways in the Liver. J Proteomics 73:1612-1631.

Klaassen CD and Aleksunes L M (2010) Xenobiotic, Bile Acid, and Cholesterol Transporters: Function and Regulation. Pharmacol Rev 62:1-96.

Klein-Hitpass L, Tsai S Y, Greene G L, Clark J H, Tsai M J and O'Malley B W (1989) Specific Binding of Estrogen Receptor to the Estrogen Response Element. Mol Cell Biol 9:43-49. 64

Kobayashi K, Sueyoshi T, Inoue K, Moore R and Negishi M (2003) Cytoplasmic Accumulation of the Nuclear Receptor CAR by a Tetratricopeptide Repeat Protein in HepG2 Cells. Mol Pharmacol 64:1069-1075.

Koike C, Moore R and Negishi M (2007) Extracellular Signal-Regulated Kinase Is an Endogenous Signal Retaining the Nuclear Constitutive Active/Androstane Receptor (CAR) in the Cytoplasm of Mouse Primary Hepatocytes. Mol Pharmacol 71:1217-1221.

Kojima H, Sakurai S, Matsumura M, Umemoto N, Uemura M, Morimoto H, Tamagawa Y and Fukui H (2006) Cryptogenic Cirrhosis in the Region Where Obesity Is Not Prevalent. World J Gastroenterol 12:2080-2085.

Kosters A and Karpen S J (2008) Bile Acid Transporters in Health and Disease. Xenobiotica 38:1043-1071.

Krasowski MD, Yasuda K, Hagey L R and Schuetz E G (2005) Evolutionary Selection Across the Nuclear Hormone Receptor Superfamily With a Focus on the NR1I Subfamily (Vitamin D, Pregnane X, and Constitutive Androstane Receptors). Nucl Recept 3:2.

Lau A, Villeneuve N F, Sun Z, Wong P K and Zhang D D (2008) Dual Roles of Nrf2 in Cancer. Pharmacol Res 58:262-270.

Lewis DF and Ito Y (2009) Human P450s Involved in Drug Metabolism and the Use of Structural Modelling for Understanding Substrate Selectivity and Binding Affinity. Xenobiotica 39:625-635.

Lickteig AJ, Fisher C D, Augustine L M, Aleksunes L M, Besselsen D G, Slitt A L, Manautou J E and Cherrington N J (2007) Efflux Transporter Expression and Acetaminophen Metabolite Excretion Are Altered in Rodent Models of Nonalcoholic Fatty Liver Disease. Drug Metab Dispos 35:1970-1978.

Liston HL, Markowitz J S and DeVane C L (2001) Drug Glucuronidation in Clinical Psychopharmacology. J Clin Psychopharmacol 21:500-515.

Lloret LC, Decleves X, Oppert J M, Basdevant A, Clement K, Bardin C, Scherrmann J M, Lepine J P, Bergmann J F and Mouly S (2009) Pharmacology of Morphine in Obese Patients: Clinical Implications. Clin Pharmacokinet 48:635-651.

Lu Y and Cederbaum A I (2008) CYP2E1 and Oxidative Liver Injury by Alcohol. Free Radic Biol Med 44:723-738.

Maher JM, Aleksunes L M, Dieter M Z, Tanaka Y, Peters J M, Manautou J E and Klaassen C D (2008) Nrf2- and PPAR Alpha-Mediated Regulation of Hepatic Mrp Transporters After Exposure to Perfluorooctanoic Acid and Perfluorodecanoic Acid. Toxicol Sci 106:319-328.

Malhotra D, Portales-Casamar E, Singh A, Srivastava S, Arenillas D, Happel C, Shyr C, Wakabayashi N, Kensler T W, Wasserman W W and Biswal S (2010) Global Mapping of 65

Binding Sites for Nrf2 Identifies Novel Targets in Cell Survival Response Through ChIP- Seq Profiling and Network Analysis. Nucleic Acids Res 38:5718-5734.

Marrero JA, Fontana R J, Su G L, Conjeevaram H S, Emick D M and Lok A S (2002) NAFLD May Be a Common Underlying Liver Disease in Patients With Hepatocellular Carcinoma in the United States. Hepatology 36:1349-1354.

Matsusue K, Miyoshi A, Yamano S and Gonzalez F J (2006) Ligand-Activated PPARbeta Efficiently Represses the Induction of LXR-Dependent Promoter Activity Through Competition With RXR. Mol Cell Endocrinol 256:23-33.

Miao J, Fang S, Bae Y and Kemper J K (2006) Functional Inhibitory Cross-Talk Between Constitutive Androstane Receptor and Hepatic Nuclear Factor-4 in Hepatic Lipid/Glucose Metabolism Is Mediated by Competition for Binding to the DR1 Motif and to the Common Coactivators, GRIP-1 and PGC-1alpha. J Biol Chem 281:14537-14546.

Miao W, Hu L, Kandouz M and Batist G (2003) Oltipraz Is a Bifunctional Inducer Activating Both Phase I and Phase II Drug-Metabolizing Enzymes Via the Xenobiotic Responsive Element. Mol Pharmacol 64:346-354.

Min G, Kim H, Bae Y, Petz L and Kemper J K (2002) Inhibitory Cross-Talk Between Estrogen Receptor (ER) and Constitutively Activated Androstane Receptor (CAR). CAR Inhibits ER-Mediated Signaling Pathway by Squelching P160 Coactivators. J Biol Chem 277:34626-34633.

Moore DD (2005) CAR: Three New Models for a Problem Child. Cell Metab 1:6-8.

Nebert DW and Russell D W (2002) Clinical Importance of the Cytochromes P450. Lancet 360:1155-1162.

Neuschwander-Tetri BA and Caldwell S H (2003) Nonalcoholic Steatohepatitis: Summary of an AASLD Single Topic Conference. Hepatology 37:1202-1219.

Nowell S and Falany C N (2006) Pharmacogenetics of Human Cytosolic Sulfotransferases. Oncogene 25:1673-1678.

Okada K, Shoda J, Taguchi K, Maher J M, Ishizaki K, Inoue Y, Ohtsuki M, Goto N, Takeda K, Utsunomiya H, Oda K, Warabi E, Ishii T, Osaka K, Hyodo I and Yamamoto M (2008) Ursodeoxycholic Acid Stimulates Nrf2-Mediated Hepatocellular Transport, Detoxification, and Antioxidative Stress Systems in Mice. Am J Physiol Gastrointest Liver Physiol 295:G735-G747.

Oshima M, Mimura J, Yamamoto M and Fujii-Kuriyama Y (2007) Molecular Mechanism of Transcriptional Repression of AhR Repressor Involving ANKRA2, HDAC4, and HDAC5. Biochem Biophys Res Commun 364:276-282.

Oude Elferink RP and Paulusma C C (2007) Function and Pathophysiological Importance of ABCB4 (MDR3 P-Glycoprotein). Pflugers Arch 453:601-610. 66

Pascussi JM, Gerbal-Chaloin S, Drocourt L, Maurel P and Vilarem M J (2003) The Expression of CYP2B6, CYP2C9 and CYP3A4 Genes: a Tangle of Networks of Nuclear and Steroid Receptors. Biochim Biophys Acta 1619:243-253.

Piton A, Rauch C, Langouet S, Guillouzo A and Morel F (2010) Involvement of Pregnane X Receptor in the Regulation of CYP2B6 Gene Expression by Oltipraz in Human Hepatocytes. Toxicol In Vitro 24:452-459.

Preiss D and Sattar N (2008) Non-Alcoholic Fatty Liver Disease: an Overview of Prevalence, Diagnosis, Pathogenesis and Treatment Considerations. Clin Sci (Lond) 115:141-150.

Privalsky ML (2004) The Role of Corepressors in Transcriptional Regulation by Nuclear Hormone Receptors. Annu Rev Physiol 66:315-360.

Roth A, Looser R, Kaufmann M and Meyer U A (2008) Sterol Regulatory Element Binding Protein 1 Interacts With Pregnane X Receptor and Constitutive Androstane Receptor and Represses Their Target Genes. Pharmacogenet Genomics 18:325-337.

Rushmore TH, Morton M R and Pickett C B (1991) The Antioxidant Responsive Element. Activation by Oxidative Stress and Identification of the DNA Consensus Sequence Required for Functional Activity. J Biol Chem 266:11632-11639.

Shan L, Vincent J, Brunzelle J S, Dussault I, Lin M, Ianculescu I, Sherman M A, Forman B M and Fernandez E J (2004) Structure of the Murine Constitutive Androstane Receptor Complexed to Androstenol: a Molecular Basis for Inverse Agonism. Mol Cell 16:907-917.

Shen G and Kong A N (2009) Nrf2 Plays an Important Role in Coordinated Regulation of Phase II Drug Metabolism Enzymes and Phase III Drug Transporters. Biopharm Drug Dispos 30:345-355.

Shindo S, Numazawa S and Yoshida T (2007) A Physiological Role of AMP-Activated Protein Kinase in Phenobarbital-Mediated Constitutive Androstane Receptor Activation and CYP2B Induction. Biochem J 401:735-741.

Silveira MG and Lindor K D (2008) Primary Sclerosing Cholangitis. Can J Gastroenterol 22:689-698.

Skouby SO (2010) Hormonal Contraception in Obesity, the Metabolic Syndrome, and Diabetes. Ann N Y Acad Sci 1205:240-244.

Squires EJ, Sueyoshi T and Negishi M (2004) Cytoplasmic Localization of Pregnane X Receptor and Ligand-Dependent Nuclear Translocation in Mouse Liver. J Biol Chem 279:49307-49314.

Staudinger JL, Ding X and Lichti K (2006) Pregnane X Receptor and Natural Products: Beyond Drug-Drug Interactions. Expert Opin Drug Metab Toxicol 2:847-857. 67

Sugimoto H, Okada K, Shoda J, Warabi E, Ishige K, Ueda T, Taguchi K, Yanagawa T, Nakahara A, Hyodo I, Ishii T and Yamamoto M (2010) Deletion of Nuclear Factor-E2- Related Factor-2 Leads to Rapid Onset and Progression of Nutritional Steatohepatitis in Mice. Am J Physiol Gastrointest Liver Physiol 298:G283-G294.

Suino K, Peng L, Reynolds R, Li Y, Cha J Y, Repa J J, Kliewer S A and Xu H E (2004) The Nuclear Xenobiotic Receptor CAR: Structural Determinants of Constitutive Activation and Heterodimerization. Mol Cell 16:893-905.

Tan KP, Wang B, Yang M, Boutros P C, Macaulay J, Xu H, Chuang A I, Kosuge K, Yamamoto M, Takahashi S, Wu A M, Ross D D, Harper P A and Ito S (2010) Aryl Hydrocarbon Receptor Is a Transcriptional Activator of the Human Breast Cancer Resistance Protein (BCRP/ABCG2). Mol Pharmacol 78:175-185.

Tanaka E, Terada M and Misawa S (2000) Cytochrome P450 2E1: Its Clinical and Toxicological Role. J Clin Pharm Ther 25:165-175.

Tanaka Y, Aleksunes L M, Cui Y J and Klaassen C D (2009) ANIT-Induced Intrahepatic Cholestasis Alters Hepatobiliary Transporter Expression Via Nrf2-Dependent and Independent Signaling. Toxicol Sci 108:247-257.

Tarantino G, Conca P, Basile V, Gentile A, Capone D, Polichetti G and Leo E (2007) A Prospective Study of Acute Drug-Induced Liver Injury in Patients Suffering From Non- Alcoholic Fatty Liver Disease. Hepatol Res 37:410-415.

Tarantino G, Di Minno M N and Capone D (2009) Drug-Induced Liver Injury: Is It Somehow Foreseeable? World J Gastroenterol 15:2817-2833.

Teng S and Piquette-Miller M (2007) Hepatoprotective Role of PXR Activation and MRP3 in Cholic Acid-Induced Cholestasis. Br J Pharmacol 151:367-376.

Tiniakos DG, Vos M B and Brunt E M (2010) Nonalcoholic Fatty Liver Disease: Pathology and Pathogenesis. Annu Rev Pathol 5:145-171.

Tolson AH and Wang H (2010) Regulation of Drug-Metabolizing Enzymes by Xenobiotic Receptors: PXR and CAR. Adv Drug Deliv Rev.

Tong KI, Katoh Y, Kusunoki H, Itoh K, Tanaka T and Yamamoto M (2006) Keap1 Recruits Neh2 Through Binding to ETGE and DLG Motifs: Characterization of the Two- Site Molecular Recognition Model. Mol Cell Biol 26:2887-2900.

Trauner M, Fickert P, Halilbasic E and Moustafa T (2008) Lessons From the Toxic Bile Concept for the Pathogenesis and Treatment of Cholestatic Liver Diseases. Wien Med Wochenschr 158:542-548.

Tsai MJ and O'Malley B W (1994) Molecular Mechanisms of Action of Steroid/Thyroid Receptor Superfamily Members. Annu Rev Biochem 63:451-486. 68

Tzameli I, Pissios P, Schuetz E G and Moore D D (2000) The Xenobiotic Compound 1,4- Bis[2-(3,5-Dichloropyridyloxy)]Benzene Is an Agonist Ligand for the Nuclear Receptor CAR. Mol Cell Biol 20:2951-2958.

van den Hurk MJ, Cruijsen P M, Schoeber J P, Scheenen W J, Roubos E W and Jenks B G (2008) Intracellular Signal Transduction by the Extracellular Calcium-Sensing Receptor of Xenopus Melanotrope Cells. Gen Comp Endocrinol 157:156-164.

Wagner M, Halilbasic E, Marschall H U, Zollner G, Fickert P, Langner C, Zatloukal K, Denk H and Trauner M (2005) CAR and PXR Agonists Stimulate Hepatic Bile Acid and Bilirubin Detoxification and Elimination Pathways in Mice. Hepatology 42:420-430.

Wang B, Yang L P, Zhang X Z, Huang S Q, Bartlam M and Zhou S F (2009) New Insights into the Structural Characteristics and Functional Relevance of the Human Cytochrome P450 2D6 Enzyme. Drug Metab Rev 41:573-643.

Wang Y, Beydoun M A, Liang L, Caballero B and Kumanyika S K (2008) Will All Americans Become Overweight or Obese? Estimating the Progression and Cost of the US Obesity Epidemic. Obesity (Silver Spring) 16:2323-2330.

Wieckowska A and Feldstein A E (2008) Diagnosis of Nonalcoholic Fatty Liver Disease: Invasive Versus Noninvasive. Semin Liver Dis 28:386-395.

Wright E, Vincent J and Fernandez E J (2007) Thermodynamic Characterization of the Interaction Between CAR-RXR and SRC-1 Peptide by Isothermal Titration Calorimetry. Biochemistry 46:862-870.

Xie HG and Kim R B (2005) St John's Wort-Associated Drug Interactions: Short-Term Inhibition and Long-Term Induction? Clin Pharmacol Ther 78:19-24.

Xu RX, Lambert M H, Wisely B B, Warren E N, Weinert E E, Waitt G M, Williams J D, Collins J L, Moore L B, Willson T M and Moore J T (2004) A Structural Basis for Constitutive Activity in the Human CAR/RXRalpha Heterodimer. Mol Cell 16:919-928.

Yoshinari K, Kobayashi K, Moore R, Kawamoto T and Negishi M (2003) Identification of the Nuclear Receptor CAR:HSP90 Complex in Mouse Liver and Recruitment of Protein Phosphatase 2A in Response to Phenobarbital. FEBS Lett 548:17-20.

Yoshinari K, Takagi S, Sugatani J and Miwa M (2006) Changes in the Expression of Cytochromes P450 and Nuclear Receptors in the Liver of Genetically Diabetic Db/Db Mice. Biol Pharm Bull 29:1634-1638.

Zamek-Gliszczynski MJ, Hoffmaster K A, Humphreys J E, Tian X, Nezasa K and Brouwer K L (2006a) Differential Involvement of Mrp2 (Abcc2) and Bcrp (Abcg2) in Biliary Excretion of 4-Methylumbelliferyl Glucuronide and Sulfate in the Rat. J Pharmacol Exp Ther 319:459-467. 69

Zamek-Gliszczynski MJ, Hoffmaster K A, Nezasa K, Tallman M N and Brouwer K L (2006b) Integration of Hepatic Drug Transporters and Phase II Metabolizing Enzymes: Mechanisms of Hepatic Excretion of Sulfate, Glucuronide, and Glutathione Metabolites. Eur J Pharm Sci 27:447-486.

Zanger UM, Klein K, Richter T, Toscano C and Zukunft J (2005) Impact of Genetic Polymorphism in Relation to Other Factors on Expression and Function of Human Drug- Metabolizing P450s. Toxicol Mech Methods 15:121-124.

Zhang DD (2006) Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab Rev 38:769-789.

Zhang J, Hu X and Lazar M A (1999) A Novel Role for Helix 12 of Retinoid X Receptor in Regulating Repression. Mol Cell Biol 19:6448-6457.

Zhang J, Huang W, Chua S S, Wei P and Moore D D (2002) Modulation of Acetaminophen-Induced Hepatotoxicity by the Xenobiotic Receptor CAR. Science 298:422-424.

Zhang J, Huang W, Qatanani M, Evans R M and Moore D D (2004) The Constitutive Androstane Receptor and Pregnane X Receptor Function Coordinately to Prevent Bile Acid-Induced Hepatotoxicity. J Biol Chem 279:49517-49522.

Zhang WV, Ramzan I and Murray M (2007) Impaired Microsomal Oxidation of the Atypical Antipsychotic Agent Clozapine in Hepatic Steatosis. J Pharmacol Exp Ther 322:770-777.

Zhang YK, Yeager R L, Tanaka Y and Klaassen C D (2010) Enhanced Expression of Nrf2 in Mice Attenuates the Fatty Liver Produced by a Methionine- and Choline-Deficient Diet. Toxicol Appl Pharmacol 245:326-334.

Zhou SF (2008) Drugs Behave As Substrates, Inhibitors and Inducers of Human Cytochrome P450 3A4. Curr Drug Metab 9:310-322.

Zhou SF, Chan E, Zhou Z W, Xue C C, Lai X and Duan W (2009) Insights into the Structure, Function, and Regulation of Human Cytochrome P450 1A2. Curr Drug Metab.

Zollner G, Marschall H U, Wagner M and Trauner M (2006) Role of Nuclear Receptors in the Adaptive Response to Bile Acids and Cholestasis: Pathogenetic and Therapeutic Considerations. Mol Pharm 3:231-251.

Zorn, A. M. Liver Development. StemBook [Internet]. 10-31-2008. Cambridge, MA: Harvard Stem Cell Institute. Ref Type: Generic

APPENDIX A:

INDUCTION OF DRUG METABOLISM ENZYMES AND TRANSPORTERS BY

OLTIPRAZ IN RATS

Matthew D. Merrell, Lisa M. Augustine, Angela L. Slitt1, and Nathan J. Cherrington

Department of Pharmacology and Toxicology, University of Arizona, Tucson, AZ,

1 Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island,

Kingston, RI

Abstract

Coordinate regulation of Phase I & II enzymes with xenobiotic transporters has been shown after treatment with microsomal enzyme inducers. The chemopreventive agent oltipraz (OPZ) induces Phase I & II drug metabolizing enzymes such as CYP2B and NQO1. While OPZ has previously been shown to activate Nrf2 to regulate the expression of NQO1, Cyp2B is known to be regulated by the constitutive androstane receptor (CAR). The purpose of this study was to examine the regulation of drug metabolizing enzymes and transporters in response to OPZ treatment, and to determine a potential role for CAR in OPZ-mediated induction. Sprague Dawley rats treated with

OPZ exhibited increased mRNA and protein levels of both NQO1 and Cyp2B1/2 by 24h.

To determine whether OPZ activates transporter gene expression via CAR, male and female Wistar-Kyoto rats were treated with OPZ and mRNA levels quantified by bDNA signal amplification. Wistar-Kyoto females express lower levels of CAR protein, such that they exhibit significantly lower induction of Cyp2B1 by phenobarbital as compared to 71

Wistar-Kyoto males. OPZ induced UGT2B1 in males significantly higher than in females.

However, OPZ induced mEH, NQO1, and 3A equally in both genders, indicating a possible CAR-independent mechanism of induction. Similarly, the transporters Mdr1a and b, Mrp3 and 4 were induced by OPZ without any apparent difference between genders. Other transporters were unaffected by OPZ. In summary, OPZ coordinately increases multiple hepatic xenobiotic transporter mRNA levels, along with Phase I & II enzymes via both CAR-dependent and CAR-independent mechanisms.

Introduction

The chemopreventative agent Oltipraz [5-(2-pyrazinyl)-kmethyl-l,2-dithiole-3- thione] (OPZ) was originally marketed as a treatment for schistosomiasis. Although early trials achieved excellent cure rates, concerns over side effects resulted in its discontinuation as an anti-parasitic. During investigation into oltipraz’s anti-schistosomal activity, investigators found increased levels of glutathione in mice. Subsequent rodent studies revealed induction of enzymes responsible for the maintenance of glutathione levels, as well as other enzymes involved in electrophile detoxication (Kensler et al.,

1999). These Phase-I and -II enzymes include: glutathione transferases (GST),

NAD(P)H quinone oxidoreductase (Nqo1), microsomal epoxide hydrolase (mEH), aflatoxin aldehyde reductase, and glucuronosyl transferases, in addition to enzymes that increase glutathione levels (Kensler et al., 1985;Primiano et al., 1996;Davidson et al.,

1990;Morel et al., 1993;Ansher et al., 1986). This inductive ability led investigators to suggest OPZ as a chemopreventive agent, as the activity of these enzymes could prevent the DNA and protein adduction that may lead to tumor initiation. Early chemopreventative studies validated this suggestion, as OPZ was shown to protect 72

against cancers induced by both benzo[a]pyrene and aflatoxin B1 (Kensler et al., 1999).

Oltipraz has demonstrated chemopreventive activity against carcinogens targeting the lung, stomach, hematopoietic cells, trachea, breast, pancreas, urinary bladder, colon, skin, and liver (Clapper, 1998).

Many of the genes induced by OPZ have been shown to be regulated by the direct activation of the Antioxidant Response Element/Electrophile Response Element

(ARE/EpRE). The ARE is a cis-acting regulatory element located in the 5’-flanking region of several chemoprotective genes, such as NQO1 and GSTs. The NF-E2-related factor-

2 (Nrf2) was subsequently identified as an ARE activating transcription factor

(Venugopal and Jaiswal, 1996). Nrf2 knockout mice exhibit decreased levels of many known OPZ-induced genes (Kwak et al., 2001), showed increased sensitivity to chemical toxicants and carcinogens, and are resistant to the protective actions of chemopreventive compounds (Ramos-Gomez et al., 2001).

While the greater part of OPZ research has dealt with the induction of Phase II enzymes, OPZ does alter expression and activity of cytochrome P450 (P450) enzymes.

OPZ induces gene expression of some P450 enzymes, notably CYP1A1, CYP1A2,

Cyp2b1, Cyp2b2, and CYP2E1 (Buetler et al., 1995;Langouet et al., 1997;Manson et al.,

1997;Maheo et al., 1998;Cho and Kim, 2003;Cherrington et al., 2003). There is interesting evidence that the induction of certain P450’s is dependent on non-Nrf2 pathways. The mechanism of CYP1A2 gene induction has been characterized as aryl hydrocarbon receptor dependent (Cho and Kim, 2003;Miao et al., 2003), and CYP2B gene induction is known to be regulated by the constitutive androstane receptor (CAR).

Under normal conditions, CAR is localized to the cytoplasm in association with the CAR

Cytoplasmic Retention Protein and hsp90 (Kobayashi et al., 2003). Once activated, CAR 73

translocates to the nucleus where it heterodimerizes with the retinoid x receptor-α

(RXRα). This CAR: RXRα heterodimer then binds to the Phenobarbital Responsive

Enhancer Module (PBREM) to drive expression of CYP2B6 and CYP2B10 (Honkakoski and Negishi, 1997;Honkakoski et al., 1998).

We have previously shown that OPZ induction of Cyp2b10 expression is significantly decreased in RXRα-deficient mice (Cherrington et al., 2003). We used

Wistar Kyoto (WKY) rats to investigate the involvement of CAR in the induction by OPZ.

WKY rats have been shown to be sexually dimorphic in their induction of CYP2B1 mRNA in liver by phenobarbital (PB). This is likely due to the dimorphic expression of hepatic CAR protein, as male WKY rats have higher CAR protein levels and greater

CYP2B1 induction than their female counterparts (Yoshinari et al., 2001). Dimorphic induction of a particular gene in WKY rats suggests the involvement of CAR in that induction. This study was developed to determine the effect of OPZ on transporter regulation, and to investigate whether OPZ also activates the nuclear receptor CAR.

Materials and Methods

Chemicals. Oltipraz was a gift of Dr. Ronald Lubet (National Cancer Institute,

Bethesda, MD). All other chemicals were purchased from Sigma-Aldrich Co. (St. Louis,

MO).

Animals. All animals were housed and acclimated in a temperature-, light-, and humidity-controlled environment in cages with hardwood chip bedding and were fed

Harlan Teklad Rodent Diet W (Harlan Laboratories, Madison, WI) ad libitum. Male

Sprague Dawley rats (Charles River Laboratories, Wilmington, MA) weighing 200-250g were given either OPZ (150 mg/kg) or corn oil by daily oral gavage with an injection volume of 5 ml/kg (n=5) for 3, 12, 24, or 96h. Male or female Wistar Kyoto rats (200- 74

250g; Harlan, Indianapolis, IN) were treated with OPZ (150 mg/kg, po in corn oil), PB (80

mg/kg, ip in saline), corn oil (po), or saline (ip) for four days with an injection volume of 5

ml/kg (n=5). All livers were excised 24h following the final treatment or at the times

indicated and snap-frozen in liquid nitrogen and stored at -80oC until use.

RNA isolation. Total RNA was isolated using RNAzol B reagent (Tel-Test Inc.,

Friendswood, TX) as per the manufacturer’s protocol. RNA concentration was determined by UV spectrophotometry and its integrity was examined by ethidium bromide staining after agarose gel electrophoresis.

Branched DNA assay. Rat Ntcp, Oatp1, Oatp2, Oatp4, Oxt1, Oat2, Oat3, Mrp1,

Mrp2, Mrp3, Mrp4, Mrp5, Mrp6, Mdr1a, Mdr1b, Mdr2, Bsep, Cyp1A1, Cyp2B1/2

Cyp3A4, Cyp4A2/3, NQO1, UGT1A6, and UGT2B1 probes were used as previously described (Hartley and Klaassen, 2000;Leazer and Klaassen, 2003;Slitt et al.,

2002;Buist et al., 2002;Li et al., 2002;Brady et al., 2002;Cherrington et al., 2002).

Specific oligonucleotide probes were diluted in lysis buffer supplied in the Quantigene™

HV Signal Amplification Kit (Panomics, Inc., Freemont, CA). All reagents for analysis

(i.e., lysis buffer, capture hybridization buffer, amplifier/label probe buffer, and substrate solution) were supplied. Total RNA (1 µg/µl; 10 µl) was added to each well of a 96-well plate containing 50 µl capture hybridization buffer and 50 µl of a diluted probe set. Total

RNA was allowed to hybridize to each probe set overnight at 53°C. Subsequent hybridization steps were carried out as per the manufacturer’s protocol, and luminescence was measured with a Quantiplex™ 320 bDNA luminometer interfaced with

Quantiplex™ Data Management Software Version 5.02 for analysis of luminescence from 96-well plates. 75

Western blot analysis. Polyclonal antibodies to NQO1 (a gift from Dr. David

Ross, University of Colorado Health Sciences Center, Denver, CO) and CYP2B1/2

(Xenotech LLC, Lanexa, KS) were used to determine protein levels. Cytosolic and

microsomal fractions were prepared using previously described methods (Cook and

Hodgson, 1983). The various cytosolic and microsomal fractions were then analyzed for

the presence of NQO1 or CYP2B1/2 protein, respectively, by SDS-PAGE and western

blotting, using previously described procedures (Laemmli, 1970). Western blots were

developed with ECL reagents (Amersham, Arlington Heights, IL) as per manufacturer’s

protocol, exposed on Blue Lite Autoradiography Film (ISC BioExpress; Kaysville, UT),

and quantified using ImageJ densitometry software (NIH)

Statistical Analysis. Data are expressed as mean ± standard error. For multiple

comparisons, analysis of variance was performed followed by Duncan's multiple range

test. Gender and constitutive differences were determined using a Student’s t-test. The

level of significance was set at p ≤ 0.05.

Results

Induction time course of CYP2B1/2 and NQO1. The induction of hepatic

CYP2B1/2 and NQO1 over time by OPZ was determined in male Sprague Dawley rats.

Branched DNA signal amplification and Western blotting analysis were performed to determine whether OPZ was capable of inducing the mRNA and protein levels of the

CAR target gene CYP2B1/2 and the Nrf2 target gene NQO1. CYP2B1/2 mRNA levels were significantly increased at 24h (34-fold) and 96h (39-fold), respectively (Figure 1).

NQO1 mRNA levels tended to be increased by OPZ at 12h, but were significantly increased at 24h (13-fold) and 96h (6-fold). CYP2B protein levels were also significantly 76

increased at 24 (14-fold) and 96h (30-fold) (Figure 2), whereas NQO1 protein levels were only significantly increased by OPZ at 96h (5-fold).

Transporter and metabolism enzyme gene expression in the sexually dimorphic

Wistar Kyoto rat. The expression levels of several hepatic transporters and drug metabolizing genes were determined in male and female WKY rats treated with OPZ and PB using branched DNA signal amplification analysis. In the present study, while

OPZ treatment significantly increased Oct1 expression in males and Oatp2 in females, the increase was less than 2-fold and was not significantly different from the expression in the other sex. There was no increase in the mRNA levels of other uptake transporter in either male or female rats (Figure 3). (The sexual dimorphism observed in the expression of Oat3 is likely the result of endocrine regulation rather than the differential expression of CAR). As shown in figure 4, several efflux transporters were significantly induced by OPZ including Mrp3 (~17-fold), Mrp4 (~8-fold), Mdr1a (~1.7-fold), and Mdr1b

(~4-fold). However, there were no differences in the induction of these genes between male and females indicating that CAR is not involved in the induction of these genes by

OPZ. OPZ increased the mRNA levels of several drug metabolizing enzymes including

CYP1A1 (in females), CYP2B1/2, CYP3A1/23, CYP4A2/3 (in males), microsomal epoxide hydrolase, NQO1, UGT1A6, and UGT2B1 (figure 5). As expected, CYP2B1/2 mRNA abundance was induced by PB significantly higher in male rats (70-fold) than in female rats (30-fold).The induction of UGT1A6 and UGT2B1 in male WKY rats (18.5- and 8.5-fold, respectively) was significantly higher than in female rats (14.7- and 5.8-fold, respectively) indicating that CAR may play a role in OPZ induction of UGT1A6 and

UGT2B1. In contrast, there was no difference in the induction of CYP2B1/2 between 77

male and female WKY rats by OPZ (70-fold) suggesting a CAR independent mechanism for CYP2B1/2 induction by OPZ.

Discussion

The induction by OPZ of genes responsible for the disposition and bioavailability of many xenobiotics indicates the possibility of drug-drug interactions in patients treated with this compound. Clinical drug interaction studies have highlighted the effects of co- administration of inducing compounds with analgesics such as morphine and acetaminophen (Kiang et al., 2005). In our results, treatment with OPZ resulted in an

18.5-fold increase in the mRNA levels of UGT1A6, which has been shown to be involved in the metabolism of both morphine and acetaminophen (Stone et al., 2003).

Additionally, OPZ treatment increased Mrp3 mRNA 17-fold. Mrp3 has been shown to be important in sinusoidal efflux of both morphine and acetaminophen glucuronide conugates (Zelcer et al., 2005;Court MH et al., 2001).

Two morphine glucuronide conjugates are formed in the human liver, morphine-

6-glucuronide (M6G) and morphine-3-glucuronide (M3G). While UGT2B7 is known to be the major isoform responsible for this glucuronidation, UGT1A6 does catalyze M3G formation (Stone et al., 2003). Treatments with compounds that alter UGT expression have altered morphine pharmacokinetics (Kiang et al., 2005). Studies in Mrp3 -/- mice

highlighted the importance of this transporter in the disposition of morphine conjugates.

Plasma M3G levels were reduced 50-fold in these mice, indicating a major shift in the

elimination route of morphine. Additionally, the absence of Mrp3 resulted in decreased

antinociceptive effects of M6G (Zelcer et al., 2005).

Estimating the clinical effects of co-treatment with OPZ and morphine is

problematic. M-6-G appears to be more potent than morphine in providing analgesia, 78

whereas M-3-G may antagonize the effects of morphine (Zelcer et al., 2005). Since

UGT1A6 is induced by OPZ and increases the formation of M3G, induction of this enzyme may lead to decreased therapeutic effect of opiod analgesics. Alternatively, induction of Mrp3 presumably leads to an increase in sinusoidal efflux of both M6G and

M3G, resulting in higher plasma concentrations and bioavailabilty. The balance between increased metabolic elimination and increased plasma concentration make the actual therapeutic result unclear.

The induction of both Mrp3 and UGTs also presents possible drug-drug interactions with the co-administration of OPZ and acetaminophen. While different UGT isoforms do exhibit different substrate specificities, UGT1A6 has a high affinity for acetaminophen (Court MH et al., 2001). Decreased acetaminophen glucuronidation in certain animals has been correlated with increased hepatotoxicity (de Morais and Wells,

1988). Recent work from our laboratory highlighted the changes of acetaminophen disposition when Mrp3 is upregulated (Lickteig et al., 2007).

Changes in drug disposition can affect the bioavailability of therapeutic compounds and have the potential to lead to adverse drug reactions in the clinical setting. In the case of OPZ treatment, our data show an increase in the expression of several transport genes as well as drug metabolizing enzymes, with the potential for altered drug disposition. Care should be given in the administration of OPZ to avoid these possible adverse drug reactions.

The induction of several microsomal enzymes by OPZ has been reported to occur through the Nrf2/ARE pathway (Ramos-Gomez et al., 2001). While the induction of these genes has been shown to be ARE/EpRE dependent, other genes induced by

OPZ have no described ARE sequence, including CYP1A1, CYP2B, and CYP3A. These 79

genes are considered hallmark genes in recognizing activation of the aryl hydrocarbon receptor, CAR, and the pregnane X receptor, respectively. Thus, OPZ induction of these genes may be mediated by other mechanisms.

To identify an alternate OPZ induction mechanism, we compared the induction of several genes in male and female WKY rats. WKY rats exhibit a gender dimorphic expression of hepatic CAR. Male WKY rats have been shown to have higher hepatic expression of CAR than female WKY rats, and males exhibit a superior CYP2B1/2 induction response (Yoshinari et al., 2001). This sexually dimorphic liver expression of

CAR was used to indicate CAR-dependent drug induction.

Because male and female WKY rats exhibit other differences beside CAR expression levels, gene induction data from male and female WKY rats should be cautiously interpreted. Suggested differences in hepatic gene induction between males and females could be non-CAR related. While the CAR knockout mouse model is a

better indicator of CAR’s role in gene induction, there is no better in vivo rat model

available.

OPZ treatment induced the expression of seven hepatic enzymes (CYPs 1A1,

2B1/2, 3A1/23, mEH, Nqo1, UGT1A6, and UGT2B1) and four transporters (Mrp3, Mrp4,

Mdr1a, and Mdr1b). However, whereas the induction of several genes by PB exhibited

gender differences in induction, only the UGT1A6 and 2B1 showed the same

dimorphism in OPZ treated WKY rats. Our findings on the induction of CYP2B1/2 and

Mrp3 are consistent with previous experiments in WKY rats, showing OPZ induction in

both genes, but no sexual dimorphism in the induction (Cherrington et al., 2003).

Early investigators in the field of chemoprevention defined two categories of

Phase-II enzyme inducers (Prochaska and Talalay, 1988): bifunctional inducers (Phase- 80

II and select Phase-I genes) and monofunctional inducers (Phase-II without select

Phase-I genes). OPZ has been traditionally grouped with other monofunctional inducers

(phenols, lactones, isothiocyanates, and dithiocarbamates) (Kensler et al., 1999).

However, the identification of Phase-I genes induced by OPZ has led some to question that classification. OPZ has been shown to induce several Phase-I enzymes [1A1, 1A2,

2B1, 2B2, 2E1 (Maheo et al., 1998;Langouet et al., 1997;Manson et al., 1997;Cho and

Kim, 2003;Cherrington et al., 2003)] and some investigators are suggesting that OPZ be re-classified as a bifunctional inducer (Miao et al., 2003). The present data similarly shows induction of several Phase-I enzymes, including CYP1A1, Cyp2B1/2,

CYP3A1/23, and numerous xenobiotic transporters, in addition to the often reported

Phase-II enzymes.

In summary, OPZ increases the mRNA levels of several genes that encode

Phase-I and Phase-II drug metabolizing enzymes and transporters, and has the potential to lead to adverse drug reactions. In addition to the known activation of Nrf2, we report the novel observation that OPZ may also activate CAR as a means to induce drug metabolizing enzymes. 81

References

Ansher SS, Dolan P and Bueding E (1986) Biochemical Effects of Dithiolthiones. Food Chem Toxicol 24:405-415.

Brady JM, Cherrington N J, Hartley D P, Buist S C, Li N and Klaassen C D (2002) Tissue Distribution and Chemical Induction of Multiple Drug Resistance Genes in Rats. Drug Metab Dispos 30:838-844.

Buetler TM, Gallagher E P, Wang C, Stahl D L, Hayes J D and Eaton D L (1995) Induction of Phase I and Phase II Drug-Metabolizing Enzyme MRNA, Protein, and Activity by BHA, Ethoxyquin, and Oltipraz. Toxicol Appl Pharmacol 135:45-57.

Buist SC, Cherrington N J, Choudhuri S, Hartley D P and Klaassen C D (2002) Gender- Specific and Developmental Influences on the Expression of Rat Organic Anion Transporters. J Pharmacol Exp Ther 301:145-151.

Cherrington NJ, Hartley D P, Li N, Johnson D R and Klaassen C D (2002) Organ Distribution of Multidrug Resistance Proteins 1, 2, and 3 (Mrp1, 2, and 3) MRNA and Hepatic Induction of Mrp3 by Constitutive Androstane Receptor Activators in Rats. J Pharmacol Exp Ther 300:97-104.

Cherrington NJ, Slitt A L, Maher J M, Zhang X X, Zhang J, Huang W, Wan Y J, Moore D D and Klaassen C D (2003) Induction of Multidrug Resistance Protein 3 (Mrp3) in Vivo Is Independent of Constitutive Androstane Receptor. Drug Metab Dispos 31:1315-1319.

Cho IJ and Kim S G (2003) Oltipraz Inhibits 3-Methylcholanthrene Induction of CYP1A1 by CCAAT/Enhancer-Binding Protein Activation. J Biol Chem 278:44103-44112.

Clapper ML (1998) Chemopreventive Activity of Oltipraz. Pharmacol Ther 78:17-27.

Cook JC and Hodgson E (1983) Induction of Cytochrome P-450 by Methylenedioxyphenyl Compounds: Importance of the Methylene Carbon. Toxicol Appl Pharmacol 68:131-139.

Court MH, Duan S X, von Moltke L L, Greenblatt D J, Patten C J, Miners J O and Mackenzie P I (2001) Interindividual Variability in Acetaminophen Glucuronidation by Human Liver Microsomes: Identification of Relevant Acetaminophen UDP- Glucuronosyltransferase Isoforms. J Pharmacol Exp Ther 299:998-1006.

Davidson NE, Egner P A and Kensler T W (1990) Transcriptional Control of Glutathione S-Transferase Gene Expression by the Chemoprotective Agent 5-(2-Pyrazinyl)-4- Methyl-1,2-Dithiole-3-Thione (Oltipraz) in Rat Liver. Cancer Res 50:2251-2255.

de Morais SM and Wells P G (1988) Deficiency in Bilirubin UDP-Glucuronyl Transferase As a Genetic Determinant of Acetaminophen Toxicity. J Pharmacol Exp Ther 247:323- 331. 82

Hartley DP and Klaassen C D (2000) Detection of Chemical-Induced Differential Expression of Rat Hepatic Cytochrome P450 MRNA Transcripts Using Branched DNA Signal Amplification Technology. Drug Metabolism and Disposition 28:608-616.

Honkakoski P and Negishi M (1997) Characterization of a Phenobarbital-Responsive Enhancer Module in Mouse P450 Cyp2b10 Gene. J Biol Chem 272:14943-14949.

Honkakoski P, Zelko I, Sueyoshi T and Negishi M (1998) The Nuclear Orphan Receptor CAR-Retinoid X Receptor Heterodimer Activates the Phenobarbital-Responsive Enhancer Module of the CYP2B Gene. Mol Cell Biol 18:5652-5658.

Kensler TW, Egner P A, Trush M A, Bueding E and Groopman J D (1985) Modification of Aflatoxin B1 Binding to DNA in Vivo in Rats Fed Phenolic Antioxidants, Ethoxyquin and a Dithiothione. Carcinogenesis 6:759-763.

Kensler TW, Groopman J D, Sutter T R, Curphey T J and Roebuck B D (1999) Development of Cancer Chemopreventive Agents: Oltipraz As a Paradigm. Chem Res Toxicol 12:113-126.

Kiang TK, Ensom M H and Chang T K (2005) UDP-Glucuronosyltransferases and Clinical Drug-Drug Interactions. Pharmacol Ther 106:97-132.

Kobayashi K, Sueyoshi T, Inoue K, Moore R and Negishi M (2003) Cytoplasmic Accumulation of the Nuclear Receptor CAR by a Tetratricopeptide Repeat Protein in HepG2 Cells. Mol Pharmacol 64:1069-1075.

Kwak MK, Itoh K, Yamamoto M, Sutter T R and Kensler T W (2001) Role of Transcription Factor Nrf2 in the Induction of Hepatic Phase 2 and Antioxidative Enzymes in Vivo by the Cancer Chemoprotective Agent, 3H-1, 2-Dimethiole-3-Thione. Mol Med 7:135-145.

Laemmli UK (1970) Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4. Nature 227:680-685.

Langouet S, Maheo K, Berthou F, Morel F, Lagadic-Gossman D, Glaise D, Coles B, Ketterer B and Guillouzo A (1997) Effects of Administration of the Chemoprotective Agent Oltipraz on CYP1A and CYP2B in Rat Liver and Rat Hepatocytes in Culture. Carcinogenesis 18:1343-1349.

Leazer TM and Klaassen C D (2003) The Presence of Xenobiotic Transporters in Rat Placenta. Drug Metab Dispos 31:1-15.

Li N, Hartley D P, Cherrington N J and Klaassen C D (2002) Tissue Expression, Ontogeny, and Inducibility of Rat Organic Anion Transporting Polypeptide 4. J Pharmacol Exp Ther 301:551-560. 83

Maheo K, Morel F, ntras-Ferry J, Langouet S, Desmots F, Corcos L and Guillouzo A (1998) Endotoxin Suppresses the Oltipraz-Mediated Induction of Major Hepatic Glutathione Transferases and Cytochromes P450 in the Rat. Hepatology 28:1655-1662.

Manson MM, Ball H W, Barrett M C, Clark H L, Judah D J, Williamson G and Neal G E (1997) Mechanism of Action of Dietary Chemoprotective Agents in Rat Liver: Induction of Phase I and II Drug Metabolizing Enzymes and Aflatoxin B1 Metabolism. Carcinogenesis 18:1729-1738.

Morel F, Fardel O, Meyer D J, Langouet S, Gilmore K S, Meunier B, Tu C P, Kensler T W, Ketterer B and Guillouzo A (1993) Preferential Increase of Glutathione S-Transferase Class Alpha Transcripts in Cultured Human Hepatocytes by Phenobarbital, 3- Methylcholanthrene, and Dithiolethiones. Cancer Res 53:231-234.

Primiano T, Gastel J A, Kensler T W and Sutter T R (1996) Isolation of CDNAs Representing Dithiolethione-Responsive Genes. Carcinogenesis 17:2297-2303.

Prochaska HJ and Talalay P (1988) Regulatory Mechanisms of Monofunctional and Bifunctional Anticarcinogenic Enzyme Inducers in Murine Liver. Cancer Res 48:4776- 4782.

Ramos-Gomez M, Kwak M K, Dolan P M, Itoh K, Yamamoto M, Talalay P and Kensler T W (2001) Sensitivity to Carcinogenesis Is Increased and Chemoprotective Efficacy of Enzyme Inducers Is Lost in Nrf2 Transcription Factor-Deficient Mice. Proc Natl Acad Sci U S A 98:3410-3415.

Slitt AL, Cherrington N J, Hartley D P, Leazer T M and Klaassen C D (2002) Tissue Distribution and Renal Developmental Changes in Rat Organic Cation Transporter MRNA Levels. Drug Metab Dispos 30:212-219.

Stone AN, Mackenzie P I, Galetin A, Houston J B and Miners J O (2003) Isoform Selectivity and Kinetics of Morphine 3- and 6-Glucuronidation by Human Udp- Glucuronosyltransferases: Evidence for Atypical Glucuronidation Kinetics by UGT2B7. Drug Metab Dispos 31:1086-1089.

Venugopal R and Jaiswal A K (1996) Nrf1 and Nrf2 Positively and C-Fos and Fra1 Negatively Regulate the Human Antioxidant Response Element-Mediated Expression of NAD(P)H:Quinone Oxidoreductase1 Gene. Proc Natl Acad Sci U S A 93:14960-14965.

Yoshinari K, Sueyoshi T, Moore R and Negishi M (2001) Nuclear Receptor CAR As a Regulatory Factor for the Sexually Dimorphic Induction of CYB2B1 Gene by Phenobarbital in Rat Livers. Mol Pharmacol 59:278-284. 84

Zelcer N, van de W K, Hillebrand M, Sarton E, Kuil A, Wielinga P R, Tephly T, Dahan A, Beijnen J H and Borst P (2005) Mice Lacking Multidrug Resistance Protein 3 Show Altered Morphine Pharmacokinetics and Morphine-6-Glucuronide Antinociception. Proc Natl Acad Sci U S A 102:7274-7279.

Figures

Figure 1. Induction of CYP2B1/2 and NQO1 mRNA by OPZ. Total RNA was isolated from OPZ treated (150 mg/kg) adult male Sprague Dawley rats at 3, 12, 24, or 96h and analyzed by the bDNA signal amplification assay for CYP2B1/2 and NQO1 mRNA content. mRNA levels are expressed as mean relative light units (RLU) / 10 µg total RNA

+ S.E.M. (n=5) * significantly different from vehicle (p ≤ 0.05).

Figure 2. Induction of CYP2B1/2 and NQO1 protein by OPZ. Upper panel:

Representative western blots from Sprague Dawley rats treated with OPZ at 3, 12, 24, and 96 h stained with anti-CYP2B1/2 or anti-Nqo1 antibodies. Lower panel:

Quantification of protein levels by densitometry. The data are presented as relative protein expression + S.E.M. (n=5). * significantly different from vehicle (p ≤ 0.05).

Figure 3. Induction of hepatic uptake transporter mRNA in male and female WKY rats. Hepatic transporter mRNA levels were measured in male and female WKY rats treated with OPZ and PB. mRNA levels are expressed as mean relative light units (RLU)

/ 10 µg total RNA + S.E.M. * significantly different from vehicle, † significantly different from male (p ≤ 0.05).

Figure 4. Induction of hepatic efflux transporter mRNA in male and female WKY rats. Hepatic transporter mRNA levels were measured in male and female WKY rats treated with OPZ and PB. mRNA levels are expressed as mean relative light units (RLU)

/ 10 µg total RNA + S.E.M. * significantly different from vehicle, † significantly different

from male (p ≤ 0.05). 89

Figure 5. Induction of hepatic drug metabolizing enzyme mRNA in male and female WKY rats. Hepatic drug metabolizing enzyme mRNA levels were measured in male and female WKY rats treated with OPZ and PB. mRNA levels are expressed as mean relative light units (RLU) / 10 µg total RNA + S.E.M. * significantly different from

vehicle, † significantly different from male (p ≤ 0.05).

APPENDIX B:

THE Nrf2 ACTIVATOR OLTIPRAZ ALSO ACTIVATES THE CONSTITUTIVE

ANDROSTANE RECEPTOR

Matthew D. Merrell, Jonathan P. Jackson, Lisa M. Augustine, Craig D. Fisher, Angela L.

Slitt, Jonathan M. Maher, Wendong Huang, David D. Moore, Youcai Zhang, Curtis D.

Klaassen, and Nathan J. Cherrington

Department of Pharmacology and Toxicology, University of Arizona, Tucson, AZ

(M.D.M., J.P.J, L.M.A., C.D.F., N.J.C), Department of Biomedical and Pharmaceutical

Sciences, University of Rhode Island, Kingston, RI (A.L.S.), TARA center, University of

Tsukuba Tennoudai, Tsukuba-shi, Ibaraki 305-8577, Japan (J.M.M.), Department of

Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX (W.H., D.D.M.),

Department of Pharmacology, Toxicology and Therapeutics, University of Kansas

Medical Center, Kansas City, KS (Y.Z., C.D.K.)

Abstract

Oltipraz (OPZ) is a well-known inducer of NAD(P)H:quinone oxidoreductase (NQO1) along with other enzymes that comprise the NF-E2-related factor2 (Nrf2) battery of detoxification genes. However, OPZ treatment also induces expression of CYP2B, a gene regulated by the constitutive androstane receptor (CAR). Therefore, this study was designed to determine whether OPZ induces gene expression in the mouse liver through activation of CAR in addition to Nrf2. OPZ increased the mRNA expression of both

Cyp2b10 and Nqo1 in C57BL/6 mouse livers. As expected, in livers from Nrf2-/- mice, 91

OPZ induction of Nqo1 was reduced, indicating Nqo1 induction is dependent on Nrf2 activation, whereas Cyp2b10 induction was unchanged. The robust induction of

Cyp2b10 by OPZ in wild-type mice was completely absent in CAR-/- mice, revealing a

CAR dependent induction by OPZ. OPZ also induced transcription of the human

CYP2B6 promoter-reporter containing the phenobarbital responsive element in mouse liver using an in vivo transcription assay. Additionally, OPZ induced in vivo nuclear accumulation of CAR at 3 h, but, as with phenobarbital, was unable to reverse androstanol repression of mCAR constitutive activity in transiently transfected HepG2 cells. In summary, OPZ induces expression of Cyp2b10 and Nqo1 via the activation of

CAR and Nrf2, respectively.

Introduction

The chemopreventive chemical oltipraz (OPZ) (4-methyl-5-(2-pyrazinyl)-1,2- dithiol-3-thione) belongs to a class of compounds known as dithiolethiones. The anti- tumorigenic activity of OPZ is generally ascribed to its strong induction of enzymes that mediate detoxication processes. Early studies revealed that OPZ increases expression of a number of Phase-I and -II enzymes, including: glutathione-S-transferases (GST),

NAD(P)H:quinone oxidoreductase (NQO1), microsomal epoxide hydrolase, aflatoxin aldehyde reductase, glucuronosyl transferases, as well as enzymes that increase glutathione levels, namely glutathione reductase and glucose-6-phosphate dehydrogenase (Kensler et al., 1985;Primiano et al., 1996;Ansher et al., 1986;Davidson et al., 1990;Morel et al., 1993).

Induction of these metabolic enzymes by OPZ has been linked to the transcription factor NF-E2-related factor-2 (Nrf2) and its activation of the Antioxidant 92

Response Element/Electrophile Response Element (ARE/EpRE). Under normal conditions, Nrf2 is sequestered in the cytosol and marked for proteasomal degradation by the protein Kelch-like ECH-associated protein1 (Keap1). This protein acts as an

adapter for Cullin 3 (Cul3)-based ubiquitin ligase (E3 ligase), as well as a ‘receptor’ for

electrophiles (Cullinan et al., 2004). In the absence of electrophiles/oxidative stress, Nrf2

is ubiquitinated and targeted for degradation by the 26S-proteasome, keeping cellular

levels of Nrf2 low and preventing activation of its response element. Electrophilic binding

to Keap1 is thought to disrupt the ubiquitination complex and inhibit Nrf2 degradation

(Zhang et al., 2004). The increased cellular concentration of unbound Nrf2 in turn leads

to ARE/EpRE activation (Zhang, 2006). It has been demonstrated in Keap1 knockout

mice that the loss of this Nrf2-Keap1 complex leads to Nrf2 nuclear accumulation and

activation (Itoh et al., 2004). Further evidence of the role of Nrf2 in OPZ gene induction

of detoxication enzymes was provided through experiments showing that loss of

expression of Nrf2 abrogates both the chemoprotective activity of OPZ, as well as the

inducibility of many known OPZ-induced genes (Kwak et al., 2001;Ramos-Gomez et al.,

2001).

Although early investigation into the activity of OPZ focused on induction of

detoxication enzymes like NQO1 and GST, OPZ also alters the expression and activity

of certain cytochrome P450 enzymes. OPZ has been shown to induce the expression of

CYP 1A1, 1A2, 2B1, 2B2, and 2E1 (Maheo et al., 1998;Cho and Kim, 2003;Cherrington

et al., 2003). The induction of at least one of these isoforms, CYP1A1, has been

characterized as aryl hydrocarbon receptor dependent (Le et al., 2002), which suggests

that OPZ may activate multiple transcription factors. 93

Little has been reported previously regarding the strong induction of the CYP2B genes by OPZ. The mechanism by which CYP2B genes are induced is well documented

(Sueyoshi and Negishi, 2001). CYP2B inducers activate the constitutive androstane receptor (CAR), which is normally sequestered in the cytoplasm by the cytoplasmic CAR retention protein (Kobayashi et al., 2003). Treatment with CAR activators appears to induce nuclear accumulation through one of two mechanisms. 1) Some CAR activators are ligands, such as TCPOBOP (1,4-bis[2-(3,5-dichloropyridyloxy)]) in mice and CITCO

(6-[4-Chlorophenyl]imidazo(2,1-b)(1,3)thiazole-5-carbaldehyde-O-3,4-dichlorobenzyl] oxime) in humans, and act as direct activators of CAR nuclear translocation. 2) Other

CAR activators, such as phenobarbital and phenytoin, do not appear to be actual ligands and are thought to promote CAR nuclear translocation indirectly (Jackson et al.,

2004;Stanley et al., 2006;Jackson et al., 2006). In both direct and indirect activation,

CAR translocates to the nucleus where it heterodimerizes with the retinoid x receptor-α

(RXRα). The CAR:RXRα heterodimer then binds to a Phenobarbital Responsive

Enhancer Module to drive expression of CYP2B genes, including Cyp2b1 in rats,

Cyp2b10 in mice, and CYP2B6 in humans (Honkakoski and Negishi, 1997;Honkakoski et al., 1998). We have previously shown that OPZ induction of Cyp2b10 mRNA expression is significantly less in RXRα-deficient mice (Cherrington et al., 2003).

The present study was developed to determine whether, in addition to activating

Nrf2, OPZ also activates the nuclear receptor CAR. We report here that OPZ strongly induces Cyp2b10 in a CAR dependent manner, that OPZ treatment increases CAR nuclear accumulation, and that OPZ appears to be an indirect activator of CAR. This study demonstrates an uncharacterized mechanism for OPZ-mediated gene induction through activation of the constitutive androstane receptor. 94

Materials and Methods

Chemicals - Oltipraz was a gift of Dr. Ronald Lubet (National Cancer Institute,

Bethesda, MD). D-luciferin was synthesized by Dr. Eugene Mash (University of Arizona).

5α-Androstan-3α-ol (androstanol) was purchased from Steraloids (Newport, RI). PB was purchased from Mallinckrodt, Inc. (Paris, KY). Ketamine HCl and xylazine injectables were purchased from Associated Medical Supply (Scottsdale, AZ). Luciferin was obtained from Molecular Imaging Products Company (Ann Arbor, MI). All other

chemicals were purchased from Sigma-Aldrich Co. (St. Louis, MO).

Animals - All animals were housed and acclimated in a temperature-, light-, and

humidity-controlled environment in cages with hardwood chips and were given Harlan

Teklad Rodent Diet W (Harlan Laboratories, Madison, WI) and water ad libitum. All the

animals were acclimated for at least 1 week before the experiments and were allowed water and standard chow ad libitum. Housing and experimental procedures were in accordance with the Guide for the Care and Use of Laboratory Animals as determined by

the U.S. National Institutes of Health. Male C57BL/6 mice were treated with either corn

oil (5 ml/kg), OPZ (150 mg/kg, ip in corn oil), or PB (80 mg/kg, ip in saline) with an

injection volume of 5 ml/kg. The choice of these doses was based on previous work from

our lab (Cherrington et al., 2002), as well as the preponderance of published literature.

For the dose response, adult male C57BL/6 mice were treated with vehicle or

OPZ, once daily for four days (50 mg/kg, 100 mg/kg, 150 mg/kg, 200 mg/kg, and 250

mg/kg). Male Nrf2-/- mice (Aleksunes et al., 2006), CAR-/- mice (Wei et al., 2000), or

C57BL/6 mice (n=5 in each group) were treated with either corn oil (5 ml/kg), OPZ (150

mg/kg, po in corn oil), or PB (80 mg/kg, ip in saline, 24 h) for four days with an injection

volume of 5 ml/kg. For mRNA analysis, livers were excised 24 h following the final 95

treatment, snap-frozen in liquid nitrogen, and stored at -80ºC until use. For nuclear extraction, livers were excised 3 h after OPZ treatment, nuclear protein was isolated as previously described (Sueyoshi et al., 1995) and stored at -80ºC until western blot analysis of CAR accumulation. In order to assess the degree of cytosolic contamination in the nuclear extracts, western blotting was performed against GAPDH protein, with minimal cytosolic contamination detected (data not shown).

RNA isolation - Total RNA was isolated using RNAzol B reagent (Tel-Test Inc.,

Branched DNA (bDNA) signal amplification assay - Mouse Cyp2b10 and Nqo1 probe sets were used as previously described (Cherrington et al., 2003;Aleksunes et al.,

2005). These oligonucleotide probes were diluted in lysis buffer supplied in the

Quantigene™ HV Signal Screen Kit (Panomics, Inc., Freemont, CA). Reagents for analysis were supplied with the kit (i.e., lysis buffer, amplifier/label probe buffer, and substrate solution) or prepared in the lab (capture hybridization buffer). Total RNA (1

µg/µl; 10 µl) was added to each well of a 96-well plate containing 50 µl capture hybridization buffer and 50 µl of diluted probe set. mRNA was allowed to hybridize to each probe set overnight at 53°C. Subsequent hybridization steps were carried out as per the manufacturer’s protocol, and luminescence was measured with a Quantiplex™

320 bDNA luminometer interfaced with Quantiplex™ Data Management Software

Version 5.02 for analysis of luminescence from 96-well plates.

In vivo transcription assay - Male C57BL/6 mice (20-25 g, Charles River

Laboratories, Raleigh, NC) were administered 10 µg naked plasmid DNA (CYP2B6 96

promoter luciferase reporter construct) as a rapid (5 s) tail vein injection in sterile saline at a dose volume equal to 10% of body weight. Eighteen h later, animals were anesthetized with a mixture of ketamine (72 mg/kg) and xylazine (6 mg/kg). Mice were injected ip with luciferin (70 µl of a 50 mg/ml stock solution) 5 min prior to imaging. A

VersArray 1300B camera (Princeton Instruments, Trenton, NJ) thermoelectrically cooled

to -100ºC, with an aperture of ƒ1, connected to a light sealed imaging chamber was

used for all images. Images were acquired in gray-scale, and pseudo-color maps were

created with the WinView 32 program (Princeton Instruments). Color maps were

superimposed over the light image of the mouse using Adobe Photoshop 6.0 (Adobe

Systems, Mountain View, CA), and these images were considered time 0. Each animal

(n=3) was administered a single ip dose of either OPZ (150 mg/kg) or corn oil at a dose

volume of 5 ml/kg and imaging was repeated 24 h after dosing.

Western blot analysis - Nuclear extracts from control, PB and OPZ treated

C57BL/6 mice were resolved on a SDS-10% polyacrylamide gel, and transferred to a nitrocellulose membrane (Biorad, Hercules, CA). Blots were incubated 1 h at room temperature in blocking buffer containing 5% nonfat milk in TBST. After 3 h incubation with a rabbit anti-CAR polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), the membrane was incubated 1 h with a goat anti-rabbit IgG-HRP conjugate (Santa Cruz

Biotechnology, Santa Cruz, CA). Western blots were visualized using ECL Advanced reagents (Amersham, Arlington Heights, IL) as per manufacturer’s protocol.

In vitro luciferase assay - Cultured HepG2 cells were transiently transfected with a mouse CAR expression plasmid [mCAR/pCR3.0, (Sueyoshi et al., 1999)] and a

CYP2B6-tk-luciferase construct. The human CYP2B6 promoter luciferase reporter construct was obtained from Dr. Richard Kim (Vanderbilt University School of Medicine, 97

Nashville, TN). The CYP2B6 promoter luciferase reporter construct contains a 1.7kb fragment which maintains the core promoter (+39/-364) and the distal enhancer region (-

1461/-2013) including the phenobarbital-responsive element (PBREM) (unpublished).

Briefly, HepG2 cells were cultured in Eagles MEM (Invitrogen, Carlsbad,

California) supplemented with 10% FBS (Invitrogen, Carlsbad, California) according to the protocol provided by American Type Culture Collection (Manassas, VA). In 24-well plates, the CYP2B6-tk-luciferase plasmid (0.1 µg) was cotransfected with pRL-tk transfection control (0.001 µg) (Promega Corp., Madison, WI) into HepG2 cells using

Transfectene (Qiagen, Hilden, Germany), with or without a mouse CAR expression plasmid (0.025 µg). 24 h after transfection, cells were cultured in the presence of DMSO

(0.2%), PB (1 mM), TCPOBOP (250 nM), or OPZ (5, 20, 50, 100 µM) with or without androstanol (10 µM). After 24 h of exposure, the media was removed and cells were lysed with 100 µl of passive lysis buffer. Luciferase activity was determined by the Dual-

Glo™ Luciferase Assay per manufacturer’s protocol (Promega Corp., Madison, WI).

Statistical analysis - Data are expressed as mean ± standard error. For multiple comparisons, an analysis of variance was performed followed by Duncan’s multiple range test. The level of significance was set at p ≤ 0.05.

Results

Induction of Cyp2b10 and Nqo1 expression in C57BL/6 mice - Nqo1 mRNA levels were significantly increased by OPZ (22-fold), but were not induced by administration of PB (Fig. 1). However, both PB and OPZ treatment resulted in robust increases in mRNA expression of Cyp2b10 compared to control.

Dose response of induction of Nqo1 and Cyp2b10 to OPZ treatment – The increase of Nqo1 mRNA levels by OPZ (Fig. 2) reached significance at a dose of 100 98

mg/kg, and continued to increase through the higher doses, reaching an induction of 6- fold by 250 mg/kg. Though Cyp2b10 induction by OPZ did not reach significance until

200 mg/kg, the induction was more profound, with 47- and 74-fold increases at 200 and

250 mg/kg.

Induction of Cyp2b10 and Nqo1 expression in Nrf2 and CAR deficient mice - To determine the involvement of Nrf2 and CAR in the induction of Cyp2b10 and Nqo1, Nrf2- and CAR-null mice were utilized. As an indication of Nrf2-mediated induction, treatment of wild-type mice with PB and OPZ resulted in 2.5- and 3.6- fold increases in Nqo1 mRNA, respectively (Fig. 3). This induction of Nqo1 was ablated in the Nrf2-/- animals, as

has been previously noted for OPZ (Kwak et al., 2001). The absence of Nrf2 had no

effect on the induction of Cyp2b10 mRNA, as the robust induction by PB and OPZ was

maintained in Nrf2-/- animals.

Treatment of wild-type mice with PB or OPZ resulted in a greater than 30- and

10-fold increase in Cyp2b10 mRNA, respectively (Fig. 4). This robust induction was

completely absent in the CAR-/- animals treated with PB and OPZ, as has been

previously noted for PB (Wei et al., 2000). In contrast, the induction of Nqo1 mRNA was

maintained in CAR-/- animals.

Real-time in vivo activation of the human CYP2B6 promoter in mice - The ability of OPZ to activate transcription of the human CYP2B6 promoter containing the PBREM

was determined by transfecting a human CYP2B6 promoter-reporter luciferase reporter

via rapid intravenous hydrodynamic injection via the tail vein and a real-time in vivo

imaging assay before and after dosing. OPZ treatment resulted in robust activation of

the human CYP2B6 promoter as seen in Figure 5. 99

Nuclear accumulation of CAR in PB and OPZ treated mice - To determine the ability of OPZ to induce nuclear accumulation of CAR, C57BL/6 mice were treated with corn oil (5 ml/kg), PB (80 mg/kg) and OPZ (150 mg/kg). Western blot analysis of nuclear extracts show an increase in CAR nuclear accumulation in both PB and OPZ treated animals. (Fig. 6)

Ability of OPZ to overcome androstanol inhibition of CAR - Co-transfection of

HepG2 cells with a mouse CAR expression construct and CYP2B6 reporter gene containing the PBREM resulted in a 5-fold increase in luciferase expression (Fig. 7).

Known mouse CAR (mCAR) activity modulators and ligands, androstanol and

TCPOBOP, were used to further investigate the mechanisms of CAR activation. As expected, treatment with the mCAR inhibitor androstanol repressed transcriptional activation of the CYP2B6 reporter. In contrast, co-treatment with the direct CAR activator

TCPOBOP was sufficient to overcome this inhibition. Neither PB nor OPZ were able to overcome androstanol repression of CAR at the doses examined.

Discussion

Oltipraz was recognized as a microsomal enzyme inducer over 25 years ago, with apparent 4- to 6-fold increases in the activity of liver GSTs in mice treated with the drug (Ansher et al., 1983). The induction of GST as well as other cytoprotective enzymes has been termed the “antioxidant response” (Jaiswal, 1994), and is central to the proposed mechanism of action of OPZ in cancer prevention. The antioxidant response is an important mechanism for cellular defense and is mediated by the

Nrf2/ARE pathway, resulting in the induction of several chemoprotective genes, including NQO1, HO-1, and GSTA1 and GSTA2 (Kensler et al., 1985). It is important to note that the induction of NQO1 by OPZ has been shown to be dependent on Nrf2 100

activation (Ramos-Gomez et al., 2001). Our current data demonstrating the loss of Nqo1 induction in Nrf2-/- mice supports that finding.

Although the induction of these genes has been shown to be ARE/EpRE dependent, OPZ is also capable of inducing other genes in an Nrf2-independent manner

(Le et al., 2002;Ebert et al., 2005). For example, CYP2B is induced by OPZ yet is considered a hallmark gene of CAR activation. The mechanism of induction of CYP2B isoforms has been well characterized and currently no ARE/EpRE consensus sequences have been identified in their 5’-flanking regions. Consistent with these facts, our data show that OPZ activates gene transcription through activation of multiple and distinct transcription factors, including Nrf2 and CAR.

In order to analyze the role of both CAR and Nrf2 in OPZ gene induction, CAR- or Nrf2-deficient mice were treated with OPZ or the known CAR activator PB. Our data indicate that Nrf2 and CAR are required in the regulation of gene induction by OPZ. As expected, the loss of Nrf2 resulted in loss of Nqo1 induction, while induction of Cyp2b10 mRNA was unaffected. These results both confirm a role for Nrf2 in Nqo1 regulation, and suggest an Nrf2 independent mechanism for the induction of Cyp2b10 mRNA by

OPZ. The complete abrogation of Cyp2b10 mRNA induction in CAR-null mice treated with OPZ strongly implicates CAR as the regulatory mechanism. These data agree with our previously published data, which revealed that loss of the obligatory CAR-binding- partner RXRα abrogates OPZ induction of Cyp2B (Cherrington et al., 2003).

Two additional lines of evidence in this study characterize OPZ as a CAR activator. First, OPZ treatment results in transcriptional activation of a human CYP2B6 promoter construct in transiently transgenic mice. The promoter region of this construct contains the phenobarbital responsive enhancer module (PBREM), the well- 101

characterized CAR DNA-binding sequence. The evident induction of this reporter gene in OPZ treated mice compared to corn oil controls demonstrates the ability of OPZ to induce CAR-driven genes in vivo. Secondly, OPZ induces CAR nuclear accumulation in hepatocytes of OPZ treated mice. Because the main component of CAR activation appears to be nuclear translocation (Kobayashi et al., 2003), these findings firmly establish OPZ as a CAR activator. Interestingly, the OPZ dose used in these in vivo studies did not cause maximal induction of the CAR target gene Cyp2b10 (Fig. 2). This indicates that CAR may have not been fully activated at that dose. The increase in CAR activity by OPZ treatment seen even at this lower dose helps to support OPZ as a CAR activator.

In vivo, CAR can be activated either directly by ligand binding (as in the case of

TCPOBOP) or indirectly through the activation of currently unknown pathways (as with

PB) (Stanley et al., 2006). In cultured cells lines, however, transfected CAR freely translocates to the nucleus without exposure to CAR activators (Kobayashi et al., 2003).

This is apparent in our study by the increase in CYP2B6-promoter driven activity of the luciferase reporter gene upon the addition of mCAR. The treatment of these cells with the inverse agonist androstanol repressed the activity of mCAR and the transcriptional activation of the luciferase reporter gene. Androstanol is a CAR ligand and binding results in a conformational change in CAR that inhibits the recruitment of the transcriptional machinery (Wright et al., 2007). The ability of TCPOBOP to overcome this inhibition has been previously shown and results from the direct interaction of

TCPOBOP with CAR, which both displaces androstanol and promotes the recruitment of the transcriptional machinery (Tzameli et al., 2000;Sueyoshi et al., 1999). In the current study, TCPOBOP treatment, but not PB or OPZ treatment, was able to reverse the 102

inhibitory effects of androstanol. Although OPZ co-treatment resulted in a slight increase in luciferase activity, this increase never reached significance (p ≤ 0.05). While these findings suggest that OPZ acts similarly to PB to indirectly activate CAR, further investigation of any OPZ-CAR interactions is necessary to definitively rule out OPZ as a

CAR ligand.

The mechanism by which PB indirectly activates CAR remains to be elucidated, though the involvement of a number of kinases and phosphatases has been proposed.

The involvement of the extracellular signal-regulated kinase (ERK) in the repression of

CAR nuclear translocation is of particular interest. Previous work has shown that epidermal growth factor (EGF) is able to attenuate CAR-mediated induction of CYP2B by PB treatment (Bauer et al., 2004). Inhibitors of MKK1/2 (a kinase downstream of EGF signaling) have been shown to potentiate the induction CYP2B by PB (Joannard et al.,

2006). Most recently, ERK1/2 dephosphorylation (deactivation) was shown to be associated with CAR nuclear translocation (Koike et al., 2007). Our findings that OPZ activates CAR may provide additional support to the importance of ERK1/2 in the regulation of CAR. OPZ has been shown to inhibit the constitutive phosphorylation

(activation) of ERK1/2, and has been shown to inhibit the activity of MKK1 (Kang et al.,

2003). Whether this inhibition of ERK signaling by OPZ is responsible for the activation of CAR is unclear, and is under investigation.

The data presented in this manuscript demonstrate that OPZ modulates gene- expression through CAR activation, in addition to Nrf2. These results add to previous findings on the dual activation of Nrf2 and CAR. Trans-stilbene oxide and diallyl sulfide have both been identified as activators of both CAR and Nrf2 (Fisher et al., 2007;Slitt et al., 2006). The addition of yet another structurally diverse compound to this group raises 103

the possibility of cross-talk between the two factors, though further studies are needed to determine the extent of any connections.

104

References

Aleksunes LM, Slitt A L, Maher J M, Dieter M Z, Knight T R, Goedken M, Cherrington N J, Chan J Y, Klaassen C D and Manautou J E (2006) Nuclear Factor-E2-Related Factor 2 Expression in Liver Is Critical for Induction of NAD(P)H:Quinone Oxidoreductase 1 During Cholestasis. Cell Stress Chaperones 11:356-363.

Aleksunes LM, Slitt A M, Cherrington N J, Thibodeau M S, Klaassen C D and Manautou J E (2005) Differential Expression of Mouse Hepatic Transporter Genes in Response to Acetaminophen and Carbon Tetrachloride. Toxicol Sci 83:44-52.

Ansher SS, Dolan P and Bueding E (1983) Chemoprotective Effects of Two Dithiolthiones and of Butylhydroxyanisole Against Carbon Tetrachloride and Acetaminophen Toxicity. Hepatology 3:932-935.

Ansher SS, Dolan P and Bueding E (1986) Biochemical Effects of Dithiolthiones. Food Chem Toxicol 24:405-415.

Bauer D, Wolfram N, Kahl G F and Hirsch-Ernst K I (2004) Transcriptional Regulation of CYP2B1 Induction in Primary Rat Hepatocyte Cultures: Repression by Epidermal Growth Factor Is Mediated Via a Distal Enhancer Region. Mol Pharmacol 65:172-180.

Cho IJ and Kim S G (2003) Oltipraz Inhibits 3-Methylcholanthrene Induction of CYP1A1 by CCAAT/Enhancer-Binding Protein Activation. J Biol Chem 278:44103-44112.

Cullinan SB, Gordan J D, Jin J, Harper J W and Diehl J A (2004) The Keap1-BTB Protein Is an Adaptor That Bridges Nrf2 to a Cul3-Based E3 Ligase: Oxidative Stress Sensing by a Cul3-Keap1 Ligase. Mol Cell Biol 24:8477-8486.

Ebert B, Seidel A and Lampen A (2005) Induction of Phase-1 Metabolizing Enzymes by Oltipraz, Flavone and Indole-3-Carbinol Enhance the Formation and Transport of Benzo[a]Pyrene Sulfate Conjugates in Intestinal Caco-2 Cells. Toxicol Lett 158:140-151. 105

Fisher CD, Augustine L M, Maher J M, Nelson D M, Slitt A L, Klaassen C D, Lehman- McKeeman L D and Cherrington N J (2007) Induction of Drug-Metabolizing Enzymes by Garlic and Allyl Sulfide Compounds Via Activation of Constitutive Androstane Receptor and Nuclear Factor E2-Related Factor 2. Drug Metab Dispos 35:995-1000.

Honkakoski P and Negishi M (1997) Characterization of a Phenobarbital-Responsive Enhancer Module in Mouse P450 Cyp2b10 Gene. J Biol Chem 272:14943-14949.

Itoh K, Tong K I and Yamamoto M (2004) Molecular Mechanism Activating Nrf2-Keap1 Pathway in Regulation of Adaptive Response to Electrophiles. Free Radic Biol Med 36:1208-1213.

Jackson JP, Ferguson S S, Moore R, Negishi M and Goldstein J A (2004) The Constitutive Active/Androstane Receptor Regulates Phenytoin Induction of Cyp2c29. Mol Pharmacol 65:1397-1404.

Jackson JP, Ferguson S S, Negishi M and Goldstein J A (2006) Phenytoin Induction of the Cyp2c37 Gene Is Mediated by the Constitutive Androstane Receptor. Drug Metab Dispos 34:2003-2010.

Jaiswal AK (1994) Antioxidant Response Element. Biochem Pharmacol 48:439-444.

Joannard F, Rissel M, Gilot D, Anderson A, Orfila-Lefeuvre L, Guillouzo A, Atfi A and Lagadic-Gossmann D (2006) Role for Mitogen-Activated Protein Kinases in Phenobarbital-Induced Expression of Cytochrome P450 2B in Primary Cultures of Rat Hepatocytes. Toxicol Lett 161:61-72.

Kang KW, Cho I J, Lee C H and Kim S G (2003) Essential Role of Phosphatidylinositol 3-Kinase-Dependent CCAAT/Enhancer Binding Protein Beta Activation in the Induction of Glutathione S-Transferase by Oltipraz. J Natl Cancer Inst 95:53-66.

Kobayashi K, Sueyoshi T, Inoue K, Moore R and Negishi M (2003) Cytoplasmic Accumulation of the Nuclear Receptor CAR by a Tetratricopeptide Repeat Protein in HepG2 Cells. Mol Pharmacol 64:1069-1075.

Le FE, Lagadic-Gossmann D, Rauch C, Bardiau C, Maheo K, Massiere F, Le V M, Guillouzo A and Morel F (2002) Transcriptional Induction of CYP1A1 by Oltipraz in Human Caco-2 Cells Is Aryl Hydrocarbon Receptor- and Calcium-Dependent. J Biol Chem 277:24780-24787.

Maheo K, Morel F, Antras-Ferry J, Langouet S, Desmots F, Corcos L and Guillouzo A (1998) Endotoxin Suppresses the Oltipraz-Mediated Induction of Major Hepatic Glutathione Transferases and Cytochromes P450 in the Rat. Hepatology 28:1655-1662.

Primiano T, Gastel J A, Kensler T W and Sutter T R (1996) Isolation of CDNAs Representing Dithiolethione-Responsive Genes. Carcinogenesis 17:2297-2303.

Slitt AL, Cherrington N J, Dieter M Z, Aleksunes L M, Scheffer G L, Huang W, Moore D D and Klaassen C D (2006) Trans-Stilbene Oxide Induces Expression of Genes Involved in Metabolism and Transport in Mouse Liver Via CAR and Nrf2 Transcription Factors. Mol Pharmacol 69:1554-1563.

Stanley LA, Horsburgh B C, Ross J, Scheer N and Wolf C R (2006) PXR and CAR: Nuclear Receptors Which Play a Pivotal Role in Drug Disposition and Chemical Toxicity. Drug Metab Rev 38:515-597.

Sueyoshi T, Kawamoto T, Zelko I, Honkakoski P and Negishi M (1999) The Repressed Nuclear Receptor CAR Responds to Phenobarbital in Activating the Human CYP2B6 Gene. J Biol Chem 274:6043-6046.

Sueyoshi T, Kobayashi R, Nishio K, Aida K, Moore R, Wada T, Handa H and Negishi M (1995) A Nuclear Factor (NF2d9) That Binds to the Male-Specific P450 (Cyp 2d-9) Gene in Mouse Liver. Mol Cell Biol 15:4158-4166.

Sueyoshi T and Negishi M (2001) Phenobarbital Response Elements of Cytochrome P450 Genes and Nuclear Receptors. Annu Rev Pharmacol Toxicol 41:123-43.:123-143. 107

Wei P, Zhang J, Egan-Hafley M, Liang S and Moore D D (2000) The Nuclear Receptor CAR Mediates Specific Xenobiotic Induction of Drug Metabolism. Nature 407:920-923.

Wright E, Vincent J and Fernandez E J (2007) Thermodynamic Characterization of the Interaction Between CAR-RXR and SRC-1 Peptide by Isothermal Titration Calorimetry. Biochemistry 46:862-870.

Zhang DD (2006) Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab Rev 38:769-789.

Zhang DD, Lo S C, Cross J V, Templeton D J and Hannink M (2004) Keap1 Is a Redox- Regulated Substrate Adaptor Protein for a Cul3-Dependent Ubiquitin Ligase Complex. Mol Cell Biol 24:10941-10953.

108

Figures

Figure 1. Nqo1 and Cyp2b10 mRNA induction. C57BL/6 mice were treated with corn oil, PB (80 mg/kg), or OPZ (150 mg/kg). Total RNA was isolated and mRNA levels were analyzed by the bDNA signal amplification assay. mRNA levels are expressed as mean relative light units (RLU) / 10 µg total RNA + S.E.M. (n=3) * significantly different from vehicle (p ≤ 0.05).

109

Figure 2. Dose response of induction of Nqo1 and Cyp2b10 to OPZ treatment.

Total RNA was isolated from adult male C57BL/6 mice after treatment of OPZ (50 mg/kg, 100 mg/kg, 150 mg/kg, 200 mg/kg, 250 mg/kg, i.p., once daily, four days). The mRNA levels of Cyp2b10 and Nqo1 were determined by the bDNA signal amplification assay. The data are presented as mean fold induction ± S.E.M. (n=5-6) * significantly different from vehicle (p ≤ 0.05).

110

Figure 3. Induction of Cyp2b10 and Nqo1 mRNA in wild-type and Nrf2-null mice.

Total RNA was isolated from wild-type and Nrf2-/- mice treated with OPZ (150 mg/kg) and PB (80 mg/kg) and analyzed by the bDNA signal amplification assay. mRNA levels are expressed as mean relative light units (RLU) / 10 µg total RNA + S.E.M. (n=5). * significantly different from vehicle (p ≤ 0.05).

111

Figure 4. Induction of Cyp2b10 and Nqo1 mRNA in wild-type and CAR-null mice.

Total RNA was isolated from wild-type and CAR-/- mice treated with OPZ (150 mg/kg) and PB (80 mg/kg) and analyzed by the bDNA signal amplification assay. mRNA levels are expressed as mean relative light units (RLU) / 10 µg total RNA + S.E.M. (n=5). * significantly different from vehicle (p ≤ 0.05).

112

Figure 5. In vivo activation of the human CYP2B6 promoter-luciferase reporter construct in mouse liver after vehicle or OPZ administration. Male C57Bl/6 mice were injected with 10 µg of naked plasmid DNA in a rapid (5 s) tail vein injection in sterile saline in a volume equal to 10% of body weight. Following a 16 h recovery period, animals were anesthetized with a solution of ketamine (72 mg/kg) and xylazine (6 mg/kg) and injected with luciferin ip. At time 0, mice were injected with corn oil vehicle (5 ml/kg, ip) or OPZ (150 mg/kg). Images were collected at 0 h and at 24 h following vehicle or OPZ administration.

113

Figure 6. CAR nuclear accumulation. C57Bl/6 mice were treated with corn oil, PB (80 mg/kg), or OPZ (150 mg/kg). Nuclear extracts were immunoblotted to detect the presence of CAR.

114

Figure 7. Activation of the CYP2B6-tk-luciferase reporter construct in HepG2 cells after treatment with 1,4-bis[2-3,5-dichloropyridyloxy)]benzene (TCPOBOP), phenobarbital (PB), and oltipraz (OPZ). HepG2 cells were transiently transfected with the CYP2B6-tk-luciferase plasmid (0.1 µg) and pRL-TK (0.001 µg) into HepG2 cells, with or without a mouse CAR expression plasmid (0.25 µg). 24 h after transfection, the cells were treated with DMSO, TCPOBOP (TC, 250 nm), PB (1 mM) or OPZ (5, 20, 50, 100

µm) in the presence or absence of 10 µM 5α-androstan-3α-ol. 24 h after treatment the cell lysates were collected and luciferase activity was determined by the Dual-Glo™

Luciferase Assay. The data is presented as the mean fold activation + S.E.M. (n=3 wells/treatment). * significantly different from DMSO control (p ≤ 0.05).

115

APPENDIX C:

INVOLVEMENT OF THE NRF2/KEAP1 ANTI-OXIDANT RESPONSE IN THE

REGULATION OF ABCC3

Matthew Merrell*, Mark Canet*, Jonathon Maher†, Nathan Cherrington*

*University of Arizona, Dept. of Pharmacology and Toxicology, † Tohoku University

Department of Medical Biochemistry

Abstract

Members of the ATP-binding cassette C (ABCC) family, including ABCC3, play an important role in toxicology and disease by actively effluxing a wide variety of endogenous and exogenous substrates. Induction of ABCC3 has been reported during hepatic stress (disease, toxicant exposure) and in the progression of some forms of cancer. Multiple investigations have implicated the transcription factor Nrf2 in this induction. Investigation into the transcriptional regulation of ABCC3 by Nrf2 has predominantly involved rodent models, and the functional antioxidant response element

(ARE) has been characterized in the mouse Abcc3 gene. However, while recent studies in A549 human lung cells (which over-express Nrf2) have demonstrated a clear role for

Nrf2 in the induction of human ABCC3, no functional human response element has been defined. Results of a ChIP-sequencing experiment revealed a specific interaction between Nrf2 and the eighth intron of the human ABCC3 gene, but not the upstream promoter. Subsequent in silico analysis of the intron revealed several putative AREs and

ARE-like elements. Additionally, while putative response elements in the upstream promoter (-1.2kb) are not evolutionarily conserved, sequence alignment revealed 116

sequence conservation of an intronic ARE across a variety of mammalian species.

Luciferase-reporter constructs with the intronic elements showed increased activity over vector-controls. Finally, standard ChIP assays confirmed the specific chromatin-Nrf2 interaction identified in the ChIP-sequencing experiment. Our findings identifying an Nrf2 response element within an intron of the ABCC3 gene may provide a mechanistic understanding of the induction of ABCC3 during the antioxidant response.

Introduction

Directed transport of therapeutic drugs and other compounds plays a integral role in liver function and drug clearance. Members of the ATP-binding cassette (ABC) transporter family comprise the majority of hepatic efflux transporters, and are responsible for active transport of substrate molecules from the hepatocytes into the bile or back into the blood. ABC superfamily C member 3 (ABCC3), also known as Multidrug- resistance protein 3 (MRP3), is located on the basolateral (sinusoidal) membrane of hepatocytes. From this location, ABCC3 is responsible for active transport of substrate molecules back into the blood. Identified substrates for ABCC3 include endogenous compounds (bilirubin, bile acids) anticancer drugs (methotrexate, etoposide), and conjugated drug-metabolites (glucuronides, sulfonates) (Klaassen and Aleksunes,

2010). While expression is highest in the liver, ABCC3 is also expressed in a number of other tissues including the small and large intestines, stomach, kidneys, and lungs

(Klaassen and Aleksunes, 2010). ABCC3 is also highly expressed in several types of cancer, including glioblastoma multiforme (Kuan et al., 2010), gallbladder cancer (Wang et al., 2010), non-small-cell lung carcinoma (Young et al., 2001), and hepatocellular carcinoma (Nies et al., 2001). 117

ABCC3 transporter expression is upregulated in a number of pathological conditions besides cancer, including primary biliary cirrhosis (Zollner et al., 2003), hepatitis C viral infection (Ros et al., 2003), non-alcoholic steatohepatitis (Lickteig et al.,

2007a), and ANIT-induced cholestasis (Cui et al., 2009). ABCC3 induction is often hepatoprotective, and is hypothesized to provide an alternate means of molecular efflux from damaged or stressed hepatocytes. Investigations have revealed several transcription factors which are involved in ABCC3 regulation, including nuclear receptors

CAR, PXR, and PPARα, as well as oxidative stress sensor Nrf2 (Klaassen and

Aleksunes, 2010).

Nrf2 (NF-E2-related factor 2) is an important transcriptional regulator of the antioxidant response. During unstressed conditions, Nrf2 is retained in the cytoplasm by the Kelch-like ECH-associated protein 1 (Keap1). Keap1 has been characterized as an adaptor protein for a ubiquitin ligase E3 complex, and is necessary for the degradation and inhibition of Nrf2 (Zhang, 2006). Under conditions of oxidative/electrophilic stress, or following exposure to certain xenobiotics, Keap1 interaction with Nrf2 is disrupted and

Nrf2 accumulates in the nucleus. Nrf2-driven transcription requires heterodimerization with small Maf proteins and DNA binding to antioxidant response elements (ARE) of target genes (Jaiswal, 2004).

As with ABCC3, Nrf2 activation is also considered protective against damage and stress. A number of enzymes and transporters important to drug clearance have been identified as Nrf2 target genes. Several phase II drug metabolizing enzymes including glucuronosyltransferases (UGT), sulfotransferases (SULT), and glutathione transferases (GST) are regulated by Nrf2 (Shen and Kong, 2009). Phase III transport 118

proteins, including several ABCC family members, are also upregulated following

treatment with Nrf2 activators (Maher et al., 2005).

Investigation to date into the transcriptional regulation of ABCC3 by Nrf2 has

predominantly involved rodent models and cell lines (Aleksunes et al., 2008;Maher et al.,

2007;Maher et al., 2008;Okada et al., 2008), and a functional upstream ARE for Nrf2 has

been identified in the mouse gene (Maher et al., 2007). Studies in human cell lines and

tissue have also demonstrated a clear role for Nrf2 in the induction of ABCC3 (Wang et

al., 2010;Mahaffey et al., 2009), and several putative AREs have been identified

upstream of the ABCC3 transcriptional start site (TSS). However, mechanistic studies

identifying functional ARE sequences in ABCC3 have not been reported. We have

identified a functional ARE in the eighth intron of the ABCC3 gene, more than 26kb

downstream from the TSS. We demonstrate here that Nrf2 directly interacts with this

element in an Nrf2-overexpressing cell line.

Materials and Methods

In Silico Analysis - Identification of putative AREs within the eighth intron was

performed using CLC Sequence Viewer v6.4 (CLC bio, Denmark). Species alignments

were performed using comparative genomics tools available at ensemble.org, performed

Sept. 27th, 2010.

Cell culture - A549 cells were a gift from the Zhang laboratory at the University of

Arizona, Tucson AZ. Cells were grown in Dulbecco’s Modified Eagles Media supplemented with 10% fetal bovine serum, glutamine, and penicillin-streptomycin.

Cultures were grown at 37°C in 5% CO2 atmosphere,

Reporter Gene Assay - A DNA construct containing the eighth intron (1.2 kb) was produced by PCR amplification of genomic DNA. Primers used included exogenous 119

restriction sites (underlined) and are as follows: forward primer 5’-

CGCCTCGAGTGGCTGGCTAGCCCAGAGGA-3’, and reverse primer 5’-

CGCAAGCTTGCACCACTGGCCCCACATGA-3’. The resulting PCR products were

introduced into the luciferase reporter gene vector pGL3 basic (Promega Corp, Madison

WI). Cells were transfected using Transfectene (Qiagen, Hilden, Germany) as described

previously (Merrell et al., 2008b), including the use of pRL-tk transfection control

(Promega Corp, Madison WI). Luciferase activity was determined using the Dual-Glo

Luciferase Assay (Promega Corp, Madison WI), as per manufacturer’s instructions.

Each reporter construct was assayed in triplicate wells, and luciferase activity was

measured using a GloMax® 20/20 Luminometer (Promega Corp, Madison WI).

Chromatin Immunoprecipitation (ChIP) - PCR based ChIP experiments were

performed using A549 human lung cells. Following fixation with 1% formaldehyde, cells

were lysed in the presence of protease inhibitors and prepared for sonication with a

sonic dismembrator 100 (Fisher Scientific, Pittsburg PA). Sonication parameters (12

cycles of 20 seconds of sonication and 60 seconds of rest, all on ice) were optimized to

shear chromatin to between 200 and 1000 kb. Sonicated chromatin was precleared

using 3ug of normal rabbit IgG and protein A agarose beads in immunoprecipitation

buffer overnight at 4°C. Pre-cleared lysates were incubated (at 4°C for 12h) with 2µg

anti-Nrf2 (C-20; Santa Cruz Biotechnology, Santa Cruz CA) or 2µg normal rabbit IgG

(Santa Cruz Biotechnology, Santa Cruz CA). Protein A agarose beads were used to

precipitate antibody bound chromatin followed by extensive washing. Following elution,

DNA-protein crosslinks were reversed, protein was digested, and DNA was purified

using a Qiaquick PCR purification kit (Qiagen, Hilden, Germany) as per manufacturer’s

instructions. Real-time PCR amplification was performed using the Lightcycler 480 120

System (Roche, Basel Switzerland), using SYBR-green mastermix (Roche, Basel

Switzerland), as per manufacturer’s instructions. Analyses in relative quantification mode

were performed using standard conditions. Threshold cycle (CT) determinations were

performed by the Lightcycler 480 system software. PCR primers used in amplification of

the relevant DNA segments are as follows: NQO1 ARE forward 5’-

GCAGTCACAGTGACTCAGC-3’, NQO1 ARE reverse 5’-TGTGCCCTGAGGTGCAA-3’,

ABCC3 intronic-ARE forward 5’- ACAAAGCCCTGAAACAGCAT-3’, ABCC3 intronic-ARE

reverse 5’- ATCCTTAGCTCTCCCTCTCTCTG-3’, GAPDH forward 5’-

ATCATCCCTGCCTCTACT-3’, GAPDH reverse 5’- CTGCTTCACCACCTTCTT-3’.

ChIP Sequencing - Cell Culture. A549 cells (ATCC CCL-185), were passaged in

DMEM 5% FBS with 1% penicillin/streptomycin. A 10 cm plate was grown to

approximately 90% confluence, translating to roughly 1.5x106 cells. Cross-linking and

Sonication. Formaldehyde (~270μL) was added to cell media to reach a final

concentration of 1%. Cells were incubated at room temperature while shaking. Cross-

linking was stopped by adding 1 ml of 1.25 M glycine, and cells were scraped and

centrifuged at 800 RPM. Media was aspirated completely, rinsed with phosphate-

buffered saline, then re-suspended in 1mL Cell Lysis Buffer (5mM Pipes, ph8.0; 85 mM

KCl; 0.5% NP40) for 10 min on ice. Samples were centrifuged at 2000 RPM, the

supernatant was removed and re-suspended in 1L Nuclei Lysis Buffer (1% SDS, 10mM

EDTA, 50 mM Tris pH 8.0) for 10 min on ice. Sonication of samples was conducted

according to the following parameters: Output 4, Duty Cycle 50%, 20 sec, 12 repetitions.

Samples were centrifuged at full speed for 30 min at 4°C, then diluted with Dilution

Buffer (1.1% SDS, 10mM EDTA, 50mM Tris pH 8.0) Immunoprecipitation. Pre-clearing using 5 μg rabbit IgG and 300 μl of pre-blocked protein A/G fast-flow sepharose beads 121

was conducted for 12 hrs 4°C. Samples were centrifuged for 3000 RPM for 5 min, and

then transferred to new tube. This process was repeated for a total of 4 times.

Subsequently, into 1 mL of sample, the antibody of interest was added at the following

concentrations: IgG (2 ug), Nrf2 (2ug), and dH3H4dime (3 ug). Samples were rotated at

24 hrs at 4°C, and 60 μl of pre-cleared beads were added. Samples were centrifuged at

3000 RPM, and the supernatant was removed. Beads were washed with a series of low

salt, high salt, and LiCl and TE buffers. To elute, 250 μl of Elution Buffer was added (1%

SDS, 0.1M NaHCO3, 0.25 μM DTT) at 65°C overnight. Samples were then taken

through a proteinase K digestion (10 mg/ml), then a phenol-chloroform extraction for

final re-suspension into 30 μl of PCR-grade water. Library Consruction and Sequencing.

Library creation was accomplished using adapter ligation methods. Each unique library was sequenced along with an input control library using the Solexa Genome Analyzer

(Illumina; San Diego, CA), and sequences were aligned to the human genome

(www.genome.ucsc.edu) using ELAND software. Peaks were visualized using the

Integrated Genome Browser (Nicol et al., 2009)

Results

Chromatin from the Nrf2 over-expressing A549 cell line (Singh et al.,

2006;Mahaffey et al., 2009) was used to perform ChIP-seq experiments. As shown in

Figure 1, a strong and specific Nrf2 interaction was identified in the eighth intron of the

ABCC3 gene (intron located -26258 to -28823 from TSS). In contrast, no interaction was identified between Nrf2 and the upstream promoter. The DNA sequence is represented in green (bottom), with exons depicted as green bars. Positive results showing binding intensity are in blue. 122

Sequence analysis of this intron revealed two AREs separated by 480bp, which we have designated as ABCC3-1 and ABCC3-2. As shown in Table 1, the sequences of both ABCC3-1 and -2 contain the core putative ARE (underlined), but similar to Nrf2- target GCLM, lack the additional upstream element required for maximal induction

(Wasserman and Fahl, 1997).

An alignment analysis comparing species homology revealed conservation of a functional ARE at ARE-2 across a variety of mammalian species (Table 2). Differences of the core sequence between human and pig or dog species are highlighted, but still result in a correct consensus ARE. In contrast, other ARE and ARE-like regions in the eighth intron and in the promoter were not conserved between human and non-primate species.

Approximately 1.2kb of the eighth intron containing the identified AREs was inserted into a luciferase reporter gene vector. Following transfection into A549 cells

(which overexpress Nrf2), the luciferase activity of the intronic construct was significantly increased compared to the vector alone. Simultaneous transfection of these cells with an

Nrf2 expression construct further increased the observed luciferase activity (Figure 2).

Figure 3 depicts the results of chromatin immunoprecipitation assays using A549 cells. Sonicated chromatin was immunoprecipitated using anit-Nrf2 (blue) antibody or normal rabbit IgG (red). qPCR amplification using primers to amplify DNA from specific chromatin regions including the NQO1-ARE (positive control), a GAPDH region

(negative control) and the intronic ABCC3-ARE. As shown in the graphed results, the

Nrf2 immunoprecipitated chromatin was enriched compared to the immunoprecipitation control (normal IgG) for both the NQO1-ARE and the ABCC3-ARE, but not for the

GAPDH region. 123

Discussion

The involvement of Nrf2 in the regulation of ABCC3 expression has been demonstrated repeatedly. We have previously reported induction in rats treated with oltipraz (Merrell et al., 2008a;Slitt et al., 2003). Studies in mice treated with known Nrf2 activators (butylated hydroxyanisole, oltipraz, ethoxyquin) revealed significant induction of a number of ABCC family members, including ABCC3 (Maher et al., 2005).

Additionally, several investigators have reported loss of ABCC3 induction in Nrf2-null mice following treatment with a variety of chemicals, including ursodeoxycholic acid

(Okada et al., 2008), α-naphthylisothiocyanate (Tanaka et al., 2009), acetaminophen

(Aleksunes et al., 2008), perfluorodecanoic acid (Maher et al., 2008), and more traditional Nrf2 activators (Maher et al., 2007).

Investigation in human ABCC3 regulated by Nrf2 has been limited to date.

Human ABCC3 was upregulated in human hepatocytes treated with Nrf2 activator oltipraz, though almost half of the hepatocyte populations were unresponsive (Jigorel et al., 2006). Similarly, human derived HepG2 cells treated with Nrf2 activator tBHQ expressed increased levels of ABCC3 mRNA (Adachi et al., 2007). Researchers also recently reported a statistically significant association between the expression of Nrf2 and ABCC3 in gallbladder cancer (Wang et al., 2010). The only mechanistic investigation into this subject was performed in human lung cancer cell lines (Mahaffey et al., 2009). ABCC3 was found to be induced following oxidative stress in certain cell lines. However, in cell lines overexpressing Nrf2, ABCC3 was not inducible, due to the high basal expression in these cells. Furthermore, silencing of Nrf2 with siRNA inhibited

ABCC3 induction and increased toxicity following treatment with anti-cancer agent 124

cisplatin. These authors also described four putative AREs upstream of the TSS, but did not attempt to identify Nrf2 binding to these sequences.

Malhotra et al. (2010) recently published results of a ChIP-seq experiment using

Keap1-null mice. Though unfortunately no information was reported with respect to the mouse Abcc3 gene, these studies revealed interesting information concerning the definition of the ARE consensus sequence. Historic definition of the ARE defined a core sequence of “TGACnnnGC” (see Table 1). Comparison of 410 DNA sequences found to interact with Nrf2 in these new studies revealed an expanded role of the intervening three base pairs (between TGAC and GC), with TCA being the most common sequence observed. Though ARE2 appears slightly closer to the sequence of this updated Nrf2- binding profile than ARE1, future experiments will be required to determine the relative contribution of each to overall Nrf2 interactions.

Other pathological conditions besides cancer exhibit increased expression of both Nrf2 an ABCC3. Our laboratory has previously reported activation of Nrf2 in mouse models of nonalcoholic steatohepatitis (Lickteig et al., 2007b), as well as increased expression of ABCC3 in the same model (Lickteig et al., 2007a). Similarly, we have recently published results showing increased Nrf2 activation in the human disease

(Hardwick et al., 2010), and have observed increased ABCC3 expression in the same samples. Both Nrf2 and ABCC3 are induced in models of cholestasis, and Nrf2 has been suggested as a target for treating the disease because of its induction of hepatic efflux transporters like ABCC3 (Tanaka et al., 2009;Okada et al., 2008).

A number of other drug transport proteins are regulated by Nrf2, including most of the ABCC family. Nrf2 activators are able to induce mRNA expression of ABCC2-7

(Maher et al., 2005). AREs have been identified for murine Abcc1-4 (Klaassen and 125

Aleksunes, 2010), as well as for human ABCC2, 3, and 4 (Stockel et al., 2000;Mahaffey

et al., 2009)((Xu et al., 2010). Recent ChIP-sequencing experiments identified Abcc1, 2,

4 and 5 as genes near Nrf2-binding sequences (Malhotra et al., 2010). Additionally,

BSEP, MDR1, and BCRP all have been identified as Nrf2 targets (Klaassen and

Aleksunes, 2010). The transcriptional control of these transporters by Nrf2 indicates an

important role of hepatocellular efflux in the antioxidant response.

As described above, several other transcription factors have been implicated in

the regulation of ABCC3. Maher et al. (Maher et al., 2005) reported induction of ABCC3

expression following treatment with agonists of AhR, CAR, PXR, PPARα, and Nrf2.

Several other investigators have observed ABCC3 induction following treatment with

CAR activators, though some have indicated that this activation may in fact be CAR independent (Klaassen and Aleksunes, 2010;Cherrington et al., 2003). Similarly, a variety of PXR agonists induce ABCC3 expression (Teng and Piquette-Miller, 2007).

Identification of the functional response elements for any of these transcription factors has not been reported.

Instances of regulatory elements being located downstream of the TSS have been reported in various genes and by various transcription factors. While many of these elements are located in the first intron, several examples reveal that extremely distal elements can regulate transcription. ChIP-seq experiments with ERα have reported that

38% of binding elements were found within introns, and 38% were farther than 10kb from the TSS (Levy et al., 2008). Other nuclear receptors with identified intronic response elements include the androgen receptor (Zheng et al., 2006;Makkonen et al.,

2009), the vitamin D receptor (Zella et al., 2006), and PPARα (Sun et al., 2008;Napal et al., 2005). Androgen regulation of Nrf2-target gene GSTP1 appears to be dependent 126

upon a 500bp region of the 5th intron of the gene (Ikeda et al., 2002). However, to our knowledge this is the first example of Nrf2 itself regulating a target gene through an intronic response element. Furthermore, while the efflux transporters ABCA1 and

ABCG1 have been reported to have intronic LXR response elements (Singaraja et al.,

2001;Sabol et al., 2005), this is the first gene involved in drug transport that has been shown to be regulated in this manner.

In order for a distal response element to regulate transcriptional activity, the transcription factor-DNA complex must be brought into proximity with the TSS. Recent advances in molecular biology have made possible the detection of the resulting chromatin loops. A technique called Chromosome Conformation Capture (3C) is used to determine whether a gene forms these chromatin loops (Miele and Dekker, 2009). In this method, formaldehyde crosslinking is used to trap physical interactions between distal

DNA loci. Crosslinked chromatin fragments are generated by designed restriction digestion. Following digestion, ligation of these restriction fragments results in a large collection of ligation products, referred to as the 3C template or library. Since each ligation product reflects an interaction between two restriction fragments, the interaction frequencies between the promoter region and downstream loci can be determined by quantifying the relative abundance of the corresponding ligation products. The technique requires a separation of 30-40kb to detect looping, and the intronic AREs identified here are near that minimum distance. However, accurate demonstration of this chromatin looping between the intronic ARE and the upstream promoter would provide definitive evidence of the functionality of these response elements.

The A549 cell line was chosen for this study because of its well documented overexpression of Nrf2 and ABCC3 (Mahaffey et al., 2009;Singh et al., 2006;Young et 127

al., 2001). While this cell line provides an excellent model of general Nrf2 activation, verification of these results in a hepatic cell line would be intriguing. Two cell types

(HepG2 and primary hepatocytes) may prove useful. Primary hepatocytes provide the closest model system to the in vivo condition, yet suffer limitations such as unpredictable availability, short life span, and more complex culture conditions than immortalized cell lines(Hewitt et al., 2007). Contrastingly, HepG2 cells (the classic human hepatic cell line) are readily available and are easily cultured and treated, but may not optimally recapitulate the inductive capacity of human livers. 128

References

Adachi T, Nakagawa H, Chung I, Hagiya Y, Hoshijima K, Noguchi N, Kuo M T and Ishikawa T (2007) Nrf2-Dependent and -Independent Induction of ABC Transporters ABCC1, ABCC2, and ABCG2 in HepG2 Cells Under Oxidative Stress. J Exp Ther Oncol 6:335-348.

Aleksunes LM, Slitt A L, Maher J M, Augustine L M, Goedken M J, Chan J Y, Cherrington N J, Klaassen C D and Manautou J E (2008) Induction of Mrp3 and Mrp4 Transporters During Acetaminophen Hepatotoxicity Is Dependent on Nrf2. Toxicol Appl Pharmacol 226:74-83.

Cui YJ, Aleksunes L M, Tanaka Y, Goedken M J and Klaassen C D (2009) Compensatory Induction of Liver Efflux Transporters in Response to ANIT-Induced Liver Injury Is Impaired in FXR-Null Mice. Toxicol Sci 110:47-60.

Hardwick RN, Fisher C D, Canet M J, Lake A D and Cherrington N J (2010) DIVERSITY IN ANTIOXIDANT RESPONSE ENZYMES IN PROGRESSIVE STAGES OF HUMAN NON-ALCOHOLIC FATTY LIVER DISEASE. Drug Metab Dispos.

Hewitt NJ, Lechon M J, Houston J B, Hallifax D, Brown H S, Maurel P, Kenna J G, Gustavsson L, Lohmann C, Skonberg C, Guillouzo A, Tuschl G, Li A P, LeCluyse E, Groothuis G M and Hengstler J G (2007) Primary Hepatocytes: Current Understanding of the Regulation of Metabolic Enzymes and Transporter Proteins, and Pharmaceutical Practice for the Use of Hepatocytes in Metabolism, Enzyme Induction, Transporter, Clearance, and Hepatotoxicity Studies. Drug Metab Rev 39:159-234.

Ikeda H, Serria M S, Kakizaki I, Hatayama I, Satoh K, Tsuchida S, Muramatsu M, Nishi S and Sakai M (2002) Activation of Mouse Pi-Class Glutathione S-Transferase Gene by Nrf2(NF-E2-Related Factor 2) and Androgen. Biochem J 364:563-570.

Jaiswal AK (2004) Nrf2 Signaling in Coordinated Activation of Antioxidant Gene Expression. Free Radic Biol Med 36:1199-1207.

Klaassen CD and Aleksunes L M (2010) Xenobiotic, Bile Acid, and Cholesterol Transporters: Function and Regulation. Pharmacol Rev 62:1-96. 129

Kuan CT, Wakiya K, Herndon J E, Lipp E S, Pegram C N, Riggins G J, Rasheed A, Szafranski S E, McLendon R E, Wikstrand C J and Bigner D D (2010) MRP3: a Molecular Target for Human Glioblastoma Multiforme Immunotherapy. BMC Cancer 10:468.

Levy N, Tatomer D, Herber C B, Zhao X, Tang H, Sargeant T, Ball L J, Summers J, Speed T P and Leitman D C (2008) Differential Regulation of Native Estrogen Receptor- Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene. Mol Endocrinol 22:287- 303.

Lickteig AJ, Fisher C D, Augustine L M, Aleksunes L M, Besselsen D G, Slitt A L, Manautou J E and Cherrington N J (2007a) Efflux Transporter Expression and Acetaminophen Metabolite Excretion Are Altered in Rodent Models of Nonalcoholic Fatty Liver Disease. Drug Metab Dispos 35:1970-1978.

Lickteig AJ, Fisher C D, Augustine L M and Cherrington N J (2007b) Genes of the Antioxidant Response Undergo Upregulation in a Rodent Model of Nonalcoholic Steatohepatitis. J Biochem Mol Toxicol 21:216-220.

Mahaffey CM, Zhang H, Rinna A, Holland W, Mack P C and Forman H J (2009) Multidrug-Resistant Protein-3 Gene Regulation by the Transcription Factor Nrf2 in Human Bronchial Epithelial and Non-Small-Cell Lung Carcinoma. Free Radic Biol Med 46:1650-1657.

Maher JM, Cheng X, Slitt A L, Dieter M Z and Klaassen C D (2005) Induction of the Multidrug Resistance-Associated Protein Family of Transporters by Chemical Activators of Receptor-Mediated Pathways in Mouse Liver. Drug Metab Dispos 33:956-962.

Maher JM, Dieter M Z, Aleksunes L M, Slitt A L, Guo G, Tanaka Y, Scheffer G L, Chan J Y, Manautou J E, Chen Y, Dalton T P, Yamamoto M and Klaassen C D (2007) Oxidative and Electrophilic Stress Induces Multidrug Resistance-Associated Protein Transporters Via the Nuclear Factor-E2-Related Factor-2 Transcriptional Pathway. Hepatology 46:1597-1610.

Makkonen H, Kauhanen M, Paakinaho V, Jaaskelainen T and Palvimo J J (2009) Long- Range Activation of FKBP51 Transcription by the Androgen Receptor Via Distal Intronic Enhancers. Nucleic Acids Res 37:4135-4148.

Malhotra D, Portales-Casamar E, Singh A, Srivastava S, Arenillas D, Happel C, Shyr C, Wakabayashi N, Kensler T W, Wasserman W W and Biswal S (2010) Global Mapping of Binding Sites for Nrf2 Identifies Novel Targets in Cell Survival Response Through ChIP- Seq Profiling and Network Analysis. Nucleic Acids Res 38:5718-5734. 130

Merrell MD, Augustine L M, Slitt A L and Cherrington N J (2008a) Induction of Drug Metabolism Enzymes and Transporters by Oltipraz in Rats. J Biochem Mol Toxicol 22:128-135.

Merrell MD, Jackson J P, Augustine L M, Fisher C D, Slitt A L, Maher J M, Huang W, Moore D D, Zhang Y, Klaassen C D and Cherrington N J (2008b) The Nrf2 Activator Oltipraz Also Activates the Constitutive Androstane Receptor. Drug Metab Dispos 36:1716-1721.

Miele A and Dekker J (2009) Mapping Cis- and Trans- Chromatin Interaction Networks Using Chromosome Conformation Capture (3C). Methods Mol Biol 464:105-121.

Napal L, Marrero P F and Haro D (2005) An Intronic Peroxisome Proliferator-Activated Receptor-Binding Sequence Mediates Fatty Acid Induction of the Human Carnitine Palmitoyltransferase 1A. J Mol Biol 354:751-759.

Nicol JW, Helt G A, Blanchard S G, Jr., Raja A and Loraine A E (2009) The Integrated Genome Browser: Free Software for Distribution and Exploration of Genome-Scale Datasets. Bioinformatics 25:2730-2731.

Nies AT, Konig J, Pfannschmidt M, Klar E, Hofmann W J and Keppler D (2001) Expression of the Multidrug Resistance Proteins MRP2 and MRP3 in Human Hepatocellular Carcinoma. Int J Cancer 94:492-499.

Ros JE, Libbrecht L, Geuken M, Jansen P L and Roskams T A (2003) High Expression of MDR1, MRP1, and MRP3 in the Hepatic Progenitor Cell Compartment and Hepatocytes in Severe Human Liver Disease. J Pathol 200:553-560.

Sabol SL, Brewer H B, Jr. and Santamarina-Fojo S (2005) The Human ABCG1 Gene: Identification of LXR Response Elements That Modulate Expression in Macrophages and Liver. J Lipid Res 46:2151-2167.

Shen G and Kong A N (2009) Nrf2 Plays an Important Role in Coordinated Regulation of Phase II Drug Metabolism Enzymes and Phase III Drug Transporters. Biopharm Drug Dispos 30:345-355.

Singaraja RR, Bocher V, James E R, Clee S M, Zhang L H, Leavitt B R, Tan B, Brooks- Wilson A, Kwok A, Bissada N, Yang Y Z, Liu G, Tafuri S R, Fievet C, Wellington C L, Staels B and Hayden M R (2001) Human ABCA1 BAC Transgenic Mice Show Increased High Density Lipoprotein Cholesterol and ApoAI-Dependent Efflux Stimulated by an Internal Promoter Containing Liver X Receptor Response Elements in Intron 1. J Biol Chem 276:33969-33979. 131

Singh A, Misra V, Thimmulappa R K, Lee H, Ames S, Hoque M O, Herman J G, Baylin S B, Sidransky D, Gabrielson E, Brock M V and Biswal S (2006) Dysfunctional KEAP1- NRF2 Interaction in Non-Small-Cell Lung Cancer. PLoS Med 3:e420.

Slitt AL, Cherrington N J, Maher J M and Klaassen C D (2003) Induction of Multidrug Resistance Protein 3 in Rat Liver Is Associated With Altered Vectorial Excretion of Acetaminophen Metabolites. Drug Metab Dispos 31:1176-1186.

Stockel B, Konig J, Nies A T, Cui Y, Brom M and Keppler D (2000) Characterization of the 5'-Flanking Region of the Human Multidrug Resistance Protein 2 (MRP2) Gene and Its Regulation in Comparison Withthe Multidrug Resistance Protein 3 (MRP3) Gene. Eur J Biochem 267:1347-1358.

Sun Y, Ng L, Lam W, Lo C K, Chan P T, Yuen Y L, Wong P F, Tsang D S, Cheung W T and Lee S S (2008) Identification and Characterization of a Novel Mouse Peroxisome Proliferator-Activated Receptor Alpha-Regulated and Starvation-Induced Gene, Ppsig. Int J Biochem Cell Biol 40:1775-1791.

Teng S and Piquette-Miller M (2007) Hepatoprotective Role of PXR Activation and MRP3 in Cholic Acid-Induced Cholestasis. Br J Pharmacol 151:367-376.

Wang J, Zhang M, Zhang L, Cai H, Zhou S, Zhang J and Wang Y (2010) Correlation of Nrf2, HO-1, and MRP3 in Gallbladder Cancer and Their Relationships to Clinicopathologic Features and Survival. J Surg Res 164:e99-105.

Wasserman WW and Fahl W E (1997) Functional Antioxidant Responsive Elements. Proc Natl Acad Sci U S A 94:5361-5366.

Xu S, Weerachayaphorn J, Cai S Y, Soroka C J and Boyer J L (2010) Aryl Hydrocarbon Receptor and NF-E2-Related Factor 2 Are Key Regulators of Human MRP4 Expression. Am J Physiol Gastrointest Liver Physiol 299:G126-G135.

Young LC, Campling B G, Cole S P, Deeley R G and Gerlach J H (2001) Multidrug Resistance Proteins MRP3, MRP1, and MRP2 in Lung Cancer: Correlation of Protein Levels With Drug Response and Messenger RNA Levels. Clin Cancer Res 7:1798-1804.

Zella LA, Kim S, Shevde N K and Pike J W (2006) Enhancers Located Within Two Introns of the Vitamin D Receptor Gene Mediate Transcriptional Autoregulation by 1,25- Dihydroxyvitamin D3. Mol Endocrinol 20:1231-1247.

Zhang DD (2006) Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab Rev 38:769-789. 132

Zheng R, Shen R, Goodman O B, Jr. and Nanus D M (2006) Multiple Androgen Response Elements Cooperate in Androgen Regulated Activity of the Type 1 Neutral Endopeptidase Promoter. Mol Cell Endocrinol 259:10-21.

Zollner G, Fickert P, Silbert D, Fuchsbichler A, Marschall H U, Zatloukal K, Denk H and Trauner M (2003) Adaptive Changes in Hepatobiliary Transporter Expression in Primary Biliary Cirrhosis. J Hepatol 38:717-727.

133

Tables and Figures

Table 1. Comparison of putative ABCC3 intronic AREs with the ARE consensus sequence and confirmed AREs from established Nrf2-regulated genes. In the consensus ARE required nucleotides are capitalized and the core ARE is underlined. In the listed AREs, sequences in agreement with the consensus sequence are highlighted.

ARE nnnTMACnRTGAYnnnGCRWWW M=A or C NQO1 CAGTCACAGTGACTCAGCAGAATCT R=A or G GCLC GCCTCCCCGTGACTCAGCGCTTTGT Y=C or T GCLM GGAAGACAATGACTAAGCAGAAATC W=A or T ABCC3-1 5’ GAGGTGAAGTGACTTGGCCAAGGGC 3’ ABCC3-2 3’ AGGGCTTTGTGACTAAGCTGAGGCT 5’

134

Table 2. Results of a sequence alignment of the human AREs and homologous

regions in the ABCC3 gene in several other mammalian species. The sequence was

conserved across the all primate species, and several other eutherian mammals.

Because the ABCC3-2 ARE is located on the reverse strand, a comparison with the

reverse consensus ARE is provided. Of note, mutations in core ARE of the Canis lupus and Sus scrofa sequences result in a match to the consensus sequence.

ARE2 Consensus ARE YGCnnnRTCAY Homo sapiens AAAGTTCAGCCTCAGCTTAGTCACAAAGCCCTGAAACAG Pan troglodytes AAAGTTCAGCCTCAGCTTAGTCACAAAGCCCTGAAACAG Gorilla gorilla AAAGTTCAGCCTCAGCTTAGTCACAAAGCCCTGAAACAG Pongo pygmaeus AAAGTTCAGCCTCAGCTTAGTCACAAAGCCCTGAAACAG Macaca mulatta AAAGTTCAGCCTCAGCTTAGTCACAAAGCCCTGAAACAG Callithrix jacchus AAAGTTCAGCC--GGCTTAGTCACAAAGCACTGAAACAG Mus musculus --AGTATAAC--CAGCTGAGTCACCAAGGGTTGAGACAG Rattus norvegicus AAAATGCAAC--CAGCTGAGTCACAGAG------Canis lupus familiaris AGAAT------GCAAAATCAC---GGCCTCAGTGGG Bos taurus ------ACAGAGTCACAAAGGCCTGAGACAG Sus scrofa AAAGTGCATTCCAGGCAAAATCAAGAAGGCTTGAAACAG Equus caballus AAAGGGCAGCTCAGACACAGCCACAAAGACCTGAGGCAG

135

Figure 1. Results of a ChIP-sequencing experiment using Nrf2 overexpressing

A549 cells. The DNA sequence of the ABCC3 gene is shown in green, with exons depicted as green bars. Positive results showing binding intensity are in blue. A strong

Nrf2 interaction is observed in the eighth intron of the ABCC3 gene (intron located -

26258 to -28823 from TSS). In contrast, no interaction is observed between Nrf2 and the upstream promoter.

Figure 1.

136

Figure 2. Luciferase reporter assay. Luciferase activity of an ABCC3 intronic construct in Nrf2 overexpressing A549 cells was compared at two concentrations, as well as to vector control. These intronic elements increased luciferase activity by 5.6-fold and 13.1-fold, at the 200ng and 400ng amounts.

Figure 2.

137

Figure 3. Chromatin immunoprecipitation. ChIP assays were performed in A549 cells. Following formaldehyde cross-linking and sonication, immunoprecipitation was performed on the chromatin fragments using anti-Nrf2 antibodies or normal rabitt IgG negative control antibodies. The immunoprecipitated chromatin was analyzed using qPCR amplification to determine the relative interaction between Nrf2 and specific DNA regions, including the NQO1-ARE (positive control), a GAPDH region (negative control) and the intronic ABCC3-ARE. Nrf2 immunoprecipitated chromatin (blue) was enriched for both the NQO1-ARE and the ABCC3-ARE, but not for the GAPDH region.

Figure 3.

138

APPENDIX D:

DRUG METABOLISM ALTERATIONS DURING NONALCHOHOLIC FATTY LIVER

DISEASE

Matthew D. Merrell and Nathan J. Cherrington

University of Arizona, Department of Pharmacology and Toxicology

Abstract

Drug metabolizing enzymes play a vital role in the elimination of the majority of therapeutic drugs. The major organ involved in drug metabolism is the liver. Chronic liver diseases have been identified as a potential source of significant interindividual variation in hepatic metabolism. Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease in the Unites States, affecting between 60 and 90 million

Americans, yet the vast majority of NAFLD patients are undiagnosed. NAFLD encompasses a spectrum of pathologies, ranging from steatosis to nonalcoholic steatohepatitis and fibrosis. Numerous animal studies have investigated the effects of

NAFLD on hepatic gene expression, observing significant alterations in mRNA, protein, and activity levels. Information on the effects of NAFLD in human patients is limited, though several significant investigations have recently been published. Significant alterations in the activity of drug metabolizing enzymes may affect the clearance of therapeutic drugs, with the potential to result in adverse drug reactions. With the enormous prevalence of NAFLD, is it conceivable that every drug currently on the market is being given to patients with NAFLD. The current review is intended to present the results from both animal models and human patients, summarizing the observed

139

alterations in the expression and activity of the Phase I and II drug metabolizing enzymes.

Nonalcoholic Fatty Liver Disease

Non-alcoholic fatty liver disease (NAFLD) describes a spectrum of hepatic pathologies linked by the intracellular hepatic accumulation of fat (steatosis) in the absence of substantial alcoholic intake. NAFLD is only recently recognized as a serious clinical disorder, and the effect of the disease on hepatic drug metabolism is limited. This review of the literature summarizes the effects of NAFLD on the activity and expression of both Phase I and Phase II drug metabolizing enzymes (DME) in various animal models of NAFLD and in patients with NAFLD. Additionally, potential mechanisms for these alterations are proposed.

Prevalence

The term NAFLD encompasses the progression from steatosis to non-alcoholic steatohepatitis (NASH), progressive fibrosis and cirrhosis, and even hepatocellular carcinoma. Although initially described 30 years ago (Adler and Schaffner, 1979;Ludwig et al., 1980), the true scope of the disease has only recently been understood. NAFLD is the most prevalent chronic liver disease in both the US and many other industrialized nations (Wieckowska and Feldstein, 2008). NAFLD has been described as the hepatic manifestation of the metabolic syndrome, and is often linked with obesity and insulin resistance (IR) (Reynaert et al., 2005).

The prevalence of these three conditions (NAFLD, IR, obesity) has increased dramatically in the last few decades. In 2008, the prevalence of obese adults [body mass index (BMI) > 30 kg/m2] in the US was approximately 32% (Flegal et al., 2010), a

140

statistic which has doubled over the last two decades. This prevalence is projected to reach more than 50% by 2030 (Wang et al., 2008). The prevalence of diabetes

(undiagnosed and diagnosed) is estimated to similarly increase from 14% in 2007 up to

33% by 2050 (Boyle et al., 2010). Current reports place the prevalence of NAFLD between 20 and 30% (Wieckowska and Feldstein, 2008), though estimates range from

17 to 40% (Hardwick et al., 2010). In obese populations, this prevalence increases to

90% (Machado et al., 2006), making the projected increase in obesity particularly concerning.

While considered to be primarily an adult disease, the alarming increase in childhood obesity has coincided with an increasing recognition of the prevalence of pediatric NAFLD (Schwimmer et al., 2006;Lavine et al., 2010;Patton et al., 2006). NASH as a cause of chronic liver dysfunction in obese children was first reported in the early

1980s (Moran et al., 1983). Disturbingly, patients as young as 9 years-old have been reported with cirrhosis (Kader et al., 2008). In pediatric patients, the prevalence of

NAFLD is estimated to be 9.6%, and the rate is higher among adolescents (17.3%) than infants (0.7%) (Schwimmer et al., 2006). These findings are quite similar to the observed increase in the prevalence of insulin resistant diabetes seen in adolescents (Maclaren et al., 2007). As with adults, the prevalence of NAFLD is increased among obese children

(38%) (Schwimmer et al., 2006). However, while only 10% of adult NAFLD patients have progressed to the inflammatory, fibrogenic stage of NASH, it is estimated that 26% of pediatric cases have already progressed to NASH (Nobili et al., 2006).

Racial and ethnic differences are observed among patients with NAFLD, likely due to the varied prevalence of the two major risk factors in NAFLD, obesity and type 2 diabetes. Both obesity and type 2 diabetes are more prevalent among non-Hispanic

141

black and Mexican-American patients compared to non-Hispanic whites (Flegal et al.,

2002;Flegal et al., 1998;Harris et al., 2002;Flegal et al., 2010). Metabolic syndrome,

which is a well-established risk factor of NAFLD, is seen more often in Hispanics than

non-Hispanic blacks and whites (Ford et al., 2002). Hispanic males have higher

percentage body fat than white and black males (Ellis, 1997). NAFLD also appears to be

more common among Hispanic children, with higher prevalence in non-Hispanic whites

compared to non-Hispanic blacks (Loomba et al., 2009).

Histology/Etiology

Steatosis, also referred to as simple fatty liver or non-alcoholic fatty liver (NAFL) is generally defined as hepatic triglyceride accumulation exceeding 5% by weight

(Neuschwander-Tetri and Caldwell, 2003). This lipid increase can appear as macrovessicular, microvessicular, or a combination of the two, and is typically observed in zone 3 hepatocytes.

A diagnosis of NASH requires evidence of steatosis, lobular inflammation, and hepatocellular damage, and most often occurs in zone 3 hepatocytes. This damage may take the form of ballooning degeneration, Mallory-Denk bodies, apoptosis, and/or necrosis (Tiniakos et al., 2010). Inflammatory infiltrates may include lymphocytes, eosinophils, and polymorphonuclear leukocytes, in addition to the resident Kupffer cell macrophages. Additionally, fibrosis may be present even in non-cirrhotic NASH, also originating in zone 3. This fibrosis can progress to portal and periportal regions, and eventually reach bridging fibrosis and cirrhosis (Tiniakos et al., 2010).

Pediatric and adult NAFLD are predominantly the same disease, and pediatric

NAFLD leads to an increased risk for lifelong severe liver disease (Roberts, 2007). In comparison to adult NASH, histological findings (including steatosis, inflammation, and

142

fibrosis) from pediatric patients may be localized to zone 1 hepatocytes (Schwimmer et

al., 2005). This distinct histological picture has been termed “type 2 NASH” (Roberts,

2007).

Steatosis occurs due to a dysregulation of triglycerides synthesis and transport.

Sources of these accumulated lipids include increased fatty acid influx (from both diet

and peripheral tissues), increased de novo lipogenesis, and decreased triglyceride

removal (VLDL production and secretion). It is estimated that 60% of hepatic fat content

comes from circulating fatty acids, not dietary content (Donnelly et al., 2005).

Hyperinsulinemia and hyperglycemia cause activation of lipogenic transcription factors,

including sterol regulatory binding protein-1 (SREBP1), which increase de novo

lipogenesis and inhibit free fatty acid oxidation. Additionally, lipid export from

hepatocytes might be impaired due to defective incorporation of triglycerides into

apolipoprotein B, decreased apolipoprotein B synthesis or excretion (Jou et al., 2008).

Hepatic steatosis does not universally result in liver injury, and requires a second

“hit”, potentially caused by oxidative stress or inflammation, to progress to NASH (Day and James, 1998), Impaired mitochondrial function may lead to activation of lipid catabolic pathways that generate ROS, causing lipid peroxidation of the mitochondrial membrane phospholipids, leading to an additional decrease in mitochondrial function and increased oxidative stress in the cell (Browning and Horton, 2004). Cytokine and adipokine signaling from visceral adipose tissue has been well established as a key player in the progression of NAFLD. It is currently hypothesized that the oxidative and metabolic stresses in combination with the cytokine dysregulation eventually result in hepatocyte death, resulting in further inflammatory signaling and an induction of hepatic stellate cells in a fibrotic repair response (Jou et al., 2008).

143

Diagnosis

Most patients with fatty liver are asymptomatic and undiagnosed, even in advanced stages of the disease. Even in suspected cases of NAFLD, for many patients the precise stage of the disease (simple steatosis vs. NASH vs. severe fibrosis) is unknown. This lack of clinical information is due to the inadequacies of current diagnostic methods.

NAFLD is often suspected following findings of elevated aminotransferases in the absence of significant alcoholic consumption, especially when combined with other features of metabolic syndrome. However, normal serum aminotransferase tests can be seen in patients with both steatosis and NASH (Mofrad et al., 2003;Ipekci et al., 2003).

Indeed, it is reported that two-thirds of NASH patients may have normal aminotransferase levels at any given time (Oh et al., 2008;Delgado, 2008;Wieckowska and Feldstein, 2008). Kunde et al. investigated the accuracy of NASH diagnosis by serum ALT in women undergoing gastric bypass surgery (Kunde et al., 2005). They compared two different reference laboratory cutoffs for “normal” ALT levels, the previous guideline of 30U/L, and new lower level of 19U/L that was suggested to aid in the diagnosis of NAFLD. Importantly, the authors reported that the diagnostic utility of serum

ALT remained poor even at the new lower cutoff. Sensitivity and specificity of serum ALT levels were found to be 42% and 80% (ALT > 30U/L) versus 74% and 42% (ALT >

19U/L). These and other studies (Lizardi-Cervera et al., 2006;Amarapurka et al.,

2006;Amarapurkar and Patel, 2004;Chen et al., 2006;Fracanzani et al., 2008;Sorrentino et al., 2004;Mofrad and Sanyal, 2003;Uslusoy et al., 2009) illustrate the need for a more effective diagnostic measure for NAFLD, especially the NASH stage.

144

Several imaging techniques have been used with success in diagnosing NAFLD.

These include ultrasonography, computerized tomographic (CT) scanning, and magnetic resonance imaging (MRI), each of which is effective at detecting hepatic steatosis. Of these methods, ultrasonography is preferred because of its lower cost and accessibility.

However, it has several limitations. Sensitivity is high (80%) in patients with >30% steatosis, but drops to 55% with steatosis < 19% (Wieckowska and Feldstein, 2008).

Similarly, in morbidly obese patients, sensitivity drops to 49% (Mottin et al., 2004).

Similar decreases occur with respect to specificity. Additionally, ultrasonography is unable to provide a quantitative measure of the degree of lipid accumulation. Both MRI and CT scans provide an accurate quantitation of steatosis, yet the higher costs are prohibitive. The most important limitation of each of these imaging methods is the inability to distinguish between steatosis and NASH. A more recent technique, transient elastography, measures liver stiffness, and may be effective in assessing the level of hepatic fibrosis in later stages of NAFLD. However, a recent study found an increased failure rate in overweight and obese patients, which may limit the effectiveness of this technique in NAFLD (Foucher et al., 2006).

Liver histology remains the gold standard in diagnosing NAFLD, as it is able to assess steatosis, fibrosis, and inflammation. Importantly, this ability to stage and grade

NAFLD allows differentiation between simple steatosis and NASH. As mentioned previously, the principle features of NASH include macrovesicular steatosis, lobular inflammation, and ballooning degeneration. In addition to these criteria, liver biopsies also reveal the degree of liver damage and any changes in overall liver architecture

(Wieckowska and Feldstein, 2008). However, there are also limitations to this procedure; chief among them is the invasive nature of the technique. Studies have indicated

145

significant risks and complications associated with liver biopsies, including pain, major bleeding, and death. It has been estimated that 1 to 3 percent of patients may require hospitalization following a liver biopsy (Bravo et al., 2001), though in at least one study biopsy related mortality occurred in over 1 percent of biopsies (Thampanitchawong and

Piratvisuth, 1999). Other identified limitations of liver biopsies include the subjective nature of the histological analysis and the possibility of sampling error due to the relatively small sample size. In spite of these concerns, liver biopsy remains the only proven, reliable method of diagnosing NASH.

The significant underdiagnosis of fatty liver disease and inability to easily track disease progression presents two important points for consideration. First, there are an enormous number of patients in the US population in whom NAFLD may alter DME activity and drug pharmacokinetics. These unsuspecting patients may be at an increased risk for adverse drug reactions or other toxic events. Second, studies to date on the effect of NAFLD have been hampered by the difficulty in indentifying and correctly staging the disease. Because of this, the majority of the studies presented in this review are from animal models of the disease. There is a clear clinical need for additional investigations aimed at developing more efficient methods of identifying these patients, as well as better characterizing the metabolic changes associated with the disease.

Effects

NAFLD in general and NASH in particular are increasingly recognized as serious diseases. NASH is the most common cause of cryptogenic cirrhosis (Clark and Diehl,

2003;Kojima et al., 2006), and it is estimated that 30 to 50% of NASH patients will progress to cirrhosis within 10 years (Jou et al., 2008). Because of this, NASH is reported to be the underlying cause of 10% of liver transplants (Preiss and Sattar, 2008).

146

Additionally, NASH is responsible for an estimated 13% of all hepatocellular carcinoma cases (Marrero et al., 2002;Bugianesi et al., 2002).

In addition to these pathological defects, it has been established that various liver diseases can affect the metabolism and disposition of therapeutic drugs, due to alterations in the expression and activity of DMEs. For example, models of sepsis and viral hepatitis exhibit altered CYP-mediated biotransformation (Morgan, 2001). This downregulation in CYP activity has also been observed human subjects treated with lipopolysaccharide, a model of gram-negative sepsis (Shedlofsky et al., 1994).

NAFLD also modulates the expression and activity of a number of DMEs, and may result in altered pharmacologic efficacy or adverse drug reactions. Altered pharmacokinetics have been reported in obese subjects with respect to hormonal contraceptives (Edelman et al., 2010;Skouby, 2010), as well as a number of other drugs

(Lloret et al., 2009). Animal models of NAFLD have demonstrated decreased metabolism and increased toxicity from the antipsychotic drugs clozapine (Zhang et al.,

2007) and haloperidol (Hanagama et al., 2008). Additionally, patients with NAFLD have been reported to have increased risk for adverse drug reactions, specifically drug induced liver disease (Tarantino et al., 2009;Tarantino et al., 2007).

Modeling Human Disease

As mentioned previously, the only definitive method of staging NAFLD is a liver biopsy. This presents a significant complication to studying human fatty liver disease at several levels, including identifying patients for study, obtaining tissue samples, and in tracking disease progression. Furthermore, human DME expression and activity can vary widely between patients, due to a number of variables (genetic polymorphism, diet, xenobiotic exposure, age, etc) (Guengerich, 2006;Gomez-Lechon et al., 2009). As a

147

result of these limitations, the majority of human NAFLD studies employ one of two tissue sources, cadaveric organs and bariatric surgery patients. Postmortem tissue samples provide sufficient sample for material for analysis of mRNA and protein expression, as well as activity, though a detailed medical history of the patient is often lacking. The patient population undergoing bariatric surgery (morbidly obese patients), have a much higher rate of both NAFLD and NASH (Lazo and Clark, 2008). The routine intraoperative liver biopsies performed during bariatric surgery allow detailed determination of NASH status in these patients (Tanaka et al., 2006;Dolce et al., 2009).

Because of the difficulty in identifying properly diagnosed NAFLD patients, as well as the ethical and practical issues with obtaining liver samples for analysis, the majority of studies on NAFLD gene alterations have employed animal models. While some of these models are of limited accuracy in relation to either histological outcome or disease context (reviewed by Larter and Yeh, 2008;Anstee and Goldin, 2006), a detailed presentation of the various benefits and faults of each is not the focus of this review.

However, a brief description of the models used in the studies described below may prove beneficial to properly compare results between models and species. While NAFLD studies using non-rodent species have been described (Leclercq et al., 1998), the vast majority of research has been performed in rat and mouse models.

These rodent models are genetic, dietary, or a combination of the two. In both rats and mice, the most common genetic models involve dysregulation of leptin signaling, leading to hyperphagia and obesity. Obese Zucker rats and db/db mice and are deficient in the leptin receptor, while ob/ob mice are deficient in leptin itself. While these models exhibit insulin resistance and obesity, their liver pathology rarely progresses beyond steatosis to NASH without a second insult (Larter and Yeh, 2008).

148

Because of this, drug metabolism data presented from these genetic models can be assumed to correlate with a human diagnosis of simple steatosis.

In order to progress to NASH, a dietary model is often used. The classical model of rodent NASH is a methionine-choline deficient (MCD) diet, which rapidly induces steatohepatitis with a liver pathohistology closely recapitulating the human condition.

However, animals fed the MCD diet experience significant weight loss exhibit hypoinsulinemia and are insulin sensitive. An alternate dietary model, the high-fat diet, has been used to more closely recapitulate the modern “Western-diet.” However, rodents adapt to high-fat feeding and may take several months to progress to NASH.

Additionally, the composition of the experimental chow may vary a great deal in a number of constituents, with varying results. In the absence of stated hepatic histological staging, it is difficult to properly assign these models to steatosis or NASH (Larter and

Yeh, 2008). Additional animal models employed include dietary orotic acid, and forced intragastric feeding, which resulted in steatosis and steatohepatitis, respectively (Zhang et al., 2007;Deng et al., 2005)

Drug Metabolism in NAFLD

Metabolism is the major clearance mechanism for the most frequently prescribed drugs (Williams et al., 2004), and the liver is the major organ of drug metabolism. A variety of enzymes with overlapping substrate specificity is expressed in the liver and are commonly divided into Phase I (oxidizing) and Phase II (conjugating) DMEs. Phase I enzymes belong predominantly to the cytochrome p450 family, while major Phase II enzymes include glucuronosyltransferases, sulfotransferases, and glutathione transferases.

149

In the following section, we have compiled the results of published animal and clinical studies of NAFLD and obesity, where DME expression or activity was investigated. The stated focus of several of these animal studies was obesity (or diabetes), and liver histology or NAFLD status was not obtained as part of the original study. However, the models employed have been shown elsewhere to induce various stages of NAFLD, and have therefore been included. In reviewing these published data, rather than comparing the magnitude of DME alterations, we have chosen to focus on identifying a consistent direction (induction or inhibition) of DME changes in the progressive stages of NAFLD. The details and results of these studies have been compiled in the included tables.

Phase I

A recent study of the 200 most often prescribed drugs found that two-thirds of hepatically cleared drugs were metabolized by CYPs (Williams et al., 2004). These enzymes belong to 3 families (CYP1, CYP2, CYP3), with several isoforms within multiple subfamilies. CYP3A is the predominant hepatic CYP, both in terms of relative expression and the number of relevant substrates. In terms of the percent of drugs metabolized,

CYP2C9, 2D6, 2C19, and 1A2 follow CYP3A. Other enzymes, such as 2A6 and 2E1, are collectively responsible for only 6% of clinically relevant drugs (Zanger et al., 2005).

Information on the effects of NAFLD on drug metabolizing CYP enzymes was found for

CYP1A2, 2A, 2B, 2C, 2D, 2E, and 3A.

CYP1A2

CYP1A2 constitutes about 13% of hepatic CYP enzymes, and metabolizes some

15% of therapeutic drugs. Substrates for this enzyme are varied and include adenosine receptor inhibitors, analgesics, antiarrhythmic drugs, anticancer drugs, anticoagulants,

150

antidepressants, antihistamines, antihypertensive drugs, antipsychotics, -blockers, cyclooxygenase-2 inhibitors, anesthetics, and drugs from several other classes

(reviewed by Zhou et al., 2009).

The downregulation of CYP1A2 in NAFLD is one of the more consistent findings in studies of DME expression and activity. In several different rat models of steatosis, mRNA and protein were significantly decreased (Zhang et al., 2007;Hanagama et al.,

2008). Suh et al. (2005) reported an initial increase in CYP1A2 mRNA expression in

Obese Zucker rats at 6 weeks, but by 12 weeks the expression was significantly decreased over lean controls. No published rat studies of CYP1A2 in NASH were found.

Results in mouse models paralleled that of the rat with several groups employing both genetic and dietary models of steatosis exhibiting decreased mRNA, protein, and/or activity (Yoshinari et al., 2006;Kirpich et al., 2010;Roe et al., 1999), though others failed to detect this decrease (Watson et al., 1999;Barnett et al., 1992;Fisher et al., 2008). The lone study to find an increase in CYP1A2 activity found protein levels unchanged (Koide et al., 2010).

Three groups have also reported a downregulation of CYP1A2 in human NAFLD.

Greco et al. (2008) detected CYP1A2 as a significantly decreased gene in microarray studies of NAFLD patients. Using hepatocytes isolated from human liver grafts of patients with fatty liver disease, Donato et al. (2006) observed a 44% reduction in

CYP1A2 activity. Our own studies using postmortem liver samples revealed a significant decrease in both protein and activity of CYP1A2 with the progression of NAFLD (Fisher et al., 2009).

CYP2A

151

CYP2A6 (reviewed by Di et al., 2009) makes up a small fraction of the total hepatic CYPs (4%), and metabolizes around 3% of therapeutic drugs. These include anticonvulsants, anesthetics, and anticancer drugs, as well as nicotine. In part because of this comparatively small role in drug metabolism, relatively few studies in either humans or animal models have investigated CYP2A in NAFLD.

In animal studies, Weltman et al. (1996) reported decreased enzymatic activity in

MCD-fed rats, while Watson et al. (1999) observed increased activity in ob/ob mice.

Studies in human hepatocytes are similarly conflicting, with increased CYP2A6 activity in human hepatocytes isolated from fatty liver grafts, and decreased activity in FFA treated healthy hepatocytes (Donato et al., 2006). Rubio et al. (2007) found CYP2A6 among downregulated genes in NASH livers. Our own studies using human liver samples found increased expression both of CYP2A6 mRNA and protein, as well as increased activity with NAFLD progression (Fisher et al., 2009). CYP2A6 activity is elevated in patients with other inflammatory liver diseases, including hepatitis, primary biliary cirrhosis, and alcoholic cirrhosis (Fisher et al., 2009).

CYP2B

CYP2B6 accounts for 6% of total CYPs in the liver and metabolizes to some extent around 10% of therapeutic drugs. Substrate specificity for this enzyme overlaps significantly with several other CYP2 family members, and most substrate drugs are more extensively metabolized by these enzymes. The primary interest in CYP2B6 is its induction by a variety of microsomal inducers, and its co-regulation with CYP3A4 (Mo et al., 2009).

Published studies in mouse models do not allow a clear interpretation of the effect of NAFLD on Cyp2b10. While some studies in genetically steatotic mice reported

152

increased Cyp2b10 expression and activity (Yoshinari et al., 2006;Watson et al., 1999), others observed either no change (Barnett et al., 1992;Fisher et al., 2008), or decreased expression (Kirpich et al., 2010). Further complicating the picture, Cheng et al. (2008) reported increased expression in ob/ob female mice, and decreased expression in ob/ob male mice.

Few studies in human patients have reported on the effects of NAFLD on

CYP2B6 expression. While Fisher et al. (2009) found NAFLD progression increased

CYP2B6 mRNA in the absence of any effect on protein or activity, two separate groups reported decreased mRNA expression in NASH livers when compared to simple fatty liver (Stepanova et al., 2010;Yoneda et al., 2008).

CYP2C

Several isoforms of the CYP2C family exist in the human liver, including 2C8,

2C9 (rat homologue Cyp2C11, mouse homologue Cyp2c29), and 2C19. These three human isoforms together account for approximately 20% of the total hepatic CYP content (Hewitt et al., 2007), and are able to metabolize over one-half of commonly prescribed drugs (Nebert and Russell, 2002). These drug substrates include anticonvulsant drugs, anticoagulants, antidiabetic drugs, proton pump inhibitors, anticancer drugs, and nonsteroidal anti-inflammatory drugs. As with CYP2B6, members of the CYP2C family are inducible by a number of compounds including therapeutic drugs (Chen and Goldstein, 2009).

Several studies employing rat NAFLD models have reported decreased expression of the CYP2C9-homologue Cyp2C11 at the mRNA (Hanagama et al.,

2008;Kim et al., 2004a) and protein (Zhang et al., 2007) levels in steatotic rats, as well as in MCD fed rats (Lickteig, 2007). Decreased Cyp2C11 activity has also been reported

153

(Weltman et al., 1996). The db/db mouse model revealed unchanged total Cyp2c protein, though mRNA levels of Cyp2c29 were elevated (Yoshinari et al., 2006).

In contrast to the uniform decrease seen in rats, human CYP2C9 expression appears unchanged in NAFLD (Donato et al., 2006;Fisher et al., 2009). However, even in the absence of elevated expression, CYP2C9 activity was significantly and consistently increased in NAFLD progression (Fisher et al., 2009). While CYP2C isoform

CYP2C8 exhibited no change in the presence of NAFLD, CYP2C19 protein expression and activity were decreased (Fisher et al., 2009). No reports on CYP2C8 and CYP2C19 homologues in experimental NAFLD have been published.

CYP2D6

CYP2D6 makes up only 2-8% of total hepatic CYP content, yet it metabolizes

25% of clinical drugs, including antidepressants, neuroleptics, opioids, antiemetics, antiarrhythmics, -blockers, antihistamines, and anti-HIV drugs (reviewed by Wang et al., 2009). CYP2D6 is significantly polymorphic, with ultrarapid, extensive, intermediate and poor metabolizing phenotypes represented in the population. Few published studies document changes in CYP2D6 during NAFLD. While Donato et al. (2006) reported a significant downregulation of enzymatic activity in hepatocytes treated with increasing amounts of free fatty acids, our studies in human liver samples failed to reveal significant changes in either expression or activity (Fisher et al., 2009).

CYP2E1

CYP2E1 is one of the most well-conserved DMEs whose drug substrates include several anesthetics, as well as acetaminophen, phenobarbital, fluoxetine, theophyline, and chlorzoxazone (Tanaka et al., 2000). While CYP2E1 plays a relatively minor role in drug metabolism, it plays a major role in chemical toxicity and carcinogenesis. Non-drug

154

substrates include alcohol, acetone, benzene, fatty acids, carbon tetrachloride, nitrosamines (Lu and Cederbaum, 2008). Induction of both protein and activity appear to occur through increased stabilization of substrate-bound enzyme, often without increased mRNA expression (Gonzalez, 2007).

CYP2E1 is perhaps the most studied CYP enzyme in relation to NAFLD, and was the first enzyme documented to be modulated in clinical fatty liver disease (Weltman et al., 1998). The majority of human studies have reported increased expression and activity of CYP2E1, and this increase is hypothesized to play a role in NAFLD pathogenesis (Gomez-Lechon et al., 2009). Interestingly, in a number of mouse models,

Cyp2e1 expression and activity were decreased (Enriquez et al., 1999;Deng et al.,

2005;Watson et al., 1999;Ito et al., 2007;Cheng et al., 2008). Others failed to observe any change (Yoshinari et al., 2006;Roe et al., 1999;Barnett et al., 1992;Ito et al., 2006).

Only two studies reported increases in Cyp2e1; in ob/ob females (but not males), and in steatotic mice (but not in NASH mice) (Ito et al., 2007;Roe et al., 1999). Results in rat studies reveal a more consistent increase in Cyp2E1 activity and expression in MCD-diet fed rats (Weltman et al., 1996), in those fed a high-fat diet (Osabe et al.,

2008;Khemawoot et al., 2007;Lieber et al., 2004), and in Obese Zucker rats

(Khemawoot et al., 2007). Two studies reported decreases in Cyp2E1, in obese Zucker animals and orotic acid treatment (Zhang et al., 2007;Enriquez et al., 1999).

Researchers have observed human CYP2E1 upregulation in morbidly obese patients (Emery et al., 2003), in general NAFLD (Kohjima et al., 2007), and in NASH

(Weltman et al., 1998;Videla et al., 2004;Chalasani et al., 2003;Orellana et al., 2006).

Chtioui et al. (2007) reported no difference in CYP2E1 activity between steatotic livers and those with NASH, with activity correlated to severity of steatosis instead of disease

155

progression. This is in agreement with findings by Emery et al. (2003), as well as the observation that IHC staining localizing CYP2E1 protein expression to the hepatocytes most affected by lipid accumulation (zone 3) (Weltman et al., 1998;Bell et al., 2010).

However, several other studies found CYP2E1 protein and activity unchanged in patients with simple fatty liver (Donato et al., 2006;Videla et al., 2004;Orellana et al.,

2006). CYP2E1 levels and activity are decreased following dietary restriction and bariatric surgery (Bell et al., 2010;Leclercq et al., 1999). Two studies have observed decreased CYP2E1 mRNA expression in NAFLD, though decreased activity has not been reported (Fisher et al., 2009;Nakamuta et al., 2005)

CYP3A

The CYP3A family includes several isoforms (3A4, 3A5, 3A7, and 3A43), though

CYP3A4 appears to be the major enzyme in drug metabolism. CYP3A4 is the most abundant CYP enzyme in the liver and alone accounts for the metabolism of over 50% of drugs (Hewitt et al., 2007). The structurally diverse substrates of CYP3A4 include drugs from almost all drug classes (reviewed by Zhou, 2008). CYP3A4 activity is highly variable, with pharmacologic inhibition and induction reported with numerous drugs and other chemicals, including its own substrates (Zhou, 2008).

Due to the major role played by CYP3A in drug metabolism, a number of investigators have studied how this enzyme is modulated by NAFLD. All rat models to date have observed decreased expression or activity of Cyp3A, including both steatosis

(Zhang et al., 2007;Osabe et al., 2008;Hanagama et al., 2008;Suh et al., 2005;Kim et al.,

2004a) and NASH (Weltman et al., 1996). Interestingly, two independent studies observed temporal differences in the regulation of Cyp3A in NAFLD, with decreased expression at 2 weeks, increased expression at 6 and 8 weeks, and decreased

156

expression again at 12 weeks (Osabe et al., 2008;Suh et al., 2005). Studies in ob/ob and db/db mice failed to detect any change in Cyp3a activity (Yoshinari et al., 2006;Watson et al., 1999;Roe et al., 1999;Barnett et al., 1992). Results in mice fed a high-fat diet were not consistent (Koide et al., 2010;Kirpich et al., 2010;Cheng et al., 2008;Kim et al.,

2004b) while the only study in a NASH model observed increase expression (Fisher et al., 2008).

Three studies have reported decreased activity of CYP3A4/5 in NAFLD patients

(Weltman et al., 1998;Donato et al., 2006;Donato et al., 2007). Bell et al. (2010) investigated the effect of bariatric surgery on protein expression of CYP3A4/5 and

CYP2E1. While they observed a significant decrease in CYP2E1 expression, CYP3A4/5 expression was unchanged. In our recent study we observed a decreasing trend in

CYP3A4/5 expression and activity, though neither reached statistical significance (Fisher et al., 2009).

Minor Enzymes

While the majority of Phase I metabolism is performed by CYP enzymes, a number of additional enzymes play a minor role in drug and xenobiotic metabolism.

NAD(P)H quinone oxidoreductase (NQO1; NAD(P)H dehydrogenase, quinone 1) acts to detoxicate quinines, for example the toxic acetaminophen metabolite NAPQI. Nqo1 expression is consistently increased in models of NAFLD. Mouse models of both steatosis (Cheng et al., 2008) and NASH (Fisher et al., 2008) reported increased Nqo1 expression. While Kim et al. (2004a) reported slightly decreased expression in obese

Zucker rats, we have observed an increase in both the expression and activity in MCD diet fed rats (Lickteig et al., 2007). Our recently published findings on the effect of human disease on antioxidant genes found significantly increased mRNA, protein, and

157

activity in the progression of NAFLD (Hardwick et al., 2010). Heme oxygenase 1 (HO1) while not directly involved in drug metabolism is another important cytoprotective enzyme. HO1 is often coordinately regulated with NQO1, and is increased in models of steatosis and NASH (Lickteig et al., 2007;Cheng et al., 2008).

Two additional enzymes detoxicate the reactive intermediates formed during drug metabolism, epoxides and aldehydes. Microsomal epoxide hydrolase (mEH) plays a major role in the hydrolysis of epoxides formed during drug and xenobiotic metabolism.

Similarly, aldehyde dehydrogenase metabolizes acetaldehyde, produced by ethanol oxidation, to form acetate. The expression of both enzymes was altered in experimental

NAFLD. mEH was up regulated in a rat model of NASH (Lickteig et al., 2007), and several isoforms of ALDH were upregulated in mice fed high fat diets (Kim et al.,

2004b;Lee et al., 2010).

Phase II

Sulfotransferases

Sulfotransferase (SULT) enzymes are involved in the metabolism of therapeutic drugs and endogenous hormones. Drug metabolizing SULTs are cytosolic and belong to

SULT1 and SULT2 families (Nowell and Falany, 2006). While SULTs are the major detoxication enzyme in the developing liver, in adult livers they account for the metabolism of less than one-fourth of conjugated drugs (Jancova et al., 2010). Common

SULT substrates include acetaminophen, albuterol, terbutaline, methyldopa, and hormonal contraceptives (Liston et al., 2001;Edelman et al., 2010).

Early studies in obese overfed rats reported decreased formation of acetaminophen sulfonate, though NAFLD status was not investigated (Corcoran et al.,

1987;Corcoran and Wong, 1987). Few studies have reported on the effect of NAFLD on

158

SULT expression or activity. Cheng et al. (2008) observed an increase in Sult2a1/2 expression in ob/ob males, with no change in females. Koide et al. (2010) reported a decrease in Sult2a1 protein expression and activity in mice fed a high-fat diet, though no change was detected in Sult1a1 in the same animals. Studies in obese Zucker rats also found sulfotransferase activity unaffected by NAFLD (Chaudhary et al., 1993).

In human patients, Younossi et al. (2005a) reported SULT1A2 among genes down regulated in NASH. Interestingly, Stepanova et al. (2010) compared hepatic gene expression between Caucasian and African American patients with steatosis or NASH.

SULT1A1 expression was significantly downregulated with the progression to NASH, though only in African Americans.

UDP Glucuronosyltransferases

Glucuronide conjugation is the major method of Phase II conjugation, and plays a key role in conjugating clinical drugs for processing and elimination from the body.

Several NSAIDS and opioids are excreted primarily as glucuronide conjugates, as are certain anxiolytics, antidepressants, and antipsychotics (reviewed by Liston et al., 2001).

UGTs are also involved in the metabolism of several hormonal contraceptives (Liston et al., 2001;Edelman et al., 2010). Two enzymes families, UGT1A and UGT2B, are clinically important in humans with several distinct gene products of widely varying substrate specificity in each family. UGT1A family members share common exons (2-5).

Loss of function mutations in these exons can lead to Crigler-Najjar Syndrome (Bock,

2010). UGT2B family members are particularly important both due to protein levels

(UGT2B4, UGT2B10) and number of drugs metabolized (UGT2B7) (Bock, 2010).

No human studies have reported changes in UGT expression in NAFLD. In animal models, published results are fairly consistent. Obese Zucker rats exhibited

159

decreased mRNA expression of Ugt1A1, 1A6, and 2B1 (Kim et al., 2004a) though others observed increased glucuronidation in the same model (Chaudhary et al., 1993).

Similarly, rats fed a high fat diet had decreased protein levels of Ugt1A1, 1A6, 1A7 and

2B1 (Osabe et al., 2008). Watson et al. (1999) observed no change in UGT activity in ob/ob mice. Ugt1a9 mRNA levels were observed to decrease in mice with steatosis

(Kirpich et al., 2010), though protein and activity were unaltered (Koide et al., 2010).

Ugt2b activity was reportedly increased in high-fat fed mice, though expression was unchanged or even decreased (Koide et al., 2010;Kirpich et al., 2010).

Glutathione and Glutathione-S-Transferases

The glutathione antioxidant system is responsible for the conjugation of nucleophilic glutathione (GSH) to electrophilic compounds including drugs and drug metabolites. This conjugation is performed by glutathione-S-transferase (GST) enzymes, grouped into 5 classes, alpha, mu, pi, theta, and zeta (Hayes et al., 2005). Glutathione conjugation activity can be modulated through changes in the expression of GSTs, in

GSH levels, or in the expression of enzymes which synthesize GSH. While glutathione synthetase (GSS) is involved in the final step, the rate limiting step in GSH synthesis is catalyzed by glutamylcysteine ligase GCL, which is composed of a catalytic (GCLC) and a modifier (GCLM) subunit (Lu, 2009).

The impact of NALFD on GST expression and activity appears to be isoform and possibly species specific specific. Members of the Alpha family showed increased expression in ob/ob mice (Sharma et al., 2010), but expression was decreased in mice fed a high fat diet and in obese Zucker rats (Kirpich et al., 2010;Kim et al., 2004a). Two human studies have reported increases in GSTA expression. We recently reported an increase in the expression of GSTA1, A2, and A4 in NAFLD progression. Younossi

160

observed increased GSTA4 expression in NASH, though the parallel increase in a non-

NAFLD obese control group may indicate an association with obesity rather than NAFLD

(Younossi et al., 2005b).

Mouse studies on the effect of NAFLD on the Mu family of GSTs have all employed high fat diets to induce steatosis. GSTm1, m2, m3, and m6 expression has been observed to increase (Lee et al., 2010;Kim et al., 2004b) or to decrease (Kirpich et al., 2010) by different groups. In human studies, we have observed that NAFLD progression significantly increases the expression of GSTM1, and M3, but saw a contrasting decrease in overall GSTM protein expression. Yoneda et al. (2008) reported a decrease in GSTM1 expression with the progression from steatosis to NASH.

Similarly, GSTM1, 2, 4, and 5 were found among genes downregulated in steatosis

(Younossi et al., 2005a) and NASH (Rubio et al., 2007). Interestingly, ethnicity may have a significant impact on GSTM expression in NAFLD, as Stepanova et al. (2010) reported

GSTM2, M4, and M5 are all increased more in African Americans with NASH than in

Caucasians with the same disease. Finally, while GSTP1 mRNA was downregulated in mice fed a high fat diet (Kirpich et al., 2010), our human studies found both mRNA and protein expression significantly increased (Hardwick et al., 2010).

The majority of investigations into GST activity in NAFLD have found decreased enzymatic activity including studies of both ob/ob mice (Roe et al., 1999;Barnett et al.,

1992) and human liver samples (Hardwick et al., 2010). Koide et al. (2010) reported increased activity in high fat diet-fed mice, and other groups have found no change in

NAFLD models (Watson et al., 1999).

Glutathione Content and Synthesis

161

A number of studies have observed hepatic depletion of GSH content in NAFLD.

GSH levels were unchanged in obese Zucker rats when compared to liver weight

(Chaudhary et al., 1993), in ob/ob mice (Watson et al., 1999), and mice fed a high fat

diet (Ito et al., 2006). Other mouse studies have observed depletion of total GSH in both

steatosis and NASH (Ito et al., 2007;Barnett et al., 1992;Lee et al., 2010), as have

studies in human NAFLD patients (Videla et al., 2004;Hardwick et al., 2010). With

depletion of GSH, there is a concurrent decrease in the ratio between reduced GSH and

oxidized GSSG (Lee et al., 2010;Hardwick et al., 2010) in NAFLD, demonstrating the

increased oxidative stress inherent in the disease (Pastore et al., 2003). Furthermore,

this depletion of hepatic GSH is not due to decreased synthesis, as GSS, GCLC and

GCLM have been found to be unchanged or even increased in NAFLD (Kohjima et al.,

2007;Chaudhary et al., 1993;Lickteig et al., 2007;Hardwick et al., 2010;Kim et al.,

2004b).

Mechanisms

Several mechanisms involved in the alteration of drug metabolism in NAFLD

have been proposed and investigated. These include inflammatory mediators, inhibition

by free fatty acids, nuclear receptor activation, and oxidative stress signaling.

Cytokines

Insulin resistance and obesity are pro-inflammatory conditions, and while overt

inflammatory infiltration only occurs in later stages of NAFLD, cytokines and

inflammatory mediators are observed in all stages of the disorder. Prominent cytokines

involved in NAFLD progression include interleukin 1 (IL-1), IL-6, IL-8, and tumor necrosis

factor-α (TNFα) (Jarrar et al., 2008;Estep et al., 2009;Wieckowska et al., 2008). The downregulation of CYP activity and expression with inflammation has been well

162

described (Aitken et al., 2006), yet little has been reported on the effects of inflammation on phase II metabolic enzymes. Depletion of Kupffer cells in rats liver slices was shown to increase acetaminophen glucuronidation (Neyrinck et al., 1999), indicating that cytokines may also downregulate conjugating DMEs in addition to CYP enzymes.

Nuclear Receptors

CAR/PXR

The expression of many DMEs is modulated through the activity of nuclear receptors. The pregnane X receptor (PXR), known as the steroid and xenobiotic receptor in humans (SXR), along with the constitutive androstane receptor (CAR) are two well known xenosensors and master regulators of xenobiotic response (Kakizaki et al.,

2008). Studies in two mouse models have reported increased mRNA expression of PXR in NAFLD, one of which coincided with increased expression of Cyp3a11 (Yoshinari et al., 2006;Fisher et al., 2008). Characterized target genes of these receptors include

CYP2B, 2C, and 3A, SULTs and UGTs (Kakizaki et al., 2008), making modulation of

PXR and/or CAR activity a obvious hypothesis for the alterations seen in NAFLD.

Additionally, multiple links have been reported between these xenosensors and the regulation of energy/lipid metabolism (reviewed by Gao and Xie, 2010).

Polyunsaturated fatty acids have been shown to modulate the activity of CAR, and to a lesser extent PXR (Finn et al., 2009). The transcription factor sterol regulatory element binding protein (SREBP1) is upregulated in obese insulin resistant patients (Pettinelli et al., 2009), and this factor has been shown to inhibit both PXR and CAR (Roth et al.,

2008b). The master energy sensor AMP activated protein kinase (AMPK) is responsible for decreasing gluconeogenesis and lipogenesis, and appears to be required for CAR activation in the liver (Rencurel et al., 2006;Rencurel et al., 2005;Shindo et al., 2007).

163

Finally, the insulin sensitive transcription factor FOXO1 has been shown to modulate the

activity of both CAR and PXR (Kodama et al., 2004). Recent research has also indicated

that CAR activation may be protective against NAFLD (Gao et al., 2009;Dong et al.,

2009;Roth et al., 2008a;Zhai et al., 2010), though other studies have reported the

opposite (Yamazaki et al., 2007).

Hnf4α

The nuclear receptor hepatocyte nuclear factor 4-alpha is activated by a variety

of fatty acids and is responsible controlling several metabolic pathways, including both

fatty acid metabolism and drug metabolism. Reported CYPs regulated by HNF4α include

CYP2A6, 2B6, 2C8, 2C9, 2C19, 2D6, and 3A4/5 (Jover et al., 2009). While both CAR

and PXR are induced by HNF4α, it appears that only CYP2B6 induction by HNF4α can

be fully attributed to these increased CAR levels (Kamiyama et al., 2007).

In NAFLD, Yoshinari et al. (2006) observed no significant change in the mRNA

levels of HNF4α mRNA db/db mice. Similarly, Sugatani et al. (2006) reported unchanged

HNF4α mRNA levels in rats fed a high fat diet. However, levels of nuclear HNF4α protein were significantly decreased in this rat model. It is possible that the general decrease in total CYP expression observed by many groups is due to an inhibition of

HNF4α protein levels in NAFLD.

Oxidative Stress Signaling

Cells respond to oxidative stress, like that which occurs in the progression of

NAFLD, by upregulating antioxidant genes. This antioxidant response is controlled by a specific transcription factor, NF-E2-related nuclear factor 2 (Nrf2) (Jaiswal, 2004). Under normal conditions, Nrf2 is negatively regulated by the protein Keap1, which is responsible for sequestering Nrf2 from the nucleus and aiding in its degradation (Li and

164

Kong, 2009;Zhang, 2006). When a cell undergoes oxidative stress, Nrf2 is released from

Keap1 and translocates to the nucleus, where it is able to promote transcription of its target genes. Work from our lab and other has revealed Nrf2 activation in both experimental (high fat-fed or MCD-fed mice) and clinical NAFLD (Fisher et al.,

2008;Hardwick et al., 2010;Kim et al., 2004b).

Similarly to CAR and PXR, Nrf2 acts to regulate both xenobiotic responses and energy metabolism. A recent study by Kitteringham et al (Kitteringham et al., 2010) suggested that Nrf2 may be a major regulator of hepatic lipid disposition. This is in addition to its well-known regulation of GSTs, UGTs, SULTs, and glutathione production

(Shen and Kong, 2009). Nrf2 has been shown to modulate CYP activity as well, including the downregulation of CYP1A2 and the induction of CYP2A5 (Garg et al.,

2008;Lamsa et al., 2010). Researchers are further examining the interplay between Nrf2 activation and NAFLD progression (Chowdhry et al., 2010;Sugimoto et al., 2010;Zhang et al., 2010;Pi et al., 2010;Shin et al., 2009).

Conclusions

The hepatic disorder known as NAFLD results in significant alterations in the expression and activity of multiple DMEs. Because of the extremely high prevalence of the disease, when considering any drug in clinical use in the U.S. it is likely that some patients receiving the drug will have NAFLD. Altered drug metabolism in NAFLD patients may lead to altered pharmacokinetics and increased risk for adverse drug reactions. In reviewing the data currently available in the literature, several categories of responses to

NAFLD are observed.

The first category of responses includes enzyme changes that are consistent and uniform across nearly all of the published studies. For example, NAFLD appears to elicit

165

a near-uniform downregulation of CYP1A2 as well as cellular GSH. Drugs which are significantly metabolized by CYP1A2 or glutathione conjugation should be closely monitored during administration to patients where NAFLD is suspected. Additionally, because these changes are consistent across species, rodent models of NAFLD may be of use in identifying potential toxic events associated with these specific alterations.

The second category includes alterations that appear to be dependent upon species, sex, or even ethnicity. The upregulation of CYP2E1 in NAFLD is reported in the majority of human and rat studies, yet mouse studies regularly observe downregulation of this enzyme. DME alterations in NAFLD are also impacted by both race and sex.

These findings highlight the importance of carefully considering and controlling for the multiple potential sources of variability in DME expression and activity. Additional comprehensive investigations into the relative impact of these factors within the presence of NAFLD would be beneficial.

Finally, in the case of most of the clinically relevant DMEs, the effects of NAFLD are unclear, either because of high variability between studies (CYP3A) or because of an insufficient number of studies (SULTs and UGTs). In cases such as these, the use of probe compounds may allow in vivo determination of relative metabolic activity and identification of individuals that require personalized dosing regimens. In the progression to this more personalized approach to pharmacotherapy, considerations of drug metabolism and altered pharmacokinetics by chronic diseases such as NAFLD are imperative.

Despite the high prevalence of NAFLD, research in the disease effects on hepatic drug metabolism is lacking, especially in human subjects. While obvious difficulties exist (i.e. identifying clinical subjects, obtaining tissue samples), information

166

about disease-induced variability in drug metabolism and clearance is vital to safe pharmacotherapy.

167

References

Adler M and Schaffner F (1979) Fatty Liver Hepatitis and Cirrhosis in Obese Patients. Am J Med 67:811-816.

Aitken AE, Richardson T A and Morgan E T (2006) Regulation of Drug-Metabolizing Enzymes and Transporters in Inflammation. Annu Rev Pharmacol Toxicol 46:123-149.

Amarapurka DN, Amarapurkar A D, Patel N D, Agal S, Baigal R, Gupte P and Pramanik S (2006) Nonalcoholic Steatohepatitis (NASH) With Diabetes: Predictors of Liver Fibrosis. Ann Hepatol 5:30-33.

Amarapurkar DN and Patel N D (2004) Clinical Spectrum and Natural History of Non- Alcoholic Steatohepatitis With Normal Alanine Aminotransferase Values. Trop Gastroenterol 25:130-134.

Anstee QM and Goldin R D (2006) Mouse Models in Non-Alcoholic Fatty Liver Disease and Steatohepatitis Research. Int J Exp Pathol 87:1-16.

Barnett CR, Abbott R A, Bailey C J, Flatt P R and Ioannides C (1992) Cytochrome P- 450-Dependent Mixed-Function Oxidase and Glutathione S-Transferase Activities in Spontaneous Obesity-Diabetes. Biochem Pharmacol 43:1868-1871.

Bell LN, Temm C J, Saxena R, Vuppalanchi R, Schauer P, Rabinovitz M, Krasinskas A, Chalasani N and Mattar S G (2010) Bariatric Surgery-Induced Weight Loss Reduces Hepatic Lipid Peroxidation Levels and Affects Hepatic Cytochrome P-450 Protein Content. Ann Surg 251:1041-1048.

Bock KW (2010) Functions and Transcriptional Regulation of Adult Human Hepatic UDP-Glucuronosyl-Transferases (UGTs): Mechanisms Responsible for Interindividual Variation of UGT Levels. Biochem Pharmacol 80:771-777.

Bravo AA, Sheth S G and Chopra S (2001) Liver Biopsy. N Engl J Med 344:495-500.

Browning JD and Horton J D (2004) Molecular Mediators of Hepatic Steatosis and Liver Injury. J Clin Invest 114:147-152.

168

Chalasani N, Gorski J C, Asghar M S, Asghar A, Foresman B, Hall S D and Crabb D W (2003) Hepatic Cytochrome P450 2E1 Activity in Nondiabetic Patients With Nonalcoholic Steatohepatitis. Hepatology 37:544-550.

Chaudhary IP, Tuntaterdtum S, McNamara P J, Robertson L W and Blouin R A (1993) Effect of Genetic Obesity and Phenobarbital Treatment on the Hepatic Conjugation Pathways. J Pharmacol Exp Ther 265:1333-1338.

Chen CH, Huang M H, Yang J C, Nien C K, Yang C C, Yeh Y H and Yueh S K (2006) Prevalence and Risk Factors of Nonalcoholic Fatty Liver Disease in an Adult Population of Taiwan: Metabolic Significance of Nonalcoholic Fatty Liver Disease in Nonobese Adults. J Clin Gastroenterol 40:745-752.

Chen Y and Goldstein J A (2009) The Transcriptional Regulation of the Human CYP2C Genes. Curr Drug Metab 10:567-578.

Cheng Q, Aleksunes L M, Manautou J E, Cherrington N J, Scheffer G L, Yamasaki H and Slitt A L (2008) Drug-Metabolizing Enzyme and Transporter Expression in a Mouse Model of Diabetes and Obesity. Mol Pharm 5:77-91.

Chtioui H, Semela D, Ledermann M, Zimmermann A and Dufour J F (2007) Expression and Activity of the Cytochrome P450 2E1 in Patients With Nonalcoholic Steatosis and Steatohepatitis. Liver Int 27:764-771.

Clark JM and Diehl A M (2003) Nonalcoholic Fatty Liver Disease: an Underrecognized Cause of Cryptogenic Cirrhosis. JAMA 289:3000-3004.

Corcoran GB and Wong B K (1987) Obesity As a Risk Factor in Drug-Induced Organ Injury: Increased Liver and Kidney Damage by Acetaminophen in the Obese Overfed Rat. J Pharmacol Exp Ther 241:921-927.

Corcoran GB, Wong B K, Shum L and Galinsky R E (1987) Acetaminophen Sulfation Deficit in Obese Rats Overfed an Energy-Dense Cafeteria Diet. Endocr Res 13:101-121.

Day CP and James O F (1998) Steatohepatitis: a Tale of Two "Hits"? Gastroenterology 114:842-845.

Delgado JS (2008) Evolving Trends in Nonalcoholic Fatty Liver Disease. Eur J Intern Med 19:75-82.

Deng QG, She H, Cheng J H, French S W, Koop D R, Xiong S and Tsukamoto H (2005) Steatohepatitis Induced by Intragastric Overfeeding in Mice. Hepatology 42:905-914.

Di YM, Chow V D, Yang L P and Zhou S F (2009) Structure, Function, Regulation and Polymorphism of Human Cytochrome P450 2A6. Curr Drug Metab 10:754-780.

169

Dolce CJ, Russo M, Keller J E, Buckingham J, Norton H J, Heniford B T, Gersin K S and Kuwada T S (2009) Does Liver Appearance Predict Histopathologic Findings: Prospective Analysis of Routine Liver Biopsies During Bariatric Surgery. Surg Obes Relat Dis 5:323-328.

Donato MT, Jimenez N, Serralta A, Mir J, Castell J V and Gomez-Lechon M J (2007) Effects of Steatosis on Drug-Metabolizing Capability of Primary Human Hepatocytes. Toxicol In Vitro 21:271-276.

Donato MT, Lahoz A, Jimenez N, Perez G, Serralta A, Mir J, Castell J V and Gomez- Lechon M J (2006) Potential Impact of Steatosis on Cytochrome P450 Enzymes of Human Hepatocytes Isolated From Fatty Liver Grafts. Drug Metab Dispos 34:1556-1562.

Dong B, Saha P K, Huang W, Chen W, bu-Elheiga L A, Wakil S J, Stevens R D, Ilkayeva O, Newgard C B, Chan L and Moore D D (2009) Activation of Nuclear Receptor CAR Ameliorates Diabetes and Fatty Liver Disease. Proc Natl Acad Sci U S A 106:18831- 18836.

Edelman AB, Cherala G and Stanczyk F Z (2010) Metabolism and Pharmacokinetics of Contraceptive Steroids in Obese Women: a Review. Contraception 82:314-323.

Ellis KJ (1997) Body Composition of a Young, Multiethnic, Male Population. Am J Clin Nutr 66:1323-1331.

Emery MG, Fisher J M, Chien J Y, Kharasch E D, Dellinger E P, Kowdley K V and Thummel K E (2003) CYP2E1 Activity Before and After Weight Loss in Morbidly Obese Subjects With Nonalcoholic Fatty Liver Disease. Hepatology 38:428-435.

Enriquez A, Leclercq I, Farrell G C and Robertson G (1999) Altered Expression of Hepatic CYP2E1 and CYP4A in Obese, Diabetic Ob/Ob Mice, and Fa/Fa Zucker Rats. Biochem Biophys Res Commun 255:300-306.

Estep JM, Baranova A, Hossain N, Elariny H, Ankrah K, Afendy A, Chandhoke V and Younossi Z M (2009) Expression of Cytokine Signaling Genes in Morbidly Obese Patients With Non-Alcoholic Steatohepatitis and Hepatic Fibrosis. Obes Surg 19:617- 624.

Finn RD, Henderson C J, Scott C L and Wolf C R (2009) Unsaturated Fatty Acid Regulation of Cytochrome P450 Expression Via a CAR-Dependent Pathway. Biochem J 417:43-54.

Fisher CD, Jackson J P, Lickteig A J, Augustine L M and Cherrington N J (2008) Drug Metabolizing Enzyme Induction Pathways in Experimental Non-Alcoholic Steatohepatitis. Arch Toxicol 82:959-964.

170

Fisher CD, Lickteig A J, Augustine L M, Ranger-Moore J, Jackson J P, Ferguson S S and Cherrington N J (2009) Hepatic Cytochrome P450 Enzyme Alterations in Humans With Progressive Stages of Nonalcoholic Fatty Liver Disease. Drug Metab Dispos 37:2087-2094.

Flegal KM, Carroll M D, Kuczmarski R J and Johnson C L (1998) Overweight and Obesity in the United States: Prevalence and Trends, 1960-1994. Int J Obes Relat Metab Disord 22:39-47.

Flegal KM, Carroll M D, Ogden C L and Curtin L R (2010) Prevalence and Trends in Obesity Among US Adults, 1999-2008. JAMA 303:235-241.

Flegal KM, Carroll M D, Ogden C L and Johnson C L (2002) Prevalence and Trends in Obesity Among US Adults, 1999-2000. JAMA 288:1723-1727.

Ford ES, Giles W H and Dietz W H (2002) Prevalence of the Metabolic Syndrome Among US Adults: Findings From the Third National Health and Nutrition Examination Survey. JAMA 287:356-359.

Foucher J, Castera L, Bernard P H, Adhoute X, Laharie D, Bertet J, Couzigou P and de L, V (2006) Prevalence and Factors Associated With Failure of Liver Stiffness Measurement Using FibroScan in a Prospective Study of 2114 Examinations. Eur J Gastroenterol Hepatol 18:411-412.

Fracanzani AL, Valenti L, Bugianesi E, Andreoletti M, Colli A, Vanni E, Bertelli C, Fatta E, Bignamini D, Marchesini G and Fargion S (2008) Risk of Severe Liver Disease in Nonalcoholic Fatty Liver Disease With Normal Aminotransferase Levels: a Role for Insulin Resistance and Diabetes. Hepatology 48:792-798.

Gao J, He J, Zhai Y, Wada T and Xie W (2009) The Constitutive Androstane Receptor Is an Anti-Obesity Nuclear Receptor That Improves Insulin Sensitivity. J Biol Chem 284:25984-25992.

Gao J and Xie W (2010) PXR and CAR at the Crossroad of Drug Metabolism and Energy Metabolism. Drug Metab Dispos.

Garg R, Gupta S and Maru G B (2008) Dietary Curcumin Modulates Transcriptional Regulators of Phase I and Phase II Enzymes in Benzo[a]Pyrene-Treated Mice: Mechanism of Its Anti-Initiating Action. Carcinogenesis 29:1022-1032.

Gomez-Lechon MJ, Jover R and Donato M T (2009) Cytochrome P450 and Steatosis. Curr Drug Metab 10:692-699.

Gonzalez FJ (2007) The 2006 Bernard B. Brodie Award Lecture. Cyp2e1. Drug Metab Dispos 35:1-8.

171

Greco D, Kotronen A, Westerbacka J, Puig O, Arkkila P, Kiviluoto T, Laitinen S, Kolak M, Fisher R M, Hamsten A, Auvinen P and Yki-Jarvinen H (2008) Gene Expression in Human NAFLD. Am J Physiol Gastrointest Liver Physiol 294:G1281-G1287.

Guengerich FP (2006) Cytochrome P450s and Other Enzymes in Drug Metabolism and Toxicity. AAPS J 8:E101-E111.

Hanagama M, Inoue H, Kamiya M, Shinone K and Nata M (2008) Gene Expression on Liver Toxicity Induced by Administration of Haloperidol in Rats With Severe Fatty Liver. Leg Med (Tokyo) 10:177-184.

Hardwick RN, Fisher C D, Canet M J, Lake A D and Cherrington N J (2010) DIVERSITY IN ANTIOXIDANT RESPONSE ENZYMES IN PROGRESSIVE STAGES OF HUMAN NON-ALCOHOLIC FATTY LIVER DISEASE. Drug Metab Dispos.

Harris MI, Cowie C C, Gu K, Francis M E, Flegal K and Eberhardt M S (2002) Higher Fasting Insulin but Lower Fasting C-Peptide Levels in African Americans in the US Population. Diabetes Metab Res Rev 18:149-155.

Hayes JD, Flanagan J U and Jowsey I R (2005) Glutathione Transferases. Annu Rev Pharmacol Toxicol 45:51-88.

Ipekci SH, Basaranoglu M and Sonsuz A (2003) The Fluctuation of Serum Levels of Aminotransferase in Patients With Nonalcoholic Steatohepatitis. J Clin Gastroenterol 36:371.

Ito M, Suzuki J, Tsujioka S, Sasaki M, Gomori A, Shirakura T, Hirose H, Ito M, Ishihara A, Iwaasa H and Kanatani A (2007) Longitudinal Analysis of Murine Steatohepatitis Model Induced by Chronic Exposure to High-Fat Diet. Hepatol Res 37:50-57.

Ito Y, Abril E R, Bethea N W, McCuskey M K and McCuskey R S (2006) Dietary Steatotic Liver Attenuates Acetaminophen Hepatotoxicity in Mice. Microcirculation 13:19- 27.

Jaiswal AK (2004) Nrf2 Signaling in Coordinated Activation of Antioxidant Gene Expression. Free Radic Biol Med 36:1199-1207.

Jancova P, Anzenbacher P and Anzenbacherova E (2010) Phase II Drug Metabolizing Enzymes. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 154:103-116.

172

Jarrar MH, Baranova A, Collantes R, Ranard B, Stepanova M, Bennett C, Fang Y, Elariny H, Goodman Z, Chandhoke V and Younossi Z M (2008) Adipokines and Cytokines in Non-Alcoholic Fatty Liver Disease. Aliment Pharmacol Ther 27:412-421.

Jou J, Choi S S and Diehl A M (2008) Mechanisms of Disease Progression in Nonalcoholic Fatty Liver Disease. Semin Liver Dis 28:370-379.

Jover R, Moya M and Gomez-Lechon M J (2009) Transcriptional Regulation of Cytochrome P450 Genes by the Nuclear Receptor Hepatocyte Nuclear Factor 4-Alpha. Curr Drug Metab 10:508-519.

Kader HH, Henderson J, Vanhoesen K, Ghishan F and Bhattacharyya A (2008) Nonalcoholic Fatty Liver Disease in Children: a Single Center Experience. Clin Gastroenterol Hepatol 6:799-802.

Kakizaki S, Yamazaki Y, Takizawa D and Negishi M (2008) New Insights on the Xenobiotic-Sensing Nuclear Receptors in Liver Diseases--CAR and PXR--. Curr Drug Metab 9:614-621.

Kamiyama Y, Matsubara T, Yoshinari K, Nagata K, Kamimura H and Yamazoe Y (2007) Role of Human Hepatocyte Nuclear Factor 4alpha in the Expression of Drug- Metabolizing Enzymes and Transporters in Human Hepatocytes Assessed by Use of Small Interfering RNA. Drug Metab Pharmacokinet 22:287-298.

Khemawoot P, Yokogawa K, Shimada T and Miyamoto K (2007) Obesity-Induced Increase of CYP2E1 Activity and Its Effect on Disposition Kinetics of Chlorzoxazone in Zucker Rats. Biochem Pharmacol 73:155-162.

Kim MS, Wang S, Shen Z, Kochansky C J, Strauss J R, Franklin R B and Vincent S H (2004a) Differences in the Pharmacokinetics of Peroxisome Proliferator-Activated Receptor Agonists in Genetically Obese Zucker and Sprague-Dawley Rats: Implications of Decreased Glucuronidation in Obese Zucker Rats. Drug Metab Dispos 32:909-914.

Kim S, Sohn I, Ahn J I, Lee K H, Lee Y S and Lee Y S (2004b) Hepatic Gene Expression Profiles in a Long-Term High-Fat Diet-Induced Obesity Mouse Model. Gene 340:99-109.

Kirpich IA, Gobejishvili L N, Homme M B, Waigel S, Cave M, Arteel G, Barve S S, McClain C J and Deaciuc I V (2010) Integrated Hepatic Transcriptome and Proteome Analysis of Mice With High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease. J Nutr Biochem.

173

Kodama S, Koike C, Negishi M and Yamamoto Y (2004) Nuclear Receptors CAR and PXR Cross Talk With FOXO1 to Regulate Genes That Encode Drug-Metabolizing and Gluconeogenic Enzymes. Mol Cell Biol 24:7931-7940.

Kohjima M, Enjoji M, Higuchi N, Kato M, Kotoh K, Yoshimoto T, Fujino T, Yada M, Yada R, Harada N, Takayanagi R and Nakamuta M (2007) Re-Evaluation of Fatty Acid Metabolism-Related Gene Expression in Nonalcoholic Fatty Liver Disease. Int J Mol Med 20:351-358.

Koide CL, Collier A C, Berry M J and Panee J (2010) The Effect of Bamboo Extract on Hepatic Biotransforming Enzymes - Findings From an Obese-Diabetic Mouse Model. J Ethnopharmacol.

Kunde SS, Lazenby A J, Clements R H and Abrams G A (2005) Spectrum of NAFLD and Diagnostic Implications of the Proposed New Normal Range for Serum ALT in Obese Women. Hepatology 42:650-656.

Lamsa V, Levonen A L, Leinonen H, Yla-Herttuala S, Yamamoto M and Hakkola J (2010) Cytochrome P450 2A5 Constitutive Expression and Induction by Heavy Metals Is Dependent on Redox-Sensitive Transcription Factor Nrf2 in Liver. Chem Res Toxicol 23:977-985.

Larter CZ and Yeh M M (2008) Animal Models of NASH: Getting Both Pathology and Metabolic Context Right. J Gastroenterol Hepatol 23:1635-1648.

Lavine JE, Schwimmer J B, Molleston J P, Scheimann A O, Murray K F, Abrams S H, Rosenthal P, Sanyal A J, Robuck P R, Brunt E M, Unalp A and Tonascia J (2010) Treatment of Nonalcoholic Fatty Liver Disease in Children: TONIC Trial Design. Contemp Clin Trials 31:62-70.

Lazo M and Clark J M (2008) The Epidemiology of Nonalcoholic Fatty Liver Disease: a Global Perspective. Semin Liver Dis 28:339-350.

Leclercq I, Horsmans Y, Desager J P, Delzenne N and Geubel A P (1998) Reduction in Hepatic Cytochrome P-450 Is Correlated to the Degree of Liver Fat Content in Animal Models of Steatosis in the Absence of Inflammation. J Hepatol 28:410-416.

Leclercq I, Horsmans Y, Desager J P, Pauwels S and Geubel A P (1999) Dietary Restriction of Energy and Sugar Results in a Reduction in Human Cytochrome P450 2E1 Activity. Br J Nutr 82:257-262.

Lee TY, Chang H H, Lo W C and Lin H C (2010) Alleviation of Hepatic Oxidative Stress by Chinese Herbal Medicine Yin-Chen-Hao-Tang in Obese Mice With Steatosis. Int J Mol Med 25:837-844.

174

Li W and Kong A N (2009) Molecular Mechanisms of Nrf2-Mediated Antioxidant Response. Mol Carcinog 48:91-104.

Lickteig, A. J. Dissertation: Drug Metabolizing Enzyme, Drug Transporter Expression and Drug Disposition are Altered in Models of Inflammatory Liver Disease. 2007. Ref Type: Generic

Lickteig AJ, Fisher C D, Augustine L M and Cherrington N J (2007) Genes of the Antioxidant Response Undergo Upregulation in a Rodent Model of Nonalcoholic Steatohepatitis. J Biochem Mol Toxicol 21:216-220.

Lieber CS, Leo M A, Mak K M, Xu Y, Cao Q, Ren C, Ponomarenko A and DeCarli L M (2004) Model of Nonalcoholic Steatohepatitis. Am J Clin Nutr 79:502-509.

Liston HL, Markowitz J S and DeVane C L (2001) Drug Glucuronidation in Clinical Psychopharmacology. J Clin Psychopharmacol 21:500-515.

Lizardi-Cervera J, Laparra D I, Chavez-Tapia N C, Ostos M E and Esquivel M U (2006) [Prevalence of NAFLD and Metabolic Syndrome in Asymtomatics Subjects]. Rev Gastroenterol Mex 71:453-459.

Loomba R, Sirlin C B, Schwimmer J B and Lavine J E (2009) Advances in Pediatric Nonalcoholic Fatty Liver Disease. Hepatology 50:1282-1293.

Lu SC (2009) Regulation of Glutathione Synthesis. Mol Aspects Med 30:42-59.

Lu Y and Cederbaum A I (2008) CYP2E1 and Oxidative Liver Injury by Alcohol. Free Radic Biol Med 44:723-738.

Ludwig J, Viggiano T R, McGill D B and Oh B J (1980) Nonalcoholic Steatohepatitis: Mayo Clinic Experiences With a Hitherto Unnamed Disease. Mayo Clin Proc 55:434- 438.

Machado M, Marques-Vidal P and Cortez-Pinto H (2006) Hepatic Histology in Obese Patients Undergoing Bariatric Surgery. J Hepatol 45:600-606.

Maclaren NK, Gujral S, Ten S and Motagheti R (2007) Childhood Obesity and Insulin Resistance. Cell Biochem Biophys 48:73-78.

175

Mo SL, Liu Y H, Duan W, Wei M Q, Kanwar J R and Zhou S F (2009) Substrate Specificity, Regulation, and Polymorphism of Human Cytochrome P450 2B6. Curr Drug Metab 10:730-753.

Mofrad P, Contos M J, Haque M, Sargeant C, Fisher R A, Luketic V A, Sterling R K, Shiffman M L, Stravitz R T and Sanyal A J (2003) Clinical and Histologic Spectrum of Nonalcoholic Fatty Liver Disease Associated With Normal ALT Values. Hepatology 37:1286-1292.

Mofrad PS and Sanyal A J (2003) Nonalcoholic Fatty Liver Disease. MedGenMed 5:14.

Moran JR, Ghishan F K, Halter S A and Greene H L (1983) Steatohepatitis in Obese Children: a Cause of Chronic Liver Dysfunction. Am J Gastroenterol 78:374-377.

Morgan ET (2001) Regulation of Cytochrome P450 by Inflammatory Mediators: Why and How? Drug Metab Dispos 29:207-212.

Mottin CC, Moretto M, Padoin A V, Swarowsky A M, Toneto M G, Glock L and Repetto G (2004) The Role of Ultrasound in the Diagnosis of Hepatic Steatosis in Morbidly Obese Patients. Obes Surg 14:635-637.

Nakamuta M, Kohjima M, Morizono S, Kotoh K, Yoshimoto T, Miyagi I and Enjoji M (2005) Evaluation of Fatty Acid Metabolism-Related Gene Expression in Nonalcoholic Fatty Liver Disease. Int J Mol Med 16:631-635.

Nebert DW and Russell D W (2002) Clinical Importance of the Cytochromes P450. Lancet 360:1155-1162.

Neuschwander-Tetri BA and Caldwell S H (2003) Nonalcoholic Steatohepatitis: Summary of an AASLD Single Topic Conference. Hepatology 37:1202-1219.

Neyrinck A, Eeckhoudt S L, Meunier C J, Pampfer S, Taper H S, Verbeeck R K and Delzenne N (1999) Modulation of Paracetamol Metabolism by Kupffer Cells: a Study on Rat Liver Slices. Life Sci 65:2851-2859.

Nobili V, Marcellini M, Devito R, Ciampalini P, Piemonte F, Comparcola D, Sartorelli M R and Angulo P (2006) NAFLD in Children: a Prospective Clinical-Pathological Study and Effect of Lifestyle Advice. Hepatology 44:458-465.

Nowell S and Falany C N (2006) Pharmacogenetics of Human Cytosolic Sulfotransferases. Oncogene 25:1673-1678.

Oh MK, Winn J and Poordad F (2008) Review Article: Diagnosis and Treatment of Non- Alcoholic Fatty Liver Disease. Aliment Pharmacol Ther 28:503-522.

Orellana M, Rodrigo R, Varela N, Araya J, Poniachik J, Csendes A, Smok G and Videla L A (2006) Relationship Between in Vivo Chlorzoxazone Hydroxylation, Hepatic Cytochrome P450 2E1 Content and Liver Injury in Obese Non-Alcoholic Fatty Liver Disease Patients. Hepatol Res 34:57-63.

176

Osabe M, Sugatani J, Fukuyama T, Ikushiro S, Ikari A and Miwa M (2008) Expression of Hepatic UDP-Glucuronosyltransferase 1A1 and 1A6 Correlated With Increased Expression of the Nuclear Constitutive Androstane Receptor and Peroxisome Proliferator-Activated Receptor Alpha in Male Rats Fed a High-Fat and High-Sucrose Diet. Drug Metab Dispos 36:294-302.

Pastore A, Federici G, Bertini E and Piemonte F (2003) Analysis of Glutathione: Implication in Redox and Detoxification. Clin Chim Acta 333:19-39.

Patton HM, Sirlin C, Behling C, Middleton M, Schwimmer J B and Lavine J E (2006) Pediatric Nonalcoholic Fatty Liver Disease: a Critical Appraisal of Current Data and Implications for Future Research. J Pediatr Gastroenterol Nutr 43:413-427.

Pettinelli P, Del P T, Araya J, Rodrigo R, Araya A V, Smok G, Csendes A, Gutierrez L, Rojas J, Korn O, Maluenda F, Diaz J C, Rencoret G, Braghetto I, Castillo J, Poniachik J and Videla L A (2009) Enhancement in Liver SREBP-1c/PPAR-Alpha Ratio and Steatosis in Obese Patients: Correlations With Insulin Resistance and N-3 Long-Chain Polyunsaturated Fatty Acid Depletion. Biochim Biophys Acta 1792:1080-1086.

Pi J, Leung L, Xue P, Wang W, Hou Y, Liu D, Yehuda-Shnaidman E, Lee C, Lau J, Kurtz T W and Chan J Y (2010) Deficiency in the Nuclear Factor E2-Related Factor-2 Transcription Factor Results in Impaired Adipogenesis and Protects Against Diet- Induced Obesity. J Biol Chem 285:9292-9300.

Preiss D and Sattar N (2008) Non-Alcoholic Fatty Liver Disease: an Overview of Prevalence, Diagnosis, Pathogenesis and Treatment Considerations. Clin Sci (Lond) 115:141-150.

Rencurel F, Foretz M, Kaufmann M R, Stroka D, Looser R, Leclerc I, da S, X, Rutter G A, Viollet B and Meyer U A (2006) Stimulation of AMP-Activated Protein Kinase Is Essential for the Induction of Drug Metabolizing Enzymes by Phenobarbital in Human and Mouse Liver. Mol Pharmacol 70:1925-1934.

Rencurel F, Stenhouse A, Hawley S A, Friedberg T, Hardie D G, Sutherland C and Wolf C R (2005) AMP-Activated Protein Kinase Mediates Phenobarbital Induction of CYP2B Gene Expression in Hepatocytes and a Newly Derived Human Hepatoma Cell Line. J Biol Chem 280:4367-4373.

Reynaert H, Geerts A and Henrion J (2005) Review Article: the Treatment of Non- Alcoholic Steatohepatitis With Thiazolidinediones. Aliment Pharmacol Ther 22:897-905.

Roberts EA (2007) Pediatric Nonalcoholic Fatty Liver Disease (NAFLD): a "Growing" Problem? J Hepatol 46:1133-1142.

Roe AL, Howard G, Blouin R and Snawder J E (1999) Characterization of Cytochrome P450 and Glutathione S-Transferase Activity and Expression in Male and Female Ob/Ob Mice. Int J Obes Relat Metab Disord 23:48-53.

177

Roth A, Looser R, Kaufmann M, Blattler S M, Rencurel F, Huang W, Moore D D and Meyer U A (2008a) Regulatory Cross-Talk Between Drug Metabolism and Lipid Homeostasis: Constitutive Androstane Receptor and Pregnane X Receptor Increase Insig-1 Expression. Mol Pharmacol 73:1282-1289.

Roth A, Looser R, Kaufmann M and Meyer U A (2008b) Sterol Regulatory Element Binding Protein 1 Interacts With Pregnane X Receptor and Constitutive Androstane Receptor and Represses Their Target Genes. Pharmacogenet Genomics 18:325-337.

Rubio A, Guruceaga E, Vazquez-Chantada M, Sandoval J, Martinez-Cruz L A, Segura V, Sevilla J L, Podhorski A, Corrales F J, Torres L, Rodriguez M, Aillet F, Ariz U, Arrieta F M, Caballeria J, Martin-Duce A, Lu S C, Martinez-Chantar M L and Mato J M (2007) Identification of a Gene-Pathway Associated With Non-Alcoholic Steatohepatitis. J Hepatol 46:708-718.

Schwimmer JB, Deutsch R, Kahen T, Lavine J E, Stanley C and Behling C (2006) Prevalence of Fatty Liver in Children and Adolescents. Pediatrics 118:1388-1393.

Schwimmer JB, McGreal N, Deutsch R, Finegold M J and Lavine J E (2005) Influence of Gender, Race, and Ethnicity on Suspected Fatty Liver in Obese Adolescents. Pediatrics 115:e561-e565.

Sharma A, Bartell S M, Baile C A, Chen B, Podolsky R H, McIndoe R A and She J X (2010) Hepatic Gene Expression Profiling Reveals Key Pathways Involved in Leptin- Mediated Weight Loss in Ob/Ob Mice. PLoS One 5.

Shedlofsky SI, Israel B C, McClain C J, Hill D B and Blouin R A (1994) Endotoxin Administration to Humans Inhibits Hepatic Cytochrome P450-Mediated Drug Metabolism. J Clin Invest 94:2209-2214.

Shen G and Kong A N (2009) Nrf2 Plays an Important Role in Coordinated Regulation of Phase II Drug Metabolism Enzymes and Phase III Drug Transporters. Biopharm Drug Dispos 30:345-355.

Shin S, Wakabayashi J, Yates M S, Wakabayashi N, Dolan P M, Aja S, Liby K T, Sporn M B, Yamamoto M and Kensler T W (2009) Role of Nrf2 in Prevention of High-Fat Diet- Induced Obesity by Synthetic Triterpenoid CDDO-Imidazolide. Eur J Pharmacol 620:138-144.

Skouby SO (2010) Hormonal Contraception in Obesity, the Metabolic Syndrome, and Diabetes. Ann N Y Acad Sci 1205:240-244.

178

Sorrentino P, Tarantino G, Conca P, Perrella A, Terracciano M L, Vecchione R, Gargiulo G, Gennarelli N and Lobello R (2004) Silent Non-Alcoholic Fatty Liver Disease-a Clinical-Histological Study. J Hepatol 41:751-757.

Stepanova M, Hossain N, Afendy A, Perry K, Goodman Z D, Baranova A and Younossi Z (2010) Hepatic Gene Expression of Caucasian and African-American Patients With Obesity-Related Non-Alcoholic Fatty Liver Disease. Obes Surg 20:640-650.

Sugatani J, Wada T, Osabe M, Yamakawa K, Yoshinari K and Miwa M (2006) Dietary Inulin Alleviates Hepatic Steatosis and Xenobiotics-Induced Liver Injury in Rats Fed a High-Fat and High-Sucrose Diet: Association With the Suppression of Hepatic Cytochrome P450 and Hepatocyte Nuclear Factor 4alpha Expression. Drug Metab Dispos 34:1677-1687.

Suh YH, Kim Y, Bang J H, Choi K S, Lee J W, Kim W H, Oh T J, An S and Jung M H (2005) Analysis of Gene Expression Profiles in Insulin-Sensitive Tissues From Pre- Diabetic and Diabetic Zucker Diabetic Fatty Rats. J Mol Endocrinol 34:299-315.

Tanaka E, Terada M and Misawa S (2000) Cytochrome P450 2E1: Its Clinical and Toxicological Role. J Clin Pharm Ther 25:165-175.

Tanaka N, Ichijo T, Okiyama W, Mutou H, Misawa N, Matsumoto A, Yoshizawa K, Tanaka E and Kiyosawa K (2006) Laparoscopic Findings in Patients With Nonalcoholic Steatohepatitis. Liver Int 26:32-38.

Tarantino G, Di Minno M N and Capone D (2009) Drug-Induced Liver Injury: Is It Somehow Foreseeable? World J Gastroenterol 15:2817-2833.

Thampanitchawong P and Piratvisuth T (1999) Liver Biopsy:Complications and Risk Factors. World J Gastroenterol 5:301-304.

Tiniakos DG, Vos M B and Brunt E M (2010) Nonalcoholic Fatty Liver Disease: Pathology and Pathogenesis. Annu Rev Pathol 5:145-171.

Uslusoy HS, Nak S G, Gulten M and Biyikli Z (2009) Non-Alcoholic Steatohepatitis With Normal Aminotransferase Values. World J Gastroenterol 15:1863-1868.

Videla LA, Rodrigo R, Orellana M, Fernandez V, Tapia G, Quinones L, Varela N, Contreras J, Lazarte R, Csendes A, Rojas J, Maluenda F, Burdiles P, Diaz J C, Smok G,

179

Thielemann L and Poniachik J (2004) Oxidative Stress-Related Parameters in the Liver of Non-Alcoholic Fatty Liver Disease Patients. Clin Sci (Lond) 106:261-268.

Watson AM, Poloyac S M, Howard G and Blouin R A (1999) Effect of Leptin on Cytochrome P-450, Conjugation, and Antioxidant Enzymes in the Ob/Ob Mouse. Drug Metab Dispos 27:695-700.

Weltman MD, Farrell G C, Hall P, Ingelman-Sundberg M and Liddle C (1998) Hepatic Cytochrome P450 2E1 Is Increased in Patients With Nonalcoholic Steatohepatitis. Hepatology 27:128-133.

Weltman MD, Farrell G C and Liddle C (1996) Increased Hepatocyte CYP2E1 Expression in a Rat Nutritional Model of Hepatic Steatosis With Inflammation. Gastroenterology 111:1645-1653.

Wieckowska A and Feldstein A E (2008) Diagnosis of Nonalcoholic Fatty Liver Disease: Invasive Versus Noninvasive. Semin Liver Dis 28:386-395.

Wieckowska A, Papouchado B G, Li Z, Lopez R, Zein N N and Feldstein A E (2008) Increased Hepatic and Circulating Interleukin-6 Levels in Human Nonalcoholic Steatohepatitis. Am J Gastroenterol 103:1372-1379.

Williams JA, Hyland R, Jones B C, Smith D A, Hurst S, Goosen T C, Peterkin V, Koup J R and Ball S E (2004) Drug-Drug Interactions for UDP-Glucuronosyltransferase Substrates: a Pharmacokinetic Explanation for Typically Observed Low Exposure (AUCi/AUC) Ratios. Drug Metab Dispos 32:1201-1208.

Yamazaki Y, Kakizaki S, Horiguchi N, Sohara N, Sato K, Takagi H, Mori M and Negishi M (2007) The Role of the Nuclear Receptor Constitutive Androstane Receptor in the Pathogenesis of Non-Alcoholic Steatohepatitis. Gut 56:565-574.

Yoneda M, Endo H, Mawatari H, Nozaki Y, Fujita K, Akiyama T, Higurashi T, Uchiyama T, Yoneda K, Takahashi H, Kirikoshi H, Inamori M, Abe Y, Kubota K, Saito S, Kobayashi N, Yamaguchi N, Maeyama S, Yamamoto S, Tsutsumi S, Aburatani H, Wada K, Hotta K and Nakajima A (2008) Gene Expression Profiling of Non-Alcoholic Steatohepatitis Using Gene Set Enrichment Analysis. Hepatol Res 38:1204-1212.

Yoshinari K, Takagi S, Sugatani J and Miwa M (2006) Changes in the Expression of Cytochromes P450 and Nuclear Receptors in the Liver of Genetically Diabetic Db/Db Mice. Biol Pharm Bull 29:1634-1638.

180

Younossi ZM, Baranova A, Ziegler K, Del G L, Schlauch K, Born T L, Elariny H, Gorreta F, VanMeter A, Younoszai A, Ong J P, Goodman Z and Chandhoke V (2005a) A Genomic and Proteomic Study of the Spectrum of Nonalcoholic Fatty Liver Disease. Hepatology 42:665-674.

Younossi ZM, Gorreta F, Ong J P, Schlauch K, Del G L, Elariny H, Van M A, Younoszai A, Goodman Z, Baranova A, Christensen A, Grant G and Chandhoke V (2005b) Hepatic Gene Expression in Patients With Obesity-Related Non-Alcoholic Steatohepatitis. Liver Int 25:760-771.

Zhai Y, Wada T, Zhang B, Khadem S, Ren S, Kuruba R, Li S and Xie W (2010) A Functional Cross-Talk Between Liver X Receptor-Alpha and Constitutive Androstane Receptor Links Lipogenesis and Xenobiotic Responses. Mol Pharmacol 78:666-674.

Zhang DD (2006) Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab Rev 38:769-789.

Zhang WV, Ramzan I and Murray M (2007) Impaired Microsomal Oxidation of the Atypical Antipsychotic Agent Clozapine in Hepatic Steatosis. J Pharmacol Exp Ther 322:770-777.

Zhou SF (2008) Drugs Behave As Substrates, Inhibitors and Inducers of Human Cytochrome P450 3A4. Curr Drug Metab 9:310-322.

Zhou SF, Chan E, Zhou Z W, Xue C C, Lai X and Duan W (2009) Insights into the Structure, Function, and Regulation of Human Cytochrome P450 1A2. Curr Drug Metab.

181

Tables Activity Protein mRNA

CYP1A2 Source Diagnosis Model Study Mouse  not reported ob/ob at 12 weeks Watson et al. 1999  not reported ob/ob at 16 weeks Barnett et al. 1992 not reported Male ob/ob at 8 months Roe et al. 1999 not reported Female ob/ob at 4 and 8 months Roe et al. 1999  not reported db/db at 10 weeks Yoshinari et al. 2006 not reported 45% fat for 6 months Koide et al. 2010  Steatosis 60% fat for 8 weeks Kirpich et al. 2009  NASH MCD for 8 weeks Fisher et al. 2008 Rat  not reported Obese Zucker at 12 weeks Suh et al. 2005  not reported High fat (details not reported) Hanagama et al. 2007  Steatosis 18% butter for 8 weeks Lickteig, 2007  not reported 65% fat for 8 weeks Osabe et al. 2007  Steatosis Orotic acid Zhang et al. 2007  NASH MCD for 8 weeks Lickteig, 2007 Human  Steatosis Greco et al. 2008  Steatosis Donato et al. 2006  Progression of NAFLD Fisher et al. 2009

Activity Protein mRNA

CYP2A6 Source Diagnosis Model Study Mouse  ob/ob at 12 weeks Watson et al. 1999 Rat  MCD for 4 weeks Weltman et al. 1996 Human Progression of NAFLD Fisher et al. 2009  NASH Rubio et al. 2007

Activity Protein mRNA

CYP2B6 Source Diagnosis Model Study Mouse  Steatosis Male ob/ob at 11 weeks Cheng et al. 2008  Steatosis Female ob/ob at 11 weeks Cheng et al. 2008  not reported ob/ob at 12 weeks Watson et al. 1999  not reported ob/ob at 16 weeks Barnett et al. 1992 not reported db/db @ 10 weeks Yoshinari et al. 2006  Steatosis 60% fat for 8 weeks Kirpich et al. 2009  NASH MCD for 8 weeks Fisher et al. 2008 Human Progression of NAFLD Fisher et al. 2009  NASH (Caucasians) Stepanova et al. 2010  NASH vs steatosis Yoneda et al. 2008

182

Activity Protein mRNA

CYP2C Source Isoform Diagnosis Model Study Mouse total 2C  not reported db/db at 10 weeks Yoshinari et al. 2006 2C29  not reported db/db at 10 weeks Yoshinari et al. 2006 Rat 2C11  not reported Obese Zucker at 14‐16 weeks Kim et al. 2004a 2C11  not reported High fat (details not reported) Hanagam et al. 2007 2C11  Steatosis 18% butter diet for 8 weeks Lickteig, 2007 2C11  Steatosis Orotic acid Zhang et al. 2007 2C11  Steatosis MCD for 4 weeks Weltman et al. 1999 2C11  NASH MCD for 8 weeks Lickteig, 2007 2C39  not reported Obese Zucker for 6 weeks Suh et al. 2005 2C39  not reported Obese Zucker for 12 weeks Suh et al. 2005 Human 2C8 Progression of NAFLD Fisher et al. 2009 2C9  Progression of NAFLD Fisher et al. 2009 2C19  Progression of NAFLD Fisher et al. 2009

183

Activity Protein mRNA

CYP2E1 Source Diagnosis Model Study Mouse  Steatosis Male ob/ob at 11 weeks Cheng et al. 2008  Steatosis Female ob/ob at 11 weeks Cheng et al. 2008  not reported ob/ob at 12 weeks Watson et al. 1999  not reported ob/ob at 16 weeks Barnett et al. 1992 not reported male ob/ob at 4 or 8 months Roe et al. 1999 not reported female ob/ob at 4 or 8 months Roe et al. 1999 not reported ob/ob (age not reported) Enriquez et al. 1999  not reported db/db at 10 weeks Yoshinari et al. 2006  NAFLD (undifferentiated) Intragastric overfeeding Deng et al. 2005  Steatosis 41% fat for 4 months Ito et al. 2006  Steatosis and NASH 60% fat for 10, 19, 34, or 50 weeks Ito et al. 2007 Rat not reported Obese Zucker (age not reported) Enriquez et al. 1999 not reported Obese Zucker at 4 months Khemawoot et al. 2006  not reported 8.6% (w/w) fat for 3 months Khemawoot et al. 2006  Steatosis vs NASH 35% or 71% fat for 3 weeks Lieber et al. 2004  not reported 65% fat for 8 weeks Osabe et al. 2007 Steatosis and NASH MCD for 4 weeks Weltman et al. 1996  Steatosis vs NASH Orotic acid Zhang et al. 2007 Human  NAFLD (undifferentiated) Kohjima et al. 2007  NAFLD (undifferentiated) Nakamuta et al. 2005  Steatosis Donato et al. 2006  Steatosis Emery et al. 2003  Dietary restriction Leclercq et al. 1999  Bariatric surgery (Steatosis) Bell et al. 2010 Progression of NAFLD Fisher et al. 2009  Steatosis vs NASH Chtioui et al. 2007  NASH Weltman et al. 1998  NASH Chalasani et al. 2003 NASH Orellana et al. 2005 NASH Orellana et al. 2005 * intially elevated, then decreased ** results have been reversed, due to the nature of the study

184

Activity Protein mRNA

CYP3A Source Diagnosis Model Study Mouse  Steatosis Male ob/ob at 11 weeks Cheng et al. 2008  Steatosis Female ob/ob at 11 weeks Cheng et al. 2008  not reported ob/ob at 12 weeks Watson et al. 1999  not reported ob/ob at 16 weeks Barnett et al. 1992  not reported ob/ob at 4 or 8 months Roe et al. 1999  not reported db/db at 10 weeks Yoshinari et al. 2006  Steatosis 36% fat for 12 weeks Kim et al. 2004b  not reported 45% fat for 6 months Koide et al. 2010  Steatosis 60% fat for 8 weeks Kirpich et al. 2009  NASH MCD for 8 weeks Fisher et al. 2008 Rat  not reported Obese Zucker at 6 weeks Suh et al. 2005  not reported Obese Zucker at 12 weeks Suh et al. 2005  not reported Obese Zucker at 14 weeks Kim et al. 2004a  not reported High fat (details not reported) Hangama et al. 2007  not reported 65% fat for 8 weeks Osabe et al. 2007  Steatosis Orotic acid Zhang et al. 2007  Steatosis MCD for 4 weeks Weltman et al. 1996 Human Progression of NAFLD Fisher et al. 2009  NAFLD Bell et al. 2010  Hepatocytes Donato et al. 2006  Steatosis Donato et al. 2007  NASH Weltman et al. 1998

185

Activity Protein mRNA

UGT/SULT Source Diagnosis/Model Enzyme Reference Mouse Male ob/ob at 11 weeks Sult2a1/2  Cheng et al. 2008 Female ob/ob at 11 weeks Sult2a1/2  ob/ob at 12 weeks UGT  Watson et al. 1999 45% fat for 6 months Sult2a1 Koide et al. 2010 Sult1a1  Ugt1a  Ugt2b  60% fat for 8 weeks Ugt1a9  Kirpich et al. 2009 Ugt2b1  Rat Obese Zucker at 14‐16 weeks Ugt1A1  Kim et al. 2004a Ugt1A6  Ugt2B1  Obese Zucker at 6 months SULT  Chaudhary et al. 1993 UGT  65% fat for 8 weeks Ugt1A1  Osabe et al. 2007 Ugt1A6  Ugt1A7  Ugt2B1  Human African Americans with NASH SULT1A1  Stepanova et al. 2010 NASH SULT1A2  Younissi et al. 2005a

186

Activity Protein mRNA

Glutathione Source Diagnosis/Model Enzyme Reference Mouse ob/ob at 12 weekstGST  Watson et al. 1999 tGSH  ob/ob at 16 weekstGST  Barnett et al. 1992 tGSH  ob/ob at 17 weeks GSTA1, A2  Sharma et al. 2010 male ob/ob at 4 and 8 months tGST  Roe et al. 1999 36% fat for 12 weeksGstm2, m6  Kim et al. 2004b GCLC  41% fat for 4 months tGSH  Ito et al. 2006 45% fat for 6 monthes tGST  Koide et al. 2010 59% fat for 15 weeksGstm1  Lee et al. 2010 GSH:GSSG  60% fat for 8 weeks GSTA1, A2, A4  Kirpich et al. 2009 GSTM1, M3, M6  GstP1  60% fat for 34 and 50 weeks tGSH  Ito et al. 2007 Rat Obese Zucker at 14‐16 weeks GSTA2  Kim et al. 2004a Obese Zucker at 5‐6 monthstGST  Chaudhary et al. 1993 GCL  tGSH  MCD diet for 8 weeks GCLC  Lickteig et al. 2007 Human Steatosis GSTM1, M2, M4, M5  Younissi et al. 2005a NAFLD (undifferentiated) GSS  Kohjima et al. 2007 Steatosis and NASH tGSH  Videla et al. 2004 NASH vs steatosis GSTM1  Yoneda et al. 2008 NASH GSTA4  Younissi et al. 2005b NASH GSTM4, M5  Rubio et al. 2007 Afr. Amer. with NASH GSTM2, M4, M5  Stepanova et al. 2010 (compared to Cauc. with NASH) Progression of NAFLDtGSTA  Hardwick et al. 2010 GSTA1, A2, A4  tGSTM  GSTM1, M3  tGSTP  GSTP1  GCLC  GCLM  tGST  GSH:GSSG 

187

APPENDIX E:

ACETAMINOPHEN DISPOSITION:

METABOLOMIC BIOMARKER FOR NON-ALCOHOLIC FATTY LIVER DISEASE

Matthew D. Merrell*, Sarah B. Campion#, Jose E. Manautou#, H. Hesham A-Kader†,

Robert P. Erickson†, Nathan J. Cherrington*

*University of Arizona, Department of Pharmacology and Toxicology, † University of

Arizona, Department of Pediatrics, #University of Connecticut, School of Pharmacy

Abstract

Non-alcoholic fatty liver disease (NAFLD) includes a range of pathologies from simple

steatosis to steatohepatitis (NASH). Researchers estimate the prevalence of NAFLD to

be 20-25% and NASH at 2% of the US population. NAFLD has been linked to obesity

and with childhood obesity rates increasing drastically, the number of children with

severe liver disorders continues to grow. One obstacle to proper treatment is the inability

of clinicians to easily distinguish between the stages of simple steatosis and NASH.

Currently, needle biopsy is the only conclusive method of diagnosing and staging

NAFLD. A key concern with NASH is the possibility that altered hepatic function could

interfere with proper elimination of therapeutic drugs leading to toxicity. Previous work

from our laboratory using a rodent model of NASH indicated changes in the disposition

of acetaminophen (APAP) metabolites, where an increase in the expression of the

sinusoidal efflux transporter Abcc3 (Mrp3) leads to elevated plasma and urinary levels of

APAP-glucuronide. The current study was conducted to determine whether human

NAFLD also results in altered disposition of APAP and APAP metabolites. Adolescent

188

patients with steatosis or NASH, and normal patients, were given a single 1000 mg dose

of APAP. Blood and urine samples were collected over time and the levels of APAP and

APAP metabolites were determined by HPLC. As with the rodent model of NASH,

patients with the more severe disease had significantly increased plasma and urinary

levels of APAP-glucuronide. These findings demonstrate the validity of the NASH animal

model, and present the possibility of a non-invasive diagnostic tool for the advanced

stages of NAFLD.

Introduction

Non-alcoholic Fatty Liver Disease (NAFLD) is the most prevalent chronic liver

disease in both the US and many other industrialized nations (Wieckowska and

Feldstein, 2008). Although initially described almost 30 years ago, the true scope of the

disease has only recently been understood. NAFLD encompasses a number of

progressive disease stages, linked by the presence of hepatocellular lipid accumulation.

The full spectrum of the disorder ranges from simple steatosis to non-alcoholic

steatohepatitis (NASH), progressive fibrosis, cirrhosis, and even hepatocellular

carcinoma (Starley et al., 2010).

NAFLD is the hepatic component of the metabolic syndrome and as such, is

closely linked with obesity and insulin resistance. The number of American with these

three conditions (NAFLD, IR, obesity) has increased dramatically in the last few

decades, and is still on the rise. In 2008, the prevalence of obese adults [body mass

index (BMI) > 30 kg/m2] in the US was approximately 32% (Flegal et al., 2010) and is projected to reach more than 50% by 2030 (Wang et al., 2008). Similarly, the prevalence of diabetes in the U.S. is estimated to increase from 14% in 2007 up to 33% by 2050

189

(Boyle et al., 2010). The prevalence of NAFLD is estimated to be between 20% and

30%, and though once thought an adult disease, it is now known to afflict children as well (Wieckowska and Feldstein, 2008).

Steatosis occurs due to a dysregulation of triglycerides synthesis and transport leading to an accumulation of triglycerides in the hepatocytes. This steatosis does not universally result in liver injury, and cytokine and adipokine signaling has been implicated in the progression from steatosis to NASH. These oxidative and metabolic stresses, along with disease-induced inflammatory signaling, eventually result in hepatocyte death leading to additional inflammatory signaling, activation of hepatic stellate cells, and progressive fibrosis (Jou et al., 2008).

It is now recognized that NAFLD frequently affects children and has been increasingly recognized as an important pediatric liver disorder (Schwimmer et al.,

2006;Patton et al., 2006;Lavine et al., 2010). NASH as a cause of chronic liver dysfunction in obese children was first reported in the early 1980s (Moran et al., 1983) and the full spectrum of NAFLD has been observed in this population (Kader et al.,

2008). In pediatric patients, the prevalence of NAFLD is estimated to be 9.6%, and the rate is higher among adolescents (17.3%) than infants (0.7%) (Schwimmer et al., 2006).

Histologically, NASH livers display centrilobular steatosis, lobular inflammation, and hepatocellular damage appearing as ballooning degeneration, Mallory-Denk bodies, apoptosis, and/or necrosis (Tiniakos et al., 2010). Centrilobular fibrosis may also be observed in NASH, and can progress to portal and periportal regions, leading to bridging fibrosis and cirrhosis. In comparison with the adult disease, pediatric NASH pathology

(including steatosis, inflammation, and fibrosis) may appear in periportal hepatocytes

(Schwimmer et al., 2005).

190

While the majority of NAFLD cases are the benign simple steatosis, the progression to NASH is increasingly recognized as significant increase in risk for hepatic morbidity and mortality. NASH is the most common cause of cryptogenic cirrhosis, and is reported to be the underlying cause of 10% of liver transplants (Preiss and Sattar,

2008). Furthermore, 30 to 50% of NASH patients may progress to cirrhosis within 10 years (Jou et al., 2008), and 13% of all hepatocellular carcinoma cases are estimated to arise from NAFLD (Marrero et al., 2002).

The treatment and study of NASH in both adults and children is hampered by the fact that NASH is severely underdiagnosed, due to the difficulty in staging the disease.

Currently, histological analysis of liver biopsies is the only definitive way to delineate patients with NASH from those with simple steatosis (Wieckowska and Feldstein, 2008).

This procedure carries with it a clearly unacceptable rate of serious complications, precluding its use as a screening tool. A number of noninvasive methods have been proposed, including serum markers and liver imaging, though issues with cost and effectiveness have precluded their widespread clinical use.

It has been well documented that NAFLD and especially NASH alter the expression of proteins involved in drug metabolism and disposition (Gomez-Lechon et al., 2009). We have previously reported that experimental NASH in a rat model alters drug transporter expression, resulting in a significant shift in the disposition of the acetaminophen (APAP) metabolite acetaminophen-glucuronide (APAP-gluc), from bile to blood and urine (Lickteig et al., 2007). This change is not seen in rodent models of steatosis, because the expression of the drug transporters is not altered. A similar difference in the disposition of APAP-gluc in human NASH patients may provide a useful diagnostic tool for clinicians.

191

Materials and Methods

Clinical subjects - Pediatric subjects (n=12) between the ages of 12 and 18 were recruited from a pool of NAFLD patients. All patients had undergone a prior liver biopsy as part of routine patient care. These biopsies were used to establish two distinct groups of patients (simple steatosis and NASH) based on the severity of three characteristics of

NAFLD, including steatosis, fibrosis, and inflammation.

In addition to the previously described NAFLD patients, pediatric subjects (n=12) between the ages of 12 and 18 were recruited from a panel of non-NAFLD patients.

Many of these subjects were patients with constipation or abdominal pain without

NAFLD. All patients and their legal guardians were approached during regular office visits, and consent informed consent received.

To participate in the current study, each subject passed a screening evaluation based on medical history and physical examination. For further detail, see inclusion and exclusion criteria (Table 1). Inclusion and exclusion criteria were applied to non-NAFLD participants as well, with the obvious exception of NAFLD diagnosis.

Visit procedures - Subjects arrived at the Clinical and Translational Science

Center on the morning of the study after an overnight fast. Subjects were advised to avoid any product containing APAP for at least three days prior to study participation.

Approximately 7cc of blood were collected in 2 separate tubes, one of which was immediately sent for serum biochemistry analysis. The second blood sample and an initial urine sample were used as blank samples in the quantification of serum APAP levels by HPLC.

192

Table 1

Inclusion criteria:

• Liver biopsy indicating either simple steatosis or NASH

• Age 12-18

• Informed consent and assent

Exclusion criteria:

• History of significant alcohol consumption (> 20 g/d)

• Clinical or histological evidence of cirrhosis

• Evidence of other chronic liver disease (ie Dubin-Johnson syndrome)

• Presence of the hepatitis B virus surface antigen or hepatitis C virus antibodies

• Use of drugs historically associated with NAFLD

• Use of anti-NAFLD drugs in the three months prior to enrollment in this study

• Pregnancy or breastfeeding

• Absence of indicators of puberty

• History of renal dysfunction

• Other disease or conditions considered by the physician to be significant

Following these baseline collections of blood and urine, subjects were given one oral dose of 1000 mg APAP (McNeil Consumer Healthcare; Fort Washington, PA).

Subjects were allowed access to food and water during the four hour study. Blood and urine were collected at 1, 2, and 4 hours by the attending nursing staff. Approximately 7 cc of blood were collected at each time point into a serum-separator vacutainer tube

(BD; Franklin Lakes, NJ). Samples were allowed to clot, and centrifuged to obtain the

193

serum fraction. Each sample was subdivided into multiple aliquots to avoid excessive

freeze/thaw cycles. The plasma and urine samples for HPLC analysis will be stored at -

80° C.

HPLC Methods - Acetaminophen (APAP) and its metabolites (APAP-gluc, APAP- sulfate) were analyzed under high performance liquid chromatography conditions as previously published by our laboratory (Lickteig et al., 2007) .

Statistics - Statistical differences between patient groups at each time point were determined using a one-way analysis of variance followed by a Duncan's multiple range post-hoc test. The level of significance was set at p ≤ 0.05.

Results

Table 2 displays the results of serum biochemistry tests of the blood samples taken at the time of the study. Analysis of hepatic function were measured, including total serum protein, serum albumin, conjugated (direct) and total bilirubin, alkaline phosphatase (ALP), aspartate transaminase (AST), alanine transaminase (ALT). One patient exhibited mild hyperbilirubinemia and elevated serum proteins. Elevated serum

AST were observed in two NASH and two steatosis patients, and were accompanied by elevated ALT in three of the four cases.

Figure 1 shows the plasma concentrations of APAP and its major metabolites at each of the measured time points. No difference was observed in APAP plasma levels between the three groups at any time point. The levels of APAP-sulf were slightly, but not significantly, decreased in the NASH patients. APAP-gluc levels were significantly increased above both normal and steatosis patients at one hour following administration, and remained elevated compared to patients in the steatosis group over all time points measured.

194

Similar results were observed in the urinary levels of APAP and its metabolites.

As shown in Figure 2, the levels of both APAP and APAP-sulf were not significantly different between the three groups at any time point. As with the data from plasma samples, urinary levels of APAP-gluc were significantly increased in NASH patients compared to both steatosis and normal patients. Interestingly, this difference was not visible until 4 hours after dosing.

Discussion

As mentioned above, we have previously reported the effects of experimental

NASH on the disposition of APAP-gluc. In our previous study, dietary rat models of steatosis and NASH were administered APAP and measurements were made on the levels of APAP metabolites in the blood, bile, and urine over 90 minutes. A few important points should be noted. The subtoxic dose administered to rats was 151mg/kg, several times higher than the 1g dose used in this study (at least 4 times higher, depending on patient weight). Additionally, these human studies were performed over a much longer timeline (4 hours compared to 90 minutes). However, despite these experimental differences, the observed trends in both rodent and clinical NASH are remarkably similar, both in the elevation of APAP-gluc levels in the plasma of NASH patients compared to normal patients and in the absence of a similar increase in steatosis patients. This delineation between NASH and non-NASH (normal and steatosis) patients offers a potential biomarker of clear clinical utility.

Patients recruited for this study reflected the ethnic makeup of our patient pool, and more generally that of southern Arizona. Compared to nationwide demographics,

Hispanics were over-represented and African-Americans were underrepresented.

Interestingly, this ethnic representation actually reflects the reported ethnic differences in

195

NAFLD prevalence. NAFLD appears to be most common among Hispanic children, with a relatively moderate prevalence in non-Hispanic whites and a low prevalence in non-

Hispanic blacks (Loomba et al., 2009). Because of the impact that race and ethnicity have on the prevalence of both obesity and type 2 diabetes, the observed difference in

NAFLD prevalence between ethnic groups in not unexpected. Obesity and type 2 diabetes are both more prevalent among non-Hispanic black and Mexican-American patients when compared to non-Hispanic whites (Flegal et al., 2002;Flegal et al.,

2010;Harris et al., 2002). These factors have been shown to hold true in pediatric

NAFLD patients (Butte et al., 2005;Nobili et al., 2006;Fishbein et al., 2006;Perseghin et al., 2006;Mager and Roberts, 2006). Some reports have also indicated that, even after controlling for the severity of obesity, Hispanic boys and girls have higher rates of fatty liver than non-Hispanic peers (Schwimmer et al., 2008).

Acetaminophen provides an ideal probe substrate for in this study several reasons. 1) APAP has been used safely and effectively for many years to manage pain and fever in patients of all ages. While massive APAP overdose results in hepatotoxicity,

APAP is safe and well tolerated at recommended doses. APAP remains the most commonly used non-opioid analgesic and the standard antipyretic and analgesic agent against which most other similar products are compared. 2) APAP has a short plasma half-life (2.0-2.4 hours), while the half-life of APAP-gluc in normal patients is reported to be less than 4 hours (Gwilt et al., 1994). This rapid clearance allows the potential clinical test to be performed in a single office visit with minimal blood draws. 3) The metabolism and transport of APAP, the vast majority of which occurs in liver, is well defined. At least one-half of the standard administered dose is conjugated with glucuronic acid and one- third with sulfonate (Forrest et al., 1982). Importantly, these APAP metabolites require

196

efflux transport in order to be excreted from the hepatocyte, and can be detected in both bile and urine.

In vivo disposition studies and in vitro functional transport experiments indicate that the ABC transporters ABCC2, ABCC3, ABCC4 and ABCG2 each have the ability to transport a variety of unconjugated and conjugated drugs, including APAP metabolites. It is important to emphasize the distinctive location of these four transporters in hepatocytes, as well as their respective APAP metabolite substrates. ABCC2 and

ABCG2 are localized to the canalicular (apical) membrane of the hepatocyte, from which they excrete their substrates into the bile canaliculi. ABCC3 and ABCC4 are expressed at the sinusoidal (basolateral) membrane of hepatocytes and cholangiocytes from which they expel their substrates into the blood. In healthy livers, biliary excretion of the sulfate, glucuronide and gluathione conjugates of APAP is predominantly mediated by ABCC2, while ABCG2 appears also to contribute to excretion of APAP-sulf conjugates.

Sinusoidal excretion of the APAP-gluc metabolite from hepatocytes is predominantly mediated by ABCC3, while ABCC4 appears to mediate excretion of APAP-sulf metabolites. Recent studies indicate that ABCC3 and ABCC4 have an equal role in the efflux of APAP-sulf (Chen et al., 2003;Manautou et al., 2005;Konig et al., 1999;Keppler et al., 2000;Zamek-Gliszczynski et al., 2006c;Zamek-Gliszczynski et al., 2006b;Zamek-

Gliszczynski et al., 2006a)

Some researchers have suggested that significant changes in drug metabolism and pharmacokinetics may occur during puberty (Kennedy, 2008). Due to the frequent coordinated regulation of drug metabolizing enzymes and hepatic transporters, there is potential for puberty status to confound the results of this study. Unfortunately, there is a complete absence of published reports on the effects of puberty on hepatic transporter

197

expression, and a significant lack of information on the effects of puberty drug metabolizing enzymes. The greatest intra-individual variation in adolescent pharmacokinetics occurs near the onset of puberty (ages 9-13) (Kennedy, 2008), and many of the pharmacokinetic changes seen in adolescents appear to be due to changes in body size/composition and liver mass that accompany puberty. Based on our inclusion and exclusion criteria, all of the participating subjects (12-18 years of age) have entered puberty, limiting the potential for this confounding factor to influence our results.

As mentioned previously, current methods of distinguishing patients with steatosis from those with NASH lack the specificity and sensitivity to replace liver biopsy.

While the majority of NAFLD diagnoses are currently made on the basis of elevated aminotransferase levels, normal serum aminotransferase tests can be seen in patients with both steatosis and NASH (Mofrad et al., 2003;Ipekci et al., 2003). Furthermore, several investigators have reported that two-thirds of NASH patients may have normal aminotransferase levels at any given time (Oh et al., 2008;Delgado, 2008;Wieckowska and Feldstein, 2008). These and other studies (Lizardi-Cervera et al., 2006;Amarapurkar and Patel, 2004;Amarapurka et al., 2006;Chen et al., 2006;Fracanzani et al.,

2008;Sorrentino et al., 2004;Mofrad and Sanyal, 2003;Uslusoy et al., 2009) demonstrate the need for a more effective means of diagnosing NASH. The results from the current study also demonstrate the problem using with serum ALT as a marker for NASH.

Elevated ALT levels were observed in one patient without NASH while one patient with

NASH exhibited normal ALT levels (Table 2).

Several imaging techniques, including ultrasonography, computerized tomographic (CT) scanning, and magnetic resonance imaging (MRI), have successfully diagnosed lipid accumulation in NAFLD. Both MRI and CT scans are able to accurately

198

and quantitatively assess hepatic steatosis, yet the higher costs are prohibitive.

Conversely, the lower cost and accessibility of ultrasonography make it preferable to the other techniques, it is most sensitive in patients with >30% steatosis, but sensitivity and specificity significantly drops in cases with steatosis < 19% (Wieckowska and Feldstein,

2008). The most important limitation of these imaging methods is their inability to differentiate steatosis from NASH. An alternate technique, transient elastography, measures liver stiffness, and may be effective in measuring the level of hepatic fibrosis in later stages of NAFLD. However, decreased effectiveness in overweight and obese patients may limit the effectiveness of this technique in NAFLD (Foucher et al., 2006).

Histological analysis of a liver biopsy remains the gold standard in diagnosing

NAFLD, as it is able to assess steatosis, fibrosis, and inflammation, as well as changes in overall liver architecture (Wieckowska and Feldstein, 2008). However, the invasive nature of the technique precludes its use as a screening tool. Studies have indicated significant risks and complications associated with liver biopsies, including pain, major bleeding, and death. The clinical development of an APAP-gluc disposition test for

NASH may help indicate at risk patients for liver biopsy, or serve as a noninvasive means of tracking progression or treatment of the disease.

Several other liver diseases may be potential targets of an APAP-gluc diagnostic test. A key characteristic of any likely disease target is increased expression of the transporter ABCC3, which is responsible for hepatic efflux of APAP-gluc into the plasma

(Reisman et al., 2009). Increased expression of hepatic ABCC3 has been demonstrated in cholestasis (Cui et al., 2009) as well as in viral hepatitis (Ogasawara et al., 2010).

While no information is available on the effect of alcoholic or drug-induced steatohepatitis on ABCC3 expression, the induction of ABCC3 mRNA by both TNFα and

199

IL-6 cytokines indicate that any inflammatory liver disease may be alter APAP-gluc disposition (Vee et al., 2009).

If the accumulation of APAP-gluc in NASH patients can be developed as a metabolomic biomarker for pediatric NASH, a simple, non-invasive test could be performed where the child simply takes two Tylenol tablets and has blood or urine analyzed. This would be an important step in identifying those children most in need of clinical intervention.

Although this preliminary study generates confidence in our hypothesis and indicates the potential utility of APAP-gluc disposition as a NASH biomarker, the limited sample size of only three NASH patients is insufficient for appropriate statistical tests.

While the increase in blood and urine levels of APAP-gluc in our NASH patients were statistically significant by ANOVA, a more appropriate test for would employ receiver operating characteristic (ROC) curves. This method generates a graphical plot of the sensitivity of a diagnostic measure, and the area under the curve is used as a summary measure of diagnostic performance. We anticipate that a biomarker must reach an AUC of least 0.8 in order to be useful for future consideration. These statistical analyses require a much larger sample size in both NASH and non-NASH groups, and patient recruitment is ongoing.

200

References

Amarapurka DN, Amarapurkar A D, Patel N D, Agal S, Baigal R, Gupte P and Pramanik S (2006) Nonalcoholic Steatohepatitis (NASH) With Diabetes: Predictors of Liver Fibrosis. Ann Hepatol 5:30-33.

Amarapurkar DN and Patel N D (2004) Clinical Spectrum and Natural History of Non- Alcoholic Steatohepatitis With Normal Alanine Aminotransferase Values. Trop Gastroenterol 25:130-134.

Butte NF, Comuzzie A G, Cole S A, Mehta N R, Cai G, Tejero M, Bastarrachea R and Smith E O (2005) Quantitative Genetic Analysis of the Metabolic Syndrome in Hispanic Children. Pediatr Res 58:1243-1248.

Chen C, Hennig G E and Manautou J E (2003) Hepatobiliary Excretion of Acetaminophen Glutathione Conjugate and Its Derivatives in Transport-Deficient (TR-) Hyperbilirubinemic Rats. Drug Metab Dispos 31:798-804.

Delgado JS (2008) Evolving Trends in Nonalcoholic Fatty Liver Disease. Eur J Intern Med 19:75-82.

Fishbein MH, Mogren C, Gleason T and Stevens W R (2006) Relationship of Hepatic Steatosis to Adipose Tissue Distribution in Pediatric Nonalcoholic Fatty Liver Disease. J Pediatr Gastroenterol Nutr 42:83-88.

Flegal KM, Carroll M D, Ogden C L and Curtin L R (2010) Prevalence and Trends in Obesity Among US Adults, 1999-2008. JAMA 303:235-241.

Flegal KM, Carroll M D, Ogden C L and Johnson C L (2002) Prevalence and Trends in Obesity Among US Adults, 1999-2000. JAMA 288:1723-1727.

Forrest JA, Clements J A and Prescott L F (1982) Clinical Pharmacokinetics of Paracetamol. Clin Pharmacokinet 7:93-107.

201

Gomez-Lechon MJ, Jover R and Donato M T (2009) Cytochrome P450 and Steatosis. Curr Drug Metab 10:692-699.

Gwilt PR, Lear C L, Tempero M A, Birt D D, Grandjean A C, Ruddon R W and Nagel D L (1994) The Effect of Garlic Extract on Human Metabolism of Acetaminophen. Cancer Epidemiol Biomarkers Prev 3:155-160.

Ipekci SH, Basaranoglu M and Sonsuz A (2003) The Fluctuation of Serum Levels of Aminotransferase in Patients With Nonalcoholic Steatohepatitis. J Clin Gastroenterol 36:371.

Jou J, Choi S S and Diehl A M (2008) Mechanisms of Disease Progression in Nonalcoholic Fatty Liver Disease. Semin Liver Dis 28:370-379.

Kader HH, Henderson J, Vanhoesen K, Ghishan F and Bhattacharyya A (2008) Nonalcoholic Fatty Liver Disease in Children: a Single Center Experience. Clin Gastroenterol Hepatol 6:799-802.

Kennedy M (2008) Hormonal Regulation of Hepatic Drug-Metabolizing Enzyme Activity During Adolescence. Clin Pharmacol Ther 84:662-673.

Keppler D, Kamisako T, Leier I, Cui Y, Nies A T, Tsujii H and Konig J (2000) Localization, Substrate Specificity, and Drug Resistance Conferred by Conjugate Export Pumps of the MRP Family. Adv Enzyme Regul 40:339-349.

Konig J, Nies A T, Cui Y, Leier I and Keppler D (1999) Conjugate Export Pumps of the Multidrug Resistance Protein (MRP) Family: Localization, Substrate Specificity, and MRP2-Mediated Drug Resistance. Biochim Biophys Acta 1461:377-394.

202

Lizardi-Cervera J, Laparra D I, Chavez-Tapia N C, Ostos M E and Esquivel M U (2006) [Prevalence of NAFLD and Metabolic Syndrome in Asymtomatics Subjects]. Rev Gastroenterol Mex 71:453-459.

Loomba R, Sirlin C B, Schwimmer J B and Lavine J E (2009) Advances in Pediatric Nonalcoholic Fatty Liver Disease. Hepatology 50:1282-1293.

Mager DR and Roberts E A (2006) Nonalcoholic Fatty Liver Disease in Children. Clin Liver Dis 10:109-vii.

Manautou JE, de Waart D R, Kunne C, Zelcer N, Goedken M, Borst P and Elferink R O (2005) Altered Disposition of Acetaminophen in Mice With a Disruption of the Mrp3 Gene. Hepatology 42:1091-1098.

Mofrad PS and Sanyal A J (2003) Nonalcoholic Fatty Liver Disease. MedGenMed 5:14.

Moran JR, Ghishan F K, Halter S A and Greene H L (1983) Steatohepatitis in Obese Children: a Cause of Chronic Liver Dysfunction. Am J Gastroenterol 78:374-377.

Ogasawara K, Terada T, Katsura T, Hatano E, Ikai I, Yamaoka Y and Inui K (2010) Hepatitis C Virus-Related Cirrhosis Is a Major Determinant of the Expression Levels of Hepatic Drug Transporters. Drug Metab Pharmacokinet 25:190-199.

Oh MK, Winn J and Poordad F (2008) Review Article: Diagnosis and Treatment of Non- Alcoholic Fatty Liver Disease. Aliment Pharmacol Ther 28:503-522.

203

Perseghin G, Bonfanti R, Magni S, Lattuada G, De C F, Canu T, Esposito A, Scifo P, Ntali G, Costantino F, Bosio L, Ragogna F, Del M A, Chiumello G and Luzi L (2006) Insulin Resistance and Whole Body Energy Homeostasis in Obese Adolescents With Fatty Liver Disease. Am J Physiol Endocrinol Metab 291:E697-E703.

Preiss D and Sattar N (2008) Non-Alcoholic Fatty Liver Disease: an Overview of Prevalence, Diagnosis, Pathogenesis and Treatment Considerations. Clin Sci (Lond) 115:141-150.

Reisman SA, Csanaky I L, Aleksunes L M and Klaassen C D (2009) Altered Disposition of Acetaminophen in Nrf2-Null and Keap1-Knockdown Mice. Toxicol Sci 109:31-40.

Schwimmer JB, Deutsch R, Kahen T, Lavine J E, Stanley C and Behling C (2006) Prevalence of Fatty Liver in Children and Adolescents. Pediatrics 118:1388-1393.

Schwimmer JB, McGreal N, Deutsch R, Finegold M J and Lavine J E (2005) Influence of Gender, Race, and Ethnicity on Suspected Fatty Liver in Obese Adolescents. Pediatrics 115:e561-e565.

Schwimmer JB, Pardee P E, Lavine J E, Blumkin A K and Cook S (2008) Cardiovascular Risk Factors and the Metabolic Syndrome in Pediatric Nonalcoholic Fatty Liver Disease. Circulation 118:277-283.

Starley BQ, Calcagno C J and Harrison S A (2010) Nonalcoholic Fatty Liver Disease and Hepatocellular Carcinoma: a Weighty Connection. Hepatology 51:1820-1832.

Tiniakos DG, Vos M B and Brunt E M (2010) Nonalcoholic Fatty Liver Disease: Pathology and Pathogenesis. Annu Rev Pathol 5:145-171.

Uslusoy HS, Nak S G, Gulten M and Biyikli Z (2009) Non-Alcoholic Steatohepatitis With Normal Aminotransferase Values. World J Gastroenterol 15:1863-1868.

Vee ML, Lecureur V, Stieger B and Fardel O (2009) Regulation of Drug Transporter Expression in Human Hepatocytes Exposed to the Proinflammatory Cytokines Tumor Necrosis Factor-Alpha or Interleukin-6. Drug Metab Dispos 37:685-693.

Wieckowska A and Feldstein A E (2008) Diagnosis of Nonalcoholic Fatty Liver Disease: Invasive Versus Noninvasive. Semin Liver Dis 28:386-395.

Zamek-Gliszczynski MJ, Hoffmaster K A, Humphreys J E, Tian X, Nezasa K and Brouwer K L (2006a) Differential Involvement of Mrp2 (Abcc2) and Bcrp (Abcg2) in

204

Biliary Excretion of 4-Methylumbelliferyl Glucuronide and Sulfate in the Rat. J Pharmacol Exp Ther 319:459-467.

Zamek-Gliszczynski MJ, Nezasa K, Tian X, Bridges A S, Lee K, Belinsky M G, Kruh G D and Brouwer K L (2006b) Evaluation of the Role of Multidrug Resistance-Associated Protein (Mrp) 3 and Mrp4 in Hepatic Basolateral Excretion of Sulfate and Glucuronide Metabolites of Acetaminophen, 4-Methylumbelliferone, and Harmol in Abcc3-/- and Abcc4-/- Mice. J Pharmacol Exp Ther 319:1485-1491.

Zamek-Gliszczynski MJ, Nezasa K, Tian X, Kalvass J C, Patel N J, Raub T J and Brouwer K L (2006c) The Important Role of Bcrp (Abcg2) in the Biliary Excretion of Sulfate and Glucuronide Metabolites of Acetaminophen, 4-Methylumbelliferone, and Harmol in Mice. Mol Pharmacol 70:2127-2133.

205

Tables and Figures

Table 2. Patient diagnosis, sex, age, and results of serum biochemistry tests.

Laboratory tests were performed on plasma samples obtained the morning of the study.

Several general indices of hepatic function were measured, including total serum protein, serum albumin, conjugated (direct) and total bilirubin, alkaline phosphatase

(ALP), aspartate transaminase (AST), alanine transaminase (ALT). Normal levels are listed below, abnormal levels are highlighted.

206

Figure 1. Pediatric plasma levels of APAP and metabolites. Plasma was collected at

0, 1, 2, and 4h from pediatric patients with normal healthy livers, or with steatosis of

NASH following administration of 1000 mg APAP. Plasma concentrations of APAP,

APAP-gluc and APAP-sulf were determined by HLPC.

207

Figure 1.

208

Figure 2. Pediatric urine levels of APAP and metabolites. Urine was collected at 0, 1,

2, and 4h from pediatric patients with normal healthy livers, or with steatosis of NASH following administration of 1000 mg APAP. Concentrations of APAP, APAP-gluc and

APAP-sulf in the urine were determined by HLPC.

209

Figure 2.

210

APPENDIX F:

THE CONSTITUTIVE ANDROSTANE RECEPTOR:

PHARMACOLOGICAL AND TOXICOLOGICAL INTERACTIONS

Matthew D. Merrell and Nathan J. Cherrington

University of Arizona, Deptartment of Pharmacology and Toxicology

Abstract

The constitutive androstane receptor (CAR, NR1I3) plays an important role in regulating the induction of cytochrome P450 (CYP) gene expression, including CYP1A, CYP2B,

CYP3A, and CYP2C (Lee et al., 2007;Qatanani and Moore, 2005). Together, these enzymes constitute over half of the CYP protein content of the liver, and are responsible for the metabolism of over 60% of all prescription drugs (Hodgson and Rose, 2007).

CAR activity, in turn, is regulated by a variety of exogenous compounds, including both pharmaceutics and environmental toxicants. The importance CAR-controlled genes in both pharmacology and toxicology, combined with the diversity of CAR activators, makes understanding the regulation and activation of CAR a critical element in preventing drug-drug and drug-toxicant interactions.

Nuclear Receptors

CAR is a member of the nuclear hormone receptor superfamily, sharing similar activity, structure, and mechanisms of regulation with other nuclear receptors. The nuclear receptor superfamily can be loosely divided into two main groups based on their mechanism of regulation. Steroid receptors (Type I) are kept sequestered from the

211

nucleus and non-functional by molecular chaperones, especially heat shock proteins

(Hsp), in the absence of ligand binding. Ligand-receptor interaction allows

conformational changes leading to dissociation from the chaperone complex,

homodimerization, translocation to the nucleus, and DNA binding (Pascussi et al., 2003).

Type II receptors, including receptors for thyroid hormone, vitamin D3 and

retinoids, heterodimerize with the retinoid X receptor α (RXRα) and are localized to the nucleus where they are bound to the promoter regions of specific gene targets. In the absence of ligand binding to the receptor, this DNA-protein binding actually downregulates the genes downstream, as the nuclear receptor assumes conformation which facilitates interaction with corepressors, or proteins which inhibit transcriptional processes.

Both nuclear receptor classes are activated by ligand binding. The conformational changes resulting from ligand-receptor interactions promotes the release of corepressors and the recruitment of coactivators, which can lead to the transcriptional activation of downstream genes (Pascussi et al., 2003).

Nuclear receptors share common functional domains (A-F) (Tsai and O'Malley,

1994). Domains A and B contain the activation function (AF-1) which is responsible for interaction with co-activators and the recruitment of transcriptional machinery. The C region contains two zinc finger domains (type II) responsible for the selective DNA binding of the nuclear receptor. The D domain is a hinge region, and the E/F domain is the ligand-binding domain. This region also includes regions for dimerization, heat-shock protein (HSP) interactions, and a second activating function (AF-2) (Dennis and

O'Malley, 2005).

212

The DNA response elements for nuclear receptor hetero- and homodimers consist of imperfect copies of a six-nucleotide sequence (5’-AGGTCA-3’) arranged as direct (DR), inverted (IR), and/or everted (ER) repeats (Forman and Evans, 1995).

These core sequences are separated by short sequences of intervening nucleotides.

The response element of a particular nuclear receptor is designated by the directionality followed by the intervening sequence length. For example, the estrogen receptor binds

IR-3 (Klein-Hitpass et al., 1989).

Nuclear receptors interact with a number of coregulator proteins, in addition to binding with their DNA response element and their dimerization partner. Coregulators are generally classified into two groups based on the how they affect transcription; coactivators increase transcription and corepressors decrease transcription. A key mechanism in this regulation is the alteration of chromatin structure, through post- translational modification of the N-terminal tails of histones. Histone hyperacetylation has been shown to play an important role in promoting transcription, while histone deacetylation tends to inactivate nearby genes (Lu et al., 2006).

These coregulators generally interact with the AF-2 region of the nuclear receptor, through interaction with their own LXXLL motif. Correct conformation of the

AF2 region is dependent upon correct positioning of the helix 12 region of the AF-2 domain. Agonist ligands promote this active conformation through direct interactions at the ligand binding pocket (Bourguet et al., 2000). In the absence of agonist, or the presence of antagonist, helix 12 may not retain this active conformation, instead achieving a conformation capable of recruiting corepressors (Zhang et al., 1999).

Coactivators may possess intrinsic histone acetyltransferase or histone methyltransferase activity, or may recruit other proteins that do. The subsequent

213

chromatin relaxation aids in the recruitment of the transcriptional machinery (Pascussi et al., 2004) . The sequential recruitment of coactivators, followed by general transcription factors and RNA polymerase, allows the full expression of the target genes. These coactivators include the p160 family, CREB-binding protein (CBP):p300, p:CAF, thyroid hormone receptor (TR)-associated protein (TRAP):vitamin D3 receptor (VDR)-interacting protein (DRIP), activating signal cointegrator-1 (ASC-1), activating signal cointegrator-2

(ASC-2), TIF1, ARA70, SRA, PGC-1, Smad3, REA, RIP140, and many others (Lee et al., 2001). Among the better researched, the p160 family, CBP/p300, and TRAP/DRIP play an integral part in the recruitment of other factors to the ligand bound nuclear receptor.

Members of the p160 or steroid receptor coactivator (SRC) family are grouped into three subclasses based on sequence homology (SRC-1, GRIP1, and SRC-3 are representative of each subclass). These factors may have histone acetyltransferase activity, and are important in the recruitment of other coactivators. The CBP/p300 family also contains histone acetyltransferase activity, and can regulate the function of other proteins involved in gene activation. Contrastingly, TRAP/DRIP members do not contain histone acetyltransferase activity, and are thought to directly connect to the RNA polymerase II core machinery (Lee et al., 2001).

While coactivators bind to ligand-bound nuclear receptors, corepressors bind to receptors either in the absence of ligand or in the presence of an antagonist. These proteins (i.e. silencing mediator of RAR and TR, SMRT; nuclear receptor corepressor,

NCoR) recruit histone deacetylases (HDAC), leading to chromatin condensation and repression of the target genes (Pascussi et al., 2004). These factors are required for the transcriptional repression exhibited by unliganded type II nuclear receptors such as the

214

retinoic acid receptor and the thyroid receptor. Recent studies have revealed a similar molecular mechanism for the recruitment of these factors to that of the SRC family.

These corepressors contain a shared motif similar to the LXXLL motif of SRC proteins, only longer, representing an extended helix which can interact with unliganded nuclear receptor (Lee et al., 2001). In contrast to type II nuclear receptors which can interact with

NCoR and SMRT in the absence of agonist, steroid hormone receptors appear to interact with NCoR and SMRT only in the presence of an antagonist or inverse agonist

(Lavinsky et al., 1998). Specific domains of NCoR and SMRT are responsible for the association of HDACs. Several HDACs have been identified, and are grouped into two classes based on sequence homology. HDAC1 and HDAC2 (class I) are components of major multisubunit complexes (i.e. Sin3 and Mi2) that are known to be involved in the repression of unliganded retinoic acid receptor (RAR) and thyroid hormone receptor

(TR). NCoR has also been identified as a member of a complex with HDAC3 (Wen et al.,

2000).

Constitutive Androstane Receptor

CAR is a xenosensor, and along with nuclear receptors PXR/SXR and AhR, acts to detect a variety of foreign compounds and coordinate the cellular response by upregulating genes responsible for the metabolism and elimination of these compounds.

For CAR and its close cousin PXR, a key component of its strategy as a xenosensor is to respond to compounds of variety of chemical structures. Though much of the early research on CAR was focused on the induction of metabolic genes by phenobarbital, a number of structurally distinct CAR activators have emerged. The diversity of CAR activators is due to both the relatively large size of the binding pocket and to the varied mechanisms of CAR activation.

215

Though classified as an orphan receptor, the nuclear receptor CAR appears to

combine important features of both type I and II nuclear receptors. Like the steroid

receptors, CAR is found in the cytoplasm of uninduced cells, interacting with chaperone

proteins. As with type II receptors, CAR forms a heterodimer with RXRα upon nuclear localization. Most interestingly, CAR’s transcriptional activity is independent of any ligand binding.

Though CAR ligands have been identified, they often actually suppress the constitutive activity of CAR. These compounds where not classified as antagonists, but as inverse agonists. (An antagonist blocks the activity of an agonist, while an inverse agonist blocks the basal activity of the target (Moore, 2005). The first CAR ligands identified androstanol (5α-androstan-3α-ol) and androstenol (5α-androst-16-en-3α-ol)

(Forman et al., 1998), were inverse agonists.

As mentioned previously, ligand binding to nuclear receptors changes the position of the C-terminal helix 12, forming a stable conformation which forms the AF-2 coactivator binding surface (Wright et al., 2007). In the case of the constitutive androstane receptor, important differences in the structure of helix 12 promote the active conformation independent of ligand binding. The helix is held more rigidly in CAR than the usual flexible connection, and internal linkages help to assure this conformation (Xu et al., 2004;Suino et al., 2004). Binding of the inverse agonist androstanes disrupts this active conformation, while agonists such as TCPOBOP stabilize it (Wright et al.,

2007;Shan et al., 2004;Tzameli et al., 2000).

CAR Regulation

The constitutive activity of CAR is closely regulated in the cell, as evidenced by the extremely low expression of target gene CYP2B. While the first and most obvious

216

form of regulation is the retention of CAR in the cytosol, nuclear interactions between

CAR and other proteins also play an important part in CAR regulation and activity.

Cytoplasmic Rention

The CAR cytoplasmic retention protein (CCRP), in conjunction with Hsp90, secludes CAR from translocating to the nucleus. While some research has indicated the possibility of non-genomic CAR function at the cell membrane (Koike et al.,

2005;Takahashi et al., 2008), in order to transactivate its target genes, CAR must translocate to the nucleus. This translocation is determined by the interactions between specific CAR structural elements and several other cellular proteins.

CAR shares the same basic protein structure with other nuclear receptors. As mentioned previously, under uninduced conditions CAR is sequestered in the cytoplasm.

The interaction between CAR and its protein chaperones appears to be due to binding of

CCRP to the ligand binding domain (LDB, also known as the xenochemical response sequence, XRS) of CAR (Squires et al., 2004;Kobayashi et al., 2003).

This interaction can be disrupted either through the binding of a CAR ligand

(TCPOBOP in mice, CITCO in humans) or through actions of phenobarbital-like activators which appear to act through indirect mechanisms. CAR translocation is okadaic acid-sensitive indicating that post-translational modification of the

CCRP/HSP/CAR complex may be required in the translocation of CAR. Treatment with

CAR activators has been shown to recruit PP2A to the CAR-CCRP complex.

Several kinases have also been implicated in the regulation of CAR, including the

AMP-activated protein kinase (AMPK), the extracellular signal-regulated kinase (ERK), and the Ca2+/calmodulin-dependent kinase. Inhibition or loss of AMPK activity blunt the induction of CYP2B by PB, and AMPK activators are CAR activators (Rencurel et al.,

217

2006;Shindo et al., 2007). PB appears to activate AMPK through the upstream kinase

LKB1 (Blattler et al., 2007) . Activation of ERK, a mitogen-activated protein kinase

(MAPK), has been identified as a signal that retains CAR in the cytoplasm (Koike et al.,

2007). As no specific ERK phosphorylation site has been demonstrated, the target of

ERK phosphorylation could be any of the members of the CAR/CCRP complex. Though the link between AMPK, ERK, PP2A and CAR phosphorylation has not been identified, there is a clear role for post-translational modification in the regulation of CAR activity.

After dissociation from the CCRP-Hsp90 complex, several proteins are required for the nuclear accumulation of CAR. Two nuclear coactivators, the peroxisome proliferator-activated receptor (PPAR)-binding protein (PBP) and the Glucocorticoid

Receptor-interacting Protein 1 (GRIP-1) are involved in this process. While PB treatment is known to induce CAR nuclear accumulation in wild-type mice, mice deficient in hepatic

PBP exhibited no nuclear accumulation. This PB-induced nuclear accumulation was restored with the exogenous expression of PBP (Guo et al., 2006). Additionally, the exogenous expression of GRIP-1 in mice liver resulted in increased nuclear accumulation of CAR, providing evidence of the involvement of additional coactivators in the nuclear accumulation of CAR (Min et al., 2002a). While it is possible that these proteins aid in CAR translocation to the nucleus, it is also possible that despite the majority of CAR being found in the cytoplasm, low levels of CAR may be constantly entering and leaving the nucleus. In this scenario, CAR would be unable to accumulate in the nucleus in the absence of an anchor, such as PBP or GRIP-1, attaching CAR to the complex of transcriptional machinery (Guo et al., 2006;Min et al., 2002b;Xia and

Kemper, 2005).

218

Nuclear Interactions

As mentioned previously, CAR activity requires dimerization with RXRα. This

dimerization allows binding to the promoter of CAR target genes at the Phenobarbital-

Responsive Enhancer Module (PBREM) (Honkakoski and Negishi, 1997). The PBREM

contains a pair of DR-4 nuclear receptor binding sites (NR1 and NR2) each of which is

capable of binding the CAR-RXRα heterodimer.

The obligate CAR binding partner RXRα plays a role in the regulation of CAR activity. It has been reported that RXRα agonists can affect CAR activity, by promoting coactivator recruitment in the absence of CAR ligands (Tzameli et al., 2000). The same study found that RXRα agonists also inhibited the ability of CAR ligands (TCPOBOP and androstenol) to affect coactivator binding (increase and decrease, respectively). Other studies have found inhibition of CAR transactivation by retinoids. More studies are needed to clarify the effects of RXRα agonists on CAR activity.

Because RXRα acts as a binding partner of so many different nuclear receptors, the availability of RXRα in the cell has been shown to play an important role in the regulation of these receptors. Certain type II nuclear receptors (those that bind with

RXRα) have been shown to inhibit one another through competition for RXRα binding.

Ligand activation of PPARβ repressed the induction of LXR-driven genes through competition with LXR for RXRα (Matsusue et al., 2006). Additionally, the insensitivity of certain osteosarcoma cell lines to hormone therapy (calcitrol and retinoic acid), has been demonstrated to be a result of aberrant proteasomal degradation of RXRα, since the dimerization partners (vitamin D receptor and retinoic acid receptor, respectively) are still expressed in the resistant cells (Prufer et al., 2002).

219

CAR activity can still be chemically regulated even after nuclear translocation.

Treatment by the Ca2+/calmodulin-dependent kinase inhibitor KN-62 represses

TCPOBOP induced CYP2B10 gene expression, but did not affect nuclear translocation

(Yamamoto et al., 2003). However, since CAR also interacts with a variety of proteins in the nucleus (RXRα, co-activators, general transcription factors, etc.), the specific phosphorylation target of this kinase remains unclear.

As with other nuclear receptors, coactivators play vital role in the activity of CAR.

SRC-1 has been shown to interact with CAR, and that interaction is enhanced in response to treatment with TCPOBOP (Wright et al., 2007;Muangmoonchai et al., 2001).

Other p160 family members have also been linked with CAR. GRIP1 interacts with CAR, and this interaction is also sensitive to CAR activators and inhibitors, with decreased interaction in the presence of androstenol and increased interaction with TCPOBOP

(Dussault et al., 2002). xSRC-3 interacts with CAR in addition to other nuclear receptors.

Highlighting the unique nature of CAR, the interaction with xSRC-3 appears to be through domains distinct from those used by the other nuclear receptors, as mutation of those sites failed to affect the association between CAR and xSRC-3 (Kim et al., 1998) .

Other coactivators besides p160 family members also affect CAR activity. The previously mentioned PBP has been shown to interact with the AF-2 domain of CAR, and is known to be integral to the activity of CAR. Loss of PBP abrogated the PB- potentiated acetaminophen hepatotoxicity, possibly by inhibiting CAR nuclear accumulation (Guo et al., 2006;Jia et al., 2005). ASC-2 (also known as PRIP) also interacts with CAR in a ligand dependent manner in order to enhance the transcriptional activity of CAR, as demonstrated by the abrogation of acetaminophen hepatotoxicity with the loss of ASC-2 (Choi et al., 2005). Interestingly, this finding differs from another study

220

in which the loss of hepatic PRIP did not protect from acetaminophen-induced hepatic necrosis, though the two studies employed different methods of knocking down PRIP expression (Guo et al., 2006). The peroxisome proliferator-activated receptor coactivator-1α (PGC-1) interacts with CAR at the CYP2B10 promoter to enhance CAR transcriptional activity (Ding et al., 2006). Functional PGC-1 was also found to be necessary for CAR transactivation, and may be involved in subnuclear targeting (Shiraki et al., 2003).

Co-repressors also play a role in the regulation of CAR activity. Both NCoR and

SMRT have been shown to interact with CAR (Dussault et al., 2002;Bae et al.,

2004;Jyrkkarinne et al., 2003). Association with these two corepressors appears to be responsible for the inhibitory effects of androstanol as a CAR inverse agonist, as androstanol treatment promotes the interaction between corepressors and CAR. While some studies have indicated that this promotion of corepressors is the predominant means of inhibiting gene expression, other research show that androstanol acts through the dissociation of coactivators such as SRC-1, and more research is needed

(Jyrkkarinne et al., 2003;Dussault et al., 2002). Another important corepressor protein in the regulation of CAR is the short heterodimer partner (SHP) which has been shown to repress CAR transactivation. Though the actual mechanism of SHP repression remains unclear, it is hypothesized that SHP does not displace coactivators, but interacts with

HDAC1 and mSin3A and/or prevents SRC-1 from recruiting other coactivators (Bae et al., 2004).

Interactions between CAR and chemical activators seem to promote association between CAR and its co-activators, while CAR inhibitors (such as androstenol) promote co-repressor interactions (Wright et al., 2007;Lempiainen et al., 2005) .Some studies

221

have found that over-expression of corepressors inhibits CAR activity even in the

presence of the direct activator TCPOBOP. These researchers suggest that the ratio

between coactivators and corepressors may be the main regulator of the activity of CAR,

and that ligand binding may be of less importance (Lempiainen et al., 2005).

Similarly to the effects of the availability of RXRα on binding partner activity, modulation of the availability of common coactivators is also a mechanism of receptor regulation. The ability of one nuclear receptor to reduce the transactivation of a promoter by another is termed “squelching”, and was an early indication of the existence of coactivators. CAR has been shown to inhibit the transcriptional activity of the estrogen receptor through limiting the availability of co-activator GRIP1. This inhibition is dependent upon the activity of CAR, as demonstrated by the potentiation of the inhibition by TCPOBOP, and the reversal of the inhibition by androstenol. Abrogation of the interaction between CAR and GRIP1 by mutating the domain responsible for the interaction also reversed the inhibition of ER-mediated transcriptional activity (Min et al.,

2002b). Both the pregnane X receptor and CAR have been shown to inhibit the activity of HNF-4 by competing for available specific coactivators (PGC-1α, GRIP1) (Bhalla et al., 2004;Miao et al., 2006) . Additionally, CAR has been shown to interact with the HNF-

4 DR1 motif and inhibit binding of HNF-4 to the response element (Miao et al., 2006).

CAR Activity Modulators

A key characteristic of xenosensors is their ability to recognize a variety of chemically diverse compounds. While most nuclear receptor genes are strongly conserved between vertebrate species, the ligand-binding domains of both CAR and

PXR have been reported to be among the least conserved, with the PXR ligand-binding domain possibly showing positive selection (Krasowski et al., 2005). CAR also exhibited

222

low relative conservation in the DNA- binding domain, usually one of the most conserved elements. These results are consistent with the findings that ligand specificity varies greatly between humans and other mammals.

Below (Table 1) is a list of compounds which have been shown to modulate CAR activity. This is not intended to be a comprehensive list, but is meant to illustrate of the diversity of chemicals which can affect CAR activity, as well as the differences between species.

While the listed compounds are mostly pharmaceutics and natural products, environmental chemicals also play a role in CAR activation. A few identified CAR activators include: 1,1-Dichloro-2,2-bis(p-chlorophenyl)ethylene (DDE), a metabolite of the pesticide 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT), nonylphenols, toxic degradation products of the alkylphenol ethoxylates, and di-n-butyl phthalate, used as a plasticizer and solvent in numerous consumer products (Hernandez et al., 2007;Wyde et al., 2003;Wyde et al., 2005). Often, these environmental CAR activators are also endocrine disruptors or activators (di-n-butylphthalate, DDE, o,p-DDT, 17β-estradiol, estrone, methoxychlor, nonylphenol, 2,3,3′,4′,5′,6-hexachlorobiphenyl (PCB), 1,4-bis[2-

(3,5-dichloropyridyloxy)]benzene (TCPOBOP) (Tzameli et al., 2000;Sueyoshi et al.,

1999;Kawamoto et al., 2000).

Clinical Significance

As mentioned previously, CAR is a major regulator of oxidative metabolic enzymes. CAR also regulates conjugational metabolic enzymes, as well as transporter proteins which play an integral part in drug and toxicant elimination. The induction of these genes can alter the metabolism and elimination of xenobiotics (both pharmaceutic and toxicant), increasing the potential of adverse drug reactions or increased toxicity.

223

Table 1 Compound Human CAR Mouse CAR Reference NA Agonist (Chang and Chlopromazine Waxman, 2006) Inverse agonist Agonist (Moore et al., Clotrimazole 2000) Inverse agonist Agonist (Huang et al., Meclizine 2004) Indirect activator Indirect activator (Zhang et al., Acetaminophen 2002) Indirect activator Indirect activator (Kawamoto et al., Phenobarbital 1999;Sueyoshi et al., 1999) Indirect activator Indirect activator (Wang et al., Phenytoin 2004;Jackson et al., 2004) Activator (mechanism unknown (Cerveny et al., Valproic acid unclear) 2007) unknown Indirect activator (Merrell et al., Oltipraz 2008) Activator (mechanism Activator (mechanism (Kobayashi et al., Atorvastatin unclear) unclear) 2005) Activator (mechanism Activator (mechanism (Kobayashi et al., Simvastatin unclear) unclear) 2005) Activator (mechanism Activator (mechanism (Kobayashi et al., Fluvastatin unclear) unclear) 2005) unknown Activator (mechanism (Guo et al., 2007) Clofibrate unclear) Wy-14,643 unknown Inverse agonist (Guo et al., 2007) (PPARα ligand) unknown Activator (mechanism (Murray et al., Orphenadrine unclear) 2003) Agonist unknown (Simonsson et Artemisinin al., 2006) Activator (mechanism Activator (mechanism (Fisher et al., Diallyl Sulfide unclear) unclear) 2007) Estrogen unknown Activator (mechanism (Kawamoto et al., unclear) 2000) DHEA Activator (mechanism unknown (Kohalmy et al., unclear) 2007) Nonylphenol Activator (mechanism Activator (mechanism (Hernandez et (environmental unclear) unclear) al., 2007) estrogen) PK11195 Inverse agonist NA (Li et al., 2008) (benzodiazepine receptor ligand)

224

One of the more striking examples of this phenomenon is in the metabolism of acetaminophen. CAR is activated by high levels of acetaminophen, resulting in induction of CYP enzymes. These enzymes are in turn responsible for the production of the toxic acetaminophen metabolite, N-acetyl parabenzoquinone imine (NAPQI). NAPQI at low levels is conjugated to glutathione, detoxicating the molecule and allowing for increased clearance. High levels of NAPQI can deplete the cellular gluthatione stores, allowing excess unconjugated NAPQI to covalently bind to cellular proteins and nucleic acids, causing hepatotoxicity (Henderson et al., 2000). When similar doses of acetaminophen are given to wild-type as well as CAR-null mice, those mice lacking CAR do not exhibit increased production of CYP enzymes as in the wild type mice. The CAR-null animals are also more resistant to NAPQI toxicity. Additionally, inhibition of CAR activity by the

CAR inverse agonist androstenol reversed the hepatotoxicity in wild type but not in CAR null mice. This rescue was observed in mice treated after acetaminophen treatment, suggesting a possible treatment for acetaminophen overdosing (Zhang et al., 2002).

CAR is also responsible for the induction of metabolic enzymes involved in the glucuronidation (UGT) and sulfation (SULT) of both xenobiotics and endobiotics, and

CAR activation can alter the physiologic effectiveness of these compounds. For example, epileptics taking PB and oral contraceptives (e.g. ethinylestradiol) have 25-fold higher risk of pill failure caused by the increased rate of estrogen metabolism (Schipper,

1988). It has been proposed that changes in the levels of UGT1A1 and SULT1E1, two major enzymes involved in estrogen metabolism, may contribute to this effect (Qatanani and Moore, 2005). Similarly, induction of these enzymes by CAR is thought to be responsible for the decreases seen in serum levels of thyroid hormone (Qatanani et al.,

2005).

225

CAR also induces important transport proteins (MRP2 and MRP3) involved in the excretion of both endogenous and exogenous compounds. Together with metabolic enzyme induction, this increase in transport is responsible for the effective treatment of hyperbilirubinemia by the CAR activator phenobarbital. Bilirubin is produced by the breakdown of heme and is normally cleared by the liver. Deficiency in this clearance results in an accumulation of bilirubin and results in a condition known as jaundice.

Bilirubin is cleared by glucuronidation (UGT1A1) within hepatocytes, followed by excretion into the bile by MRP2 (Soloway, 1996). The genes involved in this clearance pathway have been shown to be regulated by CAR (Huang et al., 2003). The importance of CAR in the treatment of hyperbilirubinemia was further established by a study showing that a component of a traditional Chinese medicine, Yin Zhi Huang, used to treat neonatal jaundice, is a CAR activator (Huang et al., 2004). While treatment with Yin

Zhi Huang accelerated the clearance of bilirubin, the effect was lost in CAR null mice.

The treatment also induced the expression of genes in the clearance pathway (UGT1A1,

Mrp2) though not in CAR null mice.

Recent studies have additionally demonstrated that CAR is both necessary and sufficient to confer resistance to lithocholic acid (LCA) hepatotoxicity by regulating the expression of important genes (Zhang et al., 2004). LCA is a secondary bile acid, and insufficient detoxication of this hydrophobic compound results in intrahepatic cholestasis, which in its severe form may require liver transplant. The detoxication process includes hydroxylation by CYP3A, sulfation by SULT2A1, glucuronidation by UGT1A1, and excretion by MRP2 and MRP3; all genes induced by CAR. The hepatotoxicity exhibited in CAR null mice in response to LCA treatment is more severe than in wild type mice.

226

Finally, PB is used as a treatment for pruritis, a severe side effect of the elevated serum bile acids associated with intrahepatic cholestasis (Jenkins and Boothby, 2002).

The metabolism of environmental chemicals such as pesticides and industrial chemicals are also controlled by CAR. Bioactivation of these chemicals by CYP enzymes has been demonstrated. Toluene, styrene, and benzene are substrates for

CYP2B and CYP2C, while Aflatoxin B1 is bioactivated by both CYP2B and CYP3A

(Nakajima and Aoyama, 2000). Metabolism of methoxychlor, polychlorinated biphenyls, parathione, benzo(a)pyrene, nonane and naphthalene by CAR target genes has been reviewed (Hodgson and Rose, 2007). Subsequently, activation of CAR may lead to increased toxicity from these compounds and/or their metabolites.

227

References

Bae Y, Kemper J K and Kemper B (2004) Repression of CAR-Mediated Transactivation of CYP2B Genes by the Orphan Nuclear Receptor, Short Heterodimer Partner (SHP). DNA Cell Biol 23:81-91.

Blattler SM, Rencurel F, Kaufmann M R and Meyer U A (2007) In the Regulation of Cytochrome P450 Genes, Phenobarbital Targets LKB1 for Necessary Activation of AMP-Activated Protein Kinase. Proc Natl Acad Sci U S A 104:1045-1050.

Cerveny L, Svecova L, Anzenbacherova E, Vrzal R, Staud F, Dvorak Z, Ulrichova J, Anzenbacher P and Pavek P (2007) Valproic Acid Induces CYP3A4 and MDR1 Gene Expression by Activation of Constitutive Androstane Receptor and Pregnane X Receptor Pathways. Drug Metab Dispos 35:1032-1041.

Chang TK and Waxman D J (2006) Synthetic Drugs and Natural Products As Modulators of Constitutive Androstane Receptor (CAR) and Pregnane X Receptor (PXR). Drug Metab Rev 38:51-73.

Choi E, Lee S, Yeom S Y, Kim G H, Lee J W and Kim S W (2005) Characterization of Activating Signal Cointegrator-2 As a Novel Transcriptional Coactivator of the Xenobiotic Nuclear Receptor Constitutive Androstane Receptor. Mol Endocrinol 19:1711-1719.

Ding X, Lichti K, Kim I, Gonzalez F J and Staudinger J L (2006) Regulation of Constitutive Androstane Receptor and Its Target Genes by Fasting, CAMP, Hepatocyte Nuclear Factor Alpha, and the Coactivator Peroxisome Proliferator-Activated Receptor Gamma Coactivator-1alpha. J Biol Chem 281:26540-26551.

Dussault I, Lin M, Hollister K, Fan M, Termini J, Sherman M A and Forman B M (2002) A Structural Model of the Constitutive Androstane Receptor Defines Novel Interactions That Mediate Ligand-Independent Activity. Mol Cell Biol 22:5270-5280.

228

Forman BM and Evans R M (1995) Nuclear Hormone Receptors Activate Direct, Inverted, and Everted Repeats. Ann N Y Acad Sci 761:29-37.

Forman BM, Tzameli I, Choi H S, Chen J, Simha D, Seol W, Evans R M and Moore D D (1998) Androstane Metabolites Bind to and Deactivate the Nuclear Receptor CAR-Beta. Nature 395:612-615.

Guo D, Sarkar J, Ahmed M R, Viswakarma N, Jia Y, Yu S, Sambasiva R M and Reddy J K (2006) Peroxisome Proliferator-Activated Receptor (PPAR)-Binding Protein (PBP) but Not PPAR-Interacting Protein (PRIP) Is Required for Nuclear Translocation of Constitutive Androstane Receptor in Mouse Liver. Biochem Biophys Res Commun 347:485-495.

Guo D, Sarkar J, Suino-Powell K, Xu Y, Matsumoto K, Jia Y, Yu S, Khare S, Haldar K, Rao M S, Foreman J E, Monga S P, Peters J M, Xu H E and Reddy J K (2007) Induction of Nuclear Translocation of Constitutive Androstane Receptor by Peroxisome Proliferator-Activated Receptor Alpha Synthetic Ligands in Mouse Liver. J Biol Chem 282:36766-36776.

Hernandez JP, Huang W, Chapman L M, Chua S, Moore D D and Baldwin W S (2007) The Environmental Estrogen, Nonylphenol, Activates the Constitutive Androstane Receptor. Toxicol Sci 98:416-426.

Hodgson E and Rose R L (2007) The Importance of Cytochrome P450 2B6 in the Human Metabolism of Environmental Chemicals. Pharmacol Ther 113:420-428.

Honkakoski P and Negishi M (1997) Characterization of a Phenobarbital-Responsive Enhancer Module in Mouse P450 Cyp2b10 Gene. J Biol Chem 272:14943-14949.

Huang W, Zhang J, Chua S S, Qatanani M, Han Y, Granata R and Moore D D (2003) Induction of Bilirubin Clearance by the Constitutive Androstane Receptor (CAR). Proc Natl Acad Sci U S A 100:4156-4161.

Huang W, Zhang J and Moore D D (2004) A Traditional Herbal Medicine Enhances Bilirubin Clearance by Activating the Nuclear Receptor CAR. J Clin Invest 113:137-143.

Jackson JP, Ferguson S S, Moore R, Negishi M and Goldstein J A (2004) The Constitutive Active/Androstane Receptor Regulates Phenytoin Induction of Cyp2c29. Mol Pharmacol 65:1397-1404.

229

Jenkins JK and Boothby L A (2002) Treatment of Itching Associated With Intrahepatic Cholestasis of Pregnancy. Ann Pharmacother 36:1462-1465.

Jia Y, Guo G L, Surapureddi S, Sarkar J, Qi C, Guo D, Xia J, Kashireddi P, Yu S, Cho Y W, Rao M S, Kemper B, Ge K, Gonzalez F J and Reddy J K (2005) Transcription Coactivator Peroxisome Proliferator-Activated Receptor-Binding Protein/Mediator 1 Deficiency Abrogates Acetaminophen Hepatotoxicity. Proc Natl Acad Sci U S A 102:12531-12536.

Jyrkkarinne J, Makinen J, Gynther J, Savolainen H, Poso A and Honkakoski P (2003) Molecular Determinants of Steroid Inhibition for the Mouse Constitutive Androstane Receptor. J Med Chem 46:4687-4695.

Kawamoto T, Kakizaki S, Yoshinari K and Negishi M (2000) Estrogen Activation of the Nuclear Orphan Receptor CAR (Constitutive Active Receptor) in Induction of the Mouse Cyp2b10 Gene. Mol Endocrinol 14:1897-1905.

Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washburn K and Negishi M (1999) Phenobarbital-Responsive Nuclear Translocation of the Receptor CAR in Induction of the CYP2B Gene. Mol Cell Biol 19:6318-6322.

Kim HJ, Lee S K, Na S Y, Choi H S and Lee J W (1998) Molecular Cloning of XSRC-3, a Novel Transcription Coactivator From Xenopus, That Is Related to AIB1, P/CIP, and TIF2. Mol Endocrinol 12:1038-1047.

Klein-Hitpass L, Tsai S Y, Greene G L, Clark J H, Tsai M J and O'Malley B W (1989) Specific Binding of Estrogen Receptor to the Estrogen Response Element. Mol Cell Biol 9:43-49.

Kobayashi K, Sueyoshi T, Inoue K, Moore R and Negishi M (2003) Cytoplasmic Accumulation of the Nuclear Receptor CAR by a Tetratricopeptide Repeat Protein in HepG2 Cells. Mol Pharmacol 64:1069-1075.

Kobayashi K, Yamanaka Y, Iwazaki N, Nakajo I, Hosokawa M, Negishi M and Chiba K (2005) Identification of HMG-CoA Reductase Inhibitors As Activators for Human, Mouse and Rat Constitutive Androstane Receptor. Drug Metab Dispos 33:924-929.

Kohalmy K, Tamasi V, Kobori L, Sarvary E, Pascussi J M, Porrogi P, Rozman D, Prough R A, Meyer U A and Monostory K (2007) Dehydroepiandrosterone Induces Human CYP2B6 Through the Constitutive Androstane Receptor. Drug Metab Dispos 35:1495- 1501.

Koike C, Moore R and Negishi M (2005) Localization of the Nuclear Receptor CAR at the Cell Membrane of Mouse Liver. FEBS Lett 579:6733-6736.

230

Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T M, Schiff R, Del-Rio A L, Ricote M, Ngo S, Gemsch J, Hilsenbeck S G, Osborne C K, Glass C K, Rosenfeld M G and Rose D W (1998) Diverse Signaling Pathways Modulate Nuclear Receptor Recruitment of N-CoR and SMRT Complexes. Proc Natl Acad Sci U S A 95:2920-2925.

Lee CH, Ito Y, Yanagiba Y, Yamanoshita O, Kim H, Zhang S Y, Kamijima M, Gonzalez F J and Nakajima T (2007) Pyrene-Induced CYP1A2 and SULT1A1 May Be Regulated by CAR and Not by AhR. Toxicology 238:147-156.

Lee JW, Lee Y C, Na S Y, Jung D J and Lee S K (2001) Transcriptional Coregulators of the Nuclear Receptor Superfamily: Coactivators and Corepressors. Cell Mol Life Sci 58:289-297.

Lempiainen H, Molnar F, Macias G M, Perakyla M and Carlberg C (2005) Antagonist- and Inverse Agonist-Driven Interactions of the Vitamin D Receptor and the Constitutive Androstane Receptor With Corepressor Protein. Mol Endocrinol 19:2258-2272.

Li L, Chen T, Stanton J D, Sueyoshi T, Negishi M and Wang H (2008) The Peripheral Benzodiazepine Receptor Ligand 1-(2-Chlorophenyl-Methylpropyl)-3-Isoquinoline- Carboxamide Is a Novel Antagonist of Human Constitutive Androstane Receptor. Mol Pharmacol 74:443-453.

Lu Q, Qiu X, Hu N, Wen H, Su Y and Richardson B C (2006) Epigenetics, Disease, and Therapeutic Interventions. Ageing Res Rev 5:449-467.

Merrell MD, Jackson J P, Augustine L M, Fisher C D, Slitt A L, Maher J M, Huang W, Moore D D, Zhang Y, Klaassen C D and Cherrington N J (2008) The Nrf2 Activator Oltipraz Also Activates the Constitutive Androstane Receptor. Drug Metab Dispos 36:1716-1721.

Min G, Kemper J K and Kemper B (2002a) Glucocorticoid Receptor-Interacting Protein 1 Mediates Ligand-Independent Nuclear Translocation and Activation of Constitutive Androstane Receptor in Vivo. J Biol Chem 277:26356-26363.

231

Min G, Kim H, Bae Y, Petz L and Kemper J K (2002b) Inhibitory Cross-Talk Between Estrogen Receptor (ER) and Constitutively Activated Androstane Receptor (CAR). CAR Inhibits ER-Mediated Signaling Pathway by Squelching P160 Coactivators. J Biol Chem 277:34626-34633.

Moore DD (2005) CAR: Three New Models for a Problem Child. Cell Metab 1:6-8.

Moore LB, Parks D J, Jones S A, Bledsoe R K, Consler T G, Stimmel J B, Goodwin B, Liddle C, Blanchard S G, Willson T M, Collins J L and Kliewer S A (2000) Orphan Nuclear Receptors Constitutive Androstane Receptor and Pregnane X Receptor Share Xenobiotic and Steroid Ligands. J Biol Chem 275:15122-15127.

Muangmoonchai R, Smirlis D, Wong S C, Edwards M, Phillips I R and Shephard E A (2001) Xenobiotic Induction of Cytochrome P450 2B1 (CYP2B1) Is Mediated by the Orphan Nuclear Receptor Constitutive Androstane Receptor (CAR) and Requires Steroid Co-Activator 1 (SRC-1) and the Transcription Factor Sp1. Biochem J 355:71-78.

Murray M, Fiala-Beer E and Sutton D (2003) Upregulation of Cytochromes P450 2B in Rat Liver by Orphenadrine. Br J Pharmacol 139:787-796.

Nakajima T and Aoyama T (2000) Polymorphism of Drug-Metabolizing Enzymes in Relation to Individual Susceptibility to Industrial Chemicals. Ind Health 38:143-152.

Pascussi JM, Gerbal-Chaloin S, Drocourt L, Assenat E, Larrey D, Pichard-Garcia L, Vilarem M J and Maurel P (2004) Cross-Talk Between Xenobiotic Detoxication and Other Signalling Pathways: Clinical and Toxicological Consequences. Xenobiotica 34:633-664.

Prufer K, Schroder C, Hegyi K and Barsony J (2002) Degradation of RXRs Influences Sensitivity of Rat Osteosarcoma Cells to the Antiproliferative Effects of Calcitriol. Mol Endocrinol 16:961-976.

Qatanani M and Moore D D (2005) CAR, the Continuously Advancing Receptor, in Drug Metabolism and Disease. Curr Drug Metab 6:329-339.

Qatanani M, Zhang J and Moore D D (2005) Role of the Constitutive Androstane Receptor in Xenobiotic-Induced Thyroid Hormone Metabolism. Endocrinology 146:995- 1002.

232

Schipper HM (1988) Sex Hormones in Stroke, Chorea, and Anticonvulsant Therapy. Semin Neurol 8:181-186.

Shiraki T, Sakai N, Kanaya E and Jingami H (2003) Activation of Orphan Nuclear Constitutive Androstane Receptor Requires Subnuclear Targeting by Peroxisome Proliferator-Activated Receptor Gamma Coactivator-1 Alpha. A Possible Link Between Xenobiotic Response and Nutritional State. J Biol Chem 278:11344-11350.

Simonsson US, Lindell M, Raffalli-Mathieu F, Lannerbro A, Honkakoski P and Lang M A (2006) In Vivo and Mechanistic Evidence of Nuclear Receptor CAR Induction by Artemisinin. Eur J Clin Invest 36:647-653.

Soloway RD (1996) The Increasingly Complex Molecular Life Cycle of Bilirubin. Gastroenterology 110:2013-2014.

Squires EJ, Sueyoshi T and Negishi M (2004) Cytoplasmic Localization of Pregnane X Receptor and Ligand-Dependent Nuclear Translocation in Mouse Liver. J Biol Chem 279:49307-49314.

Sueyoshi T, Kawamoto T, Zelko I, Honkakoski P and Negishi M (1999) The Repressed Nuclear Receptor CAR Responds to Phenobarbital in Activating the Human CYP2B6 Gene. J Biol Chem 274:6043-6046.

Takahashi T, Moriyama Y, Ikari A, Sugatani J, Suzuki T and Miwa M (2008) Surface Localization of the Nuclear Receptor CAR in Influenza A Virus-Infected Cells. Biochem Biophys Res Commun 368:550-555.

Tsai MJ and O'Malley B W (1994) Molecular Mechanisms of Action of Steroid/Thyroid Receptor Superfamily Members. Annu Rev Biochem 63:451-486.

233

Wang H, Faucette S, Moore R, Sueyoshi T, Negishi M and LeCluyse E (2004) Human Constitutive Androstane Receptor Mediates Induction of CYP2B6 Gene Expression by Phenytoin. J Biol Chem 279:29295-29301.

Wen YD, Perissi V, Staszewski L M, Yang W M, Krones A, Glass C K, Rosenfeld M G and Seto E (2000) The Histone Deacetylase-3 Complex Contains Nuclear Receptor Corepressors. Proc Natl Acad Sci U S A 97:7202-7207.

Wright E, Vincent J and Fernandez E J (2007) Thermodynamic Characterization of the Interaction Between CAR-RXR and SRC-1 Peptide by Isothermal Titration Calorimetry. Biochemistry 46:862-870.

Wyde ME, Bartolucci E, Ueda A, Zhang H, Yan B, Negishi M and You L (2003) The Environmental Pollutant 1,1-Dichloro-2,2-Bis (p-Chlorophenyl)Ethylene Induces Rat Hepatic Cytochrome P450 2B and 3A Expression Through the Constitutive Androstane Receptor and Pregnane X Receptor. Mol Pharmacol 64:474-481.

Wyde ME, Kirwan S E, Zhang F, Laughter A, Hoffman H B, Bartolucci-Page E, Gaido K W, Yan B and You L (2005) Di-n-Butyl Phthalate Activates Constitutive Androstane Receptor and Pregnane X Receptor and Enhances the Expression of Steroid- Metabolizing Enzymes in the Liver of Rat Fetuses. Toxicol Sci 86:281-290.

Xia J and Kemper B (2005) Structural Determinants of Constitutive Androstane Receptor Required for Its Glucocorticoid Receptor Interacting Protein-1-Mediated Nuclear Accumulation. J Biol Chem 280:7285-7293.

Yamamoto Y, Kawamoto T and Negishi M (2003) The Role of the Nuclear Receptor CAR As a Coordinate Regulator of Hepatic Gene Expression in Defense Against Chemical Toxicity. Arch Biochem Biophys 409:207-211.

Zhang J, Hu X and Lazar M A (1999) A Novel Role for Helix 12 of Retinoid X Receptor in Regulating Repression. Mol Cell Biol 19:6448-6457.

Zhang J, Huang W, Chua S S, Wei P and Moore D D (2002) Modulation of Acetaminophen-Induced Hepatotoxicity by the Xenobiotic Receptor CAR. Science 298:422-424.

234

APPENDIX G:

HUMAN SUBJECTS AND ANIMAL RESEARCH APPROVAL

Animal studies were approved by the Institutional Animal Care and Use Committee of the University of Arizona, under the protocols 07-012 “Hepatoprotective Mrp3” and 08-

117 “Pesticide Interactions with Human Metabolizing Enzymes.”

Human subjects research was approved by the Institutional Review Board (IRB), Project number 07-0301-01.