Herpes Virus Infected with Kaposi's Sarcoma-Associated Impaired CTL

Impaired CTL Recognition of Cells Latently Infected with Kaposi’s Sarcoma-Associated Herpes Virus1

Christian Brander,2* Todd Suscovich,2* Yun Lee,* Phuong Thi Nguyen,* Paula O’Connor,*† Joerg Seebach,‡ Norman G. Jones,* Mark van Gorder,* Bruce D. Walker,* and David T. Scadden3*†

Kaposi’s sarcoma-associated herpes virus (KSHV) is a recently identified human ␥2-herpesvirus associated with Kaposi’s sarcoma, primary effusion lymphoma, and Castleman’s disease. We reasoned that CTL responses may provide host defense against this virus, and consequently, KSHV may have evolved strategies to evade the CTL-mediated immune surveillance. In this study six B cell lines latently infected with KSHV were found to express reduced levels of HLA class I surface molecules compared with B cell lines transformed by the related ␥-herpesvirus EBV. KSHV-infected cells also required higher concentrations of soluble peptides to induce efficient CTL-mediated lysis than control cell lines and were unable to process and/or present intracellularly expressed Ag. Incubation of the KSHV-infected cell lines with high concentrations of soluble HLA class I binding peptides did not restore the deficient HLA class I surface expression. To assess the underlying mechanisms of these phenomena, TAP-1 and TAP-2 gene expression was analyzed. While no attenuation in TAP-2 expression was observed, TAP-1 expression was significantly reduced in all KSHV cell lines compared with that in controls. These results indicate that KSHV can modulate HLA class I-restricted Ag presentation to CTL, which may allow latently infected cells to escape CTL recognition and persist in the infected host. The Journal of Immunology, 2000, 165: 2077–2083.

he immune response to viral infections includes the in- specific T cell responses in KSHV-infected individuals have duction of virus-specific CTL. Many viral pathogens have recently been described (12, 13). The relationship between the de- T evolved immunomodulatory mechanisms that can medi- gree of immunosuppression and the occurrence of KSHV- ate evasion from this immune surveillance, including sequence associated diseases suggests that T cell-mediated immune sur- variability in the targeted CTL epitope, down-regulation of MHC veillance of KSHV may play an important role in virus control class I expression, and inhibition of Ag processing (1–4). Al- (14–17). As a consequence, KSHV may be under significant though retroviruses may exploit the variability of their small ge- immune pressure in healthy individuals and may have developed nomes to escape immune surveillance, DNA viruses with typically strategies to evade immune surveillance, especially the surveil- lower genome variability but larger coding capacities can accom- lance by CD8ϩ CTL (4). modate an array of genes encoding for proteins that may specifi- Here we investigate the ability of KSHV to modulate HLA class cally modulate immune recognition and undermine the effective- I surface expression and HLA class I Ag processing/presentation ness of virus-specific effector cells (2–4). Such mechanisms have in latently infected cells. Six KSHV-infected cell lines, obtained been well documented for EBV (5), CMV (6), HSV, and adeno- from primary effusion lymphomas from three HIV-1-infected and virus (7), but immune modulation by Kaposi’s sarcoma-associated three HIV-1-negative individuals, were tested for HLA class I sur- herpes virus (KSHV)4 has not been reported. face expression, and their sensitivity to CTL-mediated lysis was KSHV is a member of the ␥2-herpesvirus family and has been assessed. Analyses of surface HLA class I stabilization by soluble shown to be closely related to herpesvirus saimiri, rhesus monkey peptides, processing and presentation of intracellularly expressed rhadinovirus, and EBV (8–10). Seroepidemiologic data have as- Ag, and TAP-1/TAP-2 gene expression patterns indicate a mech- sociated KSHV with Kaposi’s sarcoma (KS), multicentric Castle- anism(s) by which KSHV may mediate immune regulatory effects. man’s disease, and primary effusion lymphomas (11), and virus-

*Partners AIDS Research Center and †Massachusetts General Hospital Cancer Cen- Materials and Methods ter, Massachusetts General Hospital and Harvard Medical School, Boston, MA Cell lines 02129; and ‡Universitaets Spital Zurich, University of Zurich, Zurich, Switzerland Received for publication April 10, 2000. Accepted for publication May 23, 2000. KSHV-infected cell lines and EBV-transformed B lymphoblastoid cell lines were obtained from American Type Culture Collection (Manassas, The costs of publication of this article were defrayed in part by the payment of page VA) or generated in our laboratory and were maintained as previously charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. described (18). PCR-based HLA typing of the cell lines was performed by 1 the Massachusetts General Hospital HLA-typing laboratory, and molecular This work was supported by National Institutes of Health Grants CA73580 and HLA-A2 subtyping was performed as described previously (19). The CA78378 and the Richard Saltonstall Charitable Trust. KSHV-infected, EBV-negative cell line VG-1 and the autologous EBV- 2 C.B. and T.S. contributed equally to this work. transformed control cell line B301 were derived from a cardiac transplant 3 Address correspondence and reprint requests to Dr. David T. Scadden, AIDS Re- patient of Haitian descent who developed KS and a primary effusion lym- search Center, Massachusetts General Hospital, 149 13th Street, #5212, Boston, MA phoma (20). The presence or absence of the KSHV and EBV genomes in 02129. E-mail address: [email protected] these cell lines was determined by nested PCR using primers located in the 4 Abbreviations used in this paper: KSHV, Kaposi’s sarcoma-associated herpes virus; ORF26 region of KSHV (8) and EBNA-3A of EBV type 1 and type 2 (21). KS, Kaposi’s sarcoma; VV, vaccinia virus; ER, endoplasmic reticulum; HCV, hep- PCR analysis demonstrated that all the control EBV-transformed B cell atitis C virus. lines were KSHV negative.

Table I. HLA types of KSHV- and EBV-infected cell lines

Cell Line KSHV EBV HLA-A HLA-B HLA-C DR

VG-1 ϩϪ0201, 34 45, 52 16, – 17, 13 BCP-1 ϩϪ24, 68 38, 44 5, 12 8, 14 BCBL-1 ϩϪ1, 31 51, 55 3, 15 14, 15 BC-3 ϩϪ2, 3 50, 64 6, 8 1, 7 BC-1 ϩϩ0201, – 44, 57 5, 6 4, 7 BC-2 ϩϩ2, 26 44, 49 4, 7 4, 7 B301 Ϫϩ0201, 34 45, 52 16, – 17, 13 161j Ϫϩ0201, 3 7, 60 3, 7 2, 4 EBV LWS Ϫϩ1,3 8,51 7,15 ND 221L Ϫϩ2, 3 7, 8 7, 8 15, 17 115i Ϫϩ2, 28 14, 52 8, – 1, 2

FACS analysis of HLA class I expression tion. PCR conditions were as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 50°C for 1 min, and 72°C for 2 min; and 72°C for 10 min for all HLA class I surface expression was analyzed using an FITC-labeled mAb three primer pairs. Products were visualized on a 2% (w/v) agarose gel and (W6/32) specific for HLA class I obtained from PharMingen (San Diego, stained with ethidium bromide. Pictures were taken with Polaroid type 665 CA). Staining was performed as described previously (22). The TAP-de- film (Polaroid, Bedford, MA). Negatives were scanned using an HP 6200C/ ficient T2 cell line and its parental TAP-expressing cell line T1 (23) as well 6250C scanner (Hewlett-Packard, Palo Alto, CA), and bands were quan- as VG-1 and B301 cells were used for an HLA class I cell surface stabi- titated using National Institutes of Health Image software (http://rsb.info- lization assay (22, 24). The cells were incubated with the HLA-A*0201 .nih.gov/nih-image). Each gel was analyzed three times for calculation of binding peptide SL9 (HIV-1 Gag, p17 aa 77–85, SLYNTVATL) at con- the TAP/GAPDH ratios. Statistical analysis used two-sided Student’s t test ␮ centrations from 8 to 220 g/ml for4horwere incubated at 26°C over- and was based on four and three independent experiments for TAP-1 and night and then stained for HLA class I cell surface expression using mAb TAP-2, respectively. W6/32 (22). The experiments were conducted in duplicate and included Ig control staining as well as cells that were incubated without peptide. Results Synthetic peptides and recombinant vaccinia virus constructs HLA class I surface expression by KSHV-infected cell lines The ability to present viral epitopes for CTL-mediated lysis was deter- Human herpesviruses such as EBV and CMV have been shown to mined using virus-specific CTL clones and synthetic viral peptides. Peptide profoundly affect the recognition of virus-infected cells by HLA SLYNTVATL (SL9, HIV-1 p17, aa 77–85) was previously found to be the ϩ immunodominant HLA-A*0201-restricted, optimal CTL epitope in HIV-1 class I-restricted, CD8 CTL. To investigate whether KSHV also infection (19, 25). The 126E epitope is derived from HIV-1 envelope pro- has the potential ability to impair CTL recognition, latently tein (557–565, RAIEAQQHL) and is restricted by HLA-B51 (26). These KSHV-infected cells were assessed for their HLA class I surface epitopes are also expressed by the recombinant vaccinia virus (VV) con- expression and the ability to process and present Ag. Five KSHV- structs, vp141 and vpe11, respectively. In addition, an hepatitis C virus infected cell lines obtained from American Type Culture Collec- (HCV)-derived, HLA-A*0201-restricted epitope located in HCV NS5B (ALYDVVTKL) was included in these analyses (27). tion and one cell line (designated VG-1) established in our laboratory (Table I) were examined by FACS analysis for cell surface Cytotoxicity assays and peptide titrations HLA class I expression. The mean fluorescence intensity of stained CTL-mediated killing of 51Cr-labeled KSHV-infected and uninfected con- cells was compared with the intensity of HLA class I stained B trol target cells was tested in standard 51Cr release assays using varying E:T cells transformed by the closely related ␥-herpesvirus EBV. In all cell ratios as previously described (19). In one set of experiments KSHV- cases, KSHV-infected cell lines expressed consistently lower lev- 51 infected cell lines and uninfected control cell lines were labeled with Cr, els of surface HLA class I than BLCL controls (Fig. 1). The most pulsed with peptide (200 ␮g/ml) for 90 min, washed three times, and used as targets for CTL clones. For the peptide titration experiments, the pep- profound down-regulation of HLA class I expression was observed tides were titrated directly into the assays at final concentrations ranging in the VG-1 cell line, which exhibited Ͻ10% of the FACS inten- from 100 ␮g/ml to 10 pg/ml and incubated with previously 51Cr-labeled sity seen in the autologous, KSHV-negative, EBV-positive cell target cells alone for 45 min before addition of the effector cells. Specific line B301. The consistently lower HLA class I surface expression CTL clones were used at the indicated E:T cell ratios, and the assays were runfor4hat37°C. by KSHV-infected cell lines was not affected by EBV coinfection, as the dually infected BC-1 and BC-2 cell lines showed class I Semiquantitative RT-PCR for TAP1 and TAP2 levels comparable to those in KSHV-infected, EBV-negative cell Total RNA was isolated from the KSHV- and EBV-infected control B cell lines. lines using RNA STAT-60 (Tel-Test, Friendswood, TX) as recommended by the manufacturer. Five micrograms of RNA was used to generate cDNA CTL-mediated killing of peptide-pulsed, KSHV-infected target using the Superscript preamplification kit (Life Technologies, Gaithers- cells burg, MD). Following termination of the RT, the RNA was digested with 2 U of RNase H (Life Technologies) at 37°C for 30 min, and the cDNA To test whether the reduced HLA class I surface expression on was purified using a Qiaquick PCR purification column (Qiagen, Chats- latently KSHV-infected cell lines decreases their susceptibility to worth, CA). PCR reaction conditions were as follows: 50 mM KCl, 10 mM CTL-mediated lysis, HLA-A*0201-expressing cell lines were Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.001% (w/v) gelatin, 0.5 U AmpliTaq ␮ pulsed with a high concentration of the soluble, HLA-A*0201- Gold (Perkin-Elmer, Norwalk, CT), 0.4 mM dNTP, 0.1 M of each primer, ␮ and 1.5 ␮l of 1/10 diluted cDNA/25 ␮l of reaction. The following primers restricted, HIV-1 Gag-derived SL9 peptide (200 g/ml) and incu- were used: TAP1–5Ј, CGCCTCTCGCTGTTCCTG; TAP1–3Ј, GAGTT bated with an SL9 peptide-specific CTL clone. All the HLA- GACTGCATAGGCCACA; TAP2–5Ј, CACGGCTGAGCTCGGATAC A*0201-expressing cell lines were killed by this CTL clone, CAC; TAP2–3Ј, CAGCTCAGCATCAGCATCTGC; GAPDH-5Ј, CATAGT whereas HLA-A*0201-negative cell lines (BCBL-1) and HLA- GGGGTGGTGAATAC; and GAPDH-3Ј, CCCAATACGACCAAATCTAA. The positions of these primers were chosen to rule out potential artifacts due A*0201-positive cell lines pulsed with control peptides were not to the presence of genomic DNA in the RNA preparation (28). Cycle num- lysed (Fig. 2). The same was seen when the HLA-B51-expressing bers were optimized to be in the exponential phase of the PCR amplifica- BCBL-1 cell line was pulsed with an HLA-B51-restricted CTL The Journal of Immunology 2079

FIGURE 1. Reduced HLA class I expression by KSHV-infected cell lines. KSHV-infected cell lines as well as cells transformed by the related ␥-herpesvirus EBV were compared for HLA class I surface expression. The inserted numbers indicate the mean ﬂuorescence intensity of cells stained with the HLA class I-speciﬁc mAb W6/ 32. They gray lines indicate staining with the Ig control mAb.

epitope and incubated with a peptide-specific, HLA-B51-restricted Processing and presentation of intracellularly synthesized Ag by CTL clone (data included in Fig. 4). Since the CTL clones used in KSHV-infected cell lines these studies can be inhibited by EGTA, indicating that they may The decreased surface expression of class I molecules by KSHV- lyse target cells by the perforin pathway (29) (C. Brander, unpub- infected cells may have multiple causes, including deficient TAP lished observations), these data suggest that latently KSHV-in- function or impaired Ag-processing capacity which, alone or in fected cell lines are susceptible to perforin mediated lysis, at least concert, may limit the peptide supply to the endoplasmic reticulum when high concentrations of soluble peptides are used. (ER) and thereby reduce the transport rate of HLA class I mole- To analyze whether the reduced HLA class I expression is a cules to the cell surface (3). To investigate possible defects in the limiting factor at lower Ag concentrations, peptide titration assays Ag-processing machinery in KSHV-positive cell lines, the cell were performed using the BCBL-1 and VG-1 cell lines and par- lines were infected with a recombinant VV construct to express tially HLA-matched control B-LCL. VG-1, B301, 115 B-LCL, and viral Ag intracellularly and were analyzed for the presentation of 161j B-LCL all express HLA-A*0201 and were thus tested for recognition by HLA-A*0201-restricted CTL clones in the pres- antigenic peptide on HLA class I. Specifically, the HLA-B51- ence of decreasing amounts of the cognate HLA-A*0201-re- matched BCBL-1 (KSHV-positive) and EBV LWS (KSHV-neg- stricted peptides. Similarly, BCBL-1 and the EBV LWS cell lines ative) cell lines were infected either with the VV construct vpe-11 both express HLA-B51 and were thus tested for recognition by the expressing the HIV-1 envelope protein or with a control VV con- HLA-B51-restricted clone SE7 (26) after incubating the cells with struct (VV-NYCBH) and were subsequently tested for recognition the HLA-B51-restricted peptide 126E. The data in Fig. 3 show that by the HLA-B51-restricted CTL clone SE7, specific for the enve- the control target cells (B301, 115, 161j, and LWS) were readily lope-derived peptide 126E. Fig. 4A demonstrates that EBV LWS lysed by peptide-specific CTL at low peptide concentrations. The control cells were efficiently killed when presenting the HIV-1 peptide concentrations required for half-maximal lysis of the con- envelope-derived 126E peptide, either added as a soluble peptide trol targets varied significantly in these assays, most likely reflect- or expressed by the vpe-11 VV construct. EBV LWS cells without ing different peptide and TCR affinities (19). In contrast, the the peptide or infected with the control VV construct were not KSHV-infected cell lines were either weakly killed at highest pep- killed. In contrast, BCBL-1 cells were lysed only when pulsed with tide concentrations (Fig. 3, A and B) or reached only lower levels the soluble peptide, but not when infected with the vpe-11 VV of maximal killing compared with the control cell lines despite construct. similar peptide concentrations required for half-maximal lysis These experiments were also performed with cell lines express- ϩ (Fig. 3, C and D). These results demonstrate that KSHV-infected ing the HLA-A*0201 allele, including the KSHV VG-1 and cells can be killed by CTL, but that they present soluble antigenic BC-1 cell lines, a negative control cell line (the TAP-deficient T2 peptide less efficiently than KSHV-negative B-LCL, indicating cell line), and positive control cell lines B301, 221L, and the TAP- that the decreased HLA class I expression has functional conse- expressing T1 cell line (23). These cell lines were infected with a quences at limiting peptide concentrations. control VV construct (NYCBH) or an HIV-1 Gag-expressing VV

FIGURE 2. CTL lysis and HLA class I surface expression of HLA-A*0201-positive KSHV cell lines. Three KSHV-infected cell lines (VG-1, BC-1, BC3) and two KSHV- free, HLA-A*0201-expressing cell lines (115, T1) were pulsed with the HLA-A*0201-restricted HIV-Gag p17-derived peptide SL9 for 90 min and labeled with 51Cr. These target cells were then used in a standard chromium release assay to assess the susceptibility to CTL-mediated lysis by an HLA0A*0201 restricted, SL9-speciﬁc CTL clone. In parallel, the same cell lines were analyzed for HA class I surface expression by FACS analysis as described in Fig. 1. 2080 INHIBITION OF Ag PRESENTATION BY KSHV

FIGURE 3. Reduced susceptibility of KSHV-infected cell lines to CTL-mediated lysis. 51Cr-labeled KSHV-infected cell lines and partially HLA-matched KSHV-negative control cell lines were incubated with soluble peptides at decreasing concentrations for 45 min before addition of peptide-specific CTL at the indicated E:T ratio. Supernatant was harvested after 4 h and assayed on a gamma counter. All the target cell lines used in A, B, and C express HLA- A*0201 and were tested for recognition by HLA-A*0201-restricted CTL clones specific for peptide SL9 (HIV-1 Gag; A and C) or the HCV-derived peptide 97AP1- 1 (B). D, Both target cell lines express HLA-B51 and were tested for recognition by the HLA-B51-restricted, HIV-1 Env-specific CTL clone SE7.

construct (VV-vp141) and used as targets in cytotoxicity assays VV constructs. The KSHV-infected cell lines VG-1 and BC-1 as together with CTL clones specific for the HIV-1 Gag-derived, well as the TAP-deficient cell line T2 were not killed after infec- HLA-A*0201-restricted SL9 peptide. An aliquot of target cells tion with the Gag-expressing VV construct vp141 (Fig. 4B), was removed before 51Cr labeling and stained for intracellular whereas control cell lines were lysed. The simultaneous FACS HIV-1 Gag expression to demonstrate successful infection with the analyses showed that at least BC-1 cells expressed the VV-encoded Gag protein in amounts comparable to control cell lines T1, 221L, and B301, which were readily killed (Fig. 5). No specific killing was observed for the TAP-deficient T2 cell line, although it expressed significant amounts of p24. The expression of p24 in VG-1 cells was weak, making it difficult to interpret the relative contribution of low Ag concentration (Fig. 5) and reduced HLA class I expression (Fig. 1) to the absence of cell killing. Together, these data demonstrate that although KSHV-infected cell lines are susceptible to CTL-mediated lysis and are infectable with VV constructs and synthesize VV-encoded antigenic proteins, they do not present the immunogenic peptide efficiently to Ag-specific CTL.

Up-regulation of HLA class I surface expression by incubation with soluble peptides and IFN-␥ Several mechanisms of viral evasion from CTL recognition have been described (3, 4). These include impaired assembly and transport of HLA class I molecules, but many of these strategies also involve the TAP-mediated translocation of processed peptide into the ER (6, 7, 30–32). Retention of HLA class I molecules in the ER and rapid degradation of HLA class I heavy chain mediated by viral proteins have been described previously (6, 30–33). Alter- natively, impaired TAP function can be achieved by reduced TAP expression (34) or physical blockade of the TAP molecule (31, 32). Subsequently, if no processed peptide is transported into the ER, as is the case in the TAP-deﬁcient T2 cell line (35), the few FIGURE 4. Impaired Ag processing by KSHV-infected cell lines. A, class I molecules that reach the cell surface are empty and decay HLA-B51 expressing BCBL-1 and EBV LWS cells were pulsed without rapidly. However, they can be stabilized when HLA class I binding (Ⅺ) or with (f) 200 ␮g/ml of the HIV envelope-derived peptide 126E or peptides are added at high concentration or when the cells are Ⅺ f were infected with control NYCBH ( ) or HIV-1 Env-expressing ( )VV incubated at reduced temperature (24). and tested for recognition by the HLA-B51-restricted CTL clone SE7. B, To investigate the potential contribution of such a mechanism(s) Cell lines were pulsed with SL9 peptide (data not shown) or were infected with VV-HIV-1-Gag (f) or control NYCBH (f) and incubated with CTL to immune evasion by KSHV, several hypothesis were tested: ␥ clone XA14 speciﬁc for the HIV-1 Gag-derived SL9 epitope. After 4 h KSHV-infected cells were incubated with IFN- to up-regulate supernatant was harvested, and the amount of released 51Cr was deter- HLA class I gene expression; HLA class I stabilization assays mined. One experiment representative of three is shown. were performed to see whether empty HLA class I molecules reach The Journal of Immunology 2081

FIGURE 5. Intracellular expression of HIV-1 Gag p24 in target cell lines. HLA-A*0201-expressing, KSHV-positive cell lines, VG-1 and BC-1; two KSHV-negative EBV cell lines, B301 and 221L; and the T1/T2 cell line pair were infected with VV-Gag and stained for intracellular p24 production by intracellular FACS analysis. Black curves show staining with the PE-labeled, HIV-Gag p24-speciﬁc mAb; gray curves indicate the staining using a isotype control Ab.

the cell surface, and TAP1 and TAP-2 gene expression was as- (data not shown). These data demonstrate that VG-1 cells differ sessed in a semiquantitative approach. from T2 cells as they do not transport unstable HLA class I mol- To test whether IFN-␥ treatment of VG-1 cells (the KSHV- ecules to the surface, suggesting that if TAP function is involved infected cell line with the most profound HLA down-regulation) in the reduced HLA class I expression on KSHV-infected cells, it could restore surface HLA class I expression, these cells were is not the only factor responsible for this effect. incubated with IFN-␥ for 72 h and analyzed by FACS for surface To further address whether TAP function/expression may be HLA class I expression. A consistent 3-fold increase in HLA class impaired by KSHV infection, TAP-1 and TAP-2 gene expression I staining was observed for IFN-␥-treated VG-1 cells (data not was compared between latently KSHV-infected and KSHV-nega- shown), suggesting that in VG-1 cells at least a partial restoration tive cell lines. To this end, RT-PCR for the TAP-1, TAP-2, and of HLA class I surface expression can be achieved by IFN-␥ GAPDH genes were performed, and the amount of PCR products treatment. was assessed by quantitative densitometry. Ratios of the amount of To indirectly assess TAP function in these cells, VG-1 and the TAP-1/GAPDH and TAP-2/GAPDH specific PCR amplification TAP-deficient T2 cells were either incubated with high concentra- were used to calculate the relative abundance of the gene-specific tions of the HLA-A*0201-binding SL9 peptide at reduced (26°C) mRNAs in the different cell lines (Table II). TAP-1 gene expres- temperature for4horwere kept overnight at 26°C and analyzed sion was significantly lower in the KSHV-infected cells than in the by FACS for surface HLA class I expression (22, 24). T2 cells five cell lines transformed with the related ␥-herpesvirus EBV showed a peptide concentration-dependent increase in HLA class ( p ϭ 0.0005, average of four independent experiments, by Stu- I surface expression, but this treatment had no effect on the class dent’s t test). TAP-1/GAPDH ratios ranged from 0.95 to 2.18 (av- I expression by VG-1 cells (Fig. 6). Overnight incubation at 26°C erage, 1.37 Ϯ 0.4) in the KSHV cell lines compared with a range was also ineffective in up-regulating class I expression on VG-1 Table II. TAP-1 and TAP-2 expression in KSHV- and EBV-infected cell lines

TAP-1/GAPDHa TAP-2/GAPDH

KSHV lines VG-1 0.95 Ϯ 0.45 1.43 Ϯ 0.22 BC-1 1.29 Ϯ 0.37 1.35 Ϯ 0.49 BC-2 1.26 Ϯ 0.38 0.67 Ϯ 0.06 BC-3 2.18 Ϯ 1.18 1.88 Ϯ 0.19 BCP-1 1.02 Ϯ 0.45 0.57 Ϯ 0.05 BCBL-1 1.49 Ϯ 0.43 0.87 Ϯ 0.26 Average 1.36 Ϯ 0.44 1.12 Ϯ 0.5

EBV lines B301 2.33 Ϯ 0.82 1.83 Ϯ 0.08 221L 2.46 Ϯ 1.26 0.69 Ϯ 0.15 115 2.8 Ϯ 0.91 1.82 Ϯ 0.32 15760 2.46 Ϯ 0.93 0.74 Ϯ 0.15 16842 2.48 Ϯ 1.51 1.35 Ϯ 0.34 FIGURE 6. Up-regulation of HLA class I after incubation with soluble Average 2.51 Ϯ 0.17 1.28 Ϯ 0.55 peptide. T2 and VG-1 cells were incubated for4hat26°C with the indicated amount of the HIV-1 Gag-derived SL9 peptide and stained for HLA p valueb 0.0005 0.6 class I surface expression using the FITC-labeled W6/32 mAb (filled sym- a bols) or a FITC-labeled Ig control Ab (open symbols). The mean fluores- The average of four independent experiments for TAP-1 and three experiments for TAP-2 are shown. cence intensities from three different experiments conducted in duplicate b The p value was calculated using the two-tailed Student t test with equal variance were averaged, and the SD is shown. based on three or four independent experiments. 2082 INHIBITION OF Ag PRESENTATION BY KSHV of 2.33 to 2.80 (average, 2.51 Ϯ 0.17) for the EBV-transformed tracellular Ag for CTL-mediated lysis, which was in strong con- control cell lines. TAP-2 gene expression did not vary significantly trast to the control EBV cell lines, which were all readily killed by between the different cell types ( p ϭ 0.8), and the ratios were Ag-specific CTL. These results suggest that Ag processing by the similar for KSHV cell lines (average, 1.13 Ϯ 0.5) and the EBV cell proteasome, translocation of the processed peptide into the ER, or lines (1.28 Ϯ 0.55). TAP-2/GAPDH ratios were determined from assembly and maturation of the HLA class I molecules could be three independent experiments, and the TAP-deficient T2 cell line defective. Alternatively, the synthesis of HLA class I molecules was included in all experiments as a negative control and did not could be abrogated in KSHV-infected cells. However, semiquan- show any PCR amplification products for TAP-1 or TAP-2. These titative RT-PCR analysis for HLA-A, -B, and -C alleles revealed data indicate that TAP-1 gene expression is reduced in KSHV- no differences between KSHV- and EBV-transformed B cell lines infected cells, which may be part of the KSHV-mediated immune (T. Suscovich et al., manuscript in preparation). modulation. To further define the immune modulatory mechanism(s) em- ployed by KSHV, the effects of IFN-␥ and high concentrations of Discussion soluble peptide on surface HLA class I expression were studied. In this study evidence is presented indicating impaired CTL rec- The IFN-␥ treatment of VG-1 cells, but not B301 control cells, led ognition of KSHV-infected cell lines. The examination of six to a 3-fold increase in HLA class I surface expression. These data KSHV-infected cell lines shows that these cells 1) have a reduced suggest that the expression of HLA class I, TAP-1, or any other level of HLA class I surface expression compared with a related component of the HLA class I Ag processing pathway was at least ␥-herpesvirus, EBV; 2) are subject to CTL-mediated cell lysis, but partly restored upon IFN-␥ treatment, leading to enhanced assem- require high peptide concentrations to trigger lysis; and 3) have bly, peptide loading, and export of HLA class I molecules. In impaired ability to process/present intracellularly expressed Ag. addition, IFN-␥ could have a direct or indirect anti-viral effect and The mechanism(s) responsible for the reduced class I expression change KSHV gene expression, reverting the KSHV-mediated ef- and impaired Ag processing involves in part deficient TAP-1 ex- fect. Further investigation of gene expression patterns will be nec- pression, but may well be multifactorial and may include the syn- essary to understand the IFN-␥-mediated effect on HLA class I thesis or maturation of HLA class I molecules. expression. Furthermore, additional analyses will be required to Reduced HLA class I surface expression by virus-infected cells investigate whether all HLA class I alleles are subject to KSHV- has been described for a number of viruses, including human her- mediated down-regulation or whether HLA-C and HLA-E alleles, pesviruses (2). The mechanisms leading to this reduction are vari- which are the primary regulatory molecules for NK cell activity, able, but often involve the assembly, peptide loading, and transport remain stably expressed at the cell surface (36). of HLA class I molecules. These mechanisms may be an adaptive The incubation of VG-1 cells with high concentrations of sol- response to the host immune response and allow the virus to evade uble, HLA-A*0201 binding peptide or the incubation of these cells tight immune surveillance to persist in the host (2). Although clin- at reduced temperature failed to enhance surface HLA class I ex- ical evidence suggests that KSHV is under immune pressure, no pression. This is in contrast to the TAP-deficient T2 cell line, reports have been published to date that describe immune evasion which transports empty class I molecules to the cell surface where strategies in latently KSHV-infected cell lines. soluble peptide or reduced temperature can stabilize them, leading We analyzed six KSHV-transformed cell lines by FACS and to enhanced HLA class I surface expression (22, 24). These find- found low levels of HLA class I expressed on the cell surface. ings indicate that in VG-1 cells, no significant amounts of empty Comparison was made to EBV-transformed B cell lines, as both HLA class I molecules reach the cell surface. This also suggests viruses are ␥-herpesviruses, and revealed this to be significant. that peptide loading of class I molecules, and therefore TAP func- Unfortunately, there are currently no applicable models to study in tion, may not be the sole factor leading to the reduced HLA class vitro KSHV infection of cells, and thus direct comparison of the I expression observed in these cells. However, reduced TAP func- same cell line pre- and postinfection with KSHV could not be tion could contribute to impaired assembly of class I molecules by made. Nevertheless, for one KSHV cell line generated in our lab- limiting the supply of processed Ag. Similar mechanisms have oratory (VG-1), an autologous EBV-transformed B cell line was been reported for other herpesviruses, which have been shown to available (B301). The comparison of these two cell lines showed modulate Ag processing at several critical steps by partly redun- marked differences in HLA class I surface expression (Fig. 1), for dant mechanisms (2). It is therefore possible that KSHV can impair which individual genetic differences can be ruled out. Furthermore, multiple levels of the HLA class I Ag presentation pathway by cell lines coinfected with KSHV and EBV (BC-1 and BC-2) reveal modulating the assembly and transport of HLA class I molecules degrees of HLA down-regulation similar to EBV-negative KSHV- and efficient TAP function. infected cell lines, suggesting that EBV coinfection does not revert TAP function can be limited by several mechanisms, including the KSHV-mediated defect in HLA class I surface expression. steric hindrance or reduced TAP gene expression (1, 37). We Latent KSHV-infected cell lines were subsequently used to in- therefore analyzed the TAP expression in KSHV-infected cell vestigate whether the reduced HLA class I expression had func- lines and compared TAP/GAPDH mRNA levels in these cells to tional consequences for CTL-mediated lysis. Although all cell the TAP/GAPDH ratios in EBV-transformed B cell lines. TAP-1 lines tested were killed by CTL, they all required much higher expression was significantly reduced in KSHV cell lines, whereas concentrations of soluble peptide to achieve efficient lysis than are TAP-2 expression was unaltered. The magnitude of differences in typically observed (19). Although peptide- and clone-dependent TAP-1 expression was 2- to 3-fold between the two cell types, differences in the half-maximal lysis were observed, the use of similar to what was observed after IL-10 treatment of murine tu- different peptides and various CTL clones rules out that the ob- mor cells and to what is known to result in negative functional served differences between KSHV and EBV cell lines were due to consequences on Ag presentation (38). No difference between peptide- or clone-specific effects. EBV-positive (BC-1, BC-2) and EBV-negative KSHV cell lines When Ag was expressed intracellularly instead of added as sol- was observed with regard to TAP-1 expression, arguing against an uble peptide, KSHV and EBV cell lines differed even more dra- effect of coinfection with EBV as an explanation for the observed matically in their susceptibility to CTL-mediated lysis. None of the phenomenon. Rather, it is reasonable to hypothesize that KSHV is three KSHV cell lines tested was able to process and present indirectly responsible for altered TAP-1 levels. The Journal of Immunology 2083

The basis for differences in expression of TAP and HLA class I 19. Brander, C., K. E. Hartman, A. K. Trocha, N. G. Jones, R. P. Johnson, B. Korber, molecules between KSHV cell lines is at present unknown. It is P. Wentworth, S. P. Buchbinder, S. Wolinsky, B. D. Walker, et al. 1998. Lack of strong immune selection pressure by the immunodominant, HLA-A*0201 re- possible that epidemiologically different KSHV strains may use stricted CTL response in chronic HIV-1 infection. J. Clin. Invest. 101:2559. distinct immune modulatory mechanisms. For instance, the un- 20. Jones, D., M. E. Ballestas, K. M. Kaye, J. M. Gulizia, G. L. Winters, J. Fletcher, D. T. Scadden, and J. C. Aster. 1998. Primary-effusion lymphoma and Kaposi’s usual phenotype of VG-1, which was derived from a non-AIDS sarcoma in a cardiac-transplant recipient. N. Engl. J. Med. 339:444. patient of Haitian descent, may be characteristic of certain KSHV 21. Sample, J., L. Young, B. Martin, T. Chatman, E. Kieff, A. Rickinson, and strains. Or alternatively molecular attenuation of viral gene prod- E. Kieff. 1990. Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA- 3B, and EBNA-3C genes. J. Virol. 64:4084. ucts capable of affecting Ag presentation accounts for such differ- 22. Brander, C., W. J. Pichler, and G. Corradin. 1995. Identification of HIV-protein ences. The latent membrane protein-1 (LMP-1) gene product of derived CTL epitopes for their potential use as synthetic vaccine. Clin. Exp. EBV, for example, has been described to restore HLA class I Ag Immunol. 101:107. 23. Salter, R. D., and P. Cresswell. 1985. Genes regulating HLA class I antigen expression in type III Burkitt’s lymphoma cells (39–41). Finally, expression in T-B lymphoblast hybrids. Immunogen. 21:235. since KSHV does not encode homologues to proteins in CMV and 24. Ljunggren, H. G., N. J. Stam, C. Ohlen, J. J. Neefjes, P. Hoglund, M. T. Heemels, J. Bastin, T. N. Schumacher, A. Townsend, K. Karre, et al. 1990. Empty MHC EBV that are known to interfere with HLA class I-restricted Ag class I molecules come out in the cold. Nature 346:476. processing, entirely novel mechanisms may be used by KSHV. 25. Goulder, P. J., A. K. Sewell, D. G. Lalloo, D. A. Price, J. A. Whelan, J. Evans, Focusing on unique KSHV-derived coding sequences in Ag-pro- G. P. Taylor, G. Luzzi, P. Giangrande, R. E. Phillips, et al. 1997. Patterns of immunodominance in HIV-1-specific cytotoxic T lymphocyte responses in two cessing/presentation assays may yield insights into unique viral human histocompatibility leukocyte antigens (HLA)-identical siblings with HLA- strategies for eluding host defense. A0201 are influenced by epitope mutation. J. Exp. Med. 185:1423. 26. Sipsas, N. V., S. A. Kalams, A. Trocha, S. He, W. A. Blattner, B. D. Walker, and R. P. Johnson. 1997. Identification of type-specific cytotoxic T lymphocyte re- References sponses to homologous viral proteins in laboratory workers accidentally infected 1. Ploegh, H. L. 1998. Viral strategies of immune evasion. Science 280:248. with HIV-1. J. Clin. Invest. 99:752. 2. Brander, C., and B. D. Walker. 2000. Modulation of the host immune response 27. Lechner, F., D. Wong, P. Dunbar, R. Chapman, R. Chung, P. Dohrenwend, by clinically relevant human DNA and RNA viruses. Curr. Opin. Microbiol. In G. Robbins, R. Phillips, P. Klenerman, and B. Walker. 2000. analysis of suc- press. cessful immune responses in persons infected with hepatitis C virus. J. Exp. Med. 3. Spriggs, M. K. 1996. One step ahead of the game. Annu. Rev. Immunol. 14:101. 191:1499. 4. Johnson, D. C., and A. B. Hill. 1998. Herpesvirus evasion of the immune system. 28. Johnsen, A., J. France, M. S. Sy, and C. V. Harding. 1998. Down-regulation of Curr. Top. Microbiol. Immunol. 232:149. the transporter for antigen presentation, proteasome subunits, and class I major 5. Hill, A. B., S. P. Lee, J. S. Haurum, N. Murray, Q. Y. Yao, M. Rowe, N. Signoret, histocompatibility complex in tumor cell lines. Cancer Res. 58:3660. A. B. Rickinson, and A. J. McMichael. 1995. Class I major histocompatibility 29. Shankar, P., Z. Xu, and J. Lieberman. 1999. Viral-specific cytotoxic T lympho- complex-restricted cytotoxic T lymphocytes specific for Epstein-Barr virus cytes lyse human immunodeficiency virus-infected primary T lymphocytes by the (EBV)-transformed B lymphoblastoid do not recognize B cell lines against which granule exocytosis pathway. Blood 94:3084. they were raised. J. Exp. Med. 181:2221. 30. Ahn, K., A. Angulo, P. Ghazal, P. A. Peterson, Y. Yang, and K. Fruh. 1996. 6. Wiertz, E. J., T. R. Jones, L. Sun, M. Bogyo, H. J. Geuze, and H. L. Ploegh. 1996. Human cytomegalovirus inhibits antigen presentation by a sequential multistep The human cytomegalovirus US11 gene product dislocates MHC class I heavy process. Proc. Natl. Acad. Sci. USA 93:10990. chains from the endoplasmic reticulum to the cytosol. Cell 84:769. 31. Ahn, K., A. Gruhler, B. Galocha, T. R. Jones, E. Wiertz, H. L. Ploegh, 7. Sparer, T. E., and L. R. Gooding. 1998. Suppression of MHC class I antigen P. Peterson, Y. Yang, and K. Frueh. 1997. The ER-luminal domain of the HCMV presentation by human adenoviruses. Curr. Top. Microbiol. Immunol. 232:135. glycoprotein US6 inhibits peptide translocation by TAP. Immunity 6:613. 8. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and 32. Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yowdell, H. Ploegh, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS- D. Johnson. 1995. Herpes simplex virus turns off the TAP to evade host immu- associated Kaposi’s sarcoma. Science 266:1865. nity. Nature 375:411. 9. Levy, J. A. 1997. Three new human herpesviruses (HHV6, 7, and 8). Lancet 33. Bennett, E. M., J. R. Bennink, J. W. Yewdell, and F. M. Brodsky. 1999. Cutting 349:558. edge: adenovirus E19 has two mechanisms for affecting class I MHC expression. 10. Damania, B., M. Li, J. Choi, L. Alexander, J. Jung, and R. Desrosiers. 1999. J. Immunol. 162:5049. Identification of the R1 oncogene and its protein product from the rhadinovirus 34. Zeidler, R., G. Eissner, P. Meissner, S. Uebel, R. Tampe, S. Lazis, and of Rhesus monkeys. J. Virol. 73:5123. W. Hammerschmidt. 1997. Downregulation of TAP1 in B lymphocytes by cel- 11. Cesarman, E., and D. M. Knowles. 1997. Kaposi’s sarcoma-associated herpes- lular and Epstein Barr virus-encoded interleukin-10. Blood 90:2390. virus: a lymphotropic human herpesvirus associated with Kaposi’s sarcoma, pri- 35. Salter, R. D., D. N. Howell, and P. Cresswell. 1985. Genes regulating HLA class mary effusion lymphoma, and multicentric Castleman’s disease. Semin. Diagn. I antigen expression in T-B lymphoblast hybrids. Immunogenetics 21:235. Pathol. 14:54. 36. Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen, 12. Strickler, H. D., J. J. Goedert, F. R. Bethke, C. M. Trubey, T. R. O’Brien, J. L. Strominger, and D. Baltimore. 1999. The selective downregulation of class J. Palefsky, J. E. Whitman, D. Ablashi, S. Zeichner, and G. M. Shearer. 1999. I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells Human herpesvirus 8 cellular immune responses in homosexual men. J. Infect. from NK cells. Immunity 10:661. Dis. 180:1682. 37. Pamer, E., and P. Cresswell. 1998. Mechanisms of MHC class I-restricted antigen 13. Osman, M., T. Kubo, J. Gill, F. Neipel, M. Becker, G. Smith, R. Weiss, processing. Annu. Rev. Immunol. 16:323. B. Gazzard, C. Boshoff, and F. Gotch. 1999. Identification of human herpesvirus 38. Salazar-Onfray, F., J. Charo, M. Petersson, S. Freland, G. Noffz, Z. Qin, 8-specific cytotoxic T-cell responses. J. Virol. 73:6136. T. Blankenstein, H. G. Ljunggren, and R. Kiessling. 1997. Down-regulation of 14. Biggar, R. J., and C. S. Rabkin. 1992. The epidemiology of acquired immuno- the expression and function of the transporter associated with antigen processing deficiency-related lymphomas. Curr. Opin. Oncol. 4:883. in murine tumor cell lines expressing IL-10. J. Immunol. 159:3195. 15. Shapiro, R. S., K. McClain, G. Frizzera, G. Gajl-Peczalska, J. H. Kersey, 39. Rowe, M., R. Khanna, C. A. Jacob, V. Argaet, A. Kelly, S. Powis, M. Belich, B. R. Blazar, D. C. Arthur, D. F. Patton, J. S. Greenberg, and B. Burke. 1988. D. Croom-Carter, S. Lee, S. R. Burrows, et al. 1995. Restoration of endogenous Epstein-Barr virus associated B cell lymphoproliferative disorders following antigen processing in Burkitt’s lymphoma cells by Epstein-Barr virus latent mem- bone marrow transplantation. Blood 71:1234. brane protein-1: coordinate up-regulation of peptide transporters and HLA-class 16. Penn, I. 1979. Kaposi sarcoma in organ transplant recipients. Transplantation I antigen expression. Eur. J. Immunol. 25:1374. 27:8. 40. Whittle, H. C., J. Brown, K. Marsh, B. M. Greenwood, P. Seidelin, H. Tighe, and 17. Israel, P. 1990. Cancers complication organ transplantation. N. Engl. J. Med. L. Wedderburn. 1984. T-cell control of Epstein-Barr virus-infected B cells is lost 323:1767. during P. falciparum malaria. Nature 312:449. 18. Walker, B. D., S. Chakrabarti, B. Moss, T. J. Paradis, T. Flynn, A. G. Durno, 41. Rooney, C. M., M. Rowe, L. E. Wallace, and A. B. Rickinson. 1985. Epstein-Barr R. S. Blumberg, J. C. Kaplan, M. S. Hirsch, and R. T. Schooley. 1987. HIV- virus-positive Burkitt’s lymphoma cells not recognized by virus-specific T-cell specific cytotoxic T lymphocytes in seropositive individuals. Nature 328:345. surveillance. Nature 317:629.