Two Major Antigenic Polypeptides of Molluscum Contagiosum Virus

284

Takahiro Watanabe, Shigeru Morikawa, Kenji Suzuki, Departments of Virology II, Virology I, and Pathology, National Tatsuo Miyamura, Kunihiko Tamaki, and Yoshiaki Ueda Institute of Infectious Diseases, and Department of Dermatology, Faculty of Medicine, University of Tokyo, Tokyo, Japan

A library of molluscum contagiosum virus (MCV) transferred into the cowpox vector expression system was screened with 12 sera from molluscum patients. Two recombinant proteins of 70 and 34 kDa were detected by immunoblotting and mapped to the open-reading frames MC133L and MC084L, respectively. Consensus sites were found between the C-terminus of the 70-kDa MCV protein and the 14-kDa fusion protein of vaccinia and variola virus, and between the 34-kDa MCV protein and the 37.5-kDa viral membrane–associated protein of vaccinia and variola virus. Rabbit Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021 antisera against these two proteins were prepared. An immunoﬂuorescence study demonstrated that the 70- and 34-kDa proteins were predominantly expressed on the surface of recombinant virus– infected HeLa cells, indicating the potential to be inserted into the membrane. On immunoelectron microscopy, antiserum against 70-kDa protein showed signiﬁcant labeling of the MCV membrane, while the antiserum against 34-kDa protein failed to do so.

After the eradication of variola virus in 1977, molluscum conditions indicated that they were essentially collinear and contagiosum virus (MCV) has been the sole member of the that minor sequence heterogeneity among subtypes contributed poxviruses specific for humans. MCV has a linear double- to the loss or gain of individual restriction sites [14]. Further, stranded DNA genome of 185,000–195,000 bp and induces molecular epidemiologic studies have failed to demonstrate any benign and self-limiting skin tumors, preferentially in children correlation of MCV subtype with clinical profiles of MCV, and young adults [1, 2]. In children, molluscum lesions are including patient age and sex and duration, site, and number scattered haphazardly over the trunk and extremities, whereas of molluscum contagiosum lesions [14, 15]. in young adults the papules occur in the genital area and are The skin lesions induced by MCV usually persist for sexually transmitted [3]. Recently, multiple and extensive mol- months to years until spontaneous resolution occurs, and some luscum lesions were found in up to 20% of AIDS patients, and circumstantial evidence has suggested that it may be associ- much greater importance has been attached to the virus as a ated with the induction of cellular and humoral immune re- cutaneous marker for opportunistic infection of immunocom- sponses [18, 19]. A serial histologic observation revealed promised hosts [4–6]. Although inefficient replication and dense mononuclear cell infiltration around the disappearing growth of MCV were demonstrated in human skin grafted to molluscum lesions, indicating that a cell-mediated inflamma- athymic mice [7, 8], other attempts to propagate the virus in tory reaction plays an important role in exclusion of the virus tissue culture and to transmit it to experimental animals have [20]. In earlier studies, the crude antigen derived from mol- not been successful [9–11]. Once the sterility of the virus can luscum lesions was prepared, and virus-specific antibodies be improved, MCV has a great potential as a tissue-restricted were detected by the Ouchterlony method [21], complement vector for expression of foreign genes in human keratinocytes. fixation test [22], and indirect immunofluorescence staining The molluscum skin lesions contain millions of virus parti- [23–25]. Later, an ELISA was developed to measure levels cles that are sufficient for molecular epidemiologic analyses. of IgG antibodies; a very close relationship was also found Three major subtypes and some variants have been reported, in the antibody levels between different molecular subtypes based on the restriction endonuclease cleavage pattern of viral of MCV on cross-testing patients’ sera using DNA-typed puri- DNA [12–17]. Cross-hybridization studies under stringent fied virions as antigens [26]. We are interested in which molecules of the MCV are recognized in the humoral immune system of molluscum patients. Although all of the genome of MCV, with the exception of Received 27 May 1997; revised 25 August 1997. both terminal hairpin loops, has been cloned [27, 28] and se- Presented in part: annual meeting of the Society for Investigative Dermatol- quenced [29–33], functional studies have not been reported. ogy (Washington, DC, 23–27 April 1997). A full genomic library of MCV DNA contained in the cowpox Financial support: Promotion of Polio Eradication, Ministry of Health and Welfare; grants-in-aid from Ministry of Education, Science, and Culture; Lydia vector expression system was screened with sera from mol- O’Leary Memorial Foundation. luscum patients. The purpose of our study was to map and Reprints or correspondence: Dr. Takahiro Watanabe, Dept. of Dermatology, characterize the sera-reactive polypeptides. Faculty of Medicine, University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo, 113, Japan (email: [email protected]). Materials and Methods The Journal of Infectious Diseases 1998;177:284–92 0 ᭧ 1998 by The University of Chicago. All rights reserved. Cells and viruses. HeLa and human 143TK cells were grown 0022–1899/98/7702–0003$02.00 as monolayers in Eagle’s MEM supplemented with 10% bovine

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect JID 1998;177 (February) Antigenic Polypeptides of MCV 285 serum. A white pock variant from pock-purified red cowpox virus Immunoblotting. Purified MCV or cell extracts were dis- strain Brighton (cowpox white variant) was propagated in HeLa rupted in 21 sample buffer containing 100 mM Tris-hydrochlo- cells and purified as described previously [34]. Spodoptera frugi- ride (pH 7.0), 4% SDS, 10% 2-mercaptoethanol, 20% glycerol, perda (Sf) cells were grown in TC-100 medium containing 10% and 0.2% bromophenol blue. Solubilized polypeptides were run fetal bovine serum. Autographa californica nuclear polyhedrosis on 10% SDS-polyacrylamide gels and transferred onto nitrocellu- virus (AcNPV) and a recombinant baculovirus were propagated lose filters as described previously [39]. Before transfer, parts of in Sf cells as described previously [35]. each lane were separated, and fractionated polypeptides were Molluscum lesions were obtained from 12 patients attending the visualized by Coomassie brilliant blue staining. The transferred Department of Dermatology in Tokyo University Hospital (aged filters were soaked with blocking solution (dried nonfat milk) at 2.3–9.4 years; mean, 5.5). Purification of MCV and DNA extrac- 4ЊC overnight, washed three times with 5% fetal bovine serum tion were done as described previously [16]. Viral DNA was in 10 mM Tris-hydrochloride (pH 7.3), 115 mM sodium chloride, cleaved with restriction endonucleases BamHI, ClaI, and HindIII. and 0.05% Tween-20 (TBS-T), and then incubated with diluted

The virus isolates were typed as MCV subtype 1 variant on the serum at 4ЊC overnight. After washing three times with TBS-T, Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021 basis of the cleavage pattern as previously described [15, 16]. the filters were incubated with anti-human IgG or anti-rabbit IgG MCV DNA fragments cleaved with BamHI, ClaI, or HindIII were conjugated with alkaline phosphatase at 37ЊC for 1 h. The filters inserted into plasmids or cosmids, and an overlapping library con- were washed three times with TBS-T and visualized with a mix- taining the entire genome of the MCV 1 variant was established. ture of 0.016% 5-bromo-4-chloro-3-indolyl phosphate and It was possible that the library would form a mosaic of MCV 1 0.033% nitroblue tetrazolium. variant because the MCV DNA was purified from molluscum le- Immunofluorescence. Cells growing on coverslips were in- sions from different patients. fected with recombinant cowpox virus at an MOI of 10 pfu/cell. Antibodies. Blood samples were collected from 12 patients At 6 h after infection, cells were washed three times with PBS described above at first consultation. All patients were healthy and fixed under nonpermeable (4% formaldehyde–0.1% glutaral- young children and had not been immunized with vaccinia virus. dehyde in PBS at 4ЊC for 45 min) or permeable (acetone at 020ЊC Control sera from 10 healthy infants were drawn from the World for 15 min) conditions. Cells were washed three times in PBS and Health Organization and the National Serum Reference Bank/ then incubated with rabbit antiserum diluted 1:320 in 10% dried Tokyo (National Institute of Infectious Diseases, Japan) (aged 0.8 nonfat milk at 37ЊC for 1 h. After washing three times in PBS, months to 1.1 years; mean, 6.7 months). cells were incubated with anti-rabbit IgG at 37ЊC for 1 h, washed New Zealand White rabbits were immunized with the purified three times, mounted in glycerol-PBS (1:1 [vol/vol]), and visual- MCV and with the recombinant baculovirus–infected Sf cells with ized under a Zeiss fluorescence microscope. Freund’s complete adjuvant, followed by a booster 3 weeks later. Immunoelectron microscopy. For postembedding labeling for The antisera were collected 1 week after booster injection. immunoelectron microscopy [40], purified MCV was fixed with 4% paraformaldehyde in 0.1 M cacodylate buffer (pH 8.0). After Production of recombinant virus. Recombinant cowpox vi- dehydration with increasing amounts of ethanol (50%–100%), the ruses were obtained by insertion of MCV DNA fragments into the MCV samples were embedded (Lowicryl K4M; Chemische Werke thymidine kinase (TK) gene of the cowpox virus transfer vector Lowi, Waldkraiburg, Germany) and polymerized by UV irradia- [36]. We used pAK 2 (supplied by A. Kojima, Department of tion. Ultrathin sections were cut and collected on nickel grids. Pathology, National Institute of Infectious Diseases, Tokyo), pLJB Sections were incubated with rabbit antiserum at a dilution of 40, and J/pBR, the construction of which was described elsewhere 1:320 and then with 10-nm colloidal gold–conjugated anti-rabbit [37, 38]. All cloned MCV DNA fragments were inserted into the IgG. Finally, the sections were stained with 4% uranyl acetate and unique restriction site within the coding region of the TK gene. viewed with an electron microscope (Hitachi Scientific Instru- 143TK0 cells (1 1 106) were infected with TK/ cowpox virus at ments, Mountain View, CA). As a control, preimmune rabbit se- an MOI of 0.05 pfu/cell for 3 h and transfected with 50 mgof rum was used instead of immune antiserum. calcium phosphate–precipitated DNA. The precipitate was formed by mixing the cowpox virus transfer plasmid–containing MCV DNA fragment in 250 mM CaCl with 280 mM NaCl, 40 mM 2 Results HEPES (pH 7.05), and 2 mM Na2HPO4 . Cells were harvested after 0 48 h and passaged three times in 143TK cells in the presence of Identification of the MCV genes encoding sera-reactive poly- 0 -5-bromo-2؅-deoxyuridine at 25 mg/mL. TK recombinant cowpox peptides. To determine which cloned DNAs encoded poly virus was isolated. peptides that reacted with patients’ sera, we established a li- The MCV gene encoding sera-reactive polypeptides was in- brary composed of 24 overlapping plasmids and cosmids serted into the BamHI or EcoRI site of the baculovirus transfer containing the entire MCV genome with the exception of the plasmid pVL 1392 (Pharmingen, San Diego). The Sf cells were covalently closed terminal hairpin loops. The library was trans- transfected with mixtures of purified infectious AcNPV DNA and pVL1392 containing the MCV gene of interest. The procedures ferred into the TK gene of a cowpox virus expression vector, of transfection and selection of the recombinant baculoviruses were and the resultant plasmids were used to produce recombinant described previously [35]. cowpox viruses in which MCV DNA was inserted into the Nucleotide sequencing. MCV DNA was sequenced in both TK gene, disrupting its activity. Since functional studies have directions by primer walking with an automatic sequencer (Applied suggested that transcriptional promoter sequences are con- Biosystems, model 310; Perkin-Elmer Cetus, Foster City, CA). served between poxvirus genera [41], expression of the MCV

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect 286 Watanabe et al. JID 1998;177 (February) gene is supposed to be regulated by its own promoter. After Table 1. Antibody response of molluscum patients. propagation in HeLa cells, recombinant virus–induced total cell proteins were electrophoretically separated on 10% poly- Clinical proﬁle of molluscum lesions acrylamide gels and reacted with the sera from 12 patients. Serum antibodies MCV HindIII-E fragment (11.4 kb) produced a 70-kDa immu- Age (years)/ Duration noreactive polypeptide, and a 9.1-kb subcloned fragment de- No. sex (months) Site No. 70-kDa 34-kDa rived from HindIII-B (30.6 kb) yielded a 34-kDa immunoreactive polypeptide (ﬁgure 1). The incidences of serum reactivity 1 2.3/F 3 Axilla 20 00 2 5.9/F 2 Buttock 30 // to these two recombinant proteins were 58% and 67%, respec- 3 5.3/F 7 Back 7 /0 tively. There was no correlation of antibody type with patient 4 5.1/M 5 Abdomen 15 0/ age or sex or duration, site, or number of molluscum lesions 5 5.5/M 2 Abdomen 20 00

(table 1). The specificity of immunoblotting was demonstrated 6 6.1/M 1 Legs 10 // Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021 by the lack of reactivity with 10 healthy control sera. Both 70- 7 8.2/F 5 Trunk 5 // 8 2.9/M 0.5 Upper limbs 20 /0 and 34-kDa polypeptides could be detected when purified MCV 9 5.0/M 10 Abdomen 30 // particles were applied as antigens in immunoblotting analysis. 10 9.4/M 4 Chest 4 // Further, 70- and 34-kDa polypeptides were immunoreactive 11 4.9/M 4 Trunk 10 0/ when a series of recombinant polypeptides was incubated with 12 5.0/F 3 Buttock 10 0/ rabbit antiserum directed against purified MCV particles (figure Mean 5.5 3.9 13.9 58% 67% 2). We concluded that these two polypeptides were present NOTE. 70- and 34-kDa polypeptides were produced by cowpox recombi- within the virion. nation system, in which MCV HindIII-E fragment and subfragment from Hin- Mapping of the MCV genes encoding sera-reactive polypep- dIII-B, respectively, were inserted. There was no correlation between clinical profiles of molluscum patients and types of antibodies. tides. To localize the genes encoding sera-reactive polypeptides more precisely, cowpox virus–infected cells were transfected with smaller plasmids containing subfragments derived include the whole MC133L gene and the upstream promoter from MCV HindIII-E and HindIII-B. The HindIII-E fragment core sequence. This fragment was produced by polymerase was cleaved at three sites by BamHI, and recombinant viruses chain reaction (PCR) from MCV HindIII-E fragment, using were constructed. Since an immunoreactive 50-kDa polypep- primers 133L5V (GTCGAATTCACCTTCGGAACTGCGGA, tide instead of 70-kDa was obtained from a recombinant with EcoRI site is italic) and 133L3 (AGTGAATTCCGCAAAGCT- the 1.4-kb insert, we sequenced the fragment and boundary CGCCGCTA), which corresponded to sequences 108 bp up- region. As expected, the 1.4-kb fragment contained 1368 bp stream and 72 bp downstream of MC133L, respectively. To of 5؅ sequence from the gene MC133L, the remaining 273 bp insert EcoRI sites, GAC (Asp) at position 0105 was altered of which was cleaved with BamHI and present in the flanking to GAA (Glu) and GTG (Val) at position /67 was altered to region (figure 3). To confirm that MC133L (1641 bp) encoded the 70-kDa polypeptide, a 1821-bp fragment was designed to

Figure 1. Immunoblotting analysis using 1:20-diluted patients’ se- Figure 2. Immunoblotting analysis using 1:320-diluted rabbit anti- rum. Puriﬁed MCV particles were stained with Coomassie brilliant serum raised against puriﬁed MCV virions. MCV particles were blue (lane a) or reacted with patients’ serum (lane b). HeLa cell lysates stained with Coomassie brilliant blue (lane a) or reacted with antise- were infected with recombinant cowpox virus. Inserted fragment was rum (lane b). HeLa cell lysates were infected with recombinant cow- MCV HindIII-E (lane c), MC133L (lane d), 9.1-kb subfragment from pox virus in which MC133L (lane c) and MC084L (lane e) were HindIII-B (lane f), and MC084L (lane g). Sf cell lysates were infected inserted into thymidine kinase gene. Sf cell lysates were infected with with recombinant baculovirus containing MC133L (lane e) or recombinant baculovirus carrying MC133L (lane d) or MC084L (lane MC084L (lane h). Molecular size markers are expressed in kDa. f). Molecular size markers are expressed in kDa.

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect JID 1998;177 (February) Antigenic Polypeptides of MCV 287

Figure 3. Physical maps of genes encoding 70- and 34-kDa polypeptides. Genes were present in open-reading frames MC133L and MC084L, respectively. Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021

TTC (Phe) during PCR. The 70-kDa polypeptide was produced (Glu) at aa 267 to GAG (Glu), CCT (Pro) at aa 288 to CCC by a recombinant cowpox virus with this amplified fragment (Pro), GAG (Thr) at aa 322 to GAT (Asp), TCT (Ser) at aa (figure 1). 329 to TCG (Ser), and ACG (Thr) at aa 361 to CCG (Pro). Similarly, a 9.1-kb subfragment from the HindIII-B fragment Two large hydrophobic regions were predicted from the amino was cleaved with appropriate restriction endonucleases, and acid sequence [48], at aa 1–52 and 400–466, corresponding several recombinant viruses were obtained (figure 3). We con- to membrane-spanning domains (figure 5). The N-terminal hy- cluded that the 34-kDa polypeptide was encoded within the drophobic region was partly consistent with the general charac- 1482-bp HincII-AatII fragment, in which the gene MC084L of teristics of a signal sequence [49]. the expected length was found (figure 1). MC084L consists of 298 amino acids with a calculated mo- Nucleotide sequence of MCV sera-reactive polypeptides. lecular mass of 32.0 kDa. Between MCV 1 prototype [32] and The sequence data from MCV subtype 1 variant containing 1 variant, there was a nucleotide divergence at five points, all MC133L and MC084L have been deposited in DDBJ/EMBL/ of which were silent mutations; GGT (Gly) at aa 31 in the GenBank (accession numbers AB004837, AB004838). The ini- prototype was changed to GGC (Gly) in the variant, GGG tiation codon of MC133L and MC084L occurs within the se- (Gly) at aa 41 to GGA (Gly), ATT (Ile) at aa 68 to ATC (Ile), quence TAAATG, an initiator of the poxvirus late promoter GCG (Ala) at aa 204 to GCA (Ala), and GGT (Gly) at aa 226 [41]. A computer search (Basic Local Alignment Search Tool to GGC (Gly). Two large hydrophobic regions were deduced [42]) based on comparison of the amino acid sequence with from the amino acid sequence at aa 17–46 and 202–241 (figure other known proteins revealed consensus sequences between 5). MC133L, vaccinia (A27L), and variola (A30L) 14-kDa fusion Expression of 70- and 34-kDa polypeptides by recombinant protein [43–45] and between MC084L, vaccinia (H3L), and baculovirus. A copy of MC133L gene, containing 36 bp up- variola (I3L) 37.5-kDa intracellular mature viral membrane– stream of the initiating methionine codon and 72 bp down- associated protein [46, 47] (figure 4). The physical locations stream of a TAA termination codon, was generated by PCR of MC133L and MC084L in the MCV genome were essentially using MCV DNA and oligonucleotide primers 133L5B (GCA- identical to those of corresponding homologous genes in the GAATTCTGCGCGTTCTTAAAATCC, EcoRI site is italic) vaccinia and variola genome. and 133L3. To insert the EcoRI site, GAC (Asp) at position MC133L contains 546 amino acids with a calculated molecu- 030 was altered to TTC (Phe) during PCR. The PCR product lar mass of 59.1 kDa. The presence of three possible N-glyco- was cut with EcoRI and inserted into pVL1392. A 1299-bp sylation sites may partly explain the discrepancy between cal- DNA fragment containing the MC084L gene was obtained by culated and apparent electrophoretic molecular weight. digestion with AseI and AatII of the 9.1-kb subfragment from Sequence comparison of the MC133L from MCV subtype 1 HindIII-B. The AseI and AatII sites were located at 016 bp prototype [32] with that from MCV subtype 1 variant revealed relative to the initiation methionine codon of the MC084L gene them to be very similar, with only six nucleotide differences and /386 relative to the TGA stop codon, respectively. The and only three different amino acids; GAC (Asp) at aa 70 in AseI-AatII fragment was inserted into pVL1392, after attach- the prototype is changed to GAA (Glu) in the variant, GAA ment of a synthetic BamHI linker. Sf cells were infected with

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect 288 Watanabe et al. JID 1998;177 (February) Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021

Figure 4. Consensus sites between MC133L (MC084L) and proteins from different sources. Homologous sequences were aligned with intracellular mature viral membrane–associated proteins of vaccinia and variola virus.

a recombinant baculovirus and then applied to SDS-PAGE. under nonpermeabilized conditions, and reacted with the anti- The expression of 70- and 34-kDa polypeptides was confirmed MC133L (or anti-MC084L) rabbit antiserum (figure 7). The by immunoblotting with patients’ sera and anti-MCV rabbit intensity of cells was increased after permeabilization, which serum (figure 1, 2). indicated that the products of these two genes were expressed Characterization of 70- and 34-kDa polypeptides as antigens on the cell surface and cytoplasm. Thus, we concluded that within the envelope. To visualize the localization of 70- and 70- and 34-kDa polypeptides were potentially inserted into 34-kDa polypeptides, antisera were prepared by immunizing and spanned the membrane. Rabbit antiserum directed against rabbits with the recombinant baculovirus–infected Sf cells ex- purified MCV particles recognized both 70- and 34-kDa poly- pressing the MC133L or MC084L gene. On immunoblotting peptides on immunoblotting analysis (figure 2), and a similar analysis, the antiserum directed against the product of MC133L staining pattern was seen when anti-MCV serum was used as (MC084L) reacted with 70-kDa (34-kDa) protein when purified the first antibody (data not shown). When these three antisera MCV particles were dissociated in SDS and run as antigens were used for immunoelectron microscopy of ultrathin sections (figure 6). Although there was no immunofluorescence staining of purified MCV, antisera raised against MCV particles and for wild type cowpox–infected HeLa cells, staining on the cell 70-kDa protein immunolabeled the thick layer of virions, while surface was observed when HeLa cells were infected with the anti–34-kDa rabbit antiserum failed to bind the virion (fig- recombinant cowpox virus with MC133L (or MC084L), fixed ure 8).

Figure 5. Hydrophobicity plots [48] of 70- and 34-kDa proteins. Hydrophobic regions are above and hydrophilic regions are below axis. Two large hydrophobic domains were predicted to exist in these 2 proteins (bars).

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect JID 1998;177 (February) Antigenic Polypeptides of MCV 289

(0):13:24 in Japan [15]. These epidemiologic studies indicated that the distributions of the MCV subtypes differ ac- cording to the geographic region, so we could easily establish a deﬁned genomic library of MCV subtype 1 variant. The common marker of MCV 1 variant is 23.6-kb fusion fragments generated by loss of a BamHI site between 13.2-kb D2 and 10.4-kb F fragments of MCV 1 prototype [15]. Sequence comparisons of MC133L and MC084L between MCV 1 prototype and MCV 1 variant have shown minor heterogeneity at the nucleotide level, which could contribute to the loss or gain of individual restriction sites.

MCV can replicate only in human epidermal keratinocytes Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021 Figure 6. Western blots of purified MCV particles. Blots were in vivo [10]. Human papillomavirus is another DNA virus that probed with anti-MC133L (lanes b, c) or anti-MC084L (lanes d, can grow only in epidermal keratinocytes, and serologic assays e) rabbit antiserum prepared by injecting recombinant baculovirus– using recombinant proteins have been done. Weak immune infected Sf cells. As positive control, recombinant cowpox virus– responses to the virus have been reported [50], which may be infected HeLa cells were prepared, expressing genes MC133L (lane b) and MC084L (lane d). MCV virions were solubilized in SDS and due to the localization of viral antigens in the avascular epider- stained with Coomassie brilliant blue (lane a) or reacted with antise- mal tissue, which confers protection from the immune system. rum against MC133L (lane c) and MC084L (lane e). The immunologic circumstances may be more advantageous to MCV, because the MCV genes potentially encode at least three proteins for combating host defenses, including homologues of major histocompatibility complex (MHC) class I, Discussion chemokines, and glutathione peroxidase [32]. It is predicted Restriction endonuclease mapping of viral DNA has clas- by the comparative study of amino acid alignments that the sified MCV into three major subtypes and minor variants, viral MHC homologue protein may compete with the assembly, and the relative incidences of MCV 1 (MCV 1 prototype), transport, or function of host MHC proteins and may preclude MCV 2, and MCV 3 were reported to be 32 (31):1:0 in the presentation of MCV-specific polypeptides; truncated ana- Germany [12], 174 (168):7:2 and 80 (53):25:1 in the United logues of CC chemokines expressed on the MCV-infected cell Kingdom [14], 44 (20):22:2 in Australia [13], and 436 surface may behave as a chemokine antagonist; and viral gluta-

Figure 7. Reactivity of antisera directed against 70- and 34-kDa proteins to corresponding proteins on cell surface and in cytoplasm. HeLa cell cultures were infected with recombinant cowpox virus carrying MC133L (A, C)orMC084L (B, D), then ﬁxed under nonpermeabilizing (A, B) or permeabilizing (C, D) conditions, and reacted with anti–70- kDa antiserum (A, C) or anti–34- kDa antiserum (B, D). HeLa cells infected with wild type cowpox virus showed no reactivity with these 2 types of antisera (data not shown).

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect 290 Watanabe et al. JID 1998;177 (February) Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021

Figure 8. Immunogold electron microscopy of ultrathin sections of purified MCV particles. A, Virions reactive with rabbit antiserum against purified MCV virions as first antibody. B, Virions reactive with anti-MC133L rabbit antiserum followed by gold-conjugated anti-rabbit IgG. 70-kDa polypeptides were predominantly localized within thick layer of virion. C, Virions reactive with anti-MC084L rabbit antiserum as first antibody. Magnification 175,000. Bars represent 100 nm.

thione peroxidase may protect the virus and the infected cell tides of 70 and 34 kDa were located in the surface or subsurface from oxidative damage by peroxides [32]. of the MCV particles [56]. This is in agreement with the obser- Although several clinicians reported spontaneous regression vation that both patients’ sera and anti-MCV rabbit serum of MCV preceded by mononuclear cell infiltration [18–20], showed specific immunoreactivity with these 2 polypeptides. the number of Langerhans cells is markedly decreased [51] Membrane association of these polypeptides was suggested by and inflammatory response is usually absent [52] in molluscum the results of hydrophobicity plots and immunofluorescence lesions, which may result from the function of these ‘‘host analysis, and in the case of the 70-kDa protein, this was further response-evasion genes.’’ In this study, antibody levels of pa- confirmed by immunoelectron microscopy (the failure of anti- tients’ sera were low; two antigenic MCV polypeptides ob- MC084L antibody immunolabeling may be due to denaturation tained by recombinant cowpox virus–infected HeLa cells were of the epitope by paraformaldehyde). Since MCV particles detected when 1:20-diluted patient sera were used, whereas are usually present within keratinocytes [57], the majority of anti-MCV rabbit serum at a dilution of 1:320 immunolabeled purified virions that were used as antigens for immunoelectron these polypeptides. In previous studies, suspensions from mol- microscopy and in preparation for immunizing rabbits probably luscum lesions were found to produce an early cytopathic effect took the form of intracellular mature virion (IMV). In addition, in cultured cells, which was explained by an electron micro- a computer search demonstrated that 70- and 34-kDa MCV scopic study indicating that virus particles were quickly ad- proteins were both homologues of IMV-associated proteins in sorbed and phagocytosed by the cells [53, 54]. Guinea pig vaccinia and variola virus. Thus, it is possible that these two serum raised against crude MCV suspension neutralized this polypeptides are IMV-associated components of the MCV vi- cytopathogenicity, while patient sera failed to do so [24, 55]. rion. In molluscum patients, MCV particles may be mainly This lack of neutralization could have been simply attributed recognized as IMV, in which form the virus-packed keratino- to the low antibody levels of patients’ sera. However, the results cytes burst and subsequent virus release and cell-to-cell trans- of neutralization tests should be carefully interpreted in view mission occur. of the failure of the virus to replicate in cultured cells. It remains A computer search of the gene MC133L encoding the 70- unknown whether antiserum directed against 70- and 34-kDa kDa polypeptide revealed a consensus amino acid sequence polypeptides can neutralize the infectivity of MCV. with the 14-kDa fusion protein of vaccinia and variola virus. At least 40 polypeptides and 7 major polypeptides were The 14-kDa protein, which forms covalently linked trimers identified from purified MCV particles by highly sensitive sil- [43], is anchored in the envelope of IMV [45] and plays a ver staining and Coomassie brilliant blue staining, respectively. major role in virus penetration [43]. The sequence 81-LEN- A controlled degradation study suggested that 2 major polypep- HAETLRAAMISLAKK-100 of the 14-kDa protein (figure 4)

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect JID 1998;177 (February) Antigenic Polypeptides of MCV 291 resembles the leucine zipper motif [58] and may contribute to 20. Steffen C, Markman JA. Spontaneous disappearance of molluscum contag- formation of stable trimers [59]. This sequence is absent in iosum. Arch Dermatol 1980;116:923–4. 21. Epstein, WL, Senecal IP, Massing A. An antigen in lesions of molluscum MC133L, and the 70-kDa MCV antigenic protein may therefore contagiosum. Nature 1961;191:509. not be associated with other proteins in the thick layer of the 22. Fonseca MEF, Machado RD, Liberto MIM, Marcolino G. Molluscum virion. contagiosum: serology and electron microscopy findings in twenty one patients. Rev Inst Med Trop Sao Paulo 1967;29:86–9. 23. Epstein WL, Senecal I, Krasnobrod H, Massing AM. Viral antigens in Acknowledgments human epidermal tumours: localization of an antigen to molluscum contagiosum. J Invest Dermatol 1963;40:51–9. We thank M. Okinaga, S. Tanaka, and A. Saito for assistance 24. Raskin J. Molluscum contagiosum: tissue culture and serologic study. Arch in obtaining MCV samples; Y. Suzuki and K. Nashiro for technical Dermatol 1963;87:552–9. assistance; Y. Matsuura and H. Tani for performing baculovirus 25. Shirodaria PV, Matthews RS. Observations on the antibody responses in molluscum contagiosum. Br J Dermatol 1977;96:29–34. transfection; Y. Ami and Y. Suzaki for immunizing rabbits and Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021 antiserum collection; and H. Aizaki, Y. Aoki, K. Ishii, T. Shimoike, 26. Konya J, Thompson CH, De Zwart-Steffe RT. Enzyme-linked immunosor- bent assay for measurement of IgG antibody to molluscum contagiosum and I. Shoji for helpful discussion. virus and investigation of the serological relationship of the molecular types. J Virol Methods 1992;40:183–94. 27. Bugert JJ, Rsˇsen-Wolff A, Darai G. Genomic characterization of mol- References luscum contagiosum virus type 1: identification of the repetitive DNA 1. Parr RP, Burnett JW, Garon CF. Ultrastructural characterization of the sequences in the viral genome. Virus Genes 1989;3:159–73. molluscum contagiosum virus genome. Virology 1977;81:247–56. 28. Bugert J, Darai G. Stability of molluscum contagiosum virus DNA among 2. Gottlieb SL, Myskowski PL. Molluscum contagiosum. Int J Dermatol 184 patient isolates: evidence for variability of sequences in the terminal 1994;33:453–61. inverted repeats. J Med Virol 1991;33:211–7. 3. Blank H, Haines H. Viral diseases of the skin, 1975: a 25-year perspective. 29. Blake NW, Porter CD, Archard LC. Characterization of a molluscum J Invest Dermatol 1976;67:169–76. contagiosum virus homolog of the vaccinia virus p37K major envelope 4. Schwartz JJ, Myskowski PL. Molluscum contagiosum in patients with antigen. J Virol 1991;65:3583–9. human immunodeficiency virus infection. J Am Acad Dermatol 1992; 30. Hadasch RP, Bugert JJ, Janssen W, Darai G. Characterization of the ge- 27:583–8. nome of molluscum contagiosum virus type 1 between the genome 5. Ray MC, Gately LE III. Dermatologic manifestations of HIV infection coordinates 0.045 and 0.075 by DNA nucleotide sequence analysis of and AIDS. Infect Dis Clin North Am 1994;8:583–605. a 5.6-kb HindIII/MluI DNA fragment. Intervirology 1993;36:32–43. 6. Petersen CS, Gerstoft I. Molluscum contagiosum in HIV patients. Derma- 31. Sonntag KC, Clauer U, Bugert JJ, Schnitzler P, Darai G. Identification tology 1992;184:19–21. and properties of the genes encoding the poly(A) polymerase and a 7. Buller RM, Burnett J, Chen W, Kreider J. Replication of molluscum small (22 kDa) and the largest subunit (147 kDa) of the DNA-dependent RNA polymerase of molluscum contagiosum virus. Virology ;210: contagiosum virus. Virology 1995;213:655–9. 1995 471–8. 8. Fife KH, Whitfeld M, Faust H, Goheen MP, Bryan J, Brown DR. Growth 32. Senkevich TG, Bugert JJ, Sisler JR, Koonin EV, Darai G, Moss B. Genome of molluscum contagiosum virus in a human foreskin xenograft model. sequence of a human tumorigenic poxvirus: prediction of specific host Virology 1996;226:95–101. response-evasion genes. Science 1996;273:813–6. 9. Prose PH, Friedman-Kien AE, Vilcek J. Molluscum contagiosum virus in 33. Douglass NJ, Blake NW, Cream JJ, et al. Similarity in genome organization adult human skin cultures. Am J Pathol 1969;55:349–66. between molluscum contagiosum virus (MCV) and vaccinia virus (VV): 10. Postlethwaite R. Molluscum contagiosum: a review. Arch Environ Health identification of MCV homologues of the VV genes for protein kinase 1970;21:432–52. 2, structural protein VP8, RNA polymerase 35 kDa subunit and 3b- 11. McFadden G, Pace WE, Purres J, Dales S. Biogenesis of poxviruses: hydroxysteroid dehydrogenase. J Gen Virol 1996;77:3113–20. transitory expression of molluscum contagiosum early functions. Virol- 34. Joklik WK. The purification of four strains of poxvirus. Virology 1962; ogy 1979;94:297–313. 18:9–18. 12. Scholz J, Rsˇsen-Wolff A, Burgert J, et al. Molecular epidemiology of 35. Matsuura Y, Possee RD, Bishop DHL. Expression of the S-coded genes molluscum contagiosum. J Infect Dis 1988;158:898–900. of lymphocytic choriomeningitis arenavirus using a baculovirus vector. 13. Thompson CH, De Zwart-Steffe RT, Biggs IM. Molecular epidemiology J Gen Virol 1986;67:1515–29. of Australian isolates of molluscum contagiosum. J Med Virol 1990; 36. Pickup DJ, Ink BS, Hu W, Ray CA, Joklik WK. Hemorrhage in lesions 32:1–9. caused by cowpox virus is induced by a viral protein that is related to 14. Porter CD, Archard LC. Characterization by restriction mapping of three plasma protein inhibitors of serine proteases. Proc Natl Acad Sci USA subtypes of molluscum contagiosum virus. J Med Virol 1992;38:1–6. 1986;83:7698–702. 15. Nakamura J, Muraki Y, Yamada M, Hatano Y, Nii S. Analysis of mol- 37. Ueda Y, Morikawa S, Matsuura Y. Identification and nucleotide sequence luscum contagiosum virus genomes isolated in Japan. J Med Virol 1995; of the gene encoding a surface antigen induced by vaccinia virus. Virol- 46:339–48. ogy 1990;177:588–94. 16. Porter CD, Archard LC. Characterization and physical mapping of mol- 38. Yasuda A, Kimura-Kuroda J, Ogimoto M, et al. Introduction of protective luscum contagiosum virus DNA and location of a sequence capable of immunity in animals vaccinated with recombinant vaccinia viruses that encoding a conserved domain of epidermal growth factor. J Gen Virol express PreM and E glycoproteins of Japanese encephalitis virus. J 1967;68:673–82. Virol 1990;64:2788–95. 17. Porter CD, Blake NW, Archard LC, Muhlemann MF, Rosedale N, Cream 39. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins JJ. Molluscum contagiosum virus types in genital and non-genital le- from polyacrylamide gels to nitrocellulose sheets: procedure and some sions. Br J Dermatol 1989;120:37–41. applications. Proc Natl Acad Sci USA 1979;76:4350–4. 18. Pinkus H, Frisch D. Inflammatory reaction to molluscum contagiosum 40. Shimizu H, Nishikawa T. Application of an image analyzer to gold labeling probably of immunologic nature. J Invest Dermatol 1949;13:289–94. in immunoelectron microscopy to achieve better demonstration and 19. Kipping HF. Molluscum dermatitis. Arch Dermatol 1971;103:106–7. quantitative analysis. J Histochem Cytochem 1993;41:123–8.

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect 292 Watanabe et al. JID 1998;177 (February)

41. Rosel JL, Earl PL, Weir JP, Moss B. Conserved TAAATG sequence at 51. Bhawan J, Dayal Y, Bhan AK. Langerhans cells in molluscum contagio- the transcriptional and translational initiation sites of vaccinia virus late sum, verruca vulgaris, plantar wart, and condyloma acuminatum. J Am genes deduced by structural and functional analysis of the HindIII H Acad Dermatol 1986;15:645–9. genome fragment. J Virol 1986;60:436–49. 52. Heng MCY, Steuer ME, Levy A, et al. Lack of host cellular immune 42. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local response in eruptive molluscum contagiosum. Am J Dermatopathol alignment search tool. J Mol Biol 1990;215:403–10. 1989;11:248–54. 43. Rodriguez JF, Paez E, Esteban M. A 14,000-Mr envelope protein of vac- 53. Robinson HJ Jr, Prose PH, Friedman-Kien AE, Neistein S, Vilcek J. The cinia virus is involved in cell fusion and forms covalently linked trimers. molluscum contagiosum virus in chick embryo cell cultures: an electron J Virol 1987;61:395–404. microscopic study. J Invest Dermatol 1969;52:51–6. 44. Rodriguez JF, Esteban M. Mapping and nucleotide sequence of the vac- 54. Barbanti-Brodano G, Mannini-Palenzona A, Varoli O, Portolani M, La Placa cinia virus gene that encodes a 14-kilodalton fusion protein. J Virol M. Abortive infection and transformation of human embryonic ﬁbroblasts 1987;61:3550–4. by molluscum contagiosum virus. J Gen Virol 1974;24:237–46. 45. Rodriguez D, Rodriguez JR, Esteban M. The vaccinia virus 14-kilodalton 55. Neva FA. Studies on molluscum contagiosum: observations on the cyto- fusion protein forms a stable complex with the processed protein en- pathic effect of molluscum suspensions in vitro. Arch Intern Med 1962; Downloaded from https://academic.oup.com/jid/article/177/2/284/925332 by guest on 30 September 2021 coded by the vaccinia virus A17L gene. J Virol 1993;67:3435–40. 110:226–31. 46. Chertov OY, Telezhinskaya IN, Zaitseva EV, et al. Amino acid sequence 56. Oda H, Ohyama Y, Sameshima T, Hirakawa K. Structural polypeptides determination of vaccinia virus immunodominant protein p35 and iden- of molluscum contagiosum virus: their variability in various isolates tiﬁcation of the gene. Biomed Sci 1991;2:151–4. and location within the virion. J Med Virol 1982;9:19–25. 47. Takahashi T, Oie M, Ichihashi Y. N-terminal amino acid sequences of vaccinia virus structural proteins. Virology 1994;202:844–52. 57. Mihara M. Three-dimensional ultrastructural study of molluscum contagio- 48. Kyte J, Doolittle RF. A simple method for displaying the hydrophobic sum in the skin using scanning-electron microscopy. Br J Dermatol character of a protein. J Mol Biol 1982;157:105–32. 1991;125:557–60. 49. Perlman D, Halvorson HO. A putative signal peptidase recognition site 58. Vinson CR, Sigler PB, McKnight SL. Scissors-grip model for DNA recog- and sequence in eukaryotic and prokaryotic signal peptides. J Mol Biol nition by a family of leucine zipper proteins. Science 1989;246: 1983;167:391–409. 911–6. 50. Pass F, Shah KV. Immunology of human papovavirus. In: Nahmias AJ, 59. Sassone-Corsi P, Ransone LJ, Lamph WW, Verma IM. Direct interaction O’Reilly RJ, eds. Comparative immunology: immunology of infections. between fos and jun nuclear oncoproteins: role of the ‘‘leucine zipper’’ New York: Plenum Press, 1982:225–41. domain. Nature 1988;336:692–5.

/ 9d3f$$fe13 12-23-97 07:32:33 jinfa UC: J Infect