DOCSLIB.ORG

( 12 ) United States Patent

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
( 12 ) United States Patent US007459539B2 ( 12) United States Patent ( 10 ) Patent No. : US 7 , 459 ,539 B2 Challita - Eid et al. (45 ) Date of Patent: Dec. 2 , 2008 ( 54 ) ANTIBODY THAT BINDS ZINC WO WO 03050236 6 / 2003 TRANSPORTER PROTEIN 108P5H8 ( 75 ) Inventors : Pia M . Challita - Eid , Encino , CA (US ) ; OTHER PUBLICATIONS Mary Faris , Los Angeles , CA (US ) ; Murgia et al . Cloning, expression , and vesicular localization of zinc Daniel E . H . Afar , Brisbane , CA (US ) ; transporter Dri 27 /ZnT4 in intestinal tissue and cells . Am J Physiol Rene S . Hubert , Los Angeles , CA (US ) ; 277 (Gastrointest Liver Physiol 40 ) : G1231 -61239 , 1999 . * Steve Chappell Mitchell, Gurnee , IL Kaufman et al. Blood 9 : 3178 -3184 , 1999 . * (US ) ; Elana Levin , Los Angeles, CA Wang et al . Rapid analysis of gene expression (RAGE ) facilitates (US ) ; Karen Jane Meyrick Morrison , universal expression profiling . Nucleic Acids Res 27 (23 ) : 4609 4618 , 1999 . * Santa Monica , CA (US ) ; Arthur B . Campbell et al. Totipotency of multipotentiality of cultured cells : Raitano , Los Angeles , CA (US ) ; Aya applications and progress . Theriogenology 47 : 63 -72 , 1997 . * Jakobovits , Beverly Hills , CA (US ) Moore , G . Genetically engineered antibodies. Clin Chem 35 ( 9 ) : 1849 - 1853 , 1989 . * (73 ) Assignee : Agensys, Inc ., Santa Monica , CA (US ) Dillman et al .Monoclonal antibodies in the treatment ofmalignancy : basic concepts and recent developments . Cancer Invest 19 ( 8 ) : 833 ( * ) Notice: Subject to any disclaimer, the term of this 841, 2001. * patent is extended or adjusted under 35 Skolnick et al. From genes to protein structure and function : novel U . S . C . 154 ( b ) by 1273 days . applications of computational approaches in the genomic era . Trends in Biotech 18 ( 1 ) : 34 - 39 , 2000 . * ( 21 ) Appl. No. : 10 /024 , 652 Bork, A . Powers and pitfalls in sequence analysis : the 70 % hurdle . Genome Res 10 : 398 - 400 , 2000 . * ( 22 ) Filed : Dec . 17 , 2001 Doerks et al . Protein annotation : detective work for function predic tion . Trends in Genetics 14 ( 6 ) : 248 -250 , 1998 . * Prior Publication Data Smith et al . The challenges of genome sequence annotation or “ The devil is in the details ” . Nature Biotech 15 : 1222 - 1223 , 1997 . * US 2003 /0219738 A1 Nov . 27 , 2003 Brenner, S . E . Errors in genome function . Trends in Genetics 15 ( 4 ) : 132 - 133 , 1999 . * Related U . S . Application Data Bork et al. Go hunting in sequence databases but watch out for the ( 60 ) Provisional application No . 60 / 256 ,210 , filed on Dec. traps. Trends in Genetics. 12 ( 10 ) : 425 -427 , 1996 . * 15 , 2000 . Wells . J . A . Additivity ofmutational effects in proteins . Biochemistry 29 (37 ) : 8509 -8517 , 1990 . * (51 ) Int. Ci. Ngo et al. Computational complexity , protein structure prediction , and the Levinthal paradox . The Protein Folding Problem and Tertiary CO7K 16 / 28 ( 2006 .01 ) Structure Prediction , pp . 492 -495 , 1994. * COZK 16 / 30 ( 2006 .01 ) Daniel et al. Virology 202 :540 - 549 , 1994. * CO7K 16 /46 ( 2006 .01 ) Haynes et al . Proteome analysis : biological assay or data archive. (52 ) U . S . Cl. .. .. .. 530 / 388 . 8 ; 530 / 388 . 1 ; 530 / 388 . 15 ; Electrophoresis 19 : 1862 - 1871 , 1998 . * 530 /388 . 2 ; 530 / 387 . 3 ; 530 /391 . 1 ; 530 /391 . 3 ; Hu et al . Analysis of genomic and proteomic data using advanced 530 / 391. 7 ; 530 /809 literature mining . J Proteome Res 2 : 405 -412 , 2003 . * (58 ) Field of Classification Search .. .. 503 / 387 . 1 , Chen et al . Discordant protein and mRNA expression in lung 503 /387 . 3 , 387 . 9 , 388 . 1 , 389 . 1 , 391 . 1 , 391 . 3 , adenocarcinomas. Molec Cellular Proteomics 1 : 304 - 313 , 2002 . * 503 / 391. 7 ; 514 / 2 ; 424 / 130 . 1 , 133 . 1 , 134 . 1 , Huang et al . , Nature Genetics ( 1997 ) 17 ( 3 ) : 292 - 297 . 424 / 135 . 1 , 141 . 1 , 178 . 1 , 181. 1 , 183 . 1 Hwang et al. , Seminars in Oncology ( 1999 ) 26 ( 2 ): 192 - 201. See application file for complete search history . Southwood et al ., Journal of Immunology ( 1998 ) 160 ( 7 ): 3363 - 3373 . ( 56 ) References Cited * cited by examiner U . S . PATENT DOCUMENTS Primary ExaminerDavid S Romeo 5 , 869 ,045 A * 2 / 1999 Hellstrom et al. .. .. 424 / 130 . 1 ( 74 ) Attorney , Agent, or Firm — Morrison & Foerster LLP (57 ) ABSTRACT FOREIGN PATENT DOCUMENTS EP 1033401 A2 9 / 2000 A novel gene (designated 108P5H8) and its encoded protein , WO WO 9733605 9 / 1997 and variants thereof, are described wherein 108P5H8 exhibits WO WO0055174 Al 9 / 2000 tissue specific expression in normal adult tissue, and is aber wo W00159063 A2 8 /2001 rantly expressed in the cancers listed in Table I. Consequently , WO W00160860 A2 8 /2001 108P5H8 provides a diagnostic , prognostic , prophylactic WO W00210449 A2 2 / 2002 and /or therapeutic target for cancer. The 108P5H8 gene or WO WO0218632 A2 3 / 2002 fragment thereof, or its encoded protein , or variants thereof , WO WO 0224718 3 / 2002 or a fragment thereof, can be used to elicit a humoral or WO W00224718 A1 3 / 2002 cellular immune response ; antibodies or T cells reactive with Wo W00230268 A2 4 / 2002 191P1E1B can be used in active or passive immunization . WO WO02055700 A2 7 / 2002 WO WO 02060953 8 /2002 12 Claims, 38 Drawing Sheets U . S . Patent Dec . 2 , 2008 Sheet 1 of 38 US 7 ,459 , 539 B2 Figure 1 : 108P5H8 SSH sequence of 448 nucleotides (SEQ ID : 2568 ) 1 GATCCAGATT TCTCTGCACA CTGGACTTCG TAGAGTAAGT GTGGTAGACA AAGAGACTAC 61 ACTGCACAAC CACCAGTGAA TATCATTGCT AAGAAGACTT TGGGTCGTGT TTCTCAGCCA 121 CTCTCACAGC TTTTGTAGAC TTATTTGATT TTGAAACAAG CAGTTAGCTA AATCTATTTT 181 CCTTTTATGC ATATATGTTA ATTGGCTCAA CTTAATATGG TGTTCTTACA GAATATGAGC 241 CCATTTGAAA TAAGGTTTTA GGCAATTTTG CTGTTGGCTC TGATTTGTAT ATAGCAAATT 301 TAAAGGTACA GAGTGTTTCC TAGATAGAAG ATTAGTTCAT TTGGTTCATT TTGTCTTTGA 361 AGCAAGCCAA GCTCATGAGC CAGTTGGTTA TTTGTCATAA ATGAACACCC ATCACTATAT 421 GCTATGTTGA GGGGAGGCAA GGCTGATC Figure 2A . The cDNA ( SEQ ID . NO . :2569 ) and amino acid sequence (SEQ ID . NO . :2570 ) of 108P5H8 v . 1 . The start methionine is underlined . The open reading frame extends from nucleic acid 253 - 1542 including the stop codon . i gccggcctccagcagcgggcgcggcgggcgcgagcacgaccccactctcctgcggccgcg 61 ggtggagcagcgcgagcccgcctcgctgagccggccgggggcggggagatgagttgcggc 121 cccgcggcagcgccccaggatggggagggacgcgcggcactgccctcgagaactggcgct 181 ccggegaagtaggcgccgccggccgtccgcctcccccaagccgttccgcaccgcggccgc MAGS GA W KRL K S M L R K 241 tcagcctctgCCATGGCCGGCTCTGGCGCGTGGAAGCGCCTCAAATCTATGCTAAGGAAG 17 DD A PL FIND T S A F D F S D E A G 301 GATGATGCGCCGCTGTTTTTAPATGACACCAGCGCCTTTGACTTCTCGGATGAGGCGGGG 37 D E GLS RF N K L R V V V A DDGS E 361 GACGAGGGGCTTTCTCGGTTCAACAAACTTCGAGTTGTGGTGGCCGATGACGGTTCCGAA 57 APE RP VNG A H P T L QADD DSL 421 GCCCCGGAAAGGCCTGTTAACGGGGCGCACCCGACCCTCCAGGCCGACGATGATTCCTTA 77 L DOD L P L T N SQL K v Ds CD 481 CTGGACCAAGACTTACCTTTGACCAACAGTCAGCTGAGTTTGAAGGTGGACTCCTGTGAC 97 N C S K Q R E I L K Q R K V K A R L T I 541 AACTGCAGCAAACAGAGAGAGATACTGAAGCAGAGAAAGGTGAAAGCCAGGTTGACCATT 117 A AV LY L L MI GE IV G GYI AN 601 GCTGCCGTTCTGTACTTGCTTTTCATGATTGGAGAACTTGTAGGTGGATACATTGCAAAT 137 S L A I MI DA L H M L T D L SA II L 661 AGCCTAGCAATCATGACAGATGCACTTCATATGTTAACTGACCTAAGCGCCATCATACTC 157 TL L AL WLS S K S P T K RF TF GF 721 ACCCTGCTTGCTTTGTGGCTATCATCAAAATCACCAACCAAAAGATTCACCTTTGGATTT 177 H R LE V SAM I SV V YILM G 781 CATCGCTTAGAGGTTTTGTCAGCTATGATTAGTGTGCTGTTGGTGTATATACTTATGGGA U . S . Patent Dec . 2 , 2008 Sheet 2 of 38 US 7 ,459 , 539 B2 Figure 2A continued 197 F 1 ? ? ? ? ? Q R ? ? ? ? ? ? ? ? ? G D 841 TTCCTCTTATATGAAGCTGTGCAAAGAACTATCCATATGAACTATGAAATAAATGGAGAT 217 I M L IT AA v G v Av NV IMG FLL 901 ATAATGCTCATCACCGCAGCTGTTGGAGTTGCAGTTAATGTAATAATGGGGTTTCTGTTG 237 N e S G H RHS S S L P S N S P I R 961 AACCAGTCTGGTCACCGTCACTCCCATTCCCACTCCCTGCCTTCAAATTCCCCTACCAGA 257 G S G C E R N G e DSL A RA A EV 1021 GGTTCTGGGTGTGAACGTAACCATGGGCAGGATAGCCTGGCAGTGAGAGCTGCATTTGTA 277 H A L G D L V OS v G v L I AAYI I R 1081 CATGCTTTGGGAGATTTGGTACAGAGTGTTGGTGTGCTAATAGCTGCATACATCATACGA 297 F KPE Y KI A DPI c I Y v F S L L v 1141 TTCAAGCCAGAATACAAGATTGCTGACCCCATCTGTACATACGTATTTTCATTACTTGTG 317 A E T T E R I I W D T V VI I L E G v P 1201 GCTTTTACAACATTTCGAATCATATGGGATACAGTAGTTATAATACTAGAAGGTGTGCCA 337 S H L N V DY I K E AL MK I E D V Y S 1261 AGCCATTTGAATGTAGACTATATCAAAGAAGCCTTGATGAAAATAGAAGATGTATATTCA 357 V E D L N I W S L I S G K S T A I v H I 1321 GTCGAAGATTTAAATATCTGGTCTCTCACTTCAGGAAAATCTACTGCCATAGTTCACATA 377 Q I P G S S S K W E E ve S K A NHL 1381 CAGCTAATTCCTGGAAGTTCATCTAAATGGGAGGAAGTACAGTCCAAAGCAAACCATTTA 397 L L W T F G M Y R c T I Q L 2 s Y R E 1441 TTATTGAACACATTTGGCATGTATAGATGTACTATTCAGCTTCAGAGTTACAGGCAAGAA 417 v D R T C A N C Q S S S P + 1501 GTGGACAGAACTTGTGCAAATTGTCAGAGTTCTAGTCCCTAAttttatgtattttgggaa 1561 ctcctgccttatttatcctgcagtcacagacttgagagcaataaatgcaaacctaaatga 1621 gaaaatggaatccctgacagctgtgtccgtatcaagcatcagtctctcaaacagttgccc 1681 cagcctgacagtgctagtctctgtttaatggtaaaaggagactttgccataattttcaga 1741 tgaagatgtttcccaaacactgtttacagaatgagatgtgactctacagatacctcatag 1801 aagacaatccaagatcatacttcattaacttgacagagtacgtgtcttaaaggaagcatc 1861 aagaattcaatatttgcatttaaaaatactttttaaggccattttatattaagccagtgc 1921 tggaaaactgaattttttttattatgtataataatctcgacacccagcttctggaattge 1981 tgctttctttttacagaaattactacccaacagatttcaggaagtactagtagttatccc 2041 aaaagtggaataagcatgtattcctaagtgtttcagaaatgttttatttcacacataagt 2101 cttaatgttattgttatgactatactttataaacaaccttttccagatgctacagggttt 2161 tgaatctcaaagttaacatttttcattatttgtaatcttagaaccaaatctttatttatt 2221 gtggtcactgttattaaatgatttaggaaatactttcaatattattctgaatggctgaag 2281 ttagtcttaaactcaaattactatatgatgatttaaaacaaaataaaagagcgaggatgg
Load more

Recommended publications
  • Interactions of Zinc with the Intestinal Epithelium - Effects On
    Aus dem Institut für Veterinär-Physiologie des Fachbereichs Veterinärmedizin der Freien Universität Berlin Interactions of zinc with the intestinal epithelium - effects on transport properties and zinc homeostasis Inaugural-Dissertation zur Erlangung des Grades eines Doktors der Veterinärmedizin an der Freien U niversität Berlin vorgelegt von Eva-Maria Näser, geb. Gefeller Tierärztin aus Kassel Berlin 2015 Journal-Nr.: 3813 Gefördert durch die Deutsche Forschungsgemeinschaft und die H.W. Schaumann Stiftung Gedruckt mit Genehmigung des Fachbereichs Veterinärmedizin der Freien Universität Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Univ.-Prof. Dr. Jörg Rudolf Aschenbach Zweiter Gutachter: Prof. Dr. Holger Martens Dritter Gutachter: Prof. Dr. Robert Klopfleisch Deskriptoren (nach CAB-Thesaurus): pigs, weaning, zinc, intestines, epithelium, jejunum, ion transport Tag der Promotion: 15.09.2015 Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbibliografie; detaillierte bibliografische Daten sind im Internet über <http://dnb.ddb.de> abrufbar. ISBN: 978-3-86387-656-2 Zugl.: Berlin, Freie Univ., Diss., 2015 Dissertation, Freie Universität Berlin D 188 Dieses Werk ist urheberrechtlich geschützt. Alle Rechte, auch die der Übersetzung, des Nachdruckes und der Vervielfältigung des Buches, oder Teilen daraus, vorbehalten. Kein Teil des Werkes darf ohne schriftliche Genehmigung des Verlages in irgendeiner Form reproduziert oder unter Verwendung elektronischer Systeme verarbeitet, vervielfältigt oder verbreitet werden. Die Wiedergabe von Gebrauchsnamen, Warenbezeichnungen, usw. in diesem Werk berechtigt auch ohne besondere Kennzeichnung nicht zu der Annahme, dass solche Namen im Sinne der Warenzeichen- und Markenschutz-Gesetzgebung als frei zu betrachten wären und daher von jedermann benutzt werden dürfen. This document is protected by copyright law.
    [Show full text]
  • Clinical Study Molecular Characterization of Schizophrenia Viewed by Microarray Analysis of Gene Expression in Prefrontal Cortex
    Neuron, Vol. 28, 53±67, October, 2000, Copyright 2000 by Cell Press Molecular Characterization of Clinical Study Schizophrenia Viewed by Microarray Analysis of Gene Expression in Prefrontal Cortex Ka roly Mirnics,*³§ Frank A. Middleton,* pus, superior temporal gyrus, and thalamus, appear to Adriana Marquez,* David A. Lewis,² be disturbed in this disorder (Harrison, 1999; McCarley and Pat Levitt*³ et al., 1999). In particular, a convergence of observations *Department of Neurobiology from clinical, neuroimaging, and postmortem studies ² Departments of Psychiatry and Neuroscience have implicated the dorsal prefrontal cortex (PFC) as a ³ PittArray major locus of dysfunction in schizophrenia (Weinberger University of Pittsburgh School of Medicine et al., 1986; Selemon et al., 1995; Andreasen et al., 1997; Pittsburgh, Pennsylvania 15261 Bertolino et al., 2000). Abnormal PFC function probably contributes to many of the cognitive disturbances in schizophrenia and appears to be related to altered syn- aptic structure and/or function in this cortical region. Summary For example, in subjects with schizophrenia, reductions in gray matter volume in the dorsal PFC have been ob- Microarray expression profiling of prefrontal cortex served in neuroimaging studies (Goldstein et al., 1999; from matched pairs of schizophrenic and control sub- Sanfilipo et al., 2000), and these volumetric changes jects and hierarchical data analysis revealed that tran- are associated with an increase in cell packing density scripts encoding proteins involved in the regulation (Selemon et al., 1995, 1998; Lewis and Lieberman, 2000) of presynaptic function (PSYN) were decreased in all but no change in total neuron number in the PFC (Pak- subjects with schizophrenia. Genes of the PSYN group kenberg, 1993).
    [Show full text]
  • Frontiersin.Org 1 April 2015 | Volume 9 | Article 123 Saunders Et Al
    ORIGINAL RESEARCH published: 28 April 2015 doi: 10.3389/fnins.2015.00123 Influx mechanisms in the embryonic and adult rat choroid plexus: a transcriptome study Norman R. Saunders 1*, Katarzyna M. Dziegielewska 1, Kjeld Møllgård 2, Mark D. Habgood 1, Matthew J. Wakefield 3, Helen Lindsay 4, Nathalie Stratzielle 5, Jean-Francois Ghersi-Egea 5 and Shane A. Liddelow 1, 6 1 Department of Pharmacology and Therapeutics, University of Melbourne, Parkville, VIC, Australia, 2 Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark, 3 Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia, 4 Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland, 5 Lyon Neuroscience Research Center, INSERM U1028, Centre National de la Recherche Scientifique UMR5292, Université Lyon 1, Lyon, France, 6 Department of Neurobiology, Stanford University, Stanford, CA, USA The transcriptome of embryonic and adult rat lateral ventricular choroid plexus, using a combination of RNA-Sequencing and microarray data, was analyzed by functional groups of influx transporters, particularly solute carrier (SLC) transporters. RNA-Seq Edited by: Joana A. Palha, was performed at embryonic day (E) 15 and adult with additional data obtained at University of Minho, Portugal intermediate ages from microarray analysis. The largest represented functional group Reviewed by: in the embryo was amino acid transporters (twelve) with expression levels 2–98 times Fernanda Marques, University of Minho, Portugal greater than in the adult. In contrast, in the adult only six amino acid transporters Hanspeter Herzel, were up-regulated compared to the embryo and at more modest enrichment levels Humboldt University, Germany (<5-fold enrichment above E15).
    [Show full text]
  • List & Label Preview File
    L I N A R I S I n f o r m a t i o n B I O L O G I S C H E P R O D U K T E PRIMÄRANTIKÖRPER-Veterinär erkennen: Maus, verschiedene Labels alphabetisch geordnet Beschreibung Format Klon Wirt Isotyp Anwendung Menge ME Kat.Nr. Description Format Clone Host Isotype Application Quantity Cat.No. Mouse Anti-Cardiolipin Ig's -ve control for ELISA 1 ml ADI-5502 IgG Mouse 0,5 mg ADI-AMPT11-M-500 Anti-Cardiolipin Ig's +ve control for ELISA polyclonal Mouse 1 ml ADI-5503 CD27 PE (Armenian Hamster IgG1) Hamster 50 tests ADI-MCD027-PE Monoclonal Anti-VSV-G-Cy conjugate for Mouse 0,1 mg ADI-VSV11-Cy Immunofluorescence Interleukin-4 IgG Mouse 0,1 mg ADI-AB-10710 Anti-Myelin Oligodendrocyte Glycoprotein IgG Mouse 0,1 mg ADI-AB-19910 CD160 mAb, PE, , (mouse IgG2bk) Mouse 50 tests ADI-MCD160-PE CD81, Purified (mouse IgG1) Mouse 0,1 mg ADI-MCD081-UL Interleukin-2 receptor IgG Rat 0,1 mg ADI-AB-10310 Interleukin-2 IgG Rat 0,1 mg ADI-AB-10510 Interleukin-4 IgG Rat 0,1 mg ADI-AB-10810 Interleukin-10 IgG Rat 0,1 mg ADI-AB-11310 Interleukin-12p40 IgG Rat 0,1 mg ADI-AB-11410 CTLA-4 IgG Rat 0,1 mg ADI-AB-11610 CD80 IgG Rat 0,1 mg ADI-AB-13310 CD11a IgG Rat 0,1 mg ADI-AB-13510 CD11b-FITC IgG Rat 0,1 mg ADI-AB-13610 B220 IgG Rat 0,1 mg ADI-AB-13910 CD90 Thy-1.1 IgG Rat 0,1 mg ADI-AB-14010 CD90 Thy-1.2 IgG Rat 0,1 mg ADI-AB-14110 CD90 Thy-1 IgG Rat 0,1 mg ADI-AB-14210 CD4 IgG Rat 0,1 mg ADI-AB-16510 IFN-gamma IgG Rat 0,1 mg ADI-AB-16610 CD3 IgG Rat 0,1 mg ADI-AB-17510 Interleukin-12p75 IgG Rat 0,1 mg ADI-AB-20910 CD8b , PE-Cy5 (Clone CT-CD8b) (rat IgG2a) Rat 50 tests
    [Show full text]
  • Maestra En Ciencias Biológicas
    UNIVERSIDAD MICHOACANA DE SAN NICOLÁS DE HIDALGO FACULTAD DE BIOLOGÍA Programa institucional de Maestría en Ciencias Biológicas “Identificación de genes asociados a la síntesis de magnetita en la tortuga negra Chelonia agassizii.” TESIS QUE PARA OBTENER EL GRADO DE: Maestra en Ciencias Biológicas PRESENTA: Biol. María Guadalupe Rodríguez Jiménez Directora de Tesis: Dra. Alma Lilia Fuentes Farías Co-director: Dr. Jesús Campos García Morelia, Michoacán. Marzo del 2014 1 AGRADECIMIENTOS A Dios por darme la dicha de tener una hermosa familia, a mis padres y hermanos por todo el apoyo incondicional durante todos estos años y por haber compartido conmigo momentos inolvidables. A la Dra. Alma Lilia Fuentes Farías y al Dr. Gabriel Gutiérrez Ospina por darme el espacio y la oportunidad de integrarme a su equipo de trabajo, por todo el apoyo brindado y el esfuerzo dedicado al proyecto durante todo este tiempo. Al Dr. Jesús Campos García por recibirme en su Laboratorio de Biotecnología Microbiana en el IIQB, por las horas incansables de trabajo y esfuerzo dedicado al proyecto. Al Dr. Alejandro Bravo Patiño y a la Dra. Esperanza Meléndez Herrera, por sus valiosos comentarios y sugerencias que sin duda enriquecieron de manera sustancial al trabajo. A la M.C. Alma Laura Díaz Pérez, por el apoyo brindado, sus valiosas aportaciones y sugerencias durante la fase experimental. Al Dr. Jesús Ramírez Santos, por las sugerencias y el apoyo técnico brindado durante el proyecto. Al Dr. Irvin Jácome y al Dr. Víctor Meza por el apoyo brindado en la fase de expresión de genes en el trabajo. A todos mis amigos, compañeros de laboratorio por su apoyo y compañía.
    [Show full text]
  • Roles of the Plant Cell Wall in Powdery Mildew Disease
    Roles of the plant cell wall in powdery mildew disease resistance in Arabidopsis thaliana: PMR5 (POWDERY MILDEW RESISTANT 5) affects the acetylation of cell wall pectin By Candice Cherk Lim A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Plant Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Shauna Somerville, Chair Professor Patricia Zambryski Associate Professor Mary Wildermuth Professor James Berger Spring 2013 Abstract Roles of the plant cell wall in powdery mildew disease resistance in Arabidopsis thaliana: PMR5 (POWDERY MILDEW RESISTANT 5) affects the acetylation of cell wall pectin by Candice Cherk Lim Doctor of Philosophy in Plant Biology University of California, Berkeley Professor Shauna Somerville, Chair The pmr5 (powdery mildew resistant 5) mutant was found in a screen for genes involved in susceptibility to Golovinomyces cichoracearum, a biotrophic pathogen that infects Arabidopsis. PMR5 is a member of the TBL (TRICHOME BIREFRINGENCE LIKE) family, which is composed of 46 functionally uncharacterized plant-specific proteins. Initial characterization of this mutant showed that pmr5-mediated disease resistance acts independently of the salicylic acid, jasmonic acid, and ethylene signal transduction pathways, and that there are changes in the pmr5 cell wall that may be linked to the gain of resistance in the mutant. Specifically, PMR5 may be affecting cell wall pectin by acetylation. Characterization of the pmr5 cell wall has revealed changes in pectin composition and a decrease in acetylation. This is corroborated by the ability of heterologously expressed PMR5 protein to bind to pectin, with decreased binding affinity to acetylated pectin.
    [Show full text]
  • SLC39A14 Gene Solute Carrier Family 39 Member 14
    SLC39A14 gene solute carrier family 39 member 14 Normal Function The SLC39A14 gene provides instructions for making a protein that transports the element manganese across cell membranes. Manganese is important for many cellular functions, but large amounts are toxic, particularly to brain cells. The SLC39A14 protein is found in the membranes surrounding several types of cells, as well as in the membranes of structures within these cells. The protein is thought to transport excess manganese from the blood into liver cells so that it can be removed from the body through bile. Bile is a substance produced by the liver that is important for digestion and the removal of waste products. The SLC39A14 protein may also transport other elements, including zinc, iron, and cadmium, across cell membranes. The importance of this transport in the body is not well understood. Health Conditions Related to Genetic Changes Hypermanganesemia with dystonia At least five SLC39A14 gene mutations have been found to cause hypermanganesemia with dystonia 2, a condition that begins in early childhood and is characterized by high levels of manganese in the blood and brain (hypermanganesemia), involuntary tensing of the muscles (dystonia), and other movement problems. These mutations impair the transport of manganese into liver cells. As a result, the element cannot be removed from the body through bile. The excess manganese builds up in the blood and subsequently in brain cells, particularly cells in a region of the brain that helps control movement. High levels
    [Show full text]
  • Functional Characterisation of the Barley ZIP7 Zinc Transporter
    Functional characterisation of the barley ZIP7 zinc transporter Jingwen Tiong B. Science (Hons), The University of Adelaide A thesis submitted for the degree of Doctor of Philosophy The University of Adelaide Faculty of Sciences School of Agriculture, Food & Wine Waite Campus February 2012 I Contents List of figures ......................................................................................................................... VI List of tables ......................................................................................................................... VII Abstract ............................................................................................................................... VIII Declaration .............................................................................................................................. X Acknowledgements ............................................................................................................... XI Glossary of abbreviations .................................................................................................. XIII Chapter 1: Literature Review ................................................................................................. 1 1.1 Introduction ...................................................................................................................... 1 1.2 Improvement of plant Zn nutrition and biofortification .................................................. 3 1.2.1 Application of Zn fertilisers as an agronomic
    [Show full text]
  • Mirnas Documented to Play a Role in Hematopoietic Cell Lineage. Our
    Table S1: miRNAs documented to play a role in hematopoietic cell lineage. Our review of the literature summarizing miRNAs known to be involved in the development and proliferation of the hematopoietic lineage cells. miRNA Expression/function/target/regulator References miR-150 Elevated during developmental stages of B and T cell maturation. 16-19 Controls B cell differentiation, present in mature, resting T and B cells but decreased upon activation of naïve T or B cells. Plays a role in establishing lymphocyte identity. Very little is known about function in T cells. Regulators: Foxp3 Target: C-Myb miR-146a/b Upregulated in macropgahe inflammatory response. Differentially 17, 20 upregulated in murine Th1 subset but abolished in Th2 subset. Upregulated in response to TCRs stimulation, as well as by IL-1 and TNF. Highly expressed in murine T-regs and could play a role in establishing lymphocyte identity. Modulates activation induced cell death in activated T cells. Negative regulator of TLR and cytokine signaling pathway. Endotoxin tolerance. Antiviral role. Targets: IRAK1, IRAK2, TRAF6, FAF1 miR-16-1 Promote apoptosis by targeting Bcl2 expression, act as tumor 22 cluster suppressor RNAs. May block differentiation of later stage hematopoietic progenitor cells to mature cells. Downregulated in CLL. Target: BCL2. miR-155 Regulator of T and B cell maturation and innate immune response. 23-29 Expressed in primary mediastinal B-cell lymphoma, T and B cells, macrophages and DCs. Upregulated during B cell activation. Involved in T cell differentiation and indicated as a positive regulator of cytokine production. Activated by stimulating TLR3 and INFab receptors in bone derived macrophages (regulation of antimicrobial defense).
    [Show full text]
  • Differential Expression of Intestinal Membrane Transporters in Cholera
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 581 (2007) 3183–3188 Differential expression of intestinal membrane transporters in cholera patients Carl-Fredrik Flacha,*, Firdausi Qadrib, Taufiqur R. Bhuiyanb, Nur H. Alamb, Eva Jennischec, Jan Holmgrena, Ivar Lo¨nnrothd a Institute of Biomedicine, Department of Microbiology and Immunology, and Go¨teborg University Vaccine Research Institute (GUVAX), Go¨teborg University, Box 435, 40530 Go¨teborg, Sweden b International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR, B), Centre for Health and Population Research, Dhaka, Bangladesh c Institute of Biomedicine, Department of Anatomy and Cell Biology, Go¨teborg University, Go¨teborg, Sweden d Institute of Biomedicine, Department of Clinical Bacteriology, Go¨teborg University, Go¨teborg, Sweden Received 10 April 2007; revised 28 May 2007; accepted 1 June 2007 Available online 12 June 2007 Edited by Takashi Gojobori The patients are given an electrolyte solution intravenously fol- Abstract Vibrio cholerae causes the cholera disease through secretion of cholera toxin (CT), resulting in severe diarrhoea lowed by an oral rehydration solution (ORS). The ORS is sup- by modulation of membrane transporters in the intestinal epithe- plemented with carbohydrates for more effective reabsorption lium. Genes encoding membrane-spanning transporters identified of electrolytes, as it is known that sugars are cotransported with as being differentially expressed during cholera disease in a Na+ over the apical membrane of the enterocytes [2]. microarray screening were studied by real-time PCR, immuno- The major virulence factor responsible for the dehydrating histochemistry and in a CaCo-2 cell model.
    [Show full text]
  • A Comprehensive Set of Transcript Sequences of the Heavy Metal Hyperaccumulator Noccaea Caerulescens
    Plant Physiology A comprehensive set of transcript sequences of the heavy metal hyperaccumulator Noccaea caerulescens YA-FEN LIN, Edouard Severing, Bas te_Lintel_Hekkert, Elio Schijlen and Mark G.M. Aarts Journal Name: Frontiers in Plant Science ISSN: 1664-462X Article type: Original Research Article Received on: 11 Dec 2013 Accepted on: 21 May 2014 Provisional PDF published on: 21 May 2014 www.frontiersin.org: www.frontiersin.org Citation: Lin Y, Severing E, Te_lintel_hekkert B, Schijlen E and Aarts MG(2014) A comprehensive set of transcript sequences of the heavy metal hyperaccumulator Noccaea caerulescens. Front. Plant Sci. 5:261. doi:10.3389/fpls.2014.00261 /Journal/Abstract.aspx?s=907& /Journal/Abstract.aspx?s=907&name=plant%20physiology& name=plant%20physiology& ART_DOI=10.3389/fpls.2014.00261 ART_DOI=10.3389 /fpls.2014.00261: (If clicking on the link doesn't work, try copying and pasting it into your browser.) Copyright statement: © 2014 Lin, Severing, Te_lintel_hekkert, Schijlen and Aarts. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. This Provisional PDF corresponds to the article as it appeared upon acceptance, after rigorous peer-review. Fully formatted PDF and full text (HTML) versions will be made available soon. 1 A comprehensive set of transcript sequences of the heavy metal 2 hyperaccumulator Noccaea caerulescens 1# 1,2,# 3 3 1* 3 Ya-Fen Lin , Edouard Severing , Bas te Lintel Hekkert , Elio Schijlen , and Mark G.M.
    [Show full text]
  • The Influence of Root-Zone Bicarbonate and Carbon Dioxide Enrichment on Lettuce, Pepper and Tomato Growth
    The influence of root-zone bicarbonate and carbon dioxide enrichment on lettuce, pepper and tomato growth Estibaliz Leibar-Porcel B.Sc Biology, University of Vigo, Spain M.Sc Molecular Biotechnology, University of Barcelona, Spain This thesis is submitted to Lancaster University in partial fulfilment of the requirements for the degree of doctor of philosophy Declaration Except where reference is made to other sources, I declare that the contents in this thesis are my own work and have not been previously submitted, in part or in full, for the award of a higher degree elsewhere. Estibaliz Leibar-Porcel Lancaster University July 2019 i Publications arising from this thesis Leibar-Porcel, E., McAinsh, M.R., Dodd, I.C. Root-zone CO2 enrichment increases biomass accumulation in lettuce and pepper grown hydroponically and aeroponically. Acta Horticulturae. In Press. (Reproduced as Appendix 1) Oral/Poster presentations from this work Conferences: Leibar-Porcel, E. Increasing crop yield and resource efficiency via root-zone CO2 enrichment. The Great British Tomato Conference. Chesford Grange Hotel. 28-29th September 2016. Leibar-Porcel, E. Increasing crop yield and resource efficiency via root-zone CO2 enrichment. Plant & Crop Science Postgraduate Conference, Lancaster University, 4th October 2016. Leibar-Porcel, E. Increasing crop yield and resource efficiency via root-zone CO2 enrichment. AHDB Studentship Conference. Stratford Manor. 6-7th November 2017. Leibar-Porcel, E. Root-zone CO2 enrichment increases biomass accumulation in lettuce and pepper grown hydroponically and aeroponically. Oral presentation at the XXX. International Horticultural Congress. Istanbul, Turkey. 12-16th August 2018. Posters: Leibar-Porcel, E. Increasing crop yield and resource efficiency via root-zone CO2 enrichment.
    [Show full text]