Impacts of Feed Additives on Surface Mucosal Health and Columnaris Susceptibility in Channel Catfish, Ictalurus Punctatus
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used. -
Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Adherent Intestinal Cells from Atlantic Salmon Show Phagocytic Ability and Express Macrophage-Specific Genes
fcell-08-580848 October 11, 2020 Time: 9:56 # 1 ORIGINAL RESEARCH published: 15 October 2020 doi: 10.3389/fcell.2020.580848 Adherent Intestinal Cells From Atlantic Salmon Show Phagocytic Ability and Express Macrophage-Specific Genes Youngjin Park1, Qirui Zhang2, Geert F. Wiegertjes3, Jorge M.O. Fernandes1 and Viswanath Kiron1* 1 Faculty of Biosciences and Aquaculture, Nord University, Bodø, Norway, 2 Division of Clinical Genetics, Lund University, Lund, Sweden, 3 Aquaculture and Fisheries Group, Wageningen University & Research, Wageningen, Netherlands Our knowledge of the intestinal immune system of fish is rather limited compared to mammals. Very little is known about the immune cells including the phagocytic cells Edited by: Yi Feng, in fish intestine. Hence, employing imaging flow cytometry and RNA sequencing, we The University of Edinburgh, studied adherent cells isolated from healthy Atlantic salmon. Phagocytic activity and United Kingdom selected gene expression of adherent cells from the distal intestine (adherent intestinal Reviewed by: cells, or AIC) were compared with those from head kidney (adherent kidney cells, or Dimitar Borisov Iliev, Institute of Molecular Biology (BAS), AKC). Phagocytic activity of the two cell types was assessed based on the uptake Bulgaria of Escherichia coli BioParticlesTM. AIC showed phagocytic ability but the phagocytes Sherri L. Christian, Memorial University of Newfoundland, were of different morphology compared to AKC. Transcriptomic analysis revealed that Canada AIC expressed genes associated with macrophages, T cells, and endothelial cells. *Correspondence: Heatmap analysis of selected genes indicated that the adherent cells from the two Viswanath Kiron organs had apparently higher expression of macrophage-related genes. We believe [email protected] that the adherent intestinal cells have phagocytic characteristics and high expression Specialty section: of genes commonly associated with macrophages. -
Analysis of the Human Serum Proteome
Cedarville University DigitalCommons@Cedarville Pharmaceutical Sciences Faculty Publications Department of Pharmaceutical Sciences 6-2004 Analysis of the Human Serum Proteome King C. Chan David A. Lucas Denise Hise Carl F. Schaefer Zhen Xiao See next page for additional authors Follow this and additional works at: https://digitalcommons.cedarville.edu/ pharmaceutical_sciences_publications Part of the Pharmacy and Pharmaceutical Sciences Commons This Article is brought to you for free and open access by DigitalCommons@Cedarville, a service of the Centennial Library. It has been accepted for inclusion in Pharmaceutical Sciences Faculty Publications by an authorized administrator of DigitalCommons@Cedarville. For more information, please contact [email protected]. Authors King C. Chan, David A. Lucas, Denise Hise, Carl F. Schaefer, Zhen Xiao, George M. Janini, Kenneth H. Buetow, Haleem J. Issaq, Timothy D. Veenstra, and Thomas P. Conrads Clinical Proteomics Journal Copyright ©Humana Press Inc. All rights of any nature whatsoever are reserved. ISSN 1542-6416/04/01:101–225/$25.00 Serum/Plasma Proteome Analysis of the Human Serum Proteome King C. Chan,1,† David A. Lucas,1,† Denise Hise,2 Carl F. Schaefer,2 Zhen Xiao,1 George M. Janini,1 Kenneth H. Buetow,2 Haleem J. Issaq,1 Timothy D.Veenstra,1 and Thomas P. Conrads1,* 1Laboratory of Proteomics and Analytical Technologies, National Cancer Institute at Frederick, SAIC-Frederick, Inc, PO Box B, Frederick, MD 21702 2Center for Bioinformatics, National Cancer Institute, Bethesda, MD 20892 †These authors contributed equally to this work. each of which was analyzed by microcapillary Abstract reversed-phase liquid chromatography coupled Changes in serum proteins that signal online with MS/MS analysis. -
Interactions of Zinc with the Intestinal Epithelium - Effects On
Aus dem Institut für Veterinär-Physiologie des Fachbereichs Veterinärmedizin der Freien Universität Berlin Interactions of zinc with the intestinal epithelium - effects on transport properties and zinc homeostasis Inaugural-Dissertation zur Erlangung des Grades eines Doktors der Veterinärmedizin an der Freien U niversität Berlin vorgelegt von Eva-Maria Näser, geb. Gefeller Tierärztin aus Kassel Berlin 2015 Journal-Nr.: 3813 Gefördert durch die Deutsche Forschungsgemeinschaft und die H.W. Schaumann Stiftung Gedruckt mit Genehmigung des Fachbereichs Veterinärmedizin der Freien Universität Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Univ.-Prof. Dr. Jörg Rudolf Aschenbach Zweiter Gutachter: Prof. Dr. Holger Martens Dritter Gutachter: Prof. Dr. Robert Klopfleisch Deskriptoren (nach CAB-Thesaurus): pigs, weaning, zinc, intestines, epithelium, jejunum, ion transport Tag der Promotion: 15.09.2015 Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbibliografie; detaillierte bibliografische Daten sind im Internet über <http://dnb.ddb.de> abrufbar. ISBN: 978-3-86387-656-2 Zugl.: Berlin, Freie Univ., Diss., 2015 Dissertation, Freie Universität Berlin D 188 Dieses Werk ist urheberrechtlich geschützt. Alle Rechte, auch die der Übersetzung, des Nachdruckes und der Vervielfältigung des Buches, oder Teilen daraus, vorbehalten. Kein Teil des Werkes darf ohne schriftliche Genehmigung des Verlages in irgendeiner Form reproduziert oder unter Verwendung elektronischer Systeme verarbeitet, vervielfältigt oder verbreitet werden. Die Wiedergabe von Gebrauchsnamen, Warenbezeichnungen, usw. in diesem Werk berechtigt auch ohne besondere Kennzeichnung nicht zu der Annahme, dass solche Namen im Sinne der Warenzeichen- und Markenschutz-Gesetzgebung als frei zu betrachten wären und daher von jedermann benutzt werden dürfen. This document is protected by copyright law. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, -
Dynamics of the Linc Complex
DYNAMICS OF THE LINC COMPLEX Loic Gazquez University of Manchester School of Biological Sciences 2017 A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health TABLE OF CONTENTS Table of Contents .................................................................................................................................... 2 Abstract.................................................................................................................................................... 4 Declaration .............................................................................................................................................. 5 Copyright statement ................................................................................................................................ 5 Acknowledgements ................................................................................................................................. 6 I. Introduction .................................................................................................................................. 7 Nuclear Envelope and the LINC complex ................................................................................... 7 I. 1.1. The first LINC component: the SUN ................................................................................ 8 I. 1.2. The second LINC component: the KASH ........................................................................ 8 I. 1.1. Structure -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Fecal Metatranscriptomics of Macaques with Idiopathic Chronic Diarrhea Reveals Altered Mucin Degradation and Fucose Utilization Samuel T
Westreich et al. Microbiome (2019) 7:41 https://doi.org/10.1186/s40168-019-0664-z RESEARCH Open Access Fecal metatranscriptomics of macaques with idiopathic chronic diarrhea reveals altered mucin degradation and fucose utilization Samuel T. Westreich1, Amir Ardeshir2, Zeynep Alkan3, Mary E. Kable3,4, Ian Korf1 and Danielle G. Lemay1,3,4* Abstract Background: Idiopathic chronic diarrhea (ICD) is a common cause of morbidity and mortality among juvenile rhesus macaques. Characterized by chronic inflammation of the colon and repeated bouts of diarrhea, ICD is largely unresponsive to medical interventions, including corticosteroid, antiparasitic, and antibiotic treatments. Although ICD is accompanied by large disruptions in the composition of the commensal gut microbiome, no single pathogen has been concretely identified as responsible for the onset and continuation of the disease. Results: Fecal samples were collected from 12 ICD-diagnosed macaques and 12 age- and sex-matched controls. RNA was extracted for metatranscriptomic analysis of organisms and functional annotations associated with the gut microbiome. Bacterial, fungal, archaeal, protozoan, and macaque (host) transcripts were simultaneously assessed. ICD- afflicted animals were characterized by increased expression of host-derived genes involved in inflammation and increased transcripts from bacterial pathogens such as Campylobacter and Helicobacter and the protozoan Trichomonas. Transcripts associated with known mucin-degrading organisms and mucin-degrading enzymes were elevated in the fecal microbiomes of ICD-afflicted animals. Assessment of colon sections using immunohistochemistry and of the host transcriptome suggests differential fucosylation of mucins between control and ICD-afflicted animals. Interrogation of the metatranscriptome for fucose utilization genes reveals possible mechanisms by which opportunists persist in ICD. -
The Mucin 5AC Level in Medical Faculty Students with Computer Vision Syndrome (CVS)
ORIGINAL ARTICLE Bali Medical Journal (Bali Med J) 2019, Volume 8, Number 2: 460-463 P-ISSN.2089-1180, E-ISSN.2302-2914 The mucin 5AC level in medical faculty students with ORIGINAL ARTICLE Computer Vision Syndrome (CVS) Published by DiscoverSys CrossMark Doi: http://dx.doi.org/10.15562/bmj.v8i2.1425 I Gusti Ayu Made Juliari,1* Ratna Sari Dewi,1 Ni Luh Made Novi Ratnasari,2 Ariesanti Tri Handayani1 Volume No.: 8 ABSTRACT Introduction: Prolonged computer use will lead to a group of level which less than 186.33 ng/mL categorized as low mucin, while symptoms such as dryness of eyes, tired, headache and others called more than 186.33 ng/mL categorized as normal mucin level. Data was Issue: 2 Computer Vision Syndrome (CVS). The decrease of Mucin 5 AC (MUC5AC) analyzed by crosstabulation table and chi-square test with significant level could be one of the signs of dry eye disease on persons with CVS. value p < 0.05. Objective: The purpose of this study is to describe the Mucin 5AC Result: Most of the students who diagnosed with CVS had lower level in medical faculty students of Udayana University, Bali, Indonesia mucin 5AC levels as much as 77,3% and 33,3% students with CVS had First page No.: 460 with CVS. normal mucin 5AC level. This study analyses found there is significant Method: It is an observational cross-sectional analytic study at association between level of mucin 5AC with CVS. The students with Medical Faculty Udayana University on October 2018. Thirty four low level of mucin 5AC had 6,8 higher risk tend to be CVS (OR=6,8; CI P-ISSN.2089-1180 subject selected by purposive sampling and examined with Schirmer 95%= 1,42-32,37; p=0,012).