Sirt1/Mir-182 Axis in Corneal Nerve Regeneration Ye Wang1

Home , Myeloperoxidase

Page 1 of 48 Diabetes

MicroRNA-182 mediates Sirt1-induced diabetic corneal nerve

regeneration

Running title: Sirt1/miR182 axis in corneal nerve regeneration

Ye Wang1, 2, *, Xiaowen Zhao1, Xiaoming Wu1, Yunhai Dai1, Peng Chen1, Lixin Xie1, *

1.State Key Laboratory Cultivation Base, Shandong Provincial Key Laboratory of

Ophthalmology, Shandong Eye Institute, Shandong Academy of medical Sciences,

Qingdao, 266071 China

2. Current affiliation: Central Laboratory of the Second Affiliated Hospital, Medical

College of Qingdao University, Qingdao, 266042, China

Word count: 4028

Number of tables and figures: 8

*Corresponding author:

Ye Wang, 127 Siliu South Rd. Qingdao, 266042 China, Tel: 08653284855375

LixinXie, 5 Yan’erdao Rd. Qingdao, 266071 China, Tel: 08653285877223; Fax:

086532858911110;

Ye Wang: [email protected]; LixinXie: [email protected]

Diabetes Publish Ahead of Print, published online April 12, 2016 Diabetes Page 2 of 48

Abstract

Sensory neurons are particularly susceptible to neuonal damages in diabetes mellitus and Sirt 1 (silent mating type information regulation 2 homolog1) was newly identified as a key gene in neuroprotection and wound healing. We found that the expression of Sirt1 was downregulated in trigeminal sensory neurons of diabetic mice.

The microRNA microarray analysis identified microRNA182 (miR182) as a Sirt1 downstream effector and the expression level of miR182 was increased by Sirt1 overexpression in trigeminal neurons; Sirt1 bound to the promoter of miR182 and regulated the transcription. We also revealed that miR182 enhanced neurite outgrowth in isolated trigeminal sensory neurons and overcame the detrimental effects of hyperglycemia by stimulating corneal nerve regeneration by decreasing expression of one of its target genes, NOX4. Furthermore, the effects of miR182 on corneal nerve regeneration are associated with a functional recovery of corneal sensation in hyperglycemic conditions. These data demonstrate that miR182 is a key regulator in diabetic corneal nerve regeneration through targeting NOX4, suggesting that miR182 might be a potential target for the treatment of diabetic sensory nerve regeneration and diabetic keratopathy.

Page 3 of 48 Diabetes

Introduction

Patients with diabetes exhibit various types of diabetic keratopathy, resulting in

irreversible visual impairment (1; 2). Cornea is innervated by the ophthalmic nerve

from trigeminal ganglia (TG) neurons (3) and corneal nerve fibers are sensitive to

lowintensity mechanical, chemical, and thermal stimulation (4). Corneal nerve

supports corneal epithelial nerve function (5) and plays an important role in corneal

epithelial wound healing through the interactions with TG sensory neurons (6).

Decreased corneal sensitivity and neuronal abnormalities in diabetic patients were

thought to be the main cause of diabetic keratopathy (7).

Silent mating type information regulation 2 homolog1 (Sirt1) is an emerging focal

point for neuroprotection in both central nervous system (8; 9) and peripheral nervous

system (1012). In our previous study, overexpression of Sirt1 promoted diabetic

corneal epithelial wound healing (13; 14). However, the underlying mechanism by

which Sirt1induces diabetic corneal nerve regeneration remains elusive.

MicroRNAs (miRNAs) are small noncoding RNA molecules found in multicellular

eukaryotes and play essential regulatory roles for translational repression (15).

Several wound healingrelated miRNAs were identified in the human diabetic corneas

(14; 16; 17), such as miR146a. Abnormal miR146a upregulation may be an

important mechanism of delayed wound healing in the diabetic cornea (17; 18).

Sirt1 is a direct target of microRNA2045p in regulating epithelial cell cycle

traversal in diabetic corneas suggests Sirt1 is involved in miRNAmRNA regulatory

network (14), whereas the downstream miRNA targets of Sirt1 remain unclear in

Diabetes Page 4 of 48

diabetic corneal nerve regeneration.

miR182 was one of a sensory organspecific miRNAs (19) and was implicated in diabetic retinopathy. Diabetic retinopathy is damage to the retina (the transparent, lightsensitive structure at the back of the eye) as a result of diabetes. miR182 was also found to be associated with oxidative stress (20; 21) and was developed with selective axonopathy in sensory neurons (22). Here we used the adenoviral system to activate Sirt1 in TG tissue through subconjunctival injection. Using a miRNA screening, we revealed expression of miR182 was upregulated by Sirt1 as a direct downstream target. Using in silico prediction and luciferase reporterassay, we found

NADPH oxidase 4 (NOX4), which belongs to NOX familya major source of ROS in peripheral sensory neurons (23), may be one of miR182 target genes in diabetic corneal nerve regeneration.

Research Design and Methods

Experimental animals and tract tracing techniques

The animal experiments were approved by the Institutional Animal Care and Use

Committee, Shandong Eye Institute (Qingdao, Shandong, China). The procedures and handling of the animals during the present study conformed with the guidelines of the

Association for Research and Vision and Ophthalmology statement for the use of animals in ophthalmic and vision research. In this study, we used

BKS.Cgm+/+Leprdb/J mice (db/db) mice as the mice model of type 2 DM. db/db and nondiabetic control db/+ mice were obtained from the Jackson Laboratory (Bar

Page 5 of 48 Diabetes

Harbor, ME, USA). Tailvein blood glucose concentrations were determined using a

commercial glucometer (Bayer Diabetes Care, Elkhart, IN, USA). A blood glucose

level of more than 15 mM was considered to be diabetic. Experiments on mice were

performed more than 24 weeks after the onset of DM based on a previous report (24).

The blood sugar and body weight of db/db and nondiabetic control db/+ mice were

shown in Table 1.

The in vivo corneal injury model was established as previously described (25). The

entire corneal epithelium including limbal region (marked with 3 mm trephine) was

scraped with algerbrush II corneal rust ring remover (Alger Co., Lago Vista, TX) and

the right eye was wounded in each animal. FluoroGold™ (FG, 2% in saline)

(Fluorochrome, Denver, CO, USA) was used as a retrograde tracer to identify neurons

in the TG that were subjected to detect the expression of miR182 after

subconjunctival injection with miR182 agomir (RiboBio, GuangZhou, China). The

mice were injected with an agomir negativetreated control (NTC), miR182 agomir,

adenovirus (Ad)expressing Sirt1 (Hanbio, Shanghai, China), or Adexpressing Sirt1

short interfering RNA (siRNA). Adexpressing green fluorescent protein (GFP)

served as a control. 2.5 nM agomir NTC or miR182 agomir with 2 µl FG was

injected into the subconjunctival site of the right eye on the same day as the corneal

epithelium injury. This experiment was performed at least twice. All of the mice were

assessed by using 3 L 0.25% fluorescein sodium and were photographed at 0, 24, 48,

and 72 hours under a dissecting microscope (Canon, Tokyo, Japan) and a tungsten

light source with a cobalt blue filter (WelchAllyn, Inc., Skaneateles, NY,USA). The

Diabetes Page 6 of 48

photographs were analyzed to quantify the area of the epithelial wound using Adobe®

Photoshop software (Adobe Systems, Mountain View, CA, USA).

Primary trigeminal ganglia (TG) neuronal cellculture and treatment

Ophthalmic branches of the trigeminal nerves were collected from db/db mice and nondiabetic db/+ mice and primary trigeminal ganglia neuronal cells were cultured as described previously (17). Culturing neurons from diabetic animals were treated with 5 mM Dglucose as normal glucose (NG) and 25 mM Dglucose as high glucose

(HG). The osmotic pressure of the NG medium was adjusted to the same level of the

HG medium by adding 20 mM Lglucose. In addition, TG cells were treated with 1

M SRT1720 (Selleck Chemical, Houston, TX, USA) or 10 M resveratrol (RSV)

(SigmaAldrich, St Louis, MO, USA) in HG medium. NG medium cultured cells were treated with these chemicals for using as a control.

RNA isolation, quantitative reverse transcriptase polymerase chain reaction (qPCR), and miRNA expression profiling and validation

To detect Sirt1 mRNA expression, total RNA was isolated from mice TG using the

RNeasy® Mini Kit (Qiagen, Hilden, Germany) and transcribed using the SuperScript®

Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Primer sequences were listed in Supplmentary Table 1. Data were normalized using mice ribosomal protein L5 housekeeping gene and analyzed by the 2Ct values of the normalized data.

For analyzing miRNA expression profiling, whole 24 TG samples were harvested from 12 wildtype C57BL/6 mice aged 68 weeks after 3 days of subconjunctival injection with Adexpressing Sirt1 or GFP (serving as a control). These samples were 6

Page 7 of 48 Diabetes

pooled into six groups and subjected to the miRNA microarray assay (AdSirt1

infection group 13 and AdGFP infection group 13, each of which comprised four

TGs from two mice). The array analysis, including labeling, hybridization, scanning,

normalization, and data analysis, was performed by CloudSeq Biotech Inc., Shanghai,

China, on a miRCURY LNA™ microRNA Array Kit v.16.0 (Exiqon, Vedbaek,

Denmark). The specific primers for detecting miR182 expression was designed and

synthesized by RiboBio (Guangzhou. China) using the SYBR Green® Quantitative

PCR Protocol. U6 was used as an endogenous control to normalize the expression

level of miR182. All reactions were performed in triplicate. The TG infected with

AdGFP was used as a calibrator, and the data were presented as the fold change

relative to the calibrator.

Real time PCR-Based Array Analysis

The isolation of total RNA and cDNA synthesis were performed as described

previously (13). The realtime PCR array and data analyses were performed using a

RT² Profiler™ PCR Array Mouse Oxidative Stress and Antioxidant Defense PCR

Array (PAMM065A, SABiosciences Corp., Frederick, MD).

Luciferase assay

A 2000 bp DNA fragment containing the putative promoter region of mouse miR182

was amplified by PCR using mice genomic DNA as a template, and was cloned into

the pGL3® Luciferase Reporter Vector (Promega, Madison, WI,USA). The primers

used for the PCR were as follows:

mmumiR182pF: GAATTGGTACCCCTTGGTGGAGGCTTTGCTGAGACC 7

Diabetes Page 8 of 48

mmumiR182pR: GGAATACGCGTCAGCAGCCAGACCAGTAAGCCTATG. miR182Luc reporter plasmid (200 ng) containing the firefly luciferase gene and pRLTK (50 ng) (Promega) were cotransfected with Sirt1 or the control vector (800 ng) into human HEK 293T cells. Luciferase activities were measured with the

DualLuciferase® Reporter Assay System (Promega) and Centro® LB 960 detection system (Berthold, Germany).

Mouse NOX4 3’UTR containing the putative target site for miR182 was amplified from genomic DNA by PCR amplification and inserted into the pmiRREPORT™ (RiboBio). The mutant reporter plasmid at the miR182 complementarity site (TGCCAAA to ACGGTTT) was generated by the QuikChange

II® SiteDirected Mutagenesis Kit (Stratagene, La Jolla, CA, USA). The SHSY5Y neuroblastoma cells were transiently transfected with wildtype or mutant reporter plasmid and miRNA agomir/mimic using Lipofectamine® 2000 (Invitrogen, Carlsbad,

CA, USA).

Corneal nerve staining

Corneas from db/db and control db/+ mice were fixed in 4% paraformaldehyde and stained with an antiNeuron® Specific beta III Tubulin antibody (ab7751, Abcam,

Cambridge, MA, USA). Representative images were taken by using a Nikon® Eclipse

NiU fluorescence microscope (Nikon, Tokyo, Japan). Corneal specimen was examined in four pieshaped quadrants: superior (10.301.30 o’clock), inferior

(4.307.30 o’clock), nasal right eye and temporal left eye (1.304.30 o’clock), and temporal right eye and nasal left eye (7.3010.30 o’clock). The corneal nerves

Page 9 of 48 Diabetes

entering each quadrant were counted using ImageJ®Software (National Institutes of

Health, Bethesda, MA, USA).

Immunofluorescence

Cornea and TG samples were frozen in TissueTek optimum cutting temperature

compound (Sakura Fine technical, Tokyo, Japan). Frozen sections were fixed in 4%

paraformaldehyde. The samples were stained with primary antibodies (Supplmentary

Table 2) and subsequently incubated with fluoresceinconjugated secondary

antibodies. All stained samples were observed under a microscopeas described

previously (14).

Western blot

Samples were homogenized in 100 L RIPA buffer supplemented with a proteinase

inhibitor cocktail. The homogenates, which contained 1020 g protein, were then

separated in 15% SDSpolyacrylamide gels and transferred to polyvinyl difluoride

membranes. The blots were probed with primary antibodies as described previously

(14).

SmartFlares™ detection of miR-182 in trigeminal sensory neurons

The presence of miR182 in trigeminal sensory neurons was tested using

SmartFlares™ (Merck Millipore, Bedford, MA, USA). The mice were injected into the

subconjunctival site of the right eye with 1.5 µl SmartFlares™ after 24 hours with

miR182 agomir or agomir NTC treatment. After another 24 hours, the TG samples

were collected for detecting miR182 expression. We also performed the double

Diabetes Page 10 of 48

staining of Neurofilaments® 200 (NF200) (SigmaAldrich, Shanghai, China) and miR182 according to the immunocytochemistry protocol for mice primary neuronal cells with SmartFlare™ RNA detection probes.

Statistical analyses

The results are presented as the means ± standard error (SEM) . The statistical analyses were performed using an unpaired ttest or a oneway analysis of variance by comparing the groups using the StudentNewmanKeuls test. The least significant difference procedure was performed with GraphPad Prism software 5.0 (GraphPad

Software, Inc., San Diego, CA). A pvalue < 0.05 was considered to be statistically significant.

Results

Downregulation of Sirt1 in trigeminal sensory neurons from diabetic mice

We first examined the blood sugar and body weight of db/db and nondiabetic control db/+ mice (Table 1). As expected, db/db mice had significantly higher concentrations of blood glucose and body weight than the control mice (n=20 per group). The expression of Sirt1 was significantly downregulated at both mRNA and protein levels in the diabetic TG neurons compared with the control (n = 10 per group) (Figure 1Ai and 1Bi).

The mRNA and protein expression levels of Sirt1 were also reduced in TG cells with HG treatment compared with NG treatment group (n = 10 per group) (Figure

1Aii and 1Bii). Coimmunostaining results showed Sirt1 was partially colabelled 10

Page 11 of 48 Diabetes

with NF200 expressing neuronal cell bodies of TG sensory neurons (Figure 1C). The

number of Sirt1 positive cells were significantly decreased in the diabetic mice, which

confirmed the downregulation of Sirt1 in db/db mice.

The miR-182 is regulated by Sirt1 in high glucose conditions

In view of the downregulation of Sirt1 in TG sensory neurons of db/db mice, we

hypothesized Sirt1 might be essential for sensory neuron protection. Therefore, we

used the adenoviral system to overexpress Sirt1 in TG tissue through subconjunctival

injection, and Sirt1overexpressed TG tissues were collected for miRNA expression

profiling analysis. Differentially expressed miRNAs matching these stringent criteria

were shown in Supplemental Table 3. As shown in Figure 2A and Supplemental Table

3, several miRNAs (such as miR1a3p, miR51295p, miR4705p, miR182 etc.)

were deregulated in Sirt1activated TG tissues (n = 3 per group). Among these

differentially expressed genes, miR182 was significantly upregulated (2.27fold,

p=0.00018) in the TG tissue infected with AdSirt1 compared with that infected with

AdGFP.

Further, we focused on studying the role of miR182 in TG sensory neurons

because: (a) miR182 had the minimum p value; (b) miR182 is one of a sensory

organspecific miRNAs (19); (c) miR182 has been implicated in diabetic retinopathy

(26), the occurrence of which is parallel with nerve fiber alterations of the subbasal

nerve plexus of diabetic corneas (27).

As we expected, the mRNA expression of miR182 was decreased in the diabetic

TG samples compared with that in control mice (n = 10 per group) (Figure 2B). We

Diabetes Page 12 of 48

also found miR182 was downregulated in the primary HGtreated TG cells compared with NGtreated TG cells (n = 4 per group) (Figure 2C). We treated the primary cultured TG cells with two different Sirt1 activators, SRT1720 and RSV, which resulted in efficient upregulation of Sirt1 and miR182 expression levels (n = 4 per group) (Supplemental Figure 1 and Figure 2D). Additionally, the expression of miR182 was increased in TG cells infected with an Adexpressing Sirt1 and decreased in TG cells infected with an Adexpressing SirtsiRNA (n = 4 per group)

(Figure 2E). We revealed the relative luciferase activity of miR182 promoter was enhanced by cotransfection with Sirt1in a dosedependent manner (n = 4 per group)

(Figure 2F). We also performed ChIP assay to evaluate Sirt1 binding activity on miR182 promoter in chromatin prepared from the TG samples. Computational methods were used to predict the binding regions. The results in Figure 2G demonstrate Sirt1 binds to this predicted promoter region. Taken these results together, miR182 is upregulated by Sirt1 in TG sensory neurons. miR-182 promotes diabetic trigeminal sensory neuron growth in vitro

Primary cultured TG sensory neurons were transfected with miR182 agomir (200 µM) to achieve robust and predictable miRNA182 overexpression in both control and db/db micederived TG neurons (Figure 3A). After three days of transfection with miR182 agomir, diabetic TG neurons extended more and longer neuritis than those transfected with miRNA agomir NTC in sensory neurons from db/db and control mice

(Figure 3B). Statistical analysis showed total neurite length increased by 2.98 ±

0.029fold in miR182 agomir transfected TG sensory neurons (n = 4 per group)

Page 13 of 48 Diabetes

(Figure 3C). These data demonstrate miR182 promotes the neurite growth of diabetic

trigeminal sensory neurons in vitro.

miR-182 promotes attenuation of corneal epithelial wound healing and innervation

of the subbasal layer of corneal nerves in diabetic db/db mice

After 3 days of subconjunctival injection, miR182 was expressed at 5.12 ± 0.20fold

higher levels in TG sensory neurons versus the NTC treated mice (n = 10 per group)

(Figure 4A). Representative images of colabeling of miR182 and FluoroGold™ in

TG of diabetic db/db mice are presented in Figure 4B, which showed more

FluoroGold™labeled cell bodies were observed in the medial region of the ipsilateral

TG, compared with the NTCtreated mice. Moreover, miR182 was observed to be

costained with NF200 positive cells (Figure 4C). We also got the same results in

control db/+ mice (data not shown). These results suggest miR182 is overexpressed

in a large proportion of trigeminal sensory neurons.

qPCR analysis showed miR182 was expressed at 71.24 ± 0.14fold higher level in

the corneas of the db/db mice with a subconjunctival injection of miR182 agomir

versus the NTC treated mice (n = 10 per group) (Figure 5A). Punctate fluorescence

staining showed a significant difference was exhibited with regard to the corneal

epithelial healing rate from 48 hours of the corneal epithelium scrape between control

and miR182 agomirinjected db/db mice (Figure 5Bi). The defect size of the corneal

epithelium in the miR182 agomirinjected diabetic mice (9.73 ± 0.43%, n = 10)

was remarkably improved compared to that of the diabetic mice (54.78 ± 0.49%, n =

10) and the NTCtreated diabetic mice (52.72 ± 0.45%, n = 10), which reached a

Diabetes Page 14 of 48

comparable level to that of the control mice (18.59 ± 0.36%, n = 10) (Figure 5Bii).

Representative images of innervation of the subbasal layer are presented in Figure

5Ci. At day 28 after abrasion, the diabetic mice that received miR182 agomir treatment displayed a significant increase in corneal nerve density in both central and peripheral zone compared with the agomir NTCtreated diabetic mice (n = 6 per group) (Figure 5Cii and 5Ciii). Corneal nerve regeneration is associated with equal functional recovery. At day 28 after corneal epithelial debridement, the corneal sensation in the diabetic mice receiving the miR182 agomir injection increased significantly compared with that in the NTCtreated mice and returned almost to the level of the control db/+ mice (n = 10 per group) (Figure 5Civ).

NOX4 is directly targeted by miR-182

To study the molecular mechanism of miR182 in diabetic TG sensory neurons and diabetic keratopathy, we used in silico prediction and luciferase reporter assay to search for the potential miR182 target genes. For the silico prediction, by following three different miRNA target prediction algorithms: PicTar, miRanda and TargetScan.

Three genes were identified to implicate in oxidative stress, including membrane protein, palmitoylated 1 (MPP1), protein phosphatase 1, regulatory (inhibitor) subunit

13B (PPP1R13B), and NADPH oxidase 4 (NOX4). In order to investigate whether miR182 targets these 3 genes, we performed a luciferase reporter assay in SHSY5Y neuroblastoma cells. In view of the upregulation of NOX4 in TG neurons from diabetic mice, we only found the possibility of a direct link between miR182 and

NOX4. A significant decrease of the relative luciferase activity was observed when

Page 15 of 48 Diabetes

pmiRRBREPORTNOX43’UTR was cotransfected with a miR182 agomir (n =

4 per group) (Figure 6A). Notably, the mutation of the perfectly miR182

complementary site in the 3’UTR of NOX4 (TGCCAAA→ACGGTTT) abolished

the suppressive effect of miR182 owing to the disruption of the interaction between

miR182 and NOX4.

NOX4 protein level was decreased in TG cells by miR182 agomir treatment, but

increased with miR182 antagomir treatment (n = 4 per group) (Figure 6Bi,ii).

However, miR182 generated no effect on the expression of NOX2, another NAPDH

isoform with same treatment (Figure 6Bi, iii). We then detected the effect of

miR182 on the regulation of the NOX4 or NOX2 protein in TG cells under high

glucose conditions in vitro. Contrast to the downregulation of Sirt1 and miR182

expression, NOX4 protein levels were increased upon HG treatment (Figure 6C).

Additionally, the NOX4 expression levels were significantly downregulated after

miR182 agomir treatment for 48 hours, whereas the NOX2 expression remained at

the comparable levels (n = 3 per group) (Figure 6C). Next, diabetic adult sensory

neurons from db/db or db/+ mice were treated with miR182 agomir and cultured in

the medium exposed to high glucose. Representative results showed that NOX4 was

colocalized with NF200 and that the expression of NOX4 was significantly

downregulated in the diabetic TG cells after miR182 agomir treatment (Figure 6D).

Oxidant-antioxidant imbalance in diabetic TG neurons and upregulation of NOX4

in TG neurons from diabetic mice

Mouse Oxidative Stress and Antioxidant Defense RT2PCR arrays were performed to 15

Diabetes Page 16 of 48

investigate the oxidantantioxidant imbalance that was involved in the diabetic TG neurons. Of the 84 genes assayed in the scatter plot (Figure 7A), 24 transcripts were downregulated (Supplmentary Table 4) and 5 transcripts were upregulated

(Supplmentary Table 5). Among these genes, NADPH oxidase 4 (NOX4) was expressed at 10.11fold higher level in diabetic TG neurons compared with control group. The expression levels of NOX4 mRNA (n = 10 per group) and protein (n = 3 per group) were significantly upregulated in the diabetic TG neurons compared with the control (Figure 7B and 7C). Representative results show the NOX4 positive cells were significantly increased in the neuronal cell of the diabetic mice with stronger staining fluorescence and NOX4 was colocalized with NF200 positive TG neurons

(Figure 7D), suggesting NOX4 expression was markedly upregulated in diabetic TG neurons.

NOX4 is a functional target of miR-182 in diabetic corneal nerve regeneration

An AdNOX4, Adexpressing siRNANOX4, or AdGFP viral preparation was injected into the subconjunctival site on the same day of corneal epithelium injury after miR182 agomir or NTC treatment for 24 hours. At 48 hours post injury, the

NOX4 knockdown in corneal epithelia with miR182 agomir efficiently promoted the wound healing process (Figure 8A), and the wound area in diabetic mice that were administered with Adexpressing siRNANOX4 plus miR182 was most significantly decreased relative to other groups (Figure 8B). Conversely, NOX4 overexpression remarkably antagonized the promotion effect of miR182 agomir on corneal wound healing. At day 28 after abrasion, nerve staining analysis revealed knockdown of 16

Page 17 of 48 Diabetes

NOX4 in corneal epithelia with miR182 agomir promoted the diabetic corneal nerve

regeneration (Figure 8C). The diabetic mice that received Adexpressing

siRNANOX4 plus miR182 agomir treatment displayed a significant increase in

corneal nerve density, compared with the NTCtreated diabetic mice or (n = 6 per

group) (Figure 8D). Importantly, the miR182enhanced corneal nerve growth was

obviously hindered in AdNOX4 with miR182 treated diabetic mice (Figure 8D).

After subconjunctival injection, NOX4 was localized in the corneal epithelium

(Figure 8E). Compared with the corneal epithelia of the Adexpressing siRNANOX4

infected group, the corneal epithelia of the ADNOX4infected group with miR182

agomir treatment were characterized by high NOX4 mRNA expression (Figure 8F).

Additionally, several factors, pAKT, EGFR and Ki67 (28), which has been used as

markers for corneal wound healing, were also detected by immunofluorescence. The

expression levels of pAKT, EGFR and Ki67 were significantly increased in diabetic

mice with Adexpressing siRNANOX4 infection and miR182 treatment (Figure 8E),

further demonstrating downregulation of NOX4 by either miR182 targeting or NOX4

siRNA results in the increase of corneal nerve growth.

Discussion

Here, we report on miR182 as a Sirt1 downstream effector to protect against

peripheral nerve damage in TG neurons and keratopathy in an experimental mice

model of DM. We used the adenoviral system to overexpress Sirt1 in TG tissues and

identified miR182 as an upregulated miRNA. Moreover, the promoter activity of

miR182 is enhanced by Sirt1. These results indicate miR182 maybe a downstream

Diabetes Page 18 of 48

effector of Sirt1.

Several miRNAs could be used in a potential therapeutic approach for peripheral nerve regeneration, including miR21 and miR29b. miR21 was able to promote axon growth in adult dorsal root ganglion neurons by targeting Sprouty2 protein (29). miR29b was reported to exhibit neuronal protective effects in sciatic nerve regeneration (30). In this study, miR182 promoted corneal sensory nerve growth in a chronic diabetic neuropathy mice models. The colocalization of miR182 and

FluoroGold™ by immunofluorescence indicates the retrograde transport of miR182 agomir from the cornea to the TG. The responses to miR182 overexpression were mainly happened in TG sensory neurons, which is supported by the colocalization of miR182 and NF200 in TG neurons. Furthermore, miR182 agomir treatment significantly increased the diabetic corneal nerve density. These results demonstrate miR182 significantly increased corneal nerve regeneration in DM mice.

Accumulating evidences implied Sirt1 has a critical neuroprotective effect on nerve injury (31; 32). Consistently, Ogawa et al. reported on the expression of Sirt1 in the

TG of developing mice (33). Although several miRNAs are reported to be regulated by Sirt1, such as miR134 in the brain (34) and miR138 in mammalian axon regeneration (35), but the spectrum of Sirt1regulated miRNAs in diabetic TG sensory neurons remains to be explored in detail. Previous studies proposed miR182 was implicated in multiple functional processes, such as oncogenesis and light/dark transition in the retina (36), T helper cell clonal expansion (37), and lipid homeostasis.

More recently, miR182 was reported to be tightly associated with metastasis of

Page 19 of 48 Diabetes

primary sarcomas (18) and ROSinduced premature senescence (38).

Most investigators believe the theory of abnormal oxidative stress mediating the

changes of diabetic neuropathy and ROS accumulationinduced impaired antioxidant

capabilities in response to hyperglycemia has been considered as one of the critical

pathological mechanisms in diabetic neuropathy (39; 40). Consistent with this notion,

inhibition of ROS signaling prevents hyperglycemiainduced complications, including

the diabetic keratopathy (28; 41). As a target for diabetic complications (42), NOX4

expression and NOX4derived ROS production could be significantly induced by DM

and high glucose (43; 44). These findings suggest the ROSrelated NOX4 is likely to

be involved in diabetic neuropathy.

Actually, miR182 has many targets and several targets of miR182 have been

reported previously, such as cortactin and Rac1 in amygdaladependent memory

formation (45). It seems like an over simplification we investigated only one target

gene of miR182 in the present study. We focused on investigating NOX4 as a

miR182 target gene because: (a) NOX4 is a major source of ROS in peripheral

sensory neurons; (b) NOX4 expression was significantly different between diabetic

TG tissues and controls by the PCR array test; (C) NOX4 was present in the miRNA

predictions with three methods. As we expected, NOX4 is directly targeted by

miR182, and it acts as a key downstream target to mediate Sirt1miR182

axiselicited functions in diabetic corneal nerve regeneration, strongly demonstrating

that NOX4 is involved in the diabetic keratopathy. To further understand how

miR182 targets NOX4, we performed rescue experiments in a corneal injury model

Diabetes Page 20 of 48

with overexpression or knockdown the expression of NOX4. The promotion effect of miR182 on corneal wound healing and nerve regeneration was counteracted by

NOX4 overexpression, while downregulating the expression of NOX4 enhanced the functional effect of miR182.

Page 21 of 48 Diabetes

Acknowledgments

Author contributions

Y.W. interpreted the data and wrote the manuscript. X.Z. and Y.D. contributed the

animal model for the study. P.C. contributed the cell culture and treatment for the

study. X.Z. and Y.W. performed the data collection and analysis. Y.W. and L.X.

obtained funding for the study. All authors have read and approved the final

manuscript.

Conflict of interest statement

No potential conflicts of interest relevant to this article were reported.

Funding source

This study was supported by the State Key Basic Research (973) Project of China

(2012CB722409), the National Natural Science Foundation of China (30901637,

81370990, 81300742), and the Shandong Province Natural Science Foundation

(BS2012YY030, BS2013YY013).

We would like to thank Xiaolong Cai, Hanbio Biotechnology Co Ltd (Shanghai,

China), Meifang Dai, CloudSeq Biotech Inc. (Shanghai, China), Lei Zhang, Hubei

University of Technology (Wuhan, China), and Ji Xu, RiboBio Co. Ltd. (Guangzhou,

China) for help with preparing the manuscript. The authors acknowledge the editorial

assistance of Scribendi Inc., Chatham, Canada.

Guarantor statment

Diabetes Page 22 of 48

Dr. Ye Wang is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Page 23 of 48 Diabetes

References

1. Schultz RO, Peters MA, Sobocinski K, Nassif K, Schultz KJ: Diabetic keratopathy as a manifestation of peripheral neuropathy. Am J Ophthalmol 1983;96:368-371 2. Jeric M, Vuica A, Boric M, Puljak L, Jelicic Kadic A, Grkovic I, Filipovic N: Diabetes mellitus affects activity of calcium/calmodulin-dependent protein kinase II alpha in rat trigeminal ganglia. Journal of chemical neuroanatomy 2015;64-65C:12-19 3. Beckers HJ, Klooster J, Vrensen GF, Lamers WP: Ultrastructural identification of trigeminal nerve endings in the rat cornea and iris. Invest Ophthalmol Vis Sci 1992;33:1979-1986 4. Acosta MC, Tan ME, Belmonte C, Gallar J: Sensations evoked by selective mechanical, chemical, and thermal stimulation of the conjunctiva and cornea. Invest Ophthalmol Vis Sci 2001;42:2063-2067 5. de Leeuw AM, Chan KY: Corneal nerve regeneration. Correlation between morphology and restoration of sensitivity. Invest Ophthalmol Vis Sci 1989;30:1980-1990 6. Nones CF, Reis RC, Jesus CH, Veronez DA, Cunha JM, Chichorro JG: Orofacial sensory changes after streptozotocin-induced diabetes in rats. Brain research 2013;1501:56-67 7. Bikbova G, Oshitari T, Tawada A, Yamamoto S: Corneal changes in diabetes mellitus. Current diabetes reviews 2012;8:294-302 8. Jiang M, Wang J, Fu J, Du L, Jeong H, West T, Xiang L, Peng Q, Hou Z, Cai H, Seredenina T, Arbez N, Zhu S, Sommers K, Qian J, Zhang J, Mori S, Yang XW, Tamashiro KL, Aja S, Moran TH, Luthi-Carter R, Martin B, Maudsley S, Mattson MP, Cichewicz RH, Ross CA, Holtzman DM, Krainc D, Duan W: Neuroprotective role of Sirt1 in mammalian models of Huntington's disease through activation of multiple Sirt1 targets. Nat Med 2011;18:153-158 9. Jeong H, Cohen DE, Cui L, Supinski A, Savas JN, Mazzulli JR, Yates JR, 3rd, Bordone L, Guarente L, Krainc D: Sirt1 mediates neuroprotection from mutant huntingtin by activation of the TORC1 and CREB transcriptional pathway. Nat Med 2011;18:159-165 10. Araki T, Sasaki Y, Milbrandt J: Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal degeneration. Science 2004;305:1010-1013 11. Rigol M, Dunjko V, Olshanii M: Thermalization and its mechanism for generic isolated quantum systems. Nature 2008;452:854-858 12. Ramadori G, Fujikawa T, Anderson J, Berglund ED, Frazao R, Michan S, Vianna CR, Sinclair DA, Elias CF, Coppari R: SIRT1 deacetylase in SF1 neurons protects against metabolic imbalance. Cell Metab 2011;14:301-312 13. Wang Y, Zhao X, Shi D, Chen P, Yu Y, Yang L, Xie L: Overexpression of SIRT1 promotes high glucose-attenuated corneal epithelial wound healing via p53 regulation of the IGFBP3/IGF-1R/AKT pathway. Invest Ophthalmol Vis Sci 2013;54:3806-3814 14. Gao J, Wang Y, Zhao X, Chen P, Xie L: MicroRNA-204-5p-Mediated Regulation of SIRT1 Contributes to the Delay of Epithelial Cell Cycle Traversal in Diabetic Corneas. Invest Ophthalmol Vis Sci 2015;56:1493-1504 15. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281-297 16. Peng H, Hamanaka RB, Katsnelson J, Hao LL, Yang W, Chandel NS, Lavker RM: MicroRNA-31 targets FIH-1 to positively regulate corneal epithelial glycogen metabolism. FASEB J 2012;26:3140-3147 17. Winkler MA, Dib C, Ljubimov AV, Saghizadeh M: Targeting miR-146a to treat delayed wound healing in human diabetic organ-cultured corneas. PLoS One 2014;9:e114692 18. Funari VA, Winkler M, Brown J, Dimitrijevich SD, Ljubimov AV, Saghizadeh M: Differentially

Diabetes Page 24 of 48

expressed wound healing-related microRNAs in the human diabetic cornea. PLoS One 2013;8:e84425 19. Xu S, Witmer PD, Lumayag S, Kovacs B, Valle D: MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster. J Biol Chem 2007;282:25053-25066 20. Gheysarzadeh A, Yazdanparast R: STAT5 reactivation by catechin modulates H2O 2-induced apoptosis through miR-182/FOXO1 pathway in SK-N-MC cells. Cell biochemistry and biophysics 2015;71:649-656 21. Li G, Luna C, Qiu J, Epstein DL, Gonzalez P: Alterations in microRNA expression in stress-induced cellular senescence. Mechanisms of ageing and development 2009;130:731-741 22. Zherebitskaya E, Akude E, Smith DR, Fernyhough P: Development of selective axonopathy in adult sensory neurons isolated from diabetic rats: role of glucose-induced oxidative stress. Diabetes 2009;58:1356-1364 23. Chapleau MW: The continuing saga of neuronal oxidative stress in hypertension: Nox, Nox who's there, and where? Hypertension 2007;50:600-602 24. Sullivan KA, Lentz SI, Roberts JL, Jr., Feldman EL: Criteria for creating and assessing mouse models of diabetic neuropathy. Curr Drug Targets 2008;9:3-13 25. Yang L, Di G, Qi X, Qu M, Wang Y, Duan H, Danielson P, Xie L, Zhou Q: Substance P promotes diabetic corneal epithelial wound healing through molecular mechanisms mediated via the neurokinin-1 receptor. Diabetes 2014;63:4262-4274 26. Wu JH, Gao Y, Ren AJ, Zhao SH, Zhong M, Peng YJ, Shen W, Jing M, Liu L: Altered microRNA expression profiles in retinas with diabetic retinopathy. Ophthalmic research 2012;47:195-201 27. Nitoda E, Kallinikos P, Pallikaris A, Moschandrea J, Amoiridis G, Ganotakis ES, Tsilimbaris M: Correlation of diabetic retinopathy and corneal neuropathy using confocal microscopy. Current eye research 2012;37:898-906 28. Xu KP, Li Y, Ljubimov AV, Yu FS: High glucose suppresses epidermal growth factor receptor/phosphatidylinositol 3-kinase/Akt signaling pathway and attenuates corneal epithelial wound healing. Diabetes 2009;58:1077-1085 29. Strickland IT, Richards L, Holmes FE, Wynick D, Uney JB, Wong LF: Axotomy-induced miR-21 promotes axon growth in adult dorsal root ganglion neurons. PLoS One 2011;6:e23423 30. Kole AJ, Swahari V, Hammond SM, Deshmukh M: miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. Genes Dev 2011;25:125-130 31. Donmez G, Outeiro TF: SIRT1 and SIRT2: emerging targets in neurodegeneration. EMBO Mol Med 2013;5:344-352 32. Zochodne DW, Ramji N, Toth C: Neuronal targeting in diabetes mellitus: a story of sensory neurons and motor neurons. Neuroscientist 2008;14:311-318 33. Ogawa T, Wakai C, Saito T, Murayama A, Mimura Y, Youfu S, Nakamachi T, Kuwagata M, Satoh K, Shioda S: Distribution of the longevity gene product, SIRT1, in developing mouse organs. Congenit Anom (Kyoto) 2011;51:70-79 34. Gao J, Wang WY, Mao YW, Graff J, Guan JS, Pan L, Mak G, Kim D, Su SC, Tsai LH: A novel pathway regulates memory and plasticity via SIRT1 and miR-134. Nature 2010;466:1105-1109 35. Liu CM, Wang RY, Saijilafu, Jiao ZX, Zhang BY, Zhou FQ: MicroRNA-138 and SIRT1 form a mutual negative feedback loop to regulate mammalian axon regeneration. Genes Dev 2013;27:1473-1483 36. Krol J, Busskamp V, Markiewicz I, Stadler MB, Ribi S, Richter J, Duebel J, Bicker S, Fehling HJ, Schubeler D, Oertner TG, Schratt G, Bibel M, Roska B, Filipowicz W: Characterizing light-regulated retinal microRNAs reveals rapid turnover as a common property of neuronal microRNAs. Cell

Page 25 of 48 Diabetes

2010;141:618-631 37. Stittrich AB, Haftmann C, Sgouroudis E, Kuhl AA, Hegazy AN, Panse I, Riedel R, Flossdorf M, Dong J, Fuhrmann F, Heinz GA, Fang Z, Li N, Bissels U, Hatam F, Jahn A, Hammoud B, Matz M, Schulze FM, Baumgrass R, Bosio A, Mollenkopf HJ, Grun J, Thiel A, Chen W, Hofer T, Loddenkemper C, Lohning M, Chang HD, Rajewsky N, Radbruch A, Mashreghi MF: The microRNA miR-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes. Nat Immunol 2010;11:1057-1062 38. Chen Z, Shentu TP, Wen L, Johnson DA, Shyy JY: Regulation of SIRT1 by oxidative stress-responsive miRNAs and a systematic approach to identify its role in the endothelium. Antioxid Redox Signal 2013;19:1522-1538 39. Forbes JM, Cooper ME: Mechanisms of diabetic complications. Physiological reviews 2013;93:137-188 40. Song B, Scheuner D, Ron D, Pennathur S, Kaufman RJ: Chop deletion reduces oxidative stress, improves beta cell function, and promotes cell survival in multiple mouse models of diabetes. The Journal of clinical investigation 2008;118:3378-3389 41. Kim J, Kim CS, Kim H, Jeong IH, Sohn E, Kim JS: Protection against advanced glycation end products and oxidative stress during the development of diabetic keratopathy by KIOM-79. The Journal of pharmacy and pharmacology 2011;63:524-530 42. Gorin Y, Block K: Nox as a target for diabetic complications. Clinical science 2013;125:361-382 43. Eid AA, Ford BM, Block K, Kasinath BS, Gorin Y, Ghosh-Choudhury G, Barnes JL, Abboud HE: AMP-activated protein kinase (AMPK) negatively regulates Nox4-dependent activation of p53 and epithelial cell apoptosis in diabetes. J Biol Chem 2010;285:37503-37512 44. Block K, Gorin Y, Abboud HE: Subcellular localization of Nox4 and regulation in diabetes. Proc Natl Acad Sci U S A 2009;106:14385-14390 45. Griggs EM, Young EJ, Rumbaugh G, Miller CA: MicroRNA-182 regulates amygdala-dependent memory formation. J Neurosci 2013;33:1734-1740

Diabetes Page 26 of 48

Figure legends

Figure 1 The downregulation of Sirt1 in the trigeminal ganglia of diabetic db/db mice. (A) The expression of Sirt1 mRNA was significantly downregulated in the TG samples of the diabetic db/db mice, compared with the TG samples of the nondiabetic control db/+ mice (i). The TG sample from the nondiabetic control db/+ mice served as the control. Data are means ± SEM (n = 10 per group). HG conditions induced the downregulation of Sirt1 mRNA in the primary cultured TG cells, as indicated. TG cells were harvested 72 hours after NG (5 mM Dglucose plus 20 mM

Lglucose) or HG (25 mm Dglucose) treatment. The TG cells treated with NG served as the control. Data are means ± SEM (n = 6 per group) (ii). (B) The expression of the

Sirt1 protein was significantly downregulated in the TG of the diabetic db/db mice, compared with the TG of the nondiabetic control db/+ mice. The TG sample from the nondiabetic control db/+ mice served as the control. Data are means ± SEM (n =

6 per group) (i). HG conditions induced the downregulation of the Sirt1 protein in cultured TG cells, as indicated (ii). Data are means ± SEM (n = 6 per group). (D) The expression and localization of Sirt1 with NF200 on the TG sections from the db/db mice and the nondiabetic control db/+ mice. (*: pvalue < 0.05) between the diabetic group and the control group TG samples are identified by asterisks. Bar = 50 m.

Figure 2 The miR-182 is regulated by Sirt1 in high glucose conditions. (A)

Volcano plot filtering of expression of detected genes in TG tissue from miRNA array data. Group G, AdGFP infection group (control); Group S, AdSirt1 infection group

Page 27 of 48 Diabetes

(n = 3 per group). (B) qPCR analysis of miR182 in the RNA of the TG from the

diabetic db/db mice and the control db/+ mice. Samples were normalized to U6 RNA

samples and analyzed in parallel. Data are means ± SEM (n = 10 per group). (C)

qPCR analysis of miR182 in the RNA of the primary cultured TG cells treated with

NG (5 mM Dglucose plus 20 mM mannitol) or HG (25 mm Dglucose). Data are

means ± SEM (n = 4 per group). (C) SRT1720 and RSV treatment induced the

upregulation of miR182 in primary cultured TG cells. The TG cells with no treatment

served as the control. Data are means ± SEM (n = 4 per group). (D) Overexpression of

Sirt1 or the downregulation of Sirt1 by recombinant Ad induced the upregulation or

downregulation of miR182 in primary cultured TG cells. The TG cells with AdGFP

treatment served as the control. Data are means ± SEM (n = 4 per group). (E) Sirt1

activates the miR182 promoter by luciferase reporter assay. Data are represented as

mean ± SEM (n = 4 per group). (F) ChIP assay to evaluate Sirt1 binding activity on

miR182 promoter in chromatin prepared from the TG samples (n = 3 per group).

Significant differences (*: pvalue < 0.05) between the diabetic group and the control

group or the HG and NG treatment TG samples are identified by asterisks.

Figure 3 miR-182 promotes diabetic trigeminal sensory neuron growth in vitro

(A) Primary cultured TG sensory neurons were transfected with miR182 agomir (200

µM) to achieve robust and predictable miRNA182 overexpression in both control

and db/db micederived TG neurons (n = 4 per group). (B) miR182 agomir promotes

diabetic TG neurite growth in vitro. NG, 5 mM Dglucose plus 20 mM Lglucose. HG,

Diabetes Page 28 of 48

25 mm Dglucose. The TG neurons treated with NG served as the control. The data represent the results of four different experiments. Bar = 100 m. (C) miR182 effects on the neurite growth of neurons from the db/db and the control db/+ mice (*pvalue

< 0.05) (n = 4 per group).

Figure 4 The expression of miR-182 in TG of diabetic db/db mice by subconjunctival injection. (A) After 3 days of subconjunctival injection, miR182 was expressed at 5.12 ±0.20fold higher levels in TG sensory neurons versus the NTC treated mice (n = 10 per group). (B) Representative images of colabeling of miR182 and FluoroGold™ in TG of diabetic db/db mice. Bar = 100 m. (C) Representative images of colabeling of miR182 and NF200 in TG of diabetic db/db mice. Bar = 50

Figure 5 miR-182 promotes attenuation of corneal epithelial wound healing and innervation of the subbasal layer of corneal nerves in diabetic db/db mice. (A)

High miR182 expression was presented after a subconjunctival injection of miR182 agomir in the cornea of the diabetic db/db mice (2.5 nmol per eye both for miR182 agomir and agomir NTC) (n = 10 per group). The untreated group was used as the control group. Significant differences (*: pvalue < 0.05) were identified. (B) The miR182 agomir promotes the attenuation of corneal epithelial wound healing in diabetic db/db mice. Left panel (Bi): The fluoresceinstained corneas at 48 hours after injury. Right panel (Bii): The remaining wound area at 48 hours after injury.

Page 29 of 48 Diabetes

(Ci) miR182 promotes the attenuation of innervation of the corneal nerves.

Representative images of innervation of the subbasal layer. Top panel: Representative

images of the central zone of the subbasal nerves of the cornea from the control db/+

mice, the agomir NTCtreated db/db mice and the agomirtreated db/db mice. Bar

=100 m. Bottom panel: Representative images of the peripheral zone of the subbasal

nerves of the cornea from the control db/+ mice, the agomir NTCtreated db/db mice

and the miR182 agomirtreated BKSdb/db mice. Bar = 50 m. (Cii) The results of

the percentage of the area occupied by the subbasal nerves in the central zone. (Ciii)

The results of the percentage of the area occupied by the subbasal nerves in the

peripheral zone. The untreated db/+ mice served as the control. Data are means ±

SEM (n = 6 per group) (*: pvalue < 0.05). (Civ) Corneal nerve regeneration is

associated with equal functional recovery. Data are means ± SEM (n = 10 per group)

(*: pvalue<0.05).

Figure 6 NOX4 is directly targeted by miR-182. (A) The miR182 binding site in

the 3’UTR of NOX4 was assessed using the luciferase reporter assay. Luciferase

activity was detected by a luminometer after cotransfection for 48 hours. Data are

represented as means ± SEM (n = 4 per group) (*: pvalue < 0.05). (B) NOX4 protein

levels are downregulated by miR182 (Bi: Data from the gels, Bii and Biii:

Normalization to glyceraldehyde3phosphate dehydrogenase (GAPDH). NOX4

protein level was decreased in primary cultured TG cells by miR182 agomir

treatment, but increased with miR182 antagomir treatment (n = 4 per group) (Figure

Diabetes Page 30 of 48

6Bi, ii). However, miR182 generated no effect on the expression of NOX2, another

NAPDH isoform with same treatment (Figure 6Bi, iii). (C) The effect of miR182 on the regulation of the NOX4 or NOX2 protein in primary cultured TG cells under high glucose conditions in vitro. Contrast to the downregulation of Sirt1 and miR182 expression, NOX4 protein levels were increased upon HG treatment. Additionally, the

NOX4 expression levels were significantly downregulated after miR182 agomir treatment for 48 hours, whereas the NOX2 expression remained at the comparable levels (n = 3 per group). (D) Representative results showed that NOX4 was colocalized with NF200 and that the expression of NOX4 was significantly downregulated in the diabetic TG cells after miR182 agomir treatment. The data represent the results from three different experiments. Bar = 20 m.

Figure 7 Oxidant-antioxidant imbalance in diabetic TG neurons and upregulation of NOX4 in TG neurons from diabetic mice. (A) Mouse Oxidative

Stress and Antioxidant Defense RT2PCR array assay. (B) The expressionlevel of

NOX4 mRNA (n = 10 per group) was significantly upregulated in the diabetic TG neurons compared with the control (*: pvalue < 0.05). (C) The expression level of

NOX4 protein (n = 3 per group) was significantly upregulated in the diabetic TG neurons compared with the control (*: pvalue < 0.05). (D) Representative results of coimmunostaining with NOX4 and NF200 antibodies. The NOX4 positive cells were significantly increased in the neuronal cell of the diabetic mice with stronger staining fluorescence and that NOX4 was colocalized with NF200 positive TG neurons,

Page 31 of 48 Diabetes

suggesting that NOX4 expression was markedly upregulated in diabetic TG neurons.

Bar = 50 m.

Figure 8 NOX4 is a functional target of miR-182 in diabetic corneal nerve

regeneration. (A) The corneal surface wound was monitored by using fluorescein

dye. (B) The remaining wound area at 48 hours after injury (n=6 per group). (C)

Representative images of innervation of the subbasal nerves of the cornea. Bar =100

m. (D) The results of the percentage of the area occupied by the subbasal nerves in

the central zone. Data are means ± SEM (n = 6 per group). (E) Representative results

of immunostaining with NOX4, pAKT, EGFR and Ki67 in cornea (n = 6 per group).

The expression levels of pAKT, EGFR and Ki67 were significantly increased in

diabetic mice with Adexpressing siRNANOX4 infection and miR182 treatment.

Bar = 50 m. (F) The expression of NOX4 in cornea. Compared with the corneal

epithelia of the Adexpressing siRNANOX4 infected group, the corneal epithelia of

the ADNOX4infected group with miR182 agomir treatment were characterized by

high NOX4 mRNA expression. Data are means ± SEM (n = 10 per group).

Diabetes Page 32 of 48

Table 1. Average Weight and Blood Glucose Level at Time of Death

Age Weight Blood Glucose Group Numbers (wk) (g) (mM) Control 27 2024 26.54±0.86 6.81±1.18 Diabetic 51 2024 58.39±2.45* 25.92±2.88#

BKSdb/db mice had significantly higher blood glucose than control mice, and the weight of BKSdb/db mice was also significantly higher than that of the control animals. *p<0.05, # p<0.01, unpaired ttest relative to corresponding control group.

Page 33 of 48 Diabetes

167x132mm (300 x 300 DPI)

Diabetes Page 34 of 48

176x154mm (300 x 300 DPI)

Page 35 of 48 Diabetes

124x45mm (300 x 300 DPI)

Diabetes Page 36 of 48

127x71mm (300 x 300 DPI)

Page 37 of 48 Diabetes

243x150mm (300 x 300 DPI)

Diabetes Page 38 of 48

331x325mm (300 x 300 DPI)

Page 39 of 48 Diabetes

214x242mm (300 x 300 DPI)

Diabetes Page 40 of 48

266x207mm (300 x 300 DPI)

Page 41 of 48 Diabetes

Supplemental Figures:

Supplemental Figure 1: The results of Sirt1 activation in primary cultured TG cells using

adenoviral system. GFP expression served as the control (n = 4 per group).

Supplemental Figure 2: Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV

(1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per

group).

Supplemental Figure 1

Diabetes Page 42 of 48

Supplemental Figure 2

Supplemental Table 1. Primers used in qPCR

Gene Name Primer Sequences Product Size (bp)

Sirt1 F: tgccatcatgaagccagaga 241

(NM_001159589) R: aacatcgcagtctccaagga

NOX4 F: tgtgcctttattgtgcggag 172

(NM_001285833.1) R: gctgatacactggggcaatg

Page 43 of 48 Diabetes

Supplemental Table 2. Antibodies used in Western blot or

Immunofluorescence

Antibody Company Cat. No Isotype Dilution

Sirt1 Santa Cruz * sc15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phosphoAKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc7846 Goat IgG 1/500

* Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA

Diabetes Page 44 of 48

Supplemental Table 3. miRNA differential expression profiles from mice isolated TG samples transfected with Ad-Sirt1 versus TG samples transfected with Ad-GFP

miRNA Fold Change P value

mmumiR51295p 4.58↑ 0.027 mmumiR1931 2.63↑ 0.030 mmumiR3470a 2.53↑ 0.0022 mmumiR1825p 2.27↑ 0.00018 mmumiR30615p 2.15↑ 0.0097 mmumiR19815p 2.12↑ 0.010 mmumiR19125p 2.08↑ 0.0019 mmumiR883b3p 2.01↑ 0.00067 mmumiR1a3p 1.98↑ 0.0024 mmulet7i5p 1.88↑ 0.021 mmumiR30683p 1.86↑ 0.0094 mmumiR28b 1.84↑ 0.0120 mmumiR18a3p 1.79↑ 0.023 mmumiR4895p 1.79↑ 0.024 mmumiR3968 1.78↑ 0.024 mmumiR3455p 1.76↑ 0.010 mmumiR31025p 1.72↑ 0.020 mmumiR3465p 1.68↑ 0.044 mmumiR145a3p 1.64↑ 0.0081 mmumiR216a5p 1.64↑ 0.018 mmumiR255p 1.63↑ 0.0047 mmumiR30775p 1.63↑ 0.00029 mmumiR125b23p 1.59↑ 0.042 mmumiR30755p 1.56↑ 0.039 mmumiR5130 1.54↑ 0.0057 mmumiR451a 1.53↑ 0.014 mmumiR19a3p 1.52↑ 0.049 mmumiR30905p 1.50↑ 0.0026

Page 45 of 48 Diabetes

mmumiR467g 0.50↓ 0.017 mmumiR7705p 0.46↓ 0.0083 mmumiR5127 0.45↓ 0.011 mmumiR3472 0.40↓ 0.028 mmumiR56155p 0.482↓ 0.016 mmulet7i3p 0.442↓ 0.0046

Diabetes Page 46 of 48

Supplemental Table 4. Genes down-regulated in diabetic TG sensory neurons relative to normal as detected by PCR array

Gene description Symbol Fold regulation P Antioxidant Glutathione Peroxidases (Gpx) Glutathione peroxidase 2 Gpx2 –1.82 0.0054

Glutathione peroxidase 5 Gpx5 –6.78 0.0003

Glutathione peroxidase 6 Gpx6 –4.14 0.0014

Glutathione peroxidase 7 Gpx7 –4.29 0.0001 Glutathione peroxidase 8 Gpx8 –4.59 0.0013 Peroxiredoxins (TPx) Peroxiredoxin 1 Prdx1 –2.55 0.0020

Superoxide dismutase (SOD) Superoxide dismutase 1, soluble SOD1 –4.04 0.0001 Superoxide dismutase 2, mitochondrial SOD2 –1.64 0.0121 Superoxide dismutase 3, extracellular SOD3 –2.17 0.0126 Other Peroxidases Lactoperoxidase Lpo –5.48 0.0001 Prostaglandinendoperoxide synthase 1 Ptgs1 –3.90 0.0008 Prostaglandinendoperoxide synthase 2 Ptgs2 –4.79 0.0002 Recombination activating gene 2 Rag2 –3.94 0.0002 ROS Metabolism Superoxide Metabolism NADPH oxidase activator 1 Noxa1 –6.98 0.0015 NADPH oxidase organizer 1 Noxo1 –1.63 0.0349 RecQ proteinlike 4 Recql4 –3.38 0.0002 Other genes involved in ROS Metabolism Interleukin 19 Il19 –4.55 0.0001 Interleukin 22 Il22 –5.39 0.0001 Oxidative stress responsive genes Dual oxidase 1 Duox1 –5.28 1.80E05 Eosinophil peroxidase Epx –2.12 4.10E05 Myeloperoxidase Mpo –2.07 0.0029

Page 47 of 48 Diabetes

Membrane protein, palmitoylated 4 (MAGUK p55 Mpp4 –2.15 0.0005 subfamily member 4) Uncoupling protein 3 (mitochondrial, proton carrier) Ucp3 –2.79 0.0008 Oxygen transporters Xin actinbinding repeat containing 1 Xirp1 –8.38 0.0001

Diabetes Page 48 of 48

Supplemental Table 5. Genes up-regulated in diabetic TG sensory neurons relative to normal as detected by PCR array

Gene description Symbol Fold regulation P Antioxidant Peroxidases Glutathione reductase Gsr 1.76 0.0134

Catalase Cat 3.02 0.0006

Peroxiredoxin 6, pseudogene 1 Prdx6ps1 1.48 0.0019 ROS Metabolism Superoxide Metabolism NADPH oxidase 4 Nox4 10.11 0.0004 Protein phosphatase 1, regulatory (inhibitor) subunit Ppp1r15b 3.98 0.0001 15b