© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. M of P of of U C 1 we used RSL3, a potent and selective GPX4 inhibitor Tofibroblastsembryonicmouse (Pfa1),in deficiency induceGPX4 Lipid hydroperoxides accumulate inferroptotic ER RESULTS by ACSL4-driven esterification of AAand AdA into PE. facilitated is process this that and signals, ferroptoticAdA-PEinto AA-and oxidize directly canoxidation, ofiron-containing sources other amongLOX, that established we Here,established. been has demise cell ferroptotic the forresponsible species lipidoxygenated the natureof the peroxidationnor lipidfor evidence direct neither death of signals generproximal the as enzymes lipids oxygenated iron-containingates putative more or one of vation acti and deficiency (GSH) glutathione or GPX4 of combination a whereby peroxidation, lipid or systems—thiol redox major two in normal physiology facilitate ferroptotic the death program electron donor–acceptor propensities that define the vital role of ironenvironment the elementin this of fate the redoxscale,ferro–ferricmicroorganisms iron bycyclingof controls cell death paradoxically essential for all kingdoms of life. On a global eukaryotes and—through quorum sensing—for bacteria, thus making D Claudette V cells to ferroptosis Oxidized arachidonic andadrenic NATURE CH [email protected] C homeostatic physiological role for vitaminE.This oxidative PEdeathpathway may alsorepresent atarget for drugdiscovery. LOXa suppresssuggestingferroptosis, against E) (vitaminprotect tocotrienols and tocopherolsand and signals, death as act which triply-oxygenatedpathway.(15-hydroperoxy)-diacylatedspecies, and Lipoxygenaserescue(LOX) PE doubly generates esterification into PE by geneticAdA or pharmacological or inhibition of acyl-CoAAA synthase 4 of (ACSL4)Suppression(AdA). acts adrenoylas a specific and antiferroptotic(AA) acyls—arachidonoyl fatty two toward specific is and (PEs)) nolamines (phosphatidyletha phospholipids of class one only on occurs compartments endoplasmic-reticulum-associated in oxidation whereincenter, oxygenation organized highly a involves ferroptosis that discovered we biology, systems and bioinformatics death specialized ferroptosis—a peroxidase(GPX4).glutathione program4 of of triggeredinsufficiency by quantitativeredoxUsing reverse lipidomics, executionersgenetics, proximate the as claimed been have products peroxidation lipid Enigmatic Marcus Conrad Ivet Bahar A D ittsburgh, hemistry, hemical SA. epartment of epartment alerian lexandr ariush Mohammadyani P C P Ferroptosis is switched on by the dysregulation of one of the the of one of dysregulation the by on switched is Ferroptosis ittsburgh, ittsburgh, ell 4 D B epartment ofRadiation epartment iology, genesis sue homeostasis, immune and stress responses and embryo ulticellulareukaryotes have death programs tooptimize tis B E iology, C P MIC ennsylvania, olumbia E P P A ittsburgh, ittsburgh, U Kagan A 8 S E , JoelGreenberger L BIOLOGY niversity of nvironmental and Kapralov 1 t Croix U Sc porm ae lo eeiil o unicellular for beneficial also are programs Such . niversity of U niversity, 6 * &Hülya Bayır P P U 1 ennsylvania, ennsylvania,

– SA. | ADV 4 7 P , HaiderHussain *, Gao+wei Mao ittsburgh, 9 P 1 O D A , N ittsburgh, NCE ONLINE PUBLIC ivision ofMetabolicand ncology, A ew York, O ndrew ccupational Health, 1 , QinYang U U P SA. SA. ittsburgh, or U P N niversity of ittsburgh, [email protected] 4 11 6 ew York, I D , nstitute of A epartment of epartment R 1 2 . In eukaryoticIncells,the . , 5

ama KMallampalli * A P A ennsylvania, TION | moscato 1 U 5 P , 5 D , Bettina ennsylvania, P SA. , 13 U ittsburgh, 6 D ar . RSL3 triggered V , Feng Qu niversity of www.nature.com/naturechemicalbiology evelopmental Genetics,HelmholtzZentrum München, ascular Health, 13 1 T B , BingLiu hese authors contributed equally to thiswork. *e-mail: 5 iological Sciences, . However,. U 1 3, , Jianfei Jiang SA. P 4 ittsburgh, U . P SA. P 8 roneth ittsburgh, D 1 , epartment of epartment 13 PU 3 - - - - D U 8

, Jose , epartment of epartment niversity ofWarwick, BLI V P 10 the endoplasmicthe reticulum (ER)compartment ( in predominantly extramitochondrially, occurred hydroperoxides ( cells Pfa1 (WT) wild-type of death ferroptotic RSL3-triggered preceded that robust and time-dependent fluorescent LiperFluo response ( their hydroxy homologs to yield a fluorescent product LiperFluo, which, similarly to GPX4, reduces lipid hydroperoxides to ides in GPX4-deficient Pfa1 cells. We employed live cell imaging with tives and neutral lipid hydroperoxides to their respective hydroxy deriva instability its or degradation. prevent to needed is activity GPX4 that suggesting ( GPX4 ofabundance in decrease marked 1b Fig. and caused a marked decrease in activity of GPX4 ( ferroptotic death ( tion of lipid hydroperoxides. Both C11-BODIPY and LiperFluo LiperFluo and C11-BODIPY Both hydroperoxides. lipid of tion producdirect the reveal not could ferroptosis,they during tion fluorescenceresponses fromtheseprobes showed overall activa been used as surrogate measures for lipid click-peroxidation alkyne have azide) linoleamide fluorescein with reaction by conjugated cyclo-addition or C11-BODIPY probe, ROS lipid a dant activity toward nonlipidic fluorogenic substrates (for example, ennsylvania, S ladimir , Brent 6 C H P , JudithKlein- P4 aaye te euto o popoii hydroperoxides phospholipid of reduction the catalyzes GPX4 Measurements of reactive oxygen species (ROS) and pro-oxi and (ROS) species oxygen reactive of Measurements ittsburgh, olumbia ED 7 . We endeavored to detect the formation of lipid hydroperoxlipid formationof the We detect . endeavoredto P O edro Friedmann C 1 . fe ceia iatvto b RL, e bevd a observed we RSL3, by inactivation chemical After ). , N omputational andSystems T LI C R U amil hemistry, NE: 14 A U P i. 1 Fig. niversity,

ennsylvania, SA. S

T tockwell yurin 5 C NO D A Supplementary Results oventry, epartment of epartment c U nthonymuthu . cuuain f ieFu-ecie lipid LiperFluo-reactive of Accumulation ). VE N niversity of S PE ew York, MB 1 eetharaman , U V U SA. ER 2016 | 11 K. ladimir B , 12 s navigate A 2 10 , Yulia Y D N N D ngeli C P epartment of epartment ew York, euherberg, Germany. epartment ofMedicine, epartment ritical B ittsburgh, [email protected] iology,

D O 6 C 5 I , 13 , : are Medicine, 9 U

U R 1 ,

, 0 SA. niversity of P , T Supplementary Fig. 1c Fig. Supplementary S S itov . Supplementary Fig. 1a ittsburgh, 1 yurina 0 imon Watkins P ebastian ARTICLE 12 3 harmacology and D 8 1 / Fig. 1 epartment of epartment , ,

N

C Supplementary 8 H 7 P P U . We observed a 1 D , ittsburgh, ennsylvania, E d niversity epartment epartment U M

). 9 niversity . Although Although . B D I Fig. 1a O oll . 2 2 6 3 7 , 8 , , b ), ------) ) 1

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. ARTICLE CoAs ( CoAs ( Acsl4 cells WT to compared cells (KO) knockout from response fluorescence LiperFluo robust more a found ( death cell RSL3-induced againstprotecting ablation phospholipids into esterification their facilitating AA thus for preference a with CoAs polyunsaturated long-chain of synthesis catalyzes ACSL4 Specifically, PUFA-CoA. of formation synthase–catalyzed acyl-CoA requires phospholipids into PUFA (PL-OOH) phospholipids and (PUFA-OOH) lipid hydroperoxide accumulation of sites intracellular reports reliably fluorescence LiperFluo trast, BODIPY) interacts with (phospho)lipid C11- not(but LiperFluohydroperoxideswhereas radicals, peroxyl with react can PU ( treated withtriacsin entry. from mitochondrially targeted fluorogen-activating protein (mito-FA data one as counted position with RS stage each analysis, statistical For I protein. Scalebars, 5 and W WT in in hydroperoxides ferroptosis RSL3-induced to contributes AA esterified of Oxygenation | 1 Figure 2 PUFA-OOH free ofToanalysis LC-MS/MS performed we this, test emission. fluorescence elevated causing PL-OOH), esterified than nset, fluorescence timecourse RS after t

-test). ( FA- P4 eue hdoeoie o plustrtd at acids fatty polyunsaturated of hydroperoxides reduces GPX4 O el soe dcesd ees f polyunsaturated-acyl- of levels decreased showed cells KO OO L Fig. 1 Fig. 3 (100nM)for 2,4or6hbefore analysis. 1 f H inW 3 ) AA- and inhibition of ACSL4 by triacsin C were effective in effective were C triacsin by ACSL4 of inhibition and g d a Acsl4 KO WT f C ), they probably accumulate free PUFA-OOHprobably free accumulate they (rather ), RSL3 Control RSL3 Control

T RSL3 Control RSL3 Control oA andAdA- and Overlay Overlay Overlay C T M (2.5 and m. ( Acsl4 b Acsl4 M WT +RSL3 ) M, 6h),AA(2.5 K L iperFluo fluorescence intensity (relative RS to baseline)after C O DIC DIC DIC oA contents inW K

P O fa1 cells treated with RS with treated cells fa1 cells treated withRS L 8 LiperFluo 3 treatment (100nM)inW LiperFluo LiperFluo . M M, 16h)and/or RS T D Mito-FAP and ER-FAP Fig. 1 Fig. ER-FAP ata are mean i. 1a Fig. 7 Etrfcto of Esterification . Acsl4 Acsl4 L L 3 (100nM,6h). e 3 (100nM,6h).Results from atleastbiologicaltriplicates are presented unless otherwisespecified. ). However,we). KO+RSL3 K NATURE , O bc ef b Triacsin C 1 cells. ). Because Because ). 1 2 L o

0 Relative intensity

. Genetic Genetic . Cell death (%) 3 (100nM,6h)asindicated. . By con s.d., 120 0.4 0.8 RSL3 P T 60 90 30 1.2 , top) and AA 0 0 and D CH D ata are mean Acsl4 n ata are mean –0.2 =3samplespergroup. * E 0.4 0.8 0.6 0.2 – – –– Acsl4 MIC N 0 DIC 1 WT Acsl4 1 - 02 , Control ATURE

A , differential interference contrast; +–+–+ ––– E K L KO R-FA

Acsl4 and WT supplemented we death, ferroptotic of executioner imate To investigate whether esterified oxygenated PUFA acts as the prox AA enhances ferroptotic response inRSL3-treated cells fluorescence response to LiperFluo in its higher reactivity toward LiperFluo both contributed to the robust M 1.6 constantsofrate free (reaction towardPL-OOH with that than reactivity higher PUFA-OOHslightly was its that showed ethanol in LiperFluo with ( (C22:4) AdA and (C20:4) oxygenatedAA esterified of levels higher showed cells ( PUFA oxygenated free of accumulation lysophospholipids.In phospholipids from residues PUFA dized factor acetylhydrolase (PAF-AH), which specifically cleaves the oxi and PL-OOH in WT and BIOLOGY O Free cells withatimecontrol. −1 # ++++ Time (min) o C18:2+2[O] C22:4+2[O]/3[O] C20:4+2[O]/3[O] P s s.d.,* o (bottom) versus −1 KO cells with exogenous AA. This resulted in a 24% increase 24% a in resultedThis exogenousAA. with KOcells 00 s.d., , respectively). Thus, higher contents of free PUFA-OOH and Acsl4 #

C | ADV L Time control 3 treatment inW WT +RSL3 KO+RSL3 P H n Acsl4 <0.05 ( RSL3 =3.* * ++ E A D NCE ONLINE PUBLIC MI 400 * ata are mean Fig. 1 Fig. P KO Pfa1 cells. * <0.05 ( P <0.05 ( CAL t -test). ( L

g Esterified iperFluo. Scalebars, 5 o ). Assessments of the reaction rate constants rate reaction the of Assessments ). Acsl4 10 × 0.1 C18:2+2[O] C22:4+2[O]/3[O] C20:4+2[O]/3[O] t BI D T

-test). ( PUFA-CoA t Acsl4 and -test). ( ata are from a minimum of 10 stage positions. c (pmol/µmol PLs) Cell death (%) 40 o ) 20 50 30 10 12 0 KO cells, RSL3 predominantlyRSL3 inducedKOcells, s.d., 0 OLOG 4 8 C E ( R-FA ell deathinW a Acsl4 A ) KO cells. We used platelet-activating d TION | 3 C20:4-CoA L WT M n ) Fluorescence responses in pfa1 cells g ive cell fluorescence imaging of lipid =3.* P ) 24 , K D −1 E O istribution of free and esterified R-targeted fluorogen-activating Y s www.nature.com/naturechemicalbiology Acsl4 −1 cells. P Ascl4 WT +RSL3

(ref. 15) and 1.2 and 15) (ref. Time (h) D <0.05 ( * M O KO T m. ( * I 1 and : C 4

KO cells. 1 i. 1 Fig. to yield FA-OOH andFA-OOH yield to ontrol, noRS Acsl4 KO 0 e WT . ) Ferroptosis in 1 C22:4-CoA t Acsl4 + RSL3 Acsl4 0 -test), 3 8 * g KO Acsl4 / 6 K ), whereas WT WT whereas ), WT N O * # C P KO H cells treated < 0.05 L E 3 treatment. o M 10 × 0.1 B P I fa1 cells O

. 2 2 3 8 - - 3

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. N (PA3, hc i seii twr ln-hi phosphatidyl long-chain toward specific is which acyltransferase (LPCAT3), lysophosphatidylcholine3 by catalyzed step matic lysophospholipid,groupintoenzy an acyl an of requiresinsertion 77.7 pmol/ (72.2 lower were RSL3-treated AdA in and AA esterified oxygenated of amounts The oxygenated( itsforms andAdAamounts of increased in resulting activity, elongation triggered AA with supplementation treatment( RSL3 after cells oxygenatedesterified AA in phospholipids ofthan in WT PAF-AHanalysis(after treatment) showedgreater accumulation of in death cell in in ferroptosis in RSL3-treated WT cells, compared to a 13% increase triplicates are presented unless otherwisespecified. * (for thefullblot,see activationand 96h)after ofshR M ( D esterified into phospholipids(FAox) inW ( ( (normalized to corresponding W relative changes inoxygenated esterified AA( RS D followed by RS ( Figure ofexogenous 2|Effects AAonRSL3-triggered ferroptosis. NATURE CH of Wesubstrates.knockdown that foundPE-based and (PC)- choline e d c a P e c ab ata are mean ata are mean ) Metabolicpathways for ) ) LE <0.05 versus W ) ATURE L Cell death (%) Cell death (%) Lpcat3 Remodeling of phospholipids via the reacylation (Lands) cycle cycle (Lands) reacylation the via phospholipids of Remodeling D C 3+AA, respectively ( 40 L 80 60 20 100 cells. 40 80 0 60 20 evels ofoxidized ell deathinW ecreased RS 0 o Control LOX15 LOX15 27.0 and 28.2 and 27.0 LPCAT3 WT WT Control Actin increased resistance to ferroptosis triggered by RSL3 in RSL3 by triggered ferroptosis to resistance increased I E C20:4 Elongase C22:4 nset, MIC M C22:4+[O] C20:4+[O] mol phospholipids, respectively,

48 L C AA Acsl4 o o A 3 (100nM,6h). Lpcat3 KD 72 Gpx4 Gpx4 s.e.m., s.d., LPC L BIOLOGY H L 96 Acsl4 3-induced ferroptosis after KO T T 48 E Acsl4 and A RSL3 Supplementary Fig. 18a cells ( 0.5 * n +Cre n C20:4+[O] C22:4+[O] 72 n MI C T ( =3;* 96 n 20:4 ( 3 decrease confirmed by western blotting(48, 72 µ n =2or3) KO cells ( cells KO t M o RSL3 +AA * -test). ( =3.* 43 kDa 55 kDa Acsl4 Time (h) O el ta i RL-rae W cells WT RSL3-treated in than cells KO CAL 8.0, compared to 199.3 to compared 8.0,

RSL3 | ADV # t C -test). Results from atleastbiological P n # n $ 20:4, –1 C –1 , Fig. 1 Fig. K # P 20:4 ox) andoxidized 1.0 P A N <0.05 versus W T C O b BI and NCE ONLINE PUBLIC A against µ group) different after treatments. ) ontrol, noAAorRS cells treated withAA(2.5 +2[O] +3[O] +1[O] M C * LC Fig. 2 Fig. 22:4 andtheiroxygenated products. OLOG g d $ -MS-based heatmapsshowing ). Additionally,that). observed we P WT WT WT <0.05 versus control, RS Esterified FAox KO KO KO T and 0.05 (pmol/µmol of PLs) 0.34 0.21 a 200 250 1.0 1.0 1.0 100 150 L 50 ). Accordingly,LC-MS/MS ). ). pcat3 by

0 None C Lpcat3 0.00 0.54 Y 2. 2. 1. 1. D C20:4 Acsl4 20:4) andAdA ( 03 09 C20:4 ox 81 83

ata are mean +AA

T 0.58 D WT +RSL3 P 19 cells (one-tailed .3 .1 22 16 O A

<0.01)( +RSL3 knockdown (K C22:4 ox TION | K 0.72 I 4.4 L C 30 11 : o C .7 9

3 treatment. O 22:4 ( +RSL3 + AA 1 26.2 and 137.8 and 26.2 re addition 0

0.26 0.93 0.51 P 1.0 1.0 1.0 . 1 fa1 cells. 0 www.nature.com/naturechemicalbiology None 0.42 0.27 6. 3 1. 1. 1. C22:4 C 44 42 M 73 44 8 Fig. 2 C20:4 ox Acsl4 +AA o 22:4ox) M, 16h) / s.d., 2. 9. Fig. 2b Fig. C N .2 63 54 34 87 71 Acsl4

L +RSL3 KO+RSL3 22:4) C22:4 ox C 3 and 8.9

D

H 0 .6 0 7

1 t d

n

* +RSL3 + AA ) in -test). E =3. ). M KO 0.02 0.50 Fold

1.0 50 25 , c B ). o I - -

O

. 2 2 ferroptotic versus control cells ( cells control versus ferroptotic ( criteria ( signals death lipid being of likelihood by phospholipids oxygenated rank to features two these sig used we Therefore, the changes. the and of nificance increase fold but of cells terms in ferroptotic another one in from levels differed increased toward trend a showed and ( CL of exception the with these phospholipids, of all classes major in found were atoms oxygen of numbers different with derivatives Oxygenated species. phospholipid oxygenated 130 and ( cells Pfa1 cardiolipin (CL)—in and (PI) phosphatidylinositol (PG), phatidylglycerol phos (PS), phosphatidylserine PE, classes—PC, major five in ids phospholip of species individual 350 detected we Overall, mice. and WT cells, Pfa1 KO RSL3-treated of analysis LC-MS/MS lipidomics phospho redox global performed we phospholipids, oxygenated proferroptotic Tothe membranes. in identify PL-OOH reduce can only GPX4 isoforms of GSH peroxidases, distinct Amongeight the Redox phospholipidomicsofferroptotic signals previous report ( cells ( cells (MLE) epithelial lung mouse b otooa pril es-qae dsrmnn aayi) 1 > analysis) discriminant ( least-squares partial orthogonal (by projection the for values importance variable with biomarkers, as 0.908 = Q2(cum) phospholipid 0.953, the ( = down R2Y(cum) narrow with products to oxidation us enabling thus markers, bio potential of Clear existence the indicated analysis. data the data of stratification multivariate applied we signals, death lipid ( signals ferroptotic specific as identified were 4 only PEs, oxygenated 57 of precur as ( identified ferroptoticsignals of sors were 2 only oxidizable species, 36 and PE species PUFA-containing PE follow 62 of the out by (i) observations: emphasized two was ing signals death of specificity The cells, KO and WT the RSL3-treated including in conditions, ferroptotic species four PE oxygenated four of commonality the illustrate treated with a ferroptosis inhibitor, liproxstatin-1 ( increase in di- and tri-oxygenated PE species was attenuated in mice ( mice PE-C18:0/C22:4) and (PE-C18:0/C20:4 in found species PE oxygenated tri- and di- same Notably, the induction. knockout after d 8 mice tamoxifen-inducible of kidney in PLs oxygenated ten of ferroptosis and pholipids vivo in ( PE species vated levels of doubly and triply oxygenated AA- and AdA-containingGpx4 Inofmodel genetica that depletion deathin of we GPX4,observed Oxygenated PEin oxygenatedPEs. triply doublyand wereall 2b Fig. Supplementary ( 17 to then 44, to 110 from candidates of number the reduced criteria these of KOcells in precursors able oxidiz nonoxygenated of levels reduced (iii) death; cell with tion 3 Supplementary Fig. 5e Fig. Supplementary Fig. 5d Supplementary 8 To further validate the identified oxygenated PE species as as species PE oxygenated identified the validate further To ( diagram Venn a constructed We upeetr Fg 2a Fig. Supplementary KO cells ( Supplementary Fig. 1d Fig. Supplementary Fig. 4d Fig. causes acute renal failure, accumulation of oxygenated phos oxygenated of accumulation failure, renal acute causes Supplementary Fig. 5c Fig. Supplementary i. 3b Fig. Supplementary Fig. 3 Fig. Supplementary Gpx4 in vitro in Gpx4 Fig. 4a Fig. Supplementary Table 1 Table Supplementary

, KO cells were also present in the kidneys of of kidneys the in present also were cells KO e Gpx4 1 KO cells ( ) and RSL-3-treated cells RSL-3-treated and ) 6 Supplementary Fig. 4 Fig. Supplementary and , . c . e ple a eis f uniaie inclusion quantitative of series a applied We ). – Acsl4 c KO Pfa1 cells and kidney cells from from cells kidney and cells Pfa1 KO Gpx4 ). We previously found that depletion of GPX4 Gpx4 i. 3 Fig. , c KO cells; and (iv) elevated levels in in levels elevated (iv) and cells; KO ). ). All four oxygenated PEs were confirmed ). 1 ). ). These four remaining species molecular 8 . LC-MS analysis revealed accumulation revealed analysis LC-MS . KO mice KO cells andkidney n vitro in a Supplementary Fig. 5b Fig. Supplementary . hs nldd 2 nonoxygenated 220 included This ). ), and these results are in line with a with line in are results these and ), . ot xgntd phospholipids oxygenated Most ). ): (i) ): ). P < 0.05); (ii) and ) Fig. 2 Fig. ), 8 and finally 4 ( 4 finally and 8 ), in vivo in q 3-fold increase in content in in content in increase 3-fold ) upeetr Fg 5a Fig. Supplementary 1 7 was accompanied by ele Gpx4 e n vitro in ) and mouse embryonic mouse and ) . Sequential application Sequential . KO mice ( R > 0.7 for correla for 0.7 > ARTICLE ( Fig. 4f Fig. Fig. 5a Fig. ), and (ii) out (ii) and ), Fig. 3 Fig. ). Gpx4 Gpx4 Gpx4 , n vivo in b Fig. 3 Fig. ). This ). d Gpx4 Acsl4 Acsl4 and KO KO KO to ) ). ). b 3 ------

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. ARTICLE nondeuterated and deuterated PE was more robust in WT cells than ( foundwere species PE alkenyl or alkyl ( cells RSL3-triggered the in C18:0/C22:4-d8 and C20:4-d8 lation of di- and tri-oxygenated diacyl-PE species containing C18:0/ and AdA-d8-containing phospholipids ( ( AdA-d8-CoAAA-d8-CoA, with along acid fatty free as detectable we established that AA-d8 can be elongated into AdA-d8, which was employingBy stable-isotopic labelingdeuteratedwith (AA-d8),AA LC- ferroptotic (cell death>15%) the basisoffatty acyls(FA) in cells. phospholipids inferroptotic (cell death>15%,numberofreplicate datapoints=18)versus live (cell death<15%,numberofreplicate datapoints=26) chromatogram andmass spectra for sixmajorclasses ofphospholipidsin Figure 3|Screening ofphospholipidsandtheiroxidation products identifiesferroptosis deathsignals. 4 in Supplementary Fig. 6 Fig. Supplementary a d

719.4862

Ascl4 pmol/µmol PL 660 710 M 2,000 1,000 N S/ o oxygenated 0 747.5182 KO cells ( 740 722.5119 690 M S identificationofferroptotic signals 775.5494 770 750.5431 720 PE-(C18:0/C20:4)+2[O] 797.5340 <15 800 Cell death(%) Fig. 5 Fig. CL 766.5379 750 s were found. F bc 830 i. 5a Fig.

) and a variety of relatively abundant AA-d8- –log10P c 10 776.5590 0 4 and 8 6 2 780 790.5382 P 860 >15 sn fa1 cells. Results from atleastbiologicaltriplicates are presented unless otherwisespecified. –2 -2 positions.( , Supplementary Fig. 7 Fig. Supplementary b 818.5311 PG -PI -PE -PS 810 -PC -PG m . o hne i te bnac of abundance the in changes No ). / PE z C m 02 / , fold change. ( z 400 800 sn 0 Fig. Fig. 5 0 -2 position was detected in detected was position -2 Fig. 5 Fig. d ) log 840 L 857.5173 5 c evels ofdi-and tri-oxygenated 2 FC ). Significant accumu d PG PE-(C18:0/C22:4)+2[O] 885.5483 46 ). Accumulationof ). 880 <15 c ) Scatter plotofRS 10 Cell death(%) ). 920 NATURE PE 15 953.5357 PI 960 >15 8 PI CH Time (min) 20 E m CL MIC N / P z - fa1 cells. ( L –log P ATURE 3-induced changes inoxygenated recategorization phospholipidsafter on A 10 10 25 L 0 4 8 6 2

ated PE products were not detectable in in detectable not were products PE ated in lower ( cells nonsupplemented in 8a Fig. ( AA modified oxidatively of ( diacyl-PE of species tri-oxygenated and di- mono-, of accumulation found we these Among nondeuterated). remained 130 total the of (110 cies spe phospholipidoxygenated deuterated 20 of formation the in was not affected by by affected not was and PC in detected was AA-d8 of accumulation of degree small A BIOLOGY 2,000 1,000 PS PE 1,300 –2 Addition of RSL3 to cells supplemented with AA-d8 resulted resulted AA-d8 with supplemented cells to RSL3 of Addition 0 1,375.9748 PC -( 30 b C 1,403.9944 ) Scatter plotofRS

18:0/

C ) in PE. These species were similar to those formed formed those to similar were species These PE. in ) | ADV 02 1,360 Acsl4 H PE-(C18:0/C20:4)+3[O] 35 C E 1,427.9943 A 20:4) and <1 NCE ONLINE PUBLIC MI Fig. 5a Fig. KO cells than in WT cells. Tri-oxygenated deuter Cell death(%) 5> log 1,420 2 1,451.9944 40 FC CAL 46 1,475.9932 1,480 , Acsl4 b PE ( 1,517.9635 L ). MS/MS analysis confirmed the presence presence the confirmed analysis MS/MS ). BI 3-induced change inlevels ofoxygenated 15 a -( ) Representative normal-phase C KO ( OLOG 1,540 18:0/ A i. 5a Fig. 8 Fig. 5 Fig. TION | 720 CL 750.5278 C upeetr Fg 8b Fig. Supplementary m 22:4) inlive (cell death<15%)and FA on 1,200 / 600 z Y www.nature.com/naturechemicalbiology C20:3 C18:2 C22:3 C22:2 C22:5 C22:6 C22:4 C24:4 C20:4 e 778.5591 0 ) and AdA ( AdA and ) ,

sn b D 700 -2 ), and their content was was content their and ), O Acsl4 760.5134 780 I :

1 804.5747 0 PE-(C18:0/C22:4)+3[O] 760 . 1 KO cells ( cells KO <1 0 788.5447 Cell death(%) 5> 3 830.5905 8 810.5283 / Supplementary Supplementary 854.5906 N 840 820 C 836.5445 LC H E -MS/MS 858.5267 Fig. 5a Fig. M 15 880 PC B ). Thus, Thus, ). PS I O m . 2 / m z , 2 b / 3 z ). ). 8 - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. N AdA (or their acyl-CoA-forms) is oxygenated then esterified into esterified then oxygenated is acyl-CoA-forms) their (or or AdA AA free (ii) or oxygenated, then is which PE, into esterified is acyl-CoA-forms) their (or AdA or nonoxygenatedAA (i) roptosis: fer duringoxygenation PE forpathwaysalternative two are There Direct oxygenation of PEgenerates ferroptotic signals untreated and rosiglitazone-treated both in found those to similar were rosiglitazone to exposed cells profiles PE in changes similar caused deficiency ACSL4 and rosiglitazone observed ( signals—were death proferroptotic to oxidized not are at fattythe contentsacids C16 the with PEof the at species PE C18 to specific in changes these ( cells KO ( signals ferroptotic for substrates oxidation are which of latter the sn the at C18:1) or (C18:0 acids fatty C18 with species molecular PE (30 rosiglitazone with rosiglitazone by pressed sup pharmacologically be can PE into esterification AdA or AA PE ferroptotic precursors are decreased in major the signaling. ferroptotic for pathway represents PE AdA-containing and AA- of oxidation n tri-oxygenated and di- of accumulation the decreases liproxstatin-1 inhibitor ferroptosis species of showing fold changes inoxygenated esterified ( ferroptotic in identified species PE Oxygenated | 4 Figure NATURE CH may be due either to lower levels of AA-PE and AdA-PE undergoing PE. Accordingly, resistance of a Supplementary Fig. 9 9a Fig. Supplementary =3.* ) or -1 position and C20:4 or C22:4 fatty acids at the the at acids fatty C22:4 or C20:4 and position -1 ATURE PE P <0.05 versus mice withoutliprostatin-1 ( 1 -( 3 . Clustering analysis demonstrated that PE profiles in WT WT in profiles PE demonstratedthatanalysisClustering . PE C E de MIC upeetr Fg 9b Fig. Supplementary 18:0/

-( PEox (pmol/µmol PLs)

400 C 800 600 200 C A 18:0/ 0 L BIOLOGY H C 22:4) ( 22:4) a E Acsl4 C18:0/C20:4 pmol/µmol PLs C MI 1,000 1,500 20:4) and 500 Gpx4 0 KO cells KO b ). Principal component analysis showed that CAL

M ) inW | ADV * 13, fr 2 ) niae rdcd ees of levels reduced indicated h) 72 for M . e bevd smlr fet in effect similar a observed We ). KO 1 +1[O] 9 Lpdmc o W Pa cls treated cells Pfa1 WT of Lipidomics . +2[O] A PE-(C18:0/C20:4) BI Acsl4 Gpx4 T PE NCE ONLINE PUBLIC and C18:0/C22:4 * -( 13, +2[O] OLOG KO sn C 1 WT 9 KO cells to ferroptosis induction . oiltzn de nt cause not does Rosiglitazone ). 18:0/ -1 position, as no differences in differences no as position, -1 Gpx4 . The rosiglitazone effects were effects rosiglitazone The . Ascl4 * * +3[O] C K KO cells C 22:4) ( 22:4) O Y WT 20:4 and cells.

t D -test). Results from atleastbiologicaltriplicates are presented unless otherwisespecified. PEox (pmol/µmol PLs) * sn O A 20 30 10 0 TION | PE I -1 position—which -1 : D

Acs4 1 ox) in kidney of of kidney in ox) C18:0/C20:4 1 0 ata are mean 3 C . . 1 22:4 in W in 22:4 Gpx4 b 0 www.nature.com/naturechemicalbiology sn 3 Gpx4 pmol/µmol PLs KO cells. 8 -2 position, -2 400 800 600 200 / * KO cells andkidney of KO N 0 C H +3[O] T +1[O] E Acsl4 o and M s.d., C18:0/C22:4 Gpx4 PE-(C18:0/C22:4) Gpx4 B WT I - - * Gpx4 O

n KO K . +2[O * =3.* 2 O 2 triple-oxygenated AA detected in ferroptotic cells ( cells ferroptotic in detected AA triple-oxygenated anddouble- single-, with species PE the to identical wereproducts lishedby LC-MS/MS ( lysates of presence from control the (untreated) and RSL3-treated (for 6 h) cells and estab in 15-LOX human by PE-(C18:0/C20:4) AA-treated to RSL3. cells exposed WT nmol/ ~6 was PE into esterification AA ( of insufficiency the overriding signal death ferroptotic a as PE-OOH of role the in demonstrating directly ferroptosis RSL3-triggered AA-OOH—strongly enhanced not PE-AA-OOH—but preformed enously ( cells WT in ferroptosis during RSL3-triggered accumulated AdA-PE and AA-PE oxygenated and RSL3, or WT in detected was AdA-CoA or WT AA-OOH)orin AA of stimulatoryeffect roptosis the (beyond fer RSL3-induced stimulate not did AA-OOH-CoAs preformed fragmenta ( LC-MS profiles tion characteristic with AA-OOH-CoA yielding AA-CoA, oxidizes readily 15-LOXWe that foundPE. into AdA or AA oxygenated of integration lower to or oxygenationsubsequent e ofre te tutr o snl- n double-oxygenated and single- analysis. of MS/MS structure performed the and confirmed lysates We PE-(C18:0/C20:4) cell of with preoxidation 15-LOX) by by (prepared PE-OOH fied ( lysates) cell control (versus lysates cell RSL3-treated of presence were the in higher (PE-OOH) species hydroperoxy-PE double-oxygenated of 3 K i. 6 Fig. mice. ]+ 8 O Acsl4 o uhniae h oyeae P seis w oxidized we species, PE oxygenated the authenticate To * P

<0.05 versus W P Liproxstatin-1 f fa1 cells. ( cells. fa1 3[O] WT D PE PEox (%) b Gpx4 KO cells ( cells KO ata are mean 160 120 . fe splmnain P-O audne n cells in abundance PE-OOH supplementation, After ). 40 80 speciesinkidney ofG 0 * KO mice.

Supplementary Fig. 12 Fig. Supplementary M upeetr Fg 10 Fig. Supplementary d C18:0/C20:4 , mol phospholipids, which is comparable to that in that to comparable is which phospholipids, mol –+ e ) L c +2[O] +3[O] +1[O] * Fig. 6 Fig. evels of di-oxygenated ( di-oxygenated of evels T o +2[O]

( s.d., P SupplementaryFig. 11a a fa1 cells ( cells fa1 WT WT WT KO KO KO ) Accumulation ofoxygenated Gpx4 a C18:0/C22:4 n ). Moreover, no oxygenated AA-CoA or AA-CoA oxygenated Moreover,no ). =3.* –+ 0.18 3.6 1.0 1.0 1.0 10 P

X4-deficient mice. C20:4 * t -test). ( P <0.05 versus W 4.5 7.7 1.0 1.0 1.0 13 C18:0/C20:4 Acsl4 C22:4 ). Further, we incubated puri incubated Further,we ). –+ c . oee, biosynthetically However, ). ) d LC KO cells challenged with challenged cells KO * ) andtri-oxygenated ( 0.06 0.50 i. 5a Fig. 1.0 15 -MS-based heat map 8 +3[O] Fold Acsl4 D ) that) enzymatic the C18:0/C22:4 ata are mean T ARTICLE , –+ O el, thus cells, KO ( b PE t . ial, exog Finally, ). -test). ( Fig. 5 Fig. * -( C 18:0/ e f ). Levels Levels ). ) o T C e s.d., he 20:4) )

5 - - - - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. ARTICLE deuterated and ( (16 h)followed by RS (main) anddeuterated (inset) oxygenated Figure 5|LabelingwithAA-d8 unravels pathways leadingto oxygenated diacylated PEferroptotic signals. AA-PE and 15-hydroperoxy-9-hydroxy-15-hydroperoxy-12-hydroxy-AA-PE by ( represented were 15-hydroperoxy-8-hydroxy-AA-PE, species PE tri-oxygenated that revealed sis ( species droperoxy-AA-PE ( 15-hydroxy-AA-PE as PE 6 are presented unless otherwisespecified. PE c

) Quantitative assessment of -( d a c C Acsl4 Intensity Intensity Intensity Intensity nmol/µmol PLs pmol/µmol PLs 3 ×10 8 ×10 2 ×10 3 ×10 1,000 18:0/ 25 50 400 800 600 200 0 0 K 0 0 0 0 6 6 6 6 20 20 C 20 21 PE O WT 20:4) speciesaswell asmono-, di-andtri-oxygenated speciesformed inRS WT (18:0/20:4)

Control P from W fa1 cells treated withAA-d8. 400 600 200 22 22 22 22 KO Acsl4 0 KO L WT AA-d8 3 (AA-d8/RS T 24 24 23 24 and 20 WT 20 KO 21 20 (18:0/20:4-d8) WT Time (min) AA-d8/RSL3 WT Acsl4 AA-d8 WT 22 22 22 22 PE upeetr Fg 11c Fig. Supplementary i. 6 Fig. KO KO K Acsl4 molecularspecies( KO * * L O 24 23 * 24 24 3) (100nM,6h). * cells treated withAA-d8. p, plasmalogen. ( 1[O] WT 20 20 21 20 3[O] c 2[O] . h MS The ). 10 0 5 PE WT AA-d8 22 22 22 D RSL3 22 -(18:0/20:4) ( ata are mean WT (18:0/22:4) Acsl4 KO 24 24 24 23 * KO 802.58 774.56 730.52 758.55 Acsl4 C 2 KO C Fig. 6 n MS and * 18:0/ 802.62 774.60 730.56 758.59 AA-d8/RSL3 ontrol, untreated cells. WT 774.64 802.66 730.60 730.63 o a ad 15-hy and ) s.d., (18:0/22:4-d8) NATURE c C

) or PE-(C16:0p/C22:4-d8) PE-(C16:0p/C20:4-d8) WT

PE-(C18:0/C22:4-d8) PE-(C18:0/C20:4-d8) ). Moreover, 20:4 and KO PE n 3 * analy =3.* -(18:0/22:4) ( 1[O] CH Acsl4 KO 3[O] * E C MIC N P 2[O] 18:0/ <0.05 versus W - - ATURE

A L

( 12 Fig. ( cells untreated than PE-(C18:0/C20:4+1[O]) less and PE-(C18:0/C20:4+3[O]) more generated cells wild-type Pfa1 RSL3-treated from lysates to 15-LOX of addition that observed we C BIOLOGY D e b 140.0104 Supplementary Fig. 11b 20:4-d8) (left) and( 20:4-d8) (left) ata are mean 140.0111 e 140.0102 b

) pmol/ mol PLs

100 µ 100 ) inW 400 200 500 300 T 100 100 100 ypical MS/MS spectrumillustrating fragmentation ofnonoxygenated 0 140.0111

196.0370 153.6050 . iia rsls ee band in obtained were results Similar ).

C | ADV 196.0372 L Control WT 196.0371 T 3-treated H and 200 T 200 196.0369 [C18:0-H] 200 300 100 . E 200 ( 200 A 283.2642 255.2326 KO 0 [C18:0-H] t NCE ONLINE PUBLIC o 283.2643 MI -test). ( s.d., Acsl4 WT AA-d8 [C18:0-H] 283.2629 283.2630 303.2328 [C20:4-H] [(C20:4+O)-H] [C18:0-H] CAL 319.2281 P – KO 300 30 n fa1 cells. Results from atleastbiologicaltriplicates K 300 C 300 – =3.* 335.2243 04 d 18:0/22:4 and [(C20:4+OO)-H] O AA-d8/RSL3 [(C20:4+OOO)-H] WT ) 3 351.2172 WT cells treated withAA-d8 only(16h)orAA-d8 AA-d8 BI – – [M-C20:4-H] – D P ). KO representation ofmass spectra of KO 379.2503 400 <0.05 versus W ( * 40 462.2990 OLOG 00 400 – [M-(C20:4+O)+H a m 05 , 1[O] [M-C20:4+H A b m 436.2824 m / m 3[O] TION | ) Accumulation ofnondeuterated z / / 480.3111 / z 2[O] z z 480.3100 – – C 500 – 500 WT 00 18:0/ 531.2172 [M-C18:0-H] 500 Y www.nature.com/naturechemicalbiology RSL3

2 D O-H] KO O 2 C * O-H] I 22:4-d8) (right)inW 600 T : 600 – * 600

1 PE-(C18:0/C20:4+2[O]) PE-(C18:0/C20:4+3[O]) PE-(C18:0/C20:4+1[O]) P 60 * 0 – – fa1 cells ( Gpx4 . PE-(C18:0/C20:4) 1 07 0 AA-d8/RSL3 3 WT 8 700 O el lysates cell KO / 700 70 Supplementary N 08 00 C KO t -test). 766.5392 H [M-H] 814.5239 798.5290 782.5331 E * [M-H] [M-H] [M-H] M 800

1[O] B 800 3[O] – 00 I

800 – O – 2[O] T .

2

2 3 8 © 2016 Nature America, Inc., part of Springer Nature. All rights reserved. N (piroxicam (20 (50 nM,18h)ferroptosis inW m 15- structures ofoxygenated SA oxidation products incell lysates. OO not treated withRS AA- Figure 6|A15-LOX phospholipidoxidation product, 15-hydroperoxy-SAPE, triggers ferroptosis inWTand Among AdA. and AA oxygenate (CYP450)—can P450 chrome cyto and (COX) cyclooxygenase LOX, as enzymes—such Several Enzymatic generators ofperoxidation signals NATURE CH RS ( t -test). ( / ATURE L OO z H), 11%( 3 withoutetomoxir ( 113, OO H-12- H (2.5 OO e ) E MIC 113.0967 O E H at fifteenth carbonofAA; H atfifteenth Acsl4 tomoxir ( H-AA-

d c a M 113.0969 C A M M) andAA- Cell death (%) 100 L BIOLOGY M)) or H 20 60 80 40 140.0108 K [C20:4-OOH-H 0 100 [C20:4-OOH/OH-H L E O 140.0114 3. RS PE 150 ), 10.6% ( Control MI AA-OOH RSL3 AA-OOH-CoA B . RSL3 Control 150 -oxidation inhibitor) enhances RS C t 196.0388 P -test). Results from atleastbiologicaltriplicates are presented unless otherwisespecified. L 196.0378 * [C20:4-OOH/OH-H]– 450 (MS haracteristic fragments formed: Cell death 200 CAL 3 was usedat100nM,andcells were treated for 6h.

| ADV 333.2080

OO (fold change of RSL3) PE 200 0 4 8 Piroxicam 6 2 317.2123 2 T anddetected fragments (red). O-H]– 250 H- 283.2654 [C18:0-H]– Acsl4 cells treated withinhibitors of A BI [C20:4-OOH-H]– 250 NCE ONLINE PUBLIC L [C18:0-H]– C 2 283.2643 eft, MS eft, PPO O-H]– oA (2.5 ++ –+– –– 300 K OLOG 335.2229

MSPPOH 351.2188 300 O WT H (10 * m +SA 350 2 / (main)andMS M 350 z ++ +– 176 and155,165139203, M) ( M NCTT-956 PE 113.0 400 99.0 M)). Y 462.3015 100 400 - 90 99.0 113.1 462.3005

a OO D 121.0 126.9 ) andSA m 450 $ O A 480.3118 154.9 139.0 C / m TION | 120 H). 134.4 I ontrol, untreated cells. 450 z 480.3094 / 140 : –+–

z

PD146176 Acsl4 1 0 165.7 500 D 150 L . m 1 176.1 ++ –+ 167.0 3-induced (100nM,6h)ferroptosis inW 500 ata are mean 3 514.2576 530.2537 203.2 0 KO www.nature.com/naturechemicalbiology PE (inset)fragmentation ofdi-oxygenated (top) andtri-oxygenated (bottom) SA 180 / $ 3 z 550 180 - 8 351 and I 193.3 OO dentified products were 15- LO 207.3 / 550 N m

ML351 220 m X (M 210 C / H ( 600 / 243.1 z H z $ 600 b E 253.2 240 M ) onRS m L 260 650 351 (10 o /

ZIleuton B 273.5 s.d., 650 z I - 270 O 333,carboxylate anionsofAA- D 300 . 299.0 700 $ 2 319.0 b L ata are mean n 2 700 3-triggered ferroptosis inW eea seii rgltr, niios f O bt o CX or ( COX death ferroptotic not preventing but in effective LOX were CYP450 of inhibitors regulators, specific several Accordingly, liproxstatin-1 inhibited the 15-LOX enzymatic activity 300 Cell death 333.2 =3;* L M 3 O actate dehydrogenase release levels: 8.1% (W 8 M), (fold change of RSL3) 750 H attheeighth,ninthandtwelfth carbonsofAA.( 351.2 [M-H]– [M-H] 335.2 340 0 4 8 6 2 330 750 e 814.5262 798.5300 PD P [M-H]– Cell death (%) [M-H]– <0.05 ( 800 100 50 25 75 146176 (0.5 800 Cell death, % 0 16 12 OO 00 0 4 8 WT +RSL3 o s.d.,

H-AA- RSL3 Control .4 15-OOH-AA-PE 15-OOH-12-OH-AA-PE 15-OOH-9-OH-AA-PE 15-OOH-8-OH-AA-PE t WT 00 02 50 -test). ( SAPE-OOH, – n H –H –H * =3.* .9 –H .6 2 T 15 113 113 PE O 2 M O 2 cells. 15 O 15 113 2 O M), zileuton (10 O O OH O 0.9 , 15- 15 SAPE-OOH ( * 113 OH c OH O HO ) P 12 Acsl4 –H OH 55 T <0.05 versus control; OO LC µ –H 00 165 OO D M or 2 176 O 2 -MS identificationof15- ata are mean – 203 Acsl4 KO O H andAA- H .9 Etomoxir ( H-8- OH Acsl4 +H 9 2 HO O µ 8 M) 00 KO Pfa1 cells. O +H 0 K * +RSL3 Acsl4 155 H-AA- –H 139 O µ M .4 * M) – cells. M) and –H H 50 –H OO 333 –H KO 333 2 O 333 O 2 o 2 O 333 2 O O O O * O PE s.d., .6 O 100 O H minus O 351 O O 351 I O 351 O O nset ( O , 15- T * H 351 O 0.9 H O ), 6.2% (W ), 6.2% NCTT * n $ H O ( H P HO O =3.* OO HO a <0.05 versus RS O O P d b O HO , O P HO b ) RS LO ) shows data for cells O O P ARTICLE 150 O H-9- (20 ) O P 2 O E O X-induced SA O P * ffects of L PE <0.05 versus , respectively; NH 3-induced NH O M T 2 . Right, 2 M)), NH NH H-AA- +SA 2 2 i. 6 Fig.

CO PE PE L - X PE 3 and d

). 7

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. ARTICLE test this possibility, we used stearoyl-AA-PE (SAPE), which forms which stearoyl-AA-PE(SAPE), used possibility,we this test membrane) the in arrangements nonbilayer (PE forms LOX typically for access easier providing substrates, phospholipid of arrangementsnonbilayer of attackpreferential be may mechanism possible One unknown. still is phospholipids AA-containing ous 15a Fig. energies were similar for free and PUFA esterified ( binding15-LOX;byinto PEthe oxygenation ofesterified ity AA of feasibil the demonstrated modeling computational Our LOX? by mediators lipid of biosynthesis LOX conventional the initiate to PUFA free A Phospholipase LOX oxidizes nonbilayer phospholipidarrangements orientation tail-in the ( modeling demonstrated that and computationalTS TP interact with proteinthe in this, with line In activity. the of inhibition to utor contribmajor the be may TP,mechanism corkingand the TS For substrate( bindingsitecompete the for to of effects 14e Fig. ( enzyme the by affected slightly only were TP and A assessmentscontentschangesof the in of by that to comparable tively 14d Fig. ( TP that efficient more markedly was TS but tors, Fig. 14c characteristic eitherfrom signals resolved partially as detectable readily were which from intermediates oxidation 1-electron radicals, tocopheroxyl gen erating in ineffective was 15-LOX that confirmed we spectroscopy, ing chromanol hydroxy group. Using electron spin resonance (ESR) radical-scaveng of lack the ofspite in effect, this exert also should tocopherols of derivatives esterified activity, then LOX of pression sup the to contributes tocopherols of binding competitive the If ( tocopherols for than tocotrienols for affinity higher a hasbut family E vitamin the of differentmembers mechanism). Computational modeling showed that LOX binds with ‘corking’ the (via sites PUFAbindingsubstrate forcompetition via phospholipids of peroxidation catalyzed stronglysuppress component radical free nonregiospecific of LOX- PUFALOXinhibitorsoxygenation.of Tocopherols as effectiveness higher their with line in is which tocopherols, than effective more ( and tocotrienols protected against ferroptotic death in tocotrienolsknown to effectively inhibit LOXes The vitamin E family comprises several homologs of tocopherols and Vitamin Eregulates ferroptosis viaLOX suppression conducive to production the of death cell signals. is reactions oxygenation enzymatic forPUFA of preservation that ( death cell RSL3-induced stimulated rather PUFA of inhibitor etomoxir,an that established Wefurther substrates. oxygenation as CYP450 by phospholipids oxidationcatalyze (epoxidation, hydroxylation) of CYP450 (such as P450 2W1) oxidize free fatty acids at low rates and PUFA effectivelyutilize esterified as substratea −8.1 energy affinity (binding high with 15-LOX with binds liproxstatin-1 that showed PE oxygenatedroptotic ( taolA-C SP) ih h tpcl iae organization 8 bilayer typical the with (SAPC) stearoyl-AA-PC phases (hexagonal) nonbilayer Supplementary Fig. 14a Fig. Supplementary 13 Fig.Supplementary

-tocotrienol after incubation with 15-LOX and AA. The levels of TS A -tocopherolsuccinate or (TS) ). However, analogs both esterified asacted 15-LOX inhibi ). Thus, radical scavengingcontributecaninhibitory Thus, radical the ). to . o te nye hoe is usrts rm numer from substrates its chooses enzyme the How ). . upeso o 1-O atvt b T ws quantita was TS by activity 15-LOX of Suppression ). 2 A 4 . How is AA esterified into phospholipids recognized recognized phospholipids into esterified AA is How . -tocopherol and -tocopherol 2 1 . Notably,. used diacyl-glycerophospholipidsnot are 2 (PLA A -tocopherolor Supplementary Fig. 14b o in vivo in ) and suppressedandproduction ) proferof the . ka/o) I cnrs, O cannot COX contrast, In kcal/mol). 0.2 2 hdoyi cnrl te viaiiy of availability the controls hydrolysis ) ), but tocotrienols were overall markedly overall were tocotrienols but ), A A -tocotrienol along with their ability their with along -tocotrienol 2 -tocotrienol. We performed LC-MS We performed -tocotrienol. ( 6 , and compared its oxidation with oxidation its compared and , Fig. 4 Fig. B -oxidation, did not suppress but suppress not did -oxidation, A A -tocotrienol ( -tocotrienol f -tocopherolphosphate (TP), ). Computational modeling Computational ). upeetr Fg 14b Fig. Supplementary 2 A Supplementary Fig. 14 Fig. Supplementary 3 , but they can also act act also can they but , -tocopherol,TP, and TS Fig. 6 Fig. 2 2 0 ). 2 . Some. isoforms of . Both tocopherols Both . e sn Supplementary Supplementary Supplementary Supplementary ). This suggests This ). -1 PUFA-1 lyso Gpx4 NATURE KO cells CH 2 5 To . E MIC N ). ). ------ATURE

A L

oxidative metabolism controlled by GPX4. GPX4 deficiency leads leads deficiency GPX4 GPX4. by controlled metabolism oxidative lipidand thiol dysregulationof the with pathwaysassociateddeath The term ferroptosis was coined to describe one of the programmed D ( implicitlyarebutcapturedparameters model itsby the in included regulators and, possibly, the effects of other mechanisms that are not 16f Fig. ( validation model for reserved set data additional calibration( model the for 3 ( AdA-PE or AA- and GPX4 ferroptosis by driven responsesferroptotic regulating on focused and reactions metabolic main simpli of a network on fied based species PE oxygenated of production the for equations) differential (47 model mathematical a constructed We M SAPC ( demonstratingthat15-LOX bindsrobustly but SAPEnot withwith simulations dynamics molecular coarse-grained by supported are results These products. oxidation major the as detected were cies ( SAPC than strate ( It is also possible that the prevalence of PE in the inner leaflet of membrane plasma leaflet inner the in PE of prevalence the that possible also is It 15-LOX. by attack phos enzymatic and binding these for of substrates pholipid bilayer availability ordered the highly facilitate AA-PC, the of to organization contrast in AdA-PE, and AA- of arrangements hexagonal) (possibly nonbilayer that indicate tions simula computer and experiments biochemical model Our cies. spe PE oxygenated ferroptotic of catalysts for candidates possible generate substrates their as lipids can diacyl lize CYP450 and LOX PUFAhydroperoxides lipid COX, ER-associated where extramitochondrial compartments, the in PE-OOH of mulation accu predominant demonstrated imaging cell Live respectively. 15-LOX, probably and 30) (ref. c different—cytochrome also are in oxygenation CLs and AA or AdA (C18:2) of oxygenations PE. The enzymes oxygenating acid speciation—linoleic molecular acyl different with PE, and CL phospholipids, of classes different two of engagement on is specific based and ing in ferroptosis apoptosis sis mechanism for uptake the and phagocytosis of apoptotic cells docu mented been in plasma membranes has of resident 12/15-LOX macrophages by as a required species PUFA-PE of oxygenation Direct membrane. extranuclear and nuclear the to predominantly localized wererelevantreactions the and eicosanoids, free thesized however, were cells formed by fast immune esterification of enzymatically innatepresyn of functions signaling in implicated been eicosanoids—have free presynthesized matically enzy of esterification by products—formed death. Mono-oxygenatedPE cell ferroptotic AdA-OOH—caused or AA-OOH free not phospholipids.intoacids ExogenousAA-AdA-PE-OOH—butand fatty free AA-preoxidized of re-esterification on via not occurs but AdA-PE and attack Oxygenation signals. death ferroptotic as groups 15-hydroperoxy containing PE of species AdA-containing or AA- diacyl oxygenated triply and doubly of species molecular four identified we Here identified. been not have products dation peroxi phospholipid proximate the ferroptosis, in products peroxida tion phospholipid of role suggested commonly the of spite deficiency.In GPX4 ofcontext the in likely highly is accumulation electrophiles lipid their PL-OOH, ofreduction the catalyze to GPX4 ofability unique reactive of accumulation the to BIOLOGY Supplementary Figs. 16h 15b Fig. Supplementary – I odeling oftheferroptotic phospholipidmetabolome 5 2 SCUSS Oxidation of CLs—a required step in the execution of apopto of execution the in step required CLs—a of Oxidation 9 ). The model quantitatively reproduced not only the data set set data the only not reproduced quantitatively model The ). —was not involved in ferroptotic signaling. Thus redox signal

Supplementary Fig. 15c

C | ADV , g H ). This indicates that the network covers key ferroptotic key covers network the that indicates This ). upeetr Fg 16a Fig. Supplementary I ON E A NCE ONLINE PUBLIC MI CAL 33, upeetr Fg 15b Fig. Supplementary 3 4 contributes to the preferential oxidation by oxidation preferential the to contributes BI ). SAPE was a much better 15-LOX sub 15-LOX better much a was SAPE ). Supplementary Fig. 16b Fig. Supplementary – OLOG j 3 1 and . Of those, only LOXes, however, uti however, LOXes, only those, Of . A TION | and 17a 3 Y www.nature.com/naturechemicalbiology 2 and Supplementary Table 2 , , thus making these enzymes enzymes these making thus , b

D ). O I :

upeetr Tables Supplementary 1 0 . . AOHP spe AA-OOH-PE ). 1 0 2 3 0 Tee products, These . 8 / Supplementary N – e C 2 ) but also the the butalso ) 7 H . Given the the Given . E M B I O ). 2 . 8 2 . 2 3 8 ------

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. N PUFA-PL substrates for binding sites on 15-LOX. As 15-LOX is an is15-LOX PUFA-PLAs15-LOX. on sitesbinding forsubstrates cells intotocotrienols integrationof better to due be may efficiency higher roptosis.This fer against cells protecting in effective more even are tocotrienols that show data Our agent. antiferroptotic effective an considered of death thereafterweeks ~4 mice GPX4-deficient caused deprivation E vitamin subsequent as reversible, was protection this yet survived, diet vitamin-E-enriched a fed ers realized also vivoin was E vitamin of effect protective this importantly, More concentrations. nanomolar at ferroptosis preventing in tive In a previous publication vitamin E as a protector of cells against ferroptotic death driven oxidations. Several reports have documented the efficiency of may be an important factor in the inhibition of stereo-specific LOX- oxidation mechanism) (corking protein the the of site binding with the for substrates competition also but scavenging radical only not free Thus, products. regiospecific than rather products tion oxida random of formation the inhibiting in effective more were ( products reaction side as ides hydroperoxrandom also buthydroperoxides (phospho)lipid cific of substrate the binding site. opening the at located Arg429, with interactsgroupcarboxylate its andorientation AA, oftail-in consistent 15-LOX-2the is with only approach ics mechan mechanics–molecular quantum a using studies Previous site.catalytic substratethe dominant in the the ofalignment is tion of modeling computational orienta tail-in PUFAs, the that showsfree AdA, Our and includingAA AdA. and AA PE-esterified or free of oxygenation and binding outcompeting site catalytic LOX the of liganding specific be may action E vitamin of mechanisms possible physiologically the of one Thus, death. ferroptoticagainst protecting in effective are tocotrienols, particularly E, vitamin of discovery drug for targets cological pharma new offering thus signaling, lipid ferroptotic in ticipants par as LPCAT3and ACSL4 of importance demonstrated recently mechanism of death. cell ancientand conserved highly representa may PE esterified of tion target epithelial cells. This suggests that LOX-driven selective oxida that utilize the bacteria secretable LOX to cause ferroptotic death of substrates lipid polyunsaturated lack that prokaryotes presence of LOXes has been discovered in key enzymes several (ACSL4, LPCAT3 of sensitivityand 15-LOX) high for confirmed ferroptosis. Notably, which analysis, the biology systems our by emphasized further was PE-AdA-OOH and OOH ACSL4, elongase 5, LPCAT3 and LOX for the production of PE-AA-of association functional of significance The signals. death lipid as doubly of and triply oxygenated generation 15-hydroperoxy-containing the PE species acting to leads This reactions. LOX-catalyzed of substrates as PEs AdA-containing diacylated or AA- of duction pro enhanced the for pathways metabolic lipid triggers GPX4 of Insufficiency cells. surrounding many of viability the threatening mediators,lipid diffusible and electrophilic highly ofamounts sive exces ofaccumulation to inactivators leads chemical or genetic by PUFA-OOH.ofcontrol reactioncaused this abolicof Insufficiency of eicosanoids and production docosanoids the under redox in control involved of functionally GPX4 over be met may compartment intracellular the with interactions machinery. oxidizing its to conducive not is layer mono membrane outer the to PC of confinement whereas LOX, NATURE CH inhibitory ofactivity toward and tial TP TS 15-LOX, absence the in substan peroxidation, proferroptoticPE to contributor important A ATURE tcpeo ad 2-carboxy-2,5,7,8-tetramethyl-6-chromanol) and -tocopherol It has been reported that 15-LOX generates not only regiospe only not generates 15-LOX that reported been has It the explains PUFA oxygenated esterified of essentiality The hgl ognzd xgnto cne i te ER-associated the in center oxygenation organized highly A 4 1 . It has been establishedthat It been . has E MIC

3 C 6 A have shown that hydrogen abstraction from C from abstraction hydrogen that shown have L BIOLOGY H E MI 4 2 or to their competing more effectively with effectivelymore competing their to or CAL

| ADV 1 8 , we reported that A BI NCE ONLINE PUBLIC 3 7 Rdclsaegn antioxidants Radical-scavenging . OLOG 13, Gpx4 1 6 . Moreover, different forms Moreover,different . 3 Y Pseudomonas aeruginosa 8 -/- . Thus, vitamin E can be be can E Thus,vitamin . A pups born from mothfrompups born

D -tocopherol was effec O A TION | I :

1 0 . 1 0 www.nature.com/naturechemicalbiology 3 3 8 5 . It appears It . in vitro / N C H E 13 M 38– by B 4 0 I ------, . O

. 2 2 accession codes and references, are available in the the in available are references, and codes accession Methods, including statements of data availability and any associated MET published online14November 2016 R oxygenationon specific the of PE as ferroptotic signals. and metabolic regulators of iron uptake and metabolism—converge synthesis and transport, the redox-sensitive Nrf2 signaling pathway well- several GSH of of regulators as ferroptosis—suchof mechanisms regulators characterized that speculate to tempting is It sis. ferropto triggering and GPX4 incapacitating thus cells, leukemia side effectively removes GSH in myeloperoxidase-rich myelogenous etopo drug phenolic antitumor the particular, Intherapy. cancer (such as RSL3 or other inducers or GSH depletion) to enhance anti- to treatment of cancer could combined be with ferroptotic inducers approachesnutritional that possible is it death, cell ferroptotic ing stimulation proapoptoticresistantto cells cancereradicate to used be can ways site (i.e., corking). alternative an to points mechanism of action, such as groups,competition for the substrate binding hydroxy scavenging radical of o 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. R 18. 17. 16. 15. 14. 3 f eceived 3March 2016; accepted 3October 2016;

eferences 8

t Previous studies indicate that induction of ferroptotic death path triggers acute renal failure in mice. in failure renal acute triggers 8 death. cell nonapoptotic in genes metabolism hydroperoxides.lipid of imaging acetylhydrolase. (2016). composition. lipid (2011). cells. muscle smooth arterial human from release E ActaBiophys.Biochim. phosphatidylinositol.towards acids fatty of channeling metabolic the mediate antioxidants. Med. Biol. Radic.Free methodology. of validation and characterization (micro)spectroscopic probe: C11-BODIPY (2012). 7894–7900 cells. hydroperoxidesin lipid of detection selective Med. Biol. Radic.Free cells. mammalian in GPx4) (PHGPx, peroxidase hydroperoxideglutathione cells. cancer harboring oncogenic-AS- R in death cell nonapoptoticiron-dependent, activating Biol.TrendsCell death. death. cell bacteria. Fe-metabolizing Dis. bacteria. in death cell programmed of overview an community: into 12/15-lipoxygenase dependent- and AIF-mediated cell death. cell AIF-mediated and dependent- 12/15-lipoxygenase into (2015). Doll, S. Doll, D.L. Golej, E.M. Küch, radical-trapping of efcacy the determining for Methods D.A.Pratt, & B. Li, J.A.Post, & KJ.A.amp, den Op L.C., G.P.,Liebergen, vanDrummen, YamanaK. ka, phospholipidof fcancesigni Y.Nakagawa,Biological & H. Imai, compounds identifes screening lethal Synthetic Yang,B.. R W.S.Stockwell, & peroxidation. lipid by death Ferroptosis:Yang, B.. R W.S.Stockwell, & S.J. Dixon, in species oxygen reactive and iron of role T e B.. R Stockwell, & S.J. Dixon, J.M. Byrne, the V.for Laurenzi, Die De & C. Ilio, Di M., Masulli, N., Allocati, Friedmann Angeli, J.P.Angeli, Friedmann A. Seiler, S.J. Dixon, N. Soh, PAFof roles emerging Te D.M.Sta forini, & McIntyre,S.M. T.M.,Prescott, h , 237–248 (2008). 237–248 , e H

p 6 ODS a , e1609 (2015). e1609 , Cell p et al. et et al. et e et al. et r 4

. Nat. Chem. Biol. Chem. Nat. 3 et al. et et al. et 149 et al. et et al. et et al. et . Given the stimulatory role of AA and AdA in induc in AdAand AA of rolestimulatory the Given .

ACSL4 dictates ferroptosis sensitivity by shaping cellular shaping by sensitivity ferroptosis dictates ACSL4 fuorescentfor tool new a derivative: perylene Swallow-tailed adic. Biol. Med. Biol. Radic.Free 581/591 et al. et Glutathione peroxidase 4 senses and translates oxidative stress oxidativetranslates and senses 4 peroxidase Glutathione , 1060–1072 (2012). 1060–1072 , Human haploid cell genetics reveals roles for lipid for roles reveals genetics cell haploidHuman cell nonapoptoticof form iron-dependent an Ferroptosis:

Long-chain acyl-CoA synthetase 4 modulates prostaglandin modulates 4 synthetase acyl-CoA Long-chain Res. LipidJ. edox cycling of Fe( of cycling edoxR erentially localized acyl-CoA synthetase 4 isoenzymes isoenzymes 4 synthetase acyl-CoA localized Diferentially 26 uorescent lipid peroxidation lipidf oxidation-sensitiveuorescent an , Nat. Chem. Biol. Chem. Nat. uorescent probe with high sensitivity and sensitivity high with probef uorescentnovel A , 165–176 (2016). 165–176 ,

33 34

et al. et 1841 Chem. Biol. Chem. , 473–490 (2002). 473–490 , (2003). 145–169 , Science

10 Inactivation of the ferroptosis regulator Gpx4regulator ferroptosis the of Inactivation

, 227–239 (2014). 227–239 , 50 , 9–17 (2014). 9–17 , (Suppl.): S255–S259 (2009). S255–S259 (Suppl.):

Org. Biomol. Chem. Biomol. Org. 347

15 Nat. Cell Biol. CellNat. 82 h t , 1473–1476 (2015). 1473–1476 , t , 234–245 (2008). 234–245 , II , 187–202 (2015). 187–202 , p ) and Fe( and ) : / / d x . d ACS Chem. Biol. Chem. ACS o i . III o

r 16 ) in magnetite by magnetite in ) g SC AdvancesRSC Res. LipidJ. / , 1180–1191 (2014). 1180–1191 ,

1 5 0 , 3762–3768 (2007). 3762–3768 , . 1 ARTICLE 0 3 8 o / n n

c 10

l h Cell Death Cell 52 i e

n , 1604–1609 , 2 m Cell Metab.Cell , 782–793 , e , b

v i

o e

. 2 r 2 s 3 i o 9 n

9 - - - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. ARTICLE 36. 35. 34. 33. 32. 31. 30. 29. 28. 27. 26. 25. 24. 23. 22. 21. 20. 19. 10

for the orphan human cytochrome P450 2W1 in selective oxidation of oxidation selective in 2W1 P450 cytochrome human orphan the for Blood actions. signaling and identifcation cells: immune by generatedphospholipids (2007). macrophages. and cells muscle smooth arterial proliferator-activatedreceptor- peroxisome a via triacylglycerol and diacylglycerol to partitioning acid eory Comput. T eory simulation. energy free mechanics mechanics/molecular quantum A 15-lipoxygenase-2. enzyme human the by catalyzed acid arachidonic from from lipoxygenase fbroblasts. of that from ActaBiophys.Biochim. analogues. ethanolamine and choline by membranes plasma fbroblast relevance. biological metabolites.oxygenated factors.proapoptotic of release Biol. Chem. Nat. tolerance. immunologic maintains and cells scheme. basic a of variations peroxidases: glutathione of fcities speci and mechanisms ActaBiophys.Biochim. propressurele.f lateral the in changes via proteinsmembrane integral and peripheral a fect A2. phospholipase micelles. salt phospholipid–bile of peroxidationlipoxygenase-dependent on analogues tocopherol Chem. Biol. J. neurodegeneration.glutamate-induced of mediator k ey a 12-lipoxygenase, lysophospholipids. . R Suardíaz, A.Garreta, difers A.F. aminophospholipidMyoblastasymmetry Horwitz, & A. Sessions, murine in aminophospholipidasymmetry ofF. Schroeder, egulationR their and lipoxygenases Mammalian K. Leyen, van & S. Banthiya, H., K uhn, polyunsaturated-fatty-acid-derivedof Lipidomics A. Nicolaou, & Massey,K.A. V.E.Kagan, cytochrome sets oxidationZhivotovsCardiolipin k y,B.& S. Orrenius, Uderhardt,S. Catalytic M. Maiorino,F., Ursini,& Vanin, L., S. Toppo,Flohé, S., proteins.membrane integral of activities the a fect lipidsHow A.G. Lee, Nonbilayerlipids B. Kruij f, de & J.A. K illian, E., Laan, der k-vanBrin den van of function and regulation, types, group of Diversity E.A. Dennis, of Efect TaK. T.Terao,& kama,Suzui, k J.,A., Nagao, H., Arai, S. hanna,K role a F.P.of Guengerich,identiY.fcation and& Xiao, analysis Metabolomic oxidized bioactive of families V.B.New O’Donnell,Murphy, .C. R & B. Askari,

120 Biochim. Biophys. ActaBiophys.Biochim. , 1985–1992 (2012). 1985–1992 , et al. et et al. et et al. et et al. et et al. et

et al. et 278 osiglitazone inhibits acyl-CoA synthetase activity and fatty and activity synthetase acyl-CoA inhibits osiglitazoneR

Structure and interaction with phospholipids of a prophospholipidsinteractionStructurekwithandaaryotic of Molecular basis of vitamin E action: tocotrienol modulates tocotrienol action: E vitamin of basis Molecular 12 Biochim. Biophys. ActaBiophys.Biochim. Cytochrome 1 Understanding the mechanism of the hydrogen abstraction hydrogen the of mechanism Understanding the , 43508–43515 (2003). 43508–43515 , , 188–189 (2005). 188–189 , Pseudomonasaeruginosa 12/15-lipoxygenase orchestrates the clearance of apoptotic of clearance the orchestrates12/15-lipoxygenase , 2079–2090 (2016). 2079–2090 , J. Biol. Chem. Biol. J. Res. LipidJ. Biochim. Biophys. ActaBiophys.Biochim.

599 1666 FEBS Lett. FEBS Biochem. Soc. Trans. Soc. Biochem. , 254–270 (1980). 254–270 , , 62–87 (2004). 62–87 , G

c

Nat. Chem. Biol. Chem. Nat. 53 -independent mechanism in human in mechanism -independent acts as a cardiolipin oxygenase required for required oxygenasecardiolipin a as acts 1790 Lipids

269 , 1610–1617 (2012). 1610–1617 ,

134 , 1486–1500 (2009). 1486–1500 , , 13057–13060 (1994). 13057–13060 ,

30

, 75–78 (1981). 75–78 , 1666 , 135–140 (1995). 135–140 , .

1851 FASEB J. FASEB Immunity , 275–288 (2004). 275–288 ,

39 Diabetes

, 1240–1246 (2011). 1240–1246 , 1 , 308–330 (2015). 308–330 , , 223–232 (2005). 223–232 ,

27

36

, 4811–4821 (2013). 4811–4821 , 56 , 834–846 (2012). 834–846 , , 1143–1152 , NATURE D - A -

J. Chem. J. c free. CH E

MIC N ATURE A L

43. 42. 41. 40. 39. 38. 37. (CO 291/2-3and 291/5-1)to(CO M.C. CO ProgramScience (HFSP-RGP0013/2014), and Deutsche the Forschungsgemeinschaft NS061817 to H.B., P41GM103712to I.B. and ES020693to Y.Y.T.), Human the Frontier Institutes of Health U19AI068021to J.G., (P01HL114453to R.K.M., NS076511to V.E.K., PE oxidation products using Fusion tribrid Lumos. Supported by USNational the We thank J. Ruzicka (Thermo Fisher for Scientific) help inobtaining MS A requests for materials should addressed to be V.E.K., M.C.or H.B. available online at available inthe Any supplementary information, chemical compound information and source data are A The authors declare no competing interests. financial Competing financialinterests resultsthe and commented on manuscript. the participated informulating and idea the writing manuscript. the authors All discussed A.A.K., B.P. and Q.Y. participated or incell animal experiments. J.G., and B.R.S. R.K.M. putational modeling. B.L. and I.B. network performed analysis. S.D., H.H.D., J.J., V.B.R., and systems model A.A.A.performed experiments. D.M. and J.K.-S. com performed sis, interpreted data. C.S.and S.W. imaging cell performed experiments. T.A., V.A.T. G.M. and J.P.F.A. experiments. cell performed Y.Y.T. and F.Q. MSlipid performed analy V.E.K., M.C.and H.B. formulated study the designed idea, the and wrote manuscript. the A BIOLOGY cknowledgments dditional information uthor contributions

Cell (2000). cells. neuronal HT4 of death and activation pp60glutamate-inducedinhibitsTocotrienol potently action. Res. Circ. mice. in death early and formationthrombusmultiorgan causes E vitamin infection. to immunityprevents (2015). paralysis. and degeneration neuron motor rapid in results neurons in 4 peroxidase glutathioneinhibitor degeneration. hepatocellularprevent (2002). antioxidants.radical-scavenging of efects the and Yang,W.S. E vitamin of basis Molecular PackL. er,& oy,R S. S., hanna,K C.K., Sen, Wortmann,M. M. Matsushita, ferroptosis the ofAblation Q. an, R & W.S.,Hambright,. R L., Na, Chen, B.A. Carlson, N. Noguchi,

156

C | ADV H , 317–331 (2014). 317–331 ,

113 o E et al. et A n et al. et NCE ONLINE PUBLIC l MI h , 408–417 (2013). 408–417 , i et al. et n t t e et al. et et al. et p egulation of ferroptotic cancer cell death by GPX4. by death cell cancer ferroptotic of egulationR

v : / city of lipoxygenase-catalyzed lipid peroxidation lipid lipoxygenase-catalyzed of fcityspeci Te e CAL / Glutathione peroxidase 4 and vitamin E cooperatively E vitamin and 4 peroxidase Glutathione r w s T cell lipid peroxidation induces ferroptosis and ferroptosis induces peroxidation lipid cell T ciency in glutathione peroxidase 4 and 4 peroxidase glutathione in defciency Combined i w o w n

. o n f BI a

t t u h r e e

OLOG p . c a o p J. Exp. Med. Exp. J. A m e TION | r / . Reprints and permissions information is r J. Biol. Chem. Biol. J. e edox Biol. Redox p r i n Y www.nature.com/naturechemicalbiology t s /

i D n J. Biol. Chem. Biol. J.

212 d O e I x

: .

9 , 555–568 (2015). 555–568 , h

1 290 , 22–31 (2016). 22–31 , t 0 Biol. Chem. Biol. m . 1 l 0 . Correspondence and , 28097–28106 , 3 8

/ 275 N c-Src C

, 13049–13055 , H 383 3 spectra of spectra inase inase k E M , 619–626 , B

I

O . 2 - 2 3 - 8 © 2016 Nature America, Inc., part of Springer Nature. All rights reserved. cillin and 100 and cillin mM 2 and HEPES ferin, 30 nM sodium selenite, 10 nM hydrocortisone, 10 nM 5 with mix, 1:1 (DMEM/F12, medium HITES epithelialcells(MLE) were purchased from ATCC. cellsMLE were cultured in (MER)-Cre-MER- receptor mutated-estrogen mediated initiateexcision of floxed to used was (Tam) Cre– byerated gRNAtargeting exon of 1 the embryonic fibroblasts (Pfa1 cells) were transfected with a plasmid expressing technology a CRISPR–Cas9 using generated were werepurchasedATCC.fromatprofiledATCC. were STR Cells treatments. and conditions lines, Cell obtained from Helmholtz Zentrum, Institute of Developmental Genetics. protocolanimalnumber55.2-1-54-2532-144-12.was mice fromtissue Kidney by the Regierung von Oberbayern (Bavaria, Germany) and performed under the law. The treatment experiment using the inducible laboredbreathing),accordingsacrificedwereEuropean theyto welfareanimal ored breathing) (significant weight loss; inability to walk, groom, and eat; slow or minal signs (significant weight loss; inability to walk, groom, and eat; slow or lab ter showed animals When fashion. a in blinded done were animals of (terminal) lar weights were chosen for each sex in each group. The injections and collection groups had similar numbers of females and males of the same age. Mice of simi typically22–24 g.For thetreatment experiments, mice were allocated such that groupswas theaverage betweenweightThe age. of weeks8–10typically were treatmentstudy were randomly distributed between both sexes and weight, and blinded fashion and animal behavior was assessed daily. Animals included in the a detectableSupplementationbias.ensuringinno done waswater drinking of indistinguishablehasodor, andbrown light orliproxstatin-1 whiteand is less Vehicle color is injection. (i.p.) intraperitoneal by daily once administered were control vehicle Liproxstatin-1 and PBS). in DMSO (1% control vehicle with along mg/kg) (liproxstatin-1: 10 started was treatment compound 4, day On experiments, injectedondays inhibitor and with 130.5mg 4-hydroxytamoxifen dissolved Miglyol.in pharmacological the For (Münich, Genetics(Gpx4 Developmental of InstituteGermany). Generation of mice with Zentrum, Helmholtz in performed were Laboratories) River Charles from obtained old, weeks (8–10 Gpx4 were reagentspurchased from Sigma-Aldrich unlessindicated. other All Sigma-Aldrich. from purchased and (A5420-1mL) rabbit in produced was antibody molecule)-peroxidase (whole IgG anti-goat Secondary Inc. Biotechnology Cruz Santa from were (sc-161831) IgG clonal poly goat (D-19) MBOAT5antibody, Lpcat3-specific primary and (A3854) Abcam. from purchased was (ab125066)antibody GPX4-specific werepurchasedSigma-Aldrich. from (NCTT-956) hydroxy-5-nitro-7-quinolinyl)-2-thienylmethyl]-propanamide ( N 3-(pyrid-2- 4-hydroxy-2-methyl- (PD146176), dihydro-[1]benzothiopyrano[4,3-b]indole 6,11- (ML351), 5-(methylamino)-2-(1-naphthalenyl)-4-oxazolecarbonitrile Chemical. Cayman from purchased were15-LOX-2 recombinanthuman and from 15-LOX (PAF-AH), factor-acetylhydrolase let-activating plateAA-hydroperoxy-derivative(AA-OOH),and C, triacsin (AA-d8), acid purchased from Dojindo Molecular Technologies, was Inc. Deuterated arachidonic LiperFluo Promega. from purchased was (LDH) dehydrogenase lactate released the measuring for pur Kit Detection Cytotoxicity The Pharmaceuticals. were MultiTargetfrom obtained (SAPC) was AquaBluer Lipids. PolarAvanti from chased phosphatidylcholine 1-stearoyl-2-arachidonoyl and Materials. ONL doi:10.1038/nchembio.2238 in incubators with controlled temperature of 37 °C, 5% CO 100 and penicillin U/ml 100 FBS, 10% o (ehlufnl--2poyyoy-eznhxnmd (MSPPOH), -(methylsulfonyl)-2-(2-propynyloxy)-benzenehexanamide )- N KO mice. hdoyN(-ez[]he--lty)ra zluo) n N-[(8- and (zileuton) -hydroxy-N-(1-benzo[b]thien-2-ylethyl)urea I tm2Marc NE l te ii sadrs 1sery--rcioolP (SAPE) 1-stearoyl-2-arachidonoyl-PE standards, lipid the All yl )), referred to as M craol-H12bnohaie ,-ixd (piroxicam), 1,1-dioxide -carbamoyl)-2H-1,2-benzothiazine ET M loxP g/ml streptomycin. All cells were maintained in DMEM with DMEM in maintained were cells streptomycin. All g/ml

n vivo In H L technology as described previously described as technology -glutamine) supplemented with 10% FBS, 100 U/ml peni U/ml 100 FBS, -glutamine)supplemented10% with ODS xeiet wt C7L6 fml o ml mice male or female C57BL/6J with experiments B atnseii atbd ws rm Sigma-Aldrich from was antibody -actin-specific Gpx4 Gpx4 Acsl4 KO) was performed as previously described alleles to result in gene. loxP Mouse embryonic fibroblasts (MEFs) fibroblasts embryonic Mouse M -flanked -flanked (‘floxed’) g/ml streptomycin. Cells were grownwere streptomycin. Cells g/ml Gpx4 conditional KO werecells gen M g/ml insulin, 10 insulin, g/ml Gpx4 1 CreER Gpx4 3 Cs-xrsig mouse Cas9-expressing . KO mice was approved 1 7 . 4-hydroxytamoxifen. KO cells. Mouse lung T2 Gpx4 2 ;Gpx4 and 95% humidity. B -estradiol, 10 mM alleles ( alleles Acsl4 fl/fl lcn max Glycine M ie were mice g/ml trans g/ml KO cells Gpx4 fl/fl 1 7 ------.

ehooy n. ie st, n a OC-ls40 2 iia cO camera cMOS digital V2 ORCA-Flash4.0 an and sets, filer Inc. Technology 60× 1.49 NA oil optic, SpectraX diode-based light source (Lumencor), Chroma a with equipped microscope inverted Ti Nikon compartments)a using acquired were images ER or mitochondria mito-FAP-encoding the the defining reveal (thereby to transgene green malachite nM 5 with loaded were cells imaging, Before RSL3. nM 100 with treated then min 30 for LiperFluo protein activating either mitochondrially targeted (mito-FAP) or ER-targeted (ER-FAP)expressing vector fluorogenadenoviral an with infection before (MatTekCorp.) dishes imaging. cell Live analysis. were Cells by harvested for analysis. trypsinization further SAPE-OOH by 0.9 or 0.6 (0.45, followed h 2 for medium complete in nM) (100 RSL3 with Treatment15-hydroperoxy-AA-PE. with unless stated otherwise. for 6 h. Cell viability was assessed by propidium iodide staining or LDH release concentration of 100 nM for 6 h. For MLE cells, RSL3 was used at a at 0.5 or 1.0 performed were treatments RSL3 experiments, most In treatment. RSL3 (AA-OOH-CoA)CoA (2.5 15-hydroperoxy-AA (AA-OOH) (2.5 contamination and were negative. herewereroutinelylaboratoryfor mycoplasmaused the lines in tested cell All (molar extinction coefficient of NADPH at 340 nm is 6.2 × 10 GSH oxidized of reduction the during consumed NADPH of amount the of basis the on calculated was GSH oxidized ofamount substrate.The a as used cell protein. Oxidized tetralinoleoyl cardiolipin (final concentration 50 X-100, 0.2 mM NADPH, 3 mM GSH, glutathione reductase (1 U/ml) and 0.5 mg formed in 0.1 M Tris-HCl (pH 8.0), containing 0.5 mM EDTA and activity. 1.25% TritonGPX4 of Assessment using analyzed and NIS-Elements software (Nikon Inc.). acquired were Images K.K.). Photonics, (Hamamatsu gels (Precise 8–16% Tris-Glycine Gels, 25 was loaded in each lane. Proteins were separated proteinsofon amount equal 8–16% An gradientcells. MEF Tris-glycine the in GPX4 of abundance the mine GPX4. of analysis Westernblot anti-LPCAT3 Santa Biotechnology (Sc-161831, Cruz Inc.). blottingusingwestern by cells MEF for h 72 or cells MLE for h 96 and 72, 48, (1 stable were protein (Excellgen) cells TAT-Cre recombinase cells, of these To 90% cells. GFP-positive than more (BD sorting, third cytometry the flow After by II). FACSAria cells GFP-positive only selecting by sorted times) were (three cells Transfected (Invitrogen). 3000 Lipofectamine using cells positive the from isolated from was clone DNA (Promega). enzyme with ligase Inc.) USA, T4-DNA Bio (Takara sites XhoI and HpaI at were vector oligos pSico Annealed to 4 temperature. ligated room for to cooled buffer then and annealing °C 95 in at min heating by annealed were Technologies) DNA 3 GATCTGTACACCTTAAGCCA CAGATCTCTCTTGAA 3 GCCTTTTTTC 5 (sense, oligos (shRNA) RNA hairpin small Briefly, system. interferenceRNA Cre- based lentivirus a (Addgene11578), plasmid pSico used we Lpcat3 gents (GEHealthcare). bands were detected using Amersham ECL and western blotting detection rea IgG H&L (1:2,000, ab6721, Abcam) was applied as the secondary antibody, and anti-rabbit(HRP)-conjugated peroxidase horseradish Thereafter, the °C. 4 at GPX4-specific antibody at 1:500 (ab125066, Abcam) after overnight incubation targetproteins milk, withwere skim immunodetectedmembrane 5% the with blocking After (Bio-Rad). membrane PVDF a to transferred electrically and ` TGGCTTAAGGTGTACAGATCTTCAAGAGAGATCTGTACACTTTAA T and WT M ) a add n te fiiny of efficiency the and added was M) knockdown. . coli E. Acsl4 M M) for another 4 h in the presence of RSL3 beforeRSL3presencecell-deathof the in h foranother4 M) 4 Cells were seeded in 35-mm glass-bottomed tissue culture tissue glass-bottomed 35-mm in seeded were Cells 4 KO cells were pretreated with either AA (2.5 Ivtoe) n tasetd no L o MEF or MLE into transfected and (Invitrogen) DH5α . 48 h after transfection, cells were prestained with 10 with prestained were cells transfection, after h 48 . ` For the generation of generation the For atsne 5 antisense, ; M Activity measurements in cell lysates were per werelysates cell measurementsActivityin M) in complete medium for 16 h followed by followed h 16 for medium complete in M) Western blotting analysis was used to deter to used was analysisWestern blotting ` TCGAGAAAAAAGGCTTAAGGTGTA M M) or 15-hydroperoxy-arachidonoyl- M) M WT and WT l/well, 15 wells) (Life Technologies) Lpcat3 Lpcat3 D a dtrie after determined was KD NATURE CH KD in MLE or MEF cells, MEF or MLE in KD Acsl4 KO werecells treated 3 E mol MIC ` (Integrated ) lox −1 A -regulated L BIOLOGY cm M M) was −1 4 ). 5 M . All All . M), M), M M M M - - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. y ua rcmiat 5LX2 a promd t 1 C o 6 mn in min 60 for °C 21 at performed was 15-LOX-2 recombinant human by oxidation. Arachidonoyl-CoA tents of molecular species of long-chain acyl-CoAs were determined(Supelco) cartridges SPEby gel LC/MS silica ethyl-functionalized 2-(2-pyridyl) from the collected cells with chloroform–ethanol mixture long-chainDeterminationacyl-CoAs. of above.was as performed described analysis LC/MS and methanol, and chloroform with extracted were Samples and Tween 0.003% containing 7.8) 100 (pH 15-LOX-2 buffer borate human mM recombinant 25 with in U/ml) incubated (2 were 1:4) and 1:1 (ratios SAPC. and SAPE of Oxygenation scan rate = rapid, max injection time = 500 ms, AGC target = 3 × 10 activation type = HCD, collision energy = 40%, ion detection = ion trap, MS ion trap For event(s), 331.1916. the parameters were set 349.2021, as follows: top 367.2126, 331.1898, 349.2003, 333.2054, MS for list mass 10 × orbitrap, mass resolution = 15,000, max injection time = 250 ms, AGC target= detection ion = 8%,2 step with 28% = HCD,collisionenergy = Activation type parameters were set as follows: quadrupole isolation = 1 Da, first mass = ions)was created from solvent–blank injection data. For MS MS for listExclusion mass s. 9 was time sion most intense ion was selected for the data-dependent MS = range scan 120,000, resolution= orbitrap,mass = detection ionfollows: as set parameterswere the event, scan data-dependant-MS in acquired were Data 20%. = level RF-lens °C, 200 temperature= vaporizer °C, 300 temperature= tube transferunits), (arbitrary 0.5 = gas sweep units), (arbitrary 10 = gas auxiliaryunits), (arbitrary 55 = kV,gas 3 sheath = voltage probe in negative polarity mode. Ion ionizationsource electrospray conditions with were operated set as was follows: instrument spray The Scientific). Fisher analysisMS/MSOrbitrapusing an Fusion Lumosmassspectrometer (Thermo by identified were products PEoxygenated and extracted, were lipidsbation, 10 × 3 per nmol (10 lysates cell to added 1-steraoyl-2-arachidonoyl-PEwas 200 containing 7.4) (pH treatedwereCellsresuspended h.HEPESforwithRSL3 nM)(100mM 6 25 in lysates.cell oxygenatedin productsIdentificationPE of reconstituted inDMSO and to added cells. was trap (99%) ionPE-OOH Purified LQX Scientific). Fisher using (Thermo spectrometer LC/MS mass by confirmed was Purity separation. for used was v/v) (900:100:5:5, acid acetonitrile/water/triethylamine/acetic of consists 5 mm 150 × 4.4 using Corp.) (Shimadzu HPLC by purified and extracted was PE-OOH incubation, O 95% with bubbled continuously was mixture incubation 200 of from 15-LOX by PE. hydroperoxy of Preparation imaging system. (ImageJ). Actin antibody as aloading control. was used computerizedwithimageddigital and filmX-ray visualizedusingwere bands bandsweredetected chemiluminescence bya kitThermoFisher Scientific. The probed with and primary membrane antibodies nitrocellulose to LPCAT3 aat 1:1,000 dilution. onto Immunoreactive blotting semidry byelectrotransferred FisherScientific). Equal amounts (Thermoof protein kitwere separated assayby 10%SDS–PAGE, protein Bradford a with determined concentrations were with PBS, re-suspended in phosphate buffer (pH 7.8) and sonicated on ice. Protein 10 × 3 per nmol (10 droperoxy-PE 1-steraoyl-2-arachidonoyl-hy of presence the in incubated were lysates cell recombinant15-LOXfrom cells) and incubated at 37 °C for 2 h in the absence or in the presence of human LPCAT3. of analysis blot Western NATURE M 4 . Product. ions from targeteda mass list were selected for MS M DTPA for 30 min at room temperature with constant oxygen bubbling. M CH M DTPA, 0.05% sodium cholate, 5 cholate, sodium DTPA,0.05% M E MIC A 3 : 319.2279,317.2123,335.2228,333.2072,317.2123,:351.2159, L Glycine max Glycine

BIOLOGY 2 targeted-MS M m C18 column(Phenomenex).C18 Isocratic phasemobile m M DP, oiae ad sd o te experiment. the for used and sonicated DTPA, M Glycine max Glycine in 25 mM borate buffer, pH 9, in the presence the in 9, buffer,pH borate mM 25 in xasie xdto o arachidonoyl-CoA of oxidation Exhaustive Cells were harvested by trypsinization, washed 1-steraoyl-2-arachidonoyl-PE was oxidized was 1-steraoyl-2-arachidonoyl-PE 3 mode with cycle time setting of 3 s. Forwithcyclesettingtimemodes. MS of3 6 cells) for 2 h at 37 °C. At the end of incu of end Atthe °C. 37 at h 2 forcells) m iooe cnann SP ad SAPC and SAPE containing Liposomes / z 400–1,800, AGC target = 1× 10 . In separated series of the experimentthe ofseparated seriesIn . Long-chain acyl-CoAs wereextracted M 2 ( M H M N m = 4, isolation window = 2 Da, / z 2 values of 130 background130 of values O 2 at RT for 45 min. The min. 45 for RT at 4 6 2 and then isolated with scan. Dynamic exclu Dynamic scan. WT Pfal1 cells were cells Pfal1 WT 2 scan event(s), the 2 A te n of end the At . 3 scan. Target 4 4 7 . . The con The . m 3 5 scan / . The . z 87, 4 8 - - - - 6 .

cartridges (Waterscartridges Corp.) as described extraction mg) (30 1cc OASISHLB using (SPE) extraction solid-phase by ids procedure Folch acids. fatty esterified and free of analysis LC-MS tion by was confirmed mass spectrometry. identifica and collected, werecontainingPEoxFractions (Shimadzu). system ant was monitored by UV absorbance at 205 and 235 nm on a Shimadzu HPLC LC/MS grade. The column was eluted at a flow rate of 1.5 ml/min, and the elu H acetonitrile/ ofconsisting solventsystem isocratic an using performed was sis maintainedtemperature.roomatwascolumn (Phenomenex). analy The The (Luna3 columnreverse-phase a onseparated were (PE-OOH) PEoxand PE LC/MS. normal-phaseby RSL3 to exposed and genated and oxygenated PE (PEox)) was obtained from WT cells treated with Identification ofAA oxygenated PE in cells. quadrupole-orbitrap mass spectrometer (Thermo Fisher Scientific). (C18) reverse-phase or (silica) chromatography normal-phase followed by MS and MS/MS analysis on a Q-Exactive hybrid- using LC-MS/MS by lyzed procedure Folch the acids. fatty and phospholipids of analysis LC-MS containing 100 1.2 of presence the time time of 500 ms for was used MS a maximum injection time of 128 ms using 1 microscan. A maximum injection data-dependent mode. The scan range for MS analysis was 400–1,800 MS the for 17,500 and scan MS full the for 140,000 resolutionof a at negativein ionperformed mode Analysiswas FisherScientific). (Thermo eter spectrom mass hybrid-quadrupole-orbitrap Q-exactive a on performed was phospholipids. of analysis MS/MS and MS held at condition this for an additional 9min. At 21 min, the column was returned to starting conditions (50% solvent B) and min. 15–20 for B 100% at isocratically and B solvent 75–100% of gradient ear isocratically from 2.5 to 10 min at 75% solvent B, from 10 to 15 min with a lin 50% B and from 0.5 to 2.5 min with a linear gradient of 50–75% solvent B, then v/v/v/v). All solvents were LC/MS grade. The column was eluted for 0.5 min at methanol/H contained B Solvent v/v/v). methanol/Hcontained A Solventacetate. ammonium mM 10 containing B) and (A solvents gradient using performed The was analysis °C. 35 at maintained was column The mL/min). 0.050 of rate flow a at reverse-phase column (Luna 3 Reverse-phase column separation of fatty acids. tional 5min. foraddi equilibratedanB then atcolumn25% was B.The 25% to from100% min 70 toconditions 55 initial fromtoreturn followed a solventbyB 100% at min 55 to 48 from isocratically then B, solvent 70–100% of gradient linear a using min 48 to 38 from B, solvent 55–70% of gradient linear a with to min 38 25 from B, solvent 40–55% of gradient linear a using min 25 to 6.5 from B, solvent 25–40% of gradient linear a with min 6.5 to 0.5 from then B, 25% at isocratically min 0.5 for eluted was column The grade. LC/MS were vents sol All v/v/v). (285:215:40, propanol/hexane/watercontained B solvent and v/v/v) propanol/hexane/water(285:215:5, contained A Solvent triethylamine. 0.5% and acetate ammonium mM 10 containing B) and (A solvents gradient system. The column was maintained at 35 °C. The analysis was performed using (Phenomenex)) at a flow rate of 0.2 mL/min on a Dionex Ultimate 3000 HPLC aratednormal-phasecolumnona (Luna 3 Normal-phasecolumnseparation ofphospholipids. analyzed by reverse-phase below). LC/MS (see and SPE by extracted were acids fatty oxygenated Liberated 7.4). pH buffer, HEPES in °C 37 at min phospholipids,45 of nmol (PAF-AH)units/100 (0.01 acids, lipid extracts were treated with platelet-activating factor–acetylhydrolase 2 /rmtyaieaei ai (550505 vvvv. l slet were solvents All v/v/v/v). (45:5:0.5:0.5, acid O/trimethylamine/acetic M 4 M. TPA (pH=7.4). 9 . Oxygenated free fatty acids were obtained from total lip total from obtained were acids fatty free Oxygenated . M 4 9 H M ad hshlpd ad at ais ee ute ana further were acids fatty and phospholipids and , 2 O 2 M ls . m CaCl mM 0.3 plus m C18 (2) 100 Å, 150 × 1.0 mm, (Phenomenex) 2 (high-energy collisional dissociation (high-energy (HCD)) 5 0 . To liberate oxygenatedesterified fatty PE fraction (containing both nonoxy 2 /ctntiepoao (90:5:5:0.5, O/acetonitrile/propanol M 2.0 mm, 2.0 × 150 Å, 100 (2) Silica m MS and MS/MS analysis of PLs of analysis MS/MS and MS M m C m Fatty acids were separated on a 2 doi:10.1038/nchembio.2238 n 5 M EE buffer HEPES mM 25 in iis ee xrce by extracted were Lipids iis ee xrce by extracted were Lipids 8 4.6 mm 4.6 × 150 Å, 100 (2) Phospholipids were sep 2 O/acetonitrile (10:85:5, O/acetonitrile m 2 scan in scan / z with ------

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. binding affinities. From these we selected the best model, in which the small small the which in model, best the selected we these From affinities. binding higher accuracy in finding the binding site and reduce the discrepancies among a obtain to 14 atexhaustiveness set the with generator numberrandomseeds, three using run were models docking Three Å. 72 × 102 × 112 ofdimensions with boxes grid Weused modeling. docking the for box grid large a applied ( were converted from Protein Data Bank into PDBQT format using MGL Tools ( 1.1.2 version program, Vina AutoDock using proteins the to docked itors—were (PDB 15-LOX-2human with molecules family E vitamin and acids fatty esterified and free of interactions docking. Molecular and DTPA (100 (0.1%) salt sodium acid deoxycholic of7.4, pH PBS presence in mM) (1 the acid arachidonic in KU) (2.5 15-LOX by generated were mM) (3 analogs its mW,receiver 10 gain× 5 50 powermicrowave GHz, mT,9.44 0.2 amplitude frequency microwavetion modula kHz, 100 field magnetic s, 0.1 constant sweep time scans), mT/min(10 mT, scan 10 10 range mT, scan JES- 335.5 field (JEOL center spectrometer were settings ESRFA100) settings: spectrometer ESR and conditions spectroscopy. ESR by radicals phenoxyl tocopherol of Detection B for equilibration of column. the solvent65% using isocratically min 35 to solvent30 fromandB,65% to 100% gradientfromlinear a with solventmin using100% cratically30 to B, from25 iso min 25 to 20 from 100%, to 95% fromgradientlinear a with min 20 to 10 from B, solvent 95% to 65% from gradient linear a with min 10 to 5 from B, NH 0.1% containing methanol of consisted B Solvent acetate. ammonium mM 5 containing (1:1) methanol/water consisted A Solvent B). and (A solvents ent mL/min. 0.065 The of column was maintainedrate at 30 °C. flow The analysis was performed a using gradi at (Phenomenex) mm 1 × mm 150 Å, 100 (2) 3 Luna column reverse-phase a on separated were analogs its and wereSpectra acquired using range full zoom ( positive ion mode at 5.0 kV. The source temperature was maintained at 175 °C. instrumentTheoperated operatingwas in Fisher Scientific). system,(Thermo autosampler) coupled to an LXQ ion trap mass spectrometer with the Xcalibur and LC-ESI-MS analysis was performed on a Dionex LC system (UltiMate 3000 LC-MS as described previously 1 stoppedbynine-fold addinga excess of acetonitrile. For analysis,oxidizedAA were reactions The min. 5 for 7.4) (pH buffer Tris-HCl mM 50 in inhibitor 20 LC/MS. by AA oxidized and tocopherols of Detection towas 65. set level Rf S-lens The OC. 320 was temperature kV, capillary and3.2 at set was MS and MS the for set was Da 1.0 of window acids, fattyfatty acid metabolites forand their oxidized and listdeuterated products.inclusion An isolation an and 30 to set energy collision with analysis, time of 100 ms for was used MS injectionmaximum A microscan. 1 using ms 100 of time injectionmaximum MS data-dependent mode. The the scan range forfor MS analysis was 17,500 150–500 and scan MS full the for 140,000 of resolution a at mode ion negative in performed was Analysis Scientific). Fisher (Thermo spectrometer mass hybrid-quadrupole-orbitrap Q-exactive a on performed acids. fatty of analysis MS/MS and MS tolevel was 60. set voltageat wasset kV,3.5 and temperature capillary The S-lens Rf OC. was320 MS and MS the for set was Da 1.0 of windowisolation An products.deuterated and oxidized their and CL and PC PE, including ids phospholip for list inclusion an with 24 to set energy collision with analysis doi:10.1038/nchembio.2238 lowest (the affinity binding energy). sitecatalyticatbound of was 15-LOX-2the binding highest molecule the with http://mgltoo M M M internalM abovestandard the to mixture added was and analyzed through 4 M AA was incubated at 37 °C with 2.8 mU of 15-LOXof mU 10 and2.8 with °C incubatedat37 was AA M . The column was eluted during the first 5 min isocratically at 65% solvent http://vina.scrip ls.scripps.ed M M). Molecular docking modeling was employed to study the the study to employed was modeling docking Molecular ps.ed 3 and at Phenoxyl°C. 25 of radicals u . wn te ag sz o 1-O- poen we protein, 15-LOX-2 of size large the Owing ). u . h lpd, niios n poen structures protein and inhibitors lipids, The ). 4NR 5 1 2 . Vitamin E was extracted by Folch procedure (high-energy collisional dissociation (high-energy (HCD)) E ) 5 2 . The small molecules—lipids or inhib or molecules—lipids small The . MS and MS/MS analysis of PLs was PLs of analysis MS/MS and MS m 2 scans. Capillary spray voltage spray Capillary scans. / z 200−600) scans. Tocopherol 2 scans. Capillary spray Capillary scans.

Reaction conditionsReaction A -tocopheroland M m M of each of M Reaction Reaction 2 M / scan in scan z C18 m with a 4 9 - - - - - , .

tions were based on the MARTINI force field for biomolecular simulationsbiomolecular for field forceMARTINI the on based were tions simulations. (CGMD) dynamics molecular Coarse-grained be catalyzed by enzymes such as PLA2. The free AA is oxidized to 5-HPETE, 5-HPETE, to oxidized is AA free The PLA2. as such by enzymes catalyzed be were using performed COPASI analysis sensitivity and Simulationsbelow. described is network reaction the in defined are used in shown is network the of scheme literature the regulating ferroptosis based on data presented in this manuscript, published in Mathematical modeling. and at 1atm during NPTruns. K 310 at run were Simulations nm. 1.2 of distance cutoff a have interactions Nonbondedmotion. of equations the integrate to used was step time 15-fs A equilibration.ensemble NPT ns 1 and NVT ns 1 before ps, 20 for minimized ( software package MD GROMACSv.4.5.4 the using revealed the preferred phospholipid substrate. simulationsAll runs were performed CGMD the of configuration final the of Analysis motion. of equations restricted during equilibration runs. A 15-fs time step was used to integrate the the membrane surface, with different orientations. The position of protein was from Å ~20 located proteinwas The PE. and PC ofmembranecomprised the with 15-LOX-2 of interactions the study to applied were simulations CGMD The rate equation for the catalysis involving inhibitors I inhibitors involving catalysis the for equation rate The S substrates, two involving catalysis for equation rate The where K as modeled is reaction the of kinetics The rate. S by described reaction catalytic enzyme an For for example, kinetics. Michaelis–Menten using are described for catalysis ( (ODEs) equations differential GSH. to GSSG into reduced PE-AA-OH and PE-AdA-OH. the conversion from GR catalyzes are PE-AdA-OOH is and GSH PE-AA-OOH GS. while by GPX4, by GSSG catalyzed into converted reaction a in GSH forms and glycine with reacts which acid, cysteine–glutamic of formation the catalyzes GCS acid. glutamic AA-OOH and PE-AdA-OOH PE- leads to ferroptotic of cell death. accumulation The respectively. into PE-AdA-OOH, PE-AdA and and PE-AA PE-AA-OOH convert LOXes Lcat3. by catalyzed reaction a in be broken via down can AdA-CoA and AA-CoA AdA-CoA. to AA-CoA elongates Elongase 5/12/15-HETE, LTA mediators including PGE2. The feedback reactions involving 5/12/15-HPETE, PGH produce to COX by oxidized LTA into 5-HETE in converts further 5-LOX GPX4 GSH. of by presence the respectively, 5/12/15-HETE), (below 15-HETE and 12-HETE 5-HETE, to reduced are which respectively, 15-LOX, and 12-LOX 5-LOX, by below as 5/12/15-HPETE) to (referred and collectively 15-HPETE 12-HPETE denotes substrate, 1. AA metabolism: the release of AA from membrane phospholipids can can phospholipids membrane from AA of release the metabolism: AA 1. model: network our in modules three the describe briefly we Here The dynamics of the network was modeled as a system of 47 ordinary ordinary 47 of system a as modeled was network the of dynamics The x system regulation: GPX4-dependent 3. AA-CoA. of formation the catalyzes Acsl4 ferroptosis: AA-induced 2. cat is the turnover number and and number turnover the is http://www.ks.uiuc. 55, 5 6 or found in the Reactome and KEGG databases. The reaction Thedatabases. andKEGG Reactome orfoundthe in B -oxidation or esterified into PE to form PE-AA and PE-AdA v E Supplementary TableSupplementary 3 4  denotes enzyme, and PGE and KK v m1 We constructed the phospholipid metabolic network  • K edu/Research/vmd m m2 SE 5 2 () 7 were based on the literature the on based were 1 Supplementary Table4 Supplementary v with LSODA the solver. |

 KS KS K Supplementary Figure 16a Figure Supplementary ca 2 KS KS I m1 , which leads to the production of lipid lipid of production the to leads which , 1 ii t KS 1 ca ca v •• | P m l •• t t K 12 denotes product, and •• •• m 12

K PE I is the Michaelis–Menten constant. Michaelis–Menten the is SE 2 5 KS 2 4 E E . A system of ODEs derived from derived ODEs of system A . and visualized using VMD v.1.9 VMD using visualized and • m2

c − imports cysteine and exports exports and cysteine imports ! • / . ntal, ah ytm was system each Initially, ). NATURE CH S SS 12 • 1 ). The reaction rates rates reaction The ). , I 1 and S and 2 , … is … , 55, CGMD simula CGMD E 5 v MIC 6 . All acronyms All . is the reaction . 2 4 , is , . AA is also also is AA . A L BIOLOGY 5 3 - .

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. using SIMCA 13.0 software (Umetrics). The criteria for confirming a potential analysis (OPLS-DA) was used to discriminate between live and ferroptotic cells discriminant least-squares partial Orthogonal Inc). (SPSS software 18.0 SPSS Tukey’sANOVAone-waywith by analyzed were groups phospholipidfor each the sponding standardDifferencesbetween class. curve with ratiometric comparison to the preselected internal standard using a corre at set unpaired Student’s iments unless otherwise specified. Statistical analyses were performed by either Statistical analysis. in shown are parameters resulting The in shown are data experimental and dictions pre and model The comparison set. data test an using independent validated further was model The conditions. different under levels death cell roptotic fer of data experimental the fitting by parameters unknown the estimated constants. We of GPX4. concentration then and initial time pretreatment rate RSL3 between reaction and species in shown data the we used Specifically, of concentrations initial including use the integration of of integration the use where PE-AdA-OOH: and PE-AA-OOH of concentrations the of We defined a score indicating cell death signal strength as a linear combination respectively. kinetics, law mass and equation Hill a using and are decay regulation modeled rates for The transcriptional reaction A activators involving catalysis the for equation rate The NATURE We used the experimental data obtained to calibrate model parameters parameters model calibrate to obtained data experimental the used We P A < 0.05. Phospholipids were quantified from full-scan LC/MS spectra spectra LC/MS full-scan from quantified were Phospholipids 0.05. < CH is the basal level of cell death, and death, of cell level basal is the E S MIC deat h2 A  L

t BIOLOGY BC Data are presented as mean -test or one-way ANOVA. The threshold of significance was S v death  1 • KS [[ over time to predict cell death level (percentage). level death cell predict to time over PE ca t •• AA E • • () KS 1 OOH]+ m Figure 1 Figure Supplementary Table 5 Supplementary K

A aa 1 1 B 2

C 1 and and K Supplementary Figure 16b Figure Supplementary A o c 2 s.d. from at least three exper PE 2 to establish the relationship relationship the to establish B 2

are coefficients. We then are coefficients. ! AdA 1 post hoc post , A OOH 2 , … is … , . analyses by analyses ] – i - - - - . 57. 56. 55. 54. 52. 51. 50. 53. 49. 48. 47. 46. 45. 44. S-plotthe greater than 0.58. in Pcorr of value absolute (iii) and 0 excluding bar uncertainty jack-knife (ii) 1, than greater (VIP) projection in importance variable (i) were: biomarker

3067–3074 (2006). 3067–3074 analysis. fux lipidomics on based signaling and metabolism eicosanoid of model integrated network. 26 289 mimic. substrate a with 15-lipoxygenase-2 human of structure (2016). consequences. and mechanisms (2009). brain. rat and CSF human in acid arachidonic of metabolitesdioxygenated (1957). 497–509 tissues. animal from lipides total of purifcation and chromatography/massspectrometry.liquid 13 tissue. from esters A acyl–coenzyme long-chain and medium-, short-, for procedure tissue. mammalian in acyl-CoA proteins. surface cell imaging Biol. Chem. J. Phys. Chem. B Chem. Phys. J. simulations.biomolecular for model grained coarse feld: force MARTINI uorogen activating proteins. activating fuorogen targeted by compartments subcellular Hoops, S. Hoops, An S. Subramaniam, & E.A. Dennis, D.L.,Stephens, ., M.R Maurya, S., Gupta, Yang,K. D. Spoel, Van Der T e Newcomer,M.E. & S.G. Bartlett, C.E., Mitchell,D.B.,Neau, M.J., K obe, Tejero,J. T.M.Miller, T e YeVries,H.J.,A.H. D.P. Tieleman,de isselada, R fmov,S.J.,S., & Marrink, Folch, J., Lees, M. & Sloane Stanley, G.H. A simple method for the isolation the for method simple A Stanley,G.H. Sloane & M. Lees, J.,Folch, andconcentration the of Quantifcation Wolfe,. .R R & M.G. Cree, D., Sun, isolationNovel C.L. Hoppel,P.E.,ler,S.T.Mink & Ingalls, K J.,erner, long-chainTardi,Choy, P.C.ofquantitation P.G.,J.J.& Te Mu herjee, k C. Szent-Gyorgyi, Telmer,C.A. C tracer enrichment of long-chain fatty acyl–coenzyme A in muscle by muscle in A acyl–coenzyme fatty long-chain of enrichment tracer C , 1701–1718 (2005). 1701–1718 , , 8562–8569 (2014). 8562–8569 , J. Chromatogr. B Analyt. Technol.Chromatogr.Analyt.Sci. J.Life Biomed.B Anal. Biochem.Anal. et al. et et al. et PLoS Comput. Biol.Comput. PLoS et al. et

10 et al. et et al. et Biophys. J.Biophys. Dynamic simulations on the arachidonic acid metabolic acid arachidonic the on simulations Dynamic Peroxidase activation of cytoglobin by anionic phospholipids:anionic by cytoglobin of activationPeroxidase , 1239–1246 (2015). 1239–1246 , COPASI—a COmplex PAthwayCOPASI—aCOmplex SImulator.

111 apid, simultaneous quantitation of mono and mono ofquantitation simultaneousapid, R uorogen activation in activation fuorogenfar-red no-wash, fc, speci apid,R et al. et et al. et , 7812–7824 (2007). 7812–7824 ,

376 Fluorogen-activating single-chain antibodies for antibodies single-chainFluorogen-activating

exible, and free. and fexible, fast, GROMACS: 96 , 275–276 (2008). 275–276 , , 4542–4551 (2009). 4542–4551 ,

3 Nat. Biotechnol.Nat. , e55 (2007). e55 , Biochim. Biophys. ActaBiophys.Biochim. Lipids

27 , 65–67 (1992). 65–67 , Anal. Biochem.Anal.

26 , 235–240 (2008). 235–240 , doi:10.1038/nchembio.2238 J. Biol. Chem. Biol. J.

1861

877

Bioinformatics 349 J. Comput. Chem. Comput.J. , 391–401 , , 3991–4000 , , 87–95 (2006). 87–95 , J. Biol. Chem. Biol. J.

226 ACS

,

22

,