DOCSLIB.ORG

Molecular Mechanism and Enzymological Studies of Dye-Decolorizing Peroxidases (Dyps) from Thermomonospora Curvata and Enterobacter Lignolyticus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Mechanism and Enzymological Studies of Dye-Decolorizing Peroxidases (Dyps) from Thermomonospora Curvata and Enterobacter Lignolyticus Molecular mechanism and enzymological studies of dye-decolorizing peroxidases (DyPs) from Thermomonospora curvata and Enterobacter lignolyticus by Ruben Shrestha B.S., Tribhuvan University, 2005 M.S., Tribhuvan University, 2007 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY Department of Chemistry College of Arts and Sciences KANSAS STATE UNIVERSITY Manhattan, Kansas 2017 Abstract Dye-decolorizing peroxidases (DyPs) comprise a new family of heme peroxidases, which have received much attention due to their potential applications in degradation of lignin and anthraquinone dyes. In this research, studies of two types of DyPs are carried out and reported in the following three sections. The first section includes the identification and characterization of class-A TcDyP from Thermomonospora curvata, a thermophilic actinomycete found in composted manure. The TcDyP was found to be highly active toward a wide range of substrates including phenolic lignin model compounds. Transient- and steady state- kinetics involving wild- type (wt) and mutant TcDyPs revealed that Asp220 and Arg327 are essential for compound I formation and reduction of compound II to resting state is the rate-limiting step. Additionally, replacement of His312 and Arg327 shifted the redox potential (E°′) to a more negative value. In the second section, the residues involved in the radical generation and substrate oxidation were explored. TcDyP contains 7 tryptophans and 3 tyrosines, which are the likely candidates of protein radicals and substrate oxidation sites. Crystal structure of TcDyP solved at 1.75Å revealed Trp263, Trp376 and Tyr332 as surface-exposed protein radical sites. Further studies using site-directed mutagenesis, steady-state and stopped-flow kinetics determined that the Trp263 is also one of the surface-exposed substrate oxidation sites. The Trp376 was characterized as the residue essential for covalent crosslinking of the enzyme units and an off- pathway electron sink. The highly conserved Tyr332 was found to be unimportant for substrate oxidation due to its extremely narrow surface exposure. The final section involves mechanistic study of a class-B DyP from Enterobacter lignolyticus (ElDyP), a bacterium capable of growing on lignin anaerobically. The crystal structure of ElDyP revealed the presence of two heme access channels measuring at ~3.0 and 8.0 Å in diameter and a water molecule as the sixth ligand to the heme center. Bisubstrate Ping-Pong mechanism was found operational in the catalytic cycle of ElDyP, in which conformational change of the enzyme resting state was proposed as the final step and the rate limiting step in the presence of ABTS. Microscopic events leading to Compound I formation was analyzed using D2O2. A kinetic isotope effect (KIE) of 2.4 at pD 3.5 suggested that Compound 0 is formed initially with protonation/deprotonation as the rate- limiting step. Compound I was directly reduced to the enzyme resting state via a 2-electron process, for which the rate increases as the pH decreases. Based on viscosity effect and solvent KIE (sKIE) with the reducing substrate, aquo release was found to be mechanistically important. Distal aspartate was proposed as the key residue that modulates the acidic pH optimum in Compound I reduction. These findings will pave the way for engineering DyPs for their applications in the degradation of lignin and synthetic dyes. Molecular mechanism and enzymological studies of dye-decolorizing peroxidases (DyPs) from Thermomonospora curvata and Enterobacter lignolyticus by Ruben Shrestha B.S., Tribhuvan University, 2005 M.S., Tribhuvan University, 2007 A DISSERTATION submitted in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY Department of Chemistry College of Arts and Sciences KANSAS STATE UNIVERSITY Manhattan, Kansas 2017 Approved by: Major Professor Dr. Ping Li Copyright © Ruben Shrestha 2017. Abstract Dye-decolorizing peroxidases (DyPs) comprise a new family of heme peroxidases, which have received much attention due to their potential applications in degradation of lignin and anthraquinone dyes. In this research, studies of two types of DyPs are carried out and reported in the following three sections. The first section includes the identification and characterization of class-A TcDyP from Thermomonospora curvata, a thermophilic actinomycete found in composted manure. The TcDyP was found to be highly active toward a wide range of substrates including phenolic lignin model compounds. Transient- and steady state- kinetics involving wild- type (wt) and mutant TcDyPs revealed that Asp220 and Arg327 are essential for compound I formation and reduction of compound II to resting state is the rate-limiting step. Additionally, replacement of His312 and Arg327 shifted the redox potential (E°′) to a more negative value. In the second section, the residues involved in the radical generation and substrate oxidation were explored. TcDyP contains 7 tryptophans and 3 tyrosines, which are the likely candidates of protein radicals and substrate oxidation sites. Crystal structure of TcDyP solved at 1.75Å revealed Trp263, Trp376 and Tyr332 as surface-exposed protein radical sites. Further studies using site-directed mutagenesis, steady-state and stopped-flow kinetics determined that the Trp263 is also one of the surface-exposed substrate oxidation sites. The Trp376 was characterized as the residue essential for covalent crosslinking of the enzyme units and an off- pathway electron sink. The highly conserved Tyr332 was found to be unimportant for substrate oxidation due to its extremely narrow surface exposure. The final section involves mechanistic study of a class-B DyP from Enterobacter lignolyticus (ElDyP), a bacterium capable of growing on lignin anaerobically. The crystal structure of ElDyP revealed the presence of two heme access channels measuring at ~3.0 and 8.0 Å in diameter and a water molecule as the sixth ligand to the heme center. Bisubstrate Ping-Pong mechanism was found operational in the catalytic cycle of ElDyP, in which conformational change of the enzyme resting state was proposed as the final step and the rate limiting step in the presence of ABTS. Microscopic events leading to Compound I formation was analyzed using D2O2. A kinetic isotope effect (KIE) of 2.4 at pD 3.5 suggested that Compound 0 is formed initially with protonation/deprotonation as the rate- limiting step. Compound I was directly reduced to the enzyme resting state via a 2-electron process, for which the rate increases as the pH decreases. Based on viscosity effect and solvent KIE (sKIE) with the reducing substrate, aquo release was found to be mechanistically important. Distal aspartate was proposed as the key residue that modulates the acidic pH optimum in Compound I reduction. These findings will pave the way for engineering DyPs for their applications in the degradation of lignin and synthetic dyes. Table of Contents List of Figures .............................................................................................................................. xiii List of Tables ................................................................................................................................ xv List of Abbreviation ..................................................................................................................... xvi Acknowledgements ...................................................................................................................... xix Dedication .................................................................................................................................... xxi Preface......................................................................................................................................... xxii Chapter 1 - Introduction .................................................................................................................. 1 1.1 Peroxidases in general .......................................................................................................... 1 1.2 Dye-decolorizing peroxidase (DyP) ..................................................................................... 3 1.2.1 Discovery of DyP ........................................................................................................... 3 1.2.2 Phylogeny and classification of DyP ............................................................................. 4 1.2.3 Biochemical properties of DyP ...................................................................................... 6 1.2.3.1 UV-Vis spectra, heme content and Rz value .......................................................... 6 1.2.3.2 Effect of pH and pI ................................................................................................. 9 1.2.3.3 Effect of temperature ............................................................................................ 10 1.2.3.4 Oxidation and spin states of heme iron ................................................................. 11 1.2.3.5 Redox potential ..................................................................................................... 11 1.2.4 Structure of DyP .......................................................................................................... 14 1.2.4.1 Tertiary structure ................................................................................................... 14 1.2.4.2 Heme core and
Load more

Recommended publications
  • Elevated Hydrogen Peroxide and Decreased Catalase and Glutathione
    Sullivan-Gunn and Lewandowski BMC Geriatrics 2013, 13:104 http://www.biomedcentral.com/1471-2318/13/104 RESEARCH ARTICLE Open Access Elevated hydrogen peroxide and decreased catalase and glutathione peroxidase protection are associated with aging sarcopenia Melanie J Sullivan-Gunn1 and Paul A Lewandowski2* Abstract Background: Sarcopenia is the progressive loss of skeletal muscle that contributes to the decline in physical function during aging. A higher level of oxidative stress has been implicated in aging sarcopenia. The current study aims to determine if the higher level of oxidative stress is a result of increased superoxide (O2‾ ) production by the NADPH oxidase (NOX) enzyme or decrease in endogenous antioxidant enzyme protection. Methods: Female Balb/c mice were assigned to 4 age groups; 6, 12, 18 and 24 months. Body weight and animal survival rates were recorded over the course of the study. Skeletal muscle tissues were collected and used to measure NOX subunit mRNA, O2‾ levels and antioxidant enzymes. Results: Key subunit components of NOX expression were elevated in skeletal muscle at 18 months, when sarcopenia was first evident. Increased superoxide dismutase 1 (SOD1) activity suggests an increase in O2‾ dismutation and this was further supported by elevated levels of hydrogen peroxide (H2O2) and decline in catalase and glutathione peroxidase (GPx) antioxidant protection in skeletal muscle at this time. NOX expression was also higher in skeletal muscle at 24 months, however this was coupled with elevated levels of O2‾ and a decline in SOD1 activity, compared to 6 and 12 months but was not associated with further loss of muscle mass.
    [Show full text]
  • Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution
    Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution KUNIHIRO YAMAMOTO AND LESLIE J. DEGROOT Thyroid Study Unit, Department of Medicine, University of Chicago, Chicago, Illinois 60637 ABSTRACT. The regulation of iodination was in- TSH injection, whether expressed per mg gland vestigated in male rats during physiological altera- weight, per mg protein, or per fxg DNA, suggesting tions in thyroid function. Thyroid hyperplasia was enzyme induction and cellular hypertrophy. Involu- Downloaded from https://academic.oup.com/endo/article/95/2/606/2618917 by guest on 30 September 2021 produced by giving 0.01% PTU in drinking water or tion by T4 administration caused a decrease in injection of TSH (2 USP U/day); involution was thyroid weight, DNA content, and enzyme activity per induced after PTU treatment by giving 3 fig L-T4/ml gland. The main reason for the decrease in enzyme in drinking water. Increase in activity of thyroid activity per gland was a diminution of cell numbers. peroxidase and NADPH-cytochrome c reductase per During thyroid hyperplasia and involution, perox- gland exceeded gains in thyroid weight and DNA idase and NADPH-cytochrome c reductase activity content early in hyperplasia, but increased essen- is regulated by TSH. During the onset of TSH tially in parallel manner during chronic PTU treat- action, peroxidase and NADPH-cytochrome c re- ment. Enzyme activity per /xg DNA increased to ductase increase to a greater extent than thyroid 155% of control after 4 days of PTU treatment, weight and DNA content, suggesting preferential decreased to 138% on the seventh day, and was at enzyme synthesis in addition to cell hypertrophy.
    [Show full text]
  • Thyroid Peroxidase Antibody Is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease
    Published online: 2018-07-02 Article Thieme Li Fang et al. Thyroid Peroxidase Antibody is … Exp Clin Endocrinol Diabetes 2018; 00: 00–00 Thyroid Peroxidase Antibody is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease Authors Fang Li1 * , Gulibositan Aji1 * , Yun Wang2, Zhiqiang Lu1, Yan Ling1 Affiliations ABSTRACT 1 Department of Endocrinology and Metabolism, Zhong- Purpose Homocysteine is associated with cardiovascular, shan Hospital, Fudan University, Shanghai, China inflammation and autoimmune diseases. Previous studies have 2 Department of Endocrinology and Metabolism, the shown that thyroid peroxidase antibody is associated with ho- Second Hospital of Shijiazhuang City, Shijiazhuang, mocysteine levels in hypothyroidism. The relationship between Hebei Province, China thyroid antibodies and homocysteine in hyperthyroidism re- mains unclear. In this study, we aimed to investigate the asso- Key words ciation of thyroid antibodies with homocysteine in patients human, cardiovascular risk, hyperthyroidism with Graves’ disease. Methods This was a cross-sectional study including 478 received 07.04.2018 Graves’ disease patients who were consecutively admitted and revised 10.05.2018 underwent radioiodine therapy. Homocysteine, thyroid hor- accepted 14.06.2018 mones, thyroid antibodies, glucose and lipids were measured. Results Patients with homocysteine levels above the median Bibliography were older and had unfavorable metabolic parameters com- DOI https://doi.org/10.1055/a-0643-4692 pared to patients with homocysteine levels below the median. Published online: 2.7.2018 Thyroglobulin antibody or thyroid peroxidase antibody was Exp Clin Endocrinol Diabetes 2020; 128: 8–14 associated with homocysteine levels (β = 0.56, 95 %CI 0.03- © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · 1.08, p = 0.04; β = 0.75, 95 %CI 0.23-1.27, p = 0.005).
    [Show full text]
  • A Copper Protein and a Cytochrome Bind at the Same Site on Bacterial Cytochrome C Peroxidase† Sofia R
    14566 Biochemistry 2004, 43, 14566-14576 A Copper Protein and a Cytochrome Bind at the Same Site on Bacterial Cytochrome c Peroxidase† Sofia R. Pauleta,‡,§ Alan Cooper,⊥ Margaret Nutley,⊥ Neil Errington,| Stephen Harding,| Francoise Guerlesquin,3 Celia F. Goodhew,‡ Isabel Moura,§ Jose J. G. Moura,§ and Graham W. Pettigrew‡ Veterinary Biomedical Sciences, Royal (Dick) School of Veterinary Studies, UniVersity of Edinburgh, Summerhall, Edinburgh EH9 1QH, U.K., Department of Chemistry, UniVersity of Glasgow, Glasgow G12 8QQ, U.K., Centre for Macromolecular Hydrodynamics, UniVersity of Nottingham, Sutton Bonington, Nottingham LE12 5 RD, U.K., Unite de Bioenergetique et Ingenierie des Proteines, IBSM-CNRS, 31 chemin Joseph Aiguier, 13402 Marseilles cedex 20, France, Requimte, Departamento de Quimica, CQFB, UniVersidade NoVa de Lisboa, 2829-516 Monte de Caparica, Portugal ReceiVed July 5, 2004; ReVised Manuscript ReceiVed September 9, 2004 ABSTRACT: Pseudoazurin binds at a single site on cytochrome c peroxidase from Paracoccus pantotrophus with a Kd of 16.4 µMat25°C, pH 6.0, in an endothermic reaction that is driven by a large entropy change. Sedimentation velocity experiments confirmed the presence of a single site, although results at higher pseudoazurin concentrations are complicated by the dimerization of the protein. Microcalorimetry, ultracentrifugation, and 1H NMR spectroscopy studies in which cytochrome c550, pseudoazurin, and cytochrome c peroxidase were all present could be modeled using a competitive binding algorithm. Molecular docking simulation of the binding of pseudoazurin to the peroxidase in combination with the chemical shift perturbation pattern for pseudoazurin in the presence of the peroxidase revealed a group of solutions that were situated close to the electron-transferring heme with Cu-Fe distances of about 14 Å.
    [Show full text]
  • MPO) in Inflammatory Communication
    antioxidants Review The Enzymatic and Non-Enzymatic Function of Myeloperoxidase (MPO) in Inflammatory Communication Yulia Kargapolova * , Simon Geißen, Ruiyuan Zheng, Stephan Baldus, Holger Winkels * and Matti Adam Department III of Internal Medicine, Heart Center, Faculty of Medicine and University Hospital of Cologne, 50937 North Rhine-Westphalia, Germany; [email protected] (S.G.); [email protected] (R.Z.); [email protected] (S.B.); [email protected] (M.A.) * Correspondence: [email protected] (Y.K.); [email protected] (H.W.) Abstract: Myeloperoxidase is a signature enzyme of polymorphonuclear neutrophils in mice and humans. Being a component of circulating white blood cells, myeloperoxidase plays multiple roles in various organs and tissues and facilitates their crosstalk. Here, we describe the current knowledge on the tissue- and lineage-specific expression of myeloperoxidase, its well-studied enzymatic activity and incoherently understood non-enzymatic role in various cell types and tissues. Further, we elaborate on Myeloperoxidase (MPO) in the complex context of cardiovascular disease, innate and autoimmune response, development and progression of cancer and neurodegenerative diseases. Keywords: myeloperoxidase; oxidative burst; NETs; cellular internalization; immune response; cancer; neurodegeneration Citation: Kargapolova, Y.; Geißen, S.; Zheng, R.; Baldus, S.; Winkels, H.; Adam, M. The Enzymatic and Non-Enzymatic Function of 1. Introduction. MPO Conservation Across Species, Maturation in Myeloid Progenitors, Myeloperoxidase (MPO) in and its Role in Immune Responses Inflammatory Communication. Myeloperoxidase (MPO) is a lysosomal protein and part of the organism’s host-defense Antioxidants 2021, 10, 562. https:// system. MPOs’ pivotal function is considered to be its enzymatic activity in response to doi.org/10.3390/antiox10040562 invading pathogenic agents.
    [Show full text]
  • Catalase and Oxidase Test
    CATALASE TEST Catalase is the enzyme that breaks hydrogen peroxide (H 2O2) into H 2O and O 2. Hydrogen peroxide is often used as a topical disinfectant in wounds, and the bubbling that is seen is due to the evolution of O 2 gas. H 2O2 is a potent oxidizing agent that can wreak havoc in a cell; because of this, any cell that uses O 2 or can live in the presence of O 2 must have a way to get rid of the peroxide. One of those ways is to make catalase. PROCEDURE a. Place a small amount of growth from your culture onto a clean microscope slide. If using colonies from a blood agar plate, be very careful not to scrape up any of the blood agar— blood cells are catalase positive and any contaminating agar could give a false positive. b. Add a few drops of H 2O2 onto the smear. If needed, mix with a toothpick. DO NOT use a metal loop or needle with H 2O2; it will give a false positive and degrade the metal. c. A positive result is the rapid evolution of O 2 as evidenced by bubbling. d. A negative result is no bubbles or only a few scattered bubbles. e. Dispose of your slide in the biohazard glass disposal container. Dispose of any toothpicks in the Pipet Keeper. OXIDASE TEST Basically, this is a test to see if an organism is an aerobe. It is a check for the presence of the electron transport chain that is the final phase of aerobic respiration.
    [Show full text]
  • Myeloperoxidase Mediates Cell Adhesion Via the Αmβ2 Integrin (Mac-1, Cd11b/CD18)
    Journal of Cell Science 110, 1133-1139 (1997) 1133 Printed in Great Britain © The Company of Biologists Limited 1997 JCS4390 Myeloperoxidase mediates cell adhesion via the αMβ2 integrin (Mac-1, CD11b/CD18) Mats W. Johansson1,*, Manuel Patarroyo2, Fredrik Öberg3, Agneta Siegbahn4 and Kenneth Nilsson3 1Department of Physiological Botany, University of Uppsala, Villavägen 6, S-75236 Uppsala, Sweden 2Microbiology and Tumour Biology Centre, Karolinska Institute, PO Box 280, S-17177 Stockholm, Sweden 3Department of Pathology, University of Uppsala, University Hospital, S-75185 Uppsala, Sweden 4Department of Clinical Chemistry, University of Uppsala, University Hospital, S-75185 Uppsala, Sweden *Author for correspondence (e-mail: [email protected]) SUMMARY Myeloperoxidase is a leukocyte component able to to αM (CD11b) or to β2 (CD18) integrin subunits, but not generate potent microbicidal substances. A homologous by antibodies to αL (CD11a), αX (CD11c), or to other invertebrate blood cell protein, peroxinectin, is not only integrins. Native myeloperoxidase mediated dose- a peroxidase but also a cell adhesion ligand. We demon- dependent cell adhesion down to relatively low concen- strate in this study that human myeloperoxidase also trations, and denaturation abolished the adhesion mediates cell adhesion. Both the human myeloid cell line activity. It is evident that myeloperoxidase supports cell HL-60, when differentiated by treatment with 12-O- adhesion, a function which may be of considerable tetradecanoyl-phorbol-13-acetate (TPA) or retinoic acid, importance for leukocyte migration and infiltration in and human blood leukocytes, adhered to myeloperoxi- inflammatory reactions, that αMβ2 integrin (Mac-1 or dase; however, undifferentiated HL-60 cells showed only CD11b/CD18) mediates this adhesion, and that the αMβ2 minimal adhesion.
    [Show full text]
  • Metatranscriptomic Analysis of Community Structure And
    School of Environmental Sciences Metatranscriptomic analysis of community structure and metabolism of the rhizosphere microbiome by Thomas Richard Turner Submitted in partial fulfilment of the requirement for the degree of Doctor of Philosophy, September 2013 This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with the author and that use of any information derived there from must be in accordance with current UK Copyright Law. In addition, any quotation or extract must include full attribution. i Declaration I declare that this is an account of my own research and has not been submitted for a degree at any other university. The use of material from other sources has been properly and fully acknowledged, where appropriate. Thomas Richard Turner ii Acknowledgements I would like to thank my supervisors, Phil Poole and Alastair Grant, for their continued support and guidance over the past four years. I’m grateful to all members of my lab, both past and present, for advice and friendship. Graham Hood, I don’t know how we put up with each other, but I don’t think I could have done this without you. Cheers Salt! KK, thank you for all your help in the lab, and for Uma’s biryanis! Andrzej Tkatcz, thanks for the useful discussions about our projects. Alison East, thank you for all your support, particularly ensuring Graham and I did not kill each other. I’m grateful to Allan Downie and Colin Murrell for advice. For sequencing support, I’d like to thank TGAC, particularly Darren Heavens, Sophie Janacek, Kirsten McKlay and Melanie Febrer, as well as John Walshaw, Mark Alston and David Swarbreck for bioinformatic support.
    [Show full text]
  • Lncrna-MEG3 Functions As Ferroptotic Promoter to Mediate OGD Combined High Glucose-Induced Death of Rat Brain Microvascular Endothelial Cells Via the P53-GPX4 Axis
    LncRNA-MEG3 functions as ferroptotic promoter to mediate OGD combined high glucose-induced death of rat brain microvascular endothelial cells via the p53-GPX4 axis Cheng Chen Xiangya Hospital Central South University Yan Huang Xiangya Hospital Central South University Pingping Xia Xiangya Hospital Central South University Fan Zhang Xiangya Hospital Central South University Longyan Li Xiangya Hospital Central South University E Wang Xiangya Hospital Central South University Qulian Guo Xiangya Hospital Central South University Zhi Ye ( [email protected] ) Xiangya Hospital Central South University https://orcid.org/0000-0002-7678-0926 Research article Keywords: lncRNA-MEG3, p53, ferroptosis, ischemia, GPX4, OGD, hyperglycemia, Posted Date: May 18th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-28622/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Background Individuals with diabetes are exposed to a higher risk of perioperative stroke than non- diabetics mainly due to persistent hyperglycemia. lncRNA-MEG3 (long non-coding RNA maternally expressed gene 3) has been considered as an important mediator in regulating ischemic stroke. However, the functional and regulatory roles of lncRNA-MEG3 in diabetic brain ischemic injury remain unclear. Results In this study, RBMVECs (the rat brain microvascular endothelial cells) were exposed to 6 h of OGD (oxygen and glucose deprivation), and subsequent reperfusion via incubating cells with glucose of various high concentrations for 24 h to imitate in vitro diabetic brain ischemic injury. It was shown that the marker events of ferroptosis and increased lncRNA-MEG3 expression occurred after the injury induced by OGD combined with hyperglycemic treatment.
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]