DOCSLIB.ORG

Prdx6 Deficiency Ameliorates DSS Colitis: Relevance of Compensatory Antioxidant Mechanisms

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prdx6 Deficiency Ameliorates DSS Colitis: Relevance of Compensatory Antioxidant Mechanisms Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2017 Prdx6 Deficiency Ameliorates DSS Colitis: Relevance of Compensatory Antioxidant Mechanisms Melhem, Hassan ; Spalinger, Marianne R ; Cosin-Roger, Jesus ; Atrott, Kirstin ; Lang, Silvia ; Wojtal, Kacper A ; Vavricka, Stephan R ; Rogler, Gerhard ; Frey-Wagner, Isabelle Abstract: Background and Aims An imbalance between cellular antioxidant defence system[s] and reactive oxygen species [ROS]-driven oxidative stress has been implicated in the pathogenesis of inflammatory bowel disease. Peroxiredoxin [PRDX] 6 contributes to an appropriate redox balance by clearing ROS and reducing peroxidized membrane phospholipids. We here studied the role of PRDX6 in acute and chronic dextran sodium sulphate [DSS]-induced colitis. Methods To investigate the impact of PRDX6 on intestinal inflammation, we used wild type [WT], Prdx6 knock-out mice [Prdx6-/-] and transgenic mice [Prdx6tg/tg], overexpressing Prdx6. Acute and chronic colitis was induced by DSS in WT, Prdx6-/- and Prdx6tg/tg mice. Colitis was evaluated by endoscopy, colon length, histopathological assessment and myeloperoxidase [MPO] activity. Changes in mRNA and protein expression of pro-inflammatory cytokines and antioxidant enzymes were evaluated by real-time quantitative polymerase chain reaction [RT-qPCR] and western blot. Total glutathione [GSH] levels in colon samples were determined. Results Prdx6-/- mice exposed to acute and chronic DSS showed a significant decrease in the clinical parameters and in colonic expression of pro-inflammatory cytokines compared with WT mice. mRNA expression of antioxidant enzymes in colon samples was significantly increased in Prdx6-/- compared with WT mice exposed to acute and chronic DSS. In addition, total GSH levels were increased in Prdx6-/- mice treated with DSS in comparison with WT. Overexpression of Prdx6 did not significantly influence acute and chronic colitis. Conclusions Our data indicate that a lack of the antioxidant enzyme PRDX6 protects against the development of acute and chronic experimental colitis and is associated with increased expression and function of other antioxidant enzymes, suggesting effective compensatory mechanisms. DOI: https://doi.org/10.1093/ecco-jcc/jjx016 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-145195 Journal Article Accepted Version Originally published at: Melhem, Hassan; Spalinger, Marianne R; Cosin-Roger, Jesus; Atrott, Kirstin; Lang, Silvia; Wojtal, Kacper A; Vavricka, Stephan R; Rogler, Gerhard; Frey-Wagner, Isabelle (2017). Prdx6 Deficiency Ame- liorates DSS Colitis: Relevance of Compensatory Antioxidant Mechanisms. Journal of Crohn’s Colitis, 11(7):871-884. DOI: https://doi.org/10.1093/ecco-jcc/jjx016 1 Prdx6 deficiency ameliorates DSS colitis: relevance of compensatory antioxidant 2 mechanisms 3 4 Hassan Melhem1, Marianne R. Spalinger1, Jesus Cosin-Roger1, Kirstin Atrott1, Silvia Lang1, 5 Kacper Wojtal1, Stephan Vavricka1,2,3, Gerhard Rogler1, 2 and Isabelle Frey-Wanger1, 2 6 7 1 Departement of Gastroenterology and Hepatology, University Hospital Zurich, University of 8 Zurich, Zurich, Switzerland 9 2Division of Gastroenterology and Hepatology, Hospital Triemli, Zurich, Switzerland 10 3 Zurich Center for Integrative Human Physiology (ZIHP), University of Zurich, Zurich, 11 Switzerland 12 13 Short title: Lack of Prdx6 ameliorates DSS colitis 14 15 Correspondence: 16 Dr. Isabelle Frey-Wagner 17 Division of Gastroenterology and Hepatology 18 University Hospital of Zurich 19 Raemistrasse 100 20 CH-8091 Zurich 21 Switzerland 22 E-mail: [email protected] 23 24 Abbreviations 25 BCA, bicinchoninic acid assay; colonic lamina propria mononuclear cells (LPMC); CD, 26 Crohns’s disease; DSS, dextran sodium sulphate; GSH, reduced glutathione; IBD, 27 inflammatory bowel disease; intestinal epithelial cells, (IEC); MEICS, murine endoscopic 28 index of colitis severity; MPO, Myeloperoxidase; NO, Nitric oxide; ROS, reactive oxygen 29 species; Tg, transgenic; UC, ulcerative colitis; UV, ultraviolet 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 Abstract 52 53 Background 54 An imbalance between cellular antioxidant defense system(s) and reactive oxygen species 55 (ROS)-driven oxidative stress has been implicated in the pathogenesis of inflammatory bowel 56 disease. Peroxiredoxin (PRDX) 6, contributes to an appropriate redox balance by clearing 57 ROS and reducing peroxidized membrane phospholipids. 58 59 Aims 60 We here studied the role of Prdx6 in acute and chronic DSS-induced colitis. 61 62 Design 63 To investigate the impact of PRDX6 on intestinal inflammation, we used wild type (WT), 64 Prdx6 knock-out mice (Prdx6-/-) and transgenic mice (Prdx6tg/tg), overexpressing Prdx6. 65 Acute and chronic colitis was induced by dextran sulfate sodium (DSS) in WT, Prdx6-/-, and 66 Prdx6tg/tg mice. Colitis was evaluated by endoscopy, colon length, histopathological 67 assessment, and myeloperoxidase (MPO) activity. Changes in mRNA and protein expression 68 of pro-inflammatory cytokines and antioxidant enzymes were evaluated by RT-qPCR and 69 western blot. Total GSH levels in colon samples were determined. 70 71 Results 72 Prdx6-/- mice exposed to acute and chronic DSS showed a significant decrease in the clinical 73 parameters and in colonic expression of pro-inflammatory cytokines compared to WT mice. 74 mRNA expression of antioxidant enzymes in colon samples was significantly increased in 75 Prdx6-/- compared to WT mice exposed to acute and chronic DSS. In addition, total GSH 76 levels were increased in Prdx6-/- mice treated with DSS in comparison to WT. Overexpression 77 of Prdx6 did not significantly influence acute and chronic colitis. 78 79 Conclusion 80 Our data indicate that a lack of the antioxidant enzyme PRDX6 protects against the 81 development of acute and chronic experimental colitis and is associated with increased 82 expression and function of other antioxidant enzymes suggesting effective compensatory 83 mechanisms. 84 85 Keywords 86 IBD, colitis, ROS, Prdx6, antioxidant enzymes 87 88 Introduction 89 The major forms of inflammatory bowel diseases (IBD), Crohn's disease (CD) and ulcerative 90 colitis (UC), are chronic, relapsing inflammatory disorders of the gastrointestinal (GI) tract 91 causing a life-long burden on affected patients (1). Both disorders have a multifactorial 92 pathogenesis with three main factors involved in their pathogenesis: environmental exposure 93 (e.g. to gut microbiota and microbial pathogens), genetic susceptibility (e.g. predisposing 94 factors affecting the gut barrier function) and consecutive dysregulation of the immune 95 system (on the innate and adaptive level) (2-3). 96 The mechanisms by which imbalances of the immune system initiate and perpetuate intestinal 97 damage and inflammation are not entirely clear. However, inflammatory conditions lead to an 98 increased oxidative burden due to the release of reactive oxygen species (ROS) by activated 99 macrophages and neutrophils as a part of the body’s defense mechanisms (4). Low levels of 100 ROS have a protective effect by activating protective signaling pathways against 101 inflammation and by modulating the immune-mediated attack against extrinsic pathogens. 102 Conversely, high levels of ROS create oxidative stress within the cells and, in case of chronic 103 exposure, changes in the genome, such as single strand DNA breaks, sugar moiety 104 modifications, and deamination and adduction of bases (5), leading to a loss of homeostasis 105 (6). 106 Several studies have established a direct relation between oxidative stress and IBD 107 pathogenesis in both, human subjects and animals subjected to experimental colitis. Clinical 108 studies showed an increase of ROS as well as biomarkers of oxidative injury, including lipid 109 peroxidation products and protein modifications, in the intestinal mucosa of patients with 110 either UC or CD (7-8). These highly cytotoxic molecules contribute to tissue damage in IBD 111 (9). In line with this, Barbosa et al., (10) showed a correlation between the activity of free 112 radicals in the intestinal mucosa of IBD patients, and the clinical disease activity. To maintain 113 adequate ROS levels, a balance between oxidant and antioxidant mechanisms is necessary. A 114 depletion of antioxidant levels in the intestinal mucosa and in peripheral red blood cells has 115 been observed in IBD patients (11-13). Genetic polymorphisms in antioxidant enzymes are 116 associated with altered enzyme activity and a higher risk of developing IBD (14). In animal 117 models of IBD, multiple studies demonstrated an increased formation of ROS in the colonic 118 mucosa (15-16). In line with this, experimental colitis is associated with a decrease in the 119 levels of endogenous antioxidants in colonic tissue (17). Genetic deletion of ROS-detoxifying 120 enzymes increases the susceptibility towards tissue destruction (18), whereas an 121 overexpression of antioxidant enzymes resulted in attenuation of colitis in mice (19-20). 122 Among the most important antioxidant proteins is the peroxiredoxin (PRDX) family. PRDX6, 123 a bifunctional 25-kDa protein, is the only member of PRDXs that confers both GSH 124 peroxidase and phospholipase A2 activities (21). Despite intensive investigations, the role of 125 PRDX6 in inflammation is still controversial and both protective (experimental autoimmune 126
Load more

Recommended publications
  • Formaldehyde Induces Bone Marrow Toxicity in Mice by Inhibiting Peroxiredoxin 2 Expression
    MOLECULAR MEDICINE REPORTS 10: 1915-1920, 2014 Formaldehyde induces bone marrow toxicity in mice by inhibiting peroxiredoxin 2 expression GUANGYAN YU1, QIANG CHEN1, XIAOMEI LIU1, CAIXIA GUO2, HAIYING DU1 and ZHIWEI SUN1,2 1Department of Preventative Medicine, School of Public Health, Jilin University, Changchun, Jilin 130021; 2 Department of Hygenic Toxicology, School of Public Health, Capital Medical University, Beijing 100069, P.R. China Received November 4, 2013; Accepted June 5, 2014 DOI: 10.3892/mmr.2014.2473 Abstract. Peroxiredoxin 2 (Prx2), a member of the perox- Introduction iredoxin family, regulates numerous cellular processes through intracellular oxidative signal transduction pathways. Formaldehyde (FA) is an environmental agent commonly Formaldehyde (FA)-induced toxic damage involves reactive found in numerous products, including paint, cloth and oxygen species (ROS) that trigger subsequent toxic effects and exhaust gas, as well as other medicinal and industrial products. inflammatory responses. The present study aimed to inves- FA exposure has raised significant concerns due to mounting tigate the role of Prx2 in the development of bone marrow evidence suggesting its carcinogenic potential and severe toxicity caused by FA and the mechanism underlying FA effects on human health (1). Epidemiological and experi- toxicity. According to the results of the preliminary inves- mental data have demonstrated that FA may cause leukemia, tigations, the mice were divided into four groups (n=6 per particularly myeloid leukemia; however, the mechanism group). One group was exposed to ambient air and the other underlying this effect remains unclear (2-4). In the process three groups were exposed to different concentrations of FA of tumor formation, DNA damage may be the initiating (20, 40, 80 mg/m3) for 15 days in the respective inhalation factor (5), while myeloperoxidase (MPO) activity is associ- chambers, for 2 h a day.
    [Show full text]
  • Peroxiredoxins in Neurodegenerative Diseases
    antioxidants Review Peroxiredoxins in Neurodegenerative Diseases Monika Szeliga Mossakowski Medical Research Centre, Department of Neurotoxicology, Polish Academy of Sciences, 5 Pawinskiego Street, 02-106 Warsaw, Poland; [email protected]; Tel.: +48-(22)-6086416 Received: 31 October 2020; Accepted: 27 November 2020; Published: 30 November 2020 Abstract: Substantial evidence indicates that oxidative/nitrosative stress contributes to the neurodegenerative diseases. Peroxiredoxins (PRDXs) are one of the enzymatic antioxidant mechanisms neutralizing reactive oxygen/nitrogen species. Since mammalian PRDXs were identified 30 years ago, their significance was long overshadowed by the other well-studied ROS/RNS defense systems. An increasing number of studies suggests that these enzymes may be involved in the neurodegenerative process. This article reviews the current knowledge on the expression and putative roles of PRDXs in neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease and dementia with Lewy bodies, multiple sclerosis, amyotrophic lateral sclerosis and Huntington’s disease. Keywords: peroxiredoxin (PRDX); oxidative stress; nitrosative stress; neurodegenerative disease 1. Introduction Under physiological conditions, reactive oxygen species (ROS, e.g., superoxide anion, O2 -; · hydrogen peroxide, H O ; hydroxyl radical, OH; organic hydroperoxide, ROOH) and reactive nitrogen 2 2 · species (RNS, e.g., nitric oxide, NO ; peroxynitrite, ONOO-) are constantly produced as a result of normal · cellular metabolism and play a crucial role in signal transduction, enzyme activation, gene expression, and regulation of immune response [1]. The cells are endowed with several enzymatic (e.g., glutathione peroxidase (GPx); peroxiredoxin (PRDX); thioredoxin (TRX); catalase (CAT); superoxide dismutase (SOD)), and non-enzymatic (e.g., glutathione (GSH); quinones; flavonoids) antioxidant systems that minimize the levels of ROS and RNS.
    [Show full text]
  • MPO) in Inflammatory Communication
    antioxidants Review The Enzymatic and Non-Enzymatic Function of Myeloperoxidase (MPO) in Inflammatory Communication Yulia Kargapolova * , Simon Geißen, Ruiyuan Zheng, Stephan Baldus, Holger Winkels * and Matti Adam Department III of Internal Medicine, Heart Center, Faculty of Medicine and University Hospital of Cologne, 50937 North Rhine-Westphalia, Germany; [email protected] (S.G.); [email protected] (R.Z.); [email protected] (S.B.); [email protected] (M.A.) * Correspondence: [email protected] (Y.K.); [email protected] (H.W.) Abstract: Myeloperoxidase is a signature enzyme of polymorphonuclear neutrophils in mice and humans. Being a component of circulating white blood cells, myeloperoxidase plays multiple roles in various organs and tissues and facilitates their crosstalk. Here, we describe the current knowledge on the tissue- and lineage-specific expression of myeloperoxidase, its well-studied enzymatic activity and incoherently understood non-enzymatic role in various cell types and tissues. Further, we elaborate on Myeloperoxidase (MPO) in the complex context of cardiovascular disease, innate and autoimmune response, development and progression of cancer and neurodegenerative diseases. Keywords: myeloperoxidase; oxidative burst; NETs; cellular internalization; immune response; cancer; neurodegeneration Citation: Kargapolova, Y.; Geißen, S.; Zheng, R.; Baldus, S.; Winkels, H.; Adam, M. The Enzymatic and Non-Enzymatic Function of 1. Introduction. MPO Conservation Across Species, Maturation in Myeloid Progenitors, Myeloperoxidase (MPO) in and its Role in Immune Responses Inflammatory Communication. Myeloperoxidase (MPO) is a lysosomal protein and part of the organism’s host-defense Antioxidants 2021, 10, 562. https:// system. MPOs’ pivotal function is considered to be its enzymatic activity in response to doi.org/10.3390/antiox10040562 invading pathogenic agents.
    [Show full text]
  • Surface Phenotype Changes and Increased Response to Oxidative Stress in CD4+Cd25high T Cells
    biomedicines Article Surface Phenotype Changes and Increased Response to Oxidative Stress in CD4+CD25high T Cells Yoshiki Yamamoto 1,*, Takaharu Negoro 2, Rui Tada 3 , Michiaki Narushima 4, Akane Hoshi 2, Yoichi Negishi 3,* and Yasuko Nakano 2 1 Department of Paediatrics, Tokyo Metropolitan Ebara Hospital, Tokyo 145-0065, Japan 2 Department of Pharmacogenomics, School of Pharmacy, Showa University, Tokyo 142-8555, Japan; [email protected] (T.N.); [email protected] (A.H.); [email protected] (Y.N.) 3 Department of Drug Delivery and Molecular Biopharmaceutics, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, Tokyo 192-0392, Japan; [email protected] 4 Department of Internal Medicine, Showa University Northern Yokohama Hospital, Kanagawa 224-8503, Japan; [email protected] * Correspondence: [email protected] (Y.Y.); [email protected] (Y.N.); Tel.: +81-3-5734-8000 (Y.Y.); +81-42-676-3182 (Y.N.) + + + + Abstract: Conversion of CD4 CD25 FOXP3 T regulatory cells (Tregs) from the immature (CD45RA ) to mature (CD45RO+) phenotype has been shown during development and allergic reactions. The relative frequencies of these Treg phenotypes and their responses to oxidative stress during devel- opment and allergic inflammation were analysed in samples from paediatric and adult subjects. The FOXP3lowCD45RA+ population was dominant in early childhood, while the percentage of high + FOXP3 CD45RO cells began increasing in the first year of life. These phenotypic changes were observed in subjects with and without asthma. Further, there was a significant increase in phospho- Citation: Yamamoto, Y.; Negoro, T.; + high rylated ERK1/2 (pERK1/2) protein in hydrogen peroxide (H2O2)-treated CD4 CD25 cells in Tada, R.; Narushima, M.; Hoshi, A.; adults with asthma compared with those without asthma.
    [Show full text]
  • Oxidative Protein Biogenesis and Redox Regulation in the Mitochondrial Intermembrane Space
    Cell Tissue Res (2017) 367:43–57 DOI 10.1007/s00441-016-2488-5 REVIEW Oxidative protein biogenesis and redox regulation in the mitochondrial intermembrane space Phanee Manganas1 & Lisa MacPherson1 & Kostas Tokatlidis1 Received: 2 June 2016 /Accepted: 5 August 2016 /Published online: 8 September 2016 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract Mitochondria are organelles that play a central role membrane (IM). The presence of these two membranes allows in cellular metabolism, as they are responsible for processes the formation of two aqueous subcompartments within the such as iron/sulfur cluster biogenesis, respiration and apopto- mitochondria, which are the intermembrane space (IMS) and sis. Here, we describe briefly the various protein import path- the matrix. Each one of these compartments is characterised ways for sorting of mitochondrial proteins into the different by a specific set of proteins that carry out specialised func- subcompartments, with an emphasis on the targeting to the tions. The majority of these proteins are encoded in the nucle- intermembrane space. The discovery of a dedicated redox- ar genome and synthesised in the cytosol, making it necessary controlled pathway in the intermembrane space that links pro- for the mitochondria to possess mechanisms through which to tein import to oxidative protein folding raises important ques- import all the proteins required for the correct function of the tions on the redox regulation of this process. We discuss the organelle (Neupert 1997). During the import process, the in- salient features of redox regulation in the intermembrane coming proteins are targeted to their correct location within space and how such mechanisms may be linked to the more the organelle by utilising a series of different import pathways.
    [Show full text]
  • PRDX4 (Human) ELISA Kit 1
    PRDX4 (Human) ELISA Kit 1. The Association of Peroxiredoxin 4 with the Initiation and Progression of Hepatocellular Carcinoma. Guo X, Catalog Number: KA2121 Noguchi H, Ishii N, Homma T, Hamada T, Hiraki T, Zhang J, Matsuo K, Yokoyama S, Ishibashi H, Regulatory Status: For research use only (RUO) Fukushige T, Kanekura T, Fujii J, Uramoto H, Tanimoto A, Yamada S. Antioxid Redox Signal. 2018 Apr 24. Product Description: PRDX4 (Human) ELISA Kit is a [Epub ahead of print] sandwich enzyme immunoassay for the quantitative 2. Galectin-3 downregulates antioxidant peroxiredoxin-4 measurement of human PRDX4. in human cardiac fibroblasts: a new pathway to induce cardiac damage? Ibarrola J, Arrieta V, Sadaba R, Suitable Sample: Buffered solution Martinez-Martinez E, Garcia-Pena A, Alvarez V, Fernandez-Celis A, Gainza A, Santamaria E, Sample Volume: 100 uL Fernandez-Irigoyen J, Cachofeiro V, Zalba G, Fay R, Label: HRP-conjugated Rossignol P, Lopez-Andres N. Clin Sci (Lond). 2018 Apr 19. pii: CS20171389. [Epub ahead of print] Detection Method: Colorimetric 3. Overexpression of Peroxiredoxin 4 Affects Intestinal Function in a Dietary Mouse Model of Nonalcoholic Fatty Calibration Range: 78.13 to 5000 pg/mL Liver Disease. Nawata A, Noguchi H, Mazaki Y, Kurahashi T, Izumi H, Wang KY, Guo X, Uramoto H, Limit of Detection: 6.77 pg/mL Kohno K, Taniguchi H, Tanaka Y, Fujii J, Sasaguri Y, Tanimoto A, Nakayama T, Yamada S. PLoS One. 2016 Reactivity: Human Apr 1;11(4):e0152549. Applications: Quant (See our web site product page for detailed applications information) Protocols: See our web site at http://www.abnova.com/support/protocols.asp or product page for detailed protocols Storage Instruction: Store the kit at 4°C.
    [Show full text]
  • Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells
    Allergy Asthma Immunol Res. 2020 May;12(3):523-536 https://doi.org/10.4168/aair.2020.12.3.523 pISSN 2092-7355·eISSN 2092-7363 Original Article Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells Hyun Jae Shim ,1 So-Young Park ,2 Hyouk-Soo Kwon ,1 Woo-Jung Song ,1 Tae-Bum Kim ,1 Keun-Ai Moon ,1 Jun-Pyo Choi ,1 Sin-Jeong Kim ,1 You Sook Cho 1* 1Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea 2Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Konkuk University Medical Center, Seoul, Korea Received: Jul 8, 2019 ABSTRACT Revised: Nov 29, 2019 Accepted: Dec 23, 2019 Purpose: Reduction-oxidation reaction homeostasis is vital for regulating inflammatory Correspondence to conditions and its dysregulation may affect the pathogenesis of chronic airway inflammatory You Sook Cho, MD, PhD diseases such as asthma. Peroxiredoxin-6, an important intracellular anti-oxidant molecule, Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan is reported to be highly expressed in the airways and lungs. The aim of this study was to Medical Center, University of Ulsan College of analyze the expression pattern of peroxiredoxin-6 in the peripheral blood mononuclear cells Medicine, 88 Olympic-ro 43-gil, Songpa-gu, (PBMCs) of asthmatic patients and in bronchial epithelial cells (BECs). Seoul 05505, Korea. Methods: The expression levels and modifications of peroxiredoxin-6 were evaluated in Tel: +82-2-3010-3285 PBMCs from 22 asthmatic patients.
    [Show full text]
  • Lncrna-MEG3 Functions As Ferroptotic Promoter to Mediate OGD Combined High Glucose-Induced Death of Rat Brain Microvascular Endothelial Cells Via the P53-GPX4 Axis
    LncRNA-MEG3 functions as ferroptotic promoter to mediate OGD combined high glucose-induced death of rat brain microvascular endothelial cells via the p53-GPX4 axis Cheng Chen Xiangya Hospital Central South University Yan Huang Xiangya Hospital Central South University Pingping Xia Xiangya Hospital Central South University Fan Zhang Xiangya Hospital Central South University Longyan Li Xiangya Hospital Central South University E Wang Xiangya Hospital Central South University Qulian Guo Xiangya Hospital Central South University Zhi Ye ( [email protected] ) Xiangya Hospital Central South University https://orcid.org/0000-0002-7678-0926 Research article Keywords: lncRNA-MEG3, p53, ferroptosis, ischemia, GPX4, OGD, hyperglycemia, Posted Date: May 18th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-28622/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Background Individuals with diabetes are exposed to a higher risk of perioperative stroke than non- diabetics mainly due to persistent hyperglycemia. lncRNA-MEG3 (long non-coding RNA maternally expressed gene 3) has been considered as an important mediator in regulating ischemic stroke. However, the functional and regulatory roles of lncRNA-MEG3 in diabetic brain ischemic injury remain unclear. Results In this study, RBMVECs (the rat brain microvascular endothelial cells) were exposed to 6 h of OGD (oxygen and glucose deprivation), and subsequent reperfusion via incubating cells with glucose of various high concentrations for 24 h to imitate in vitro diabetic brain ischemic injury. It was shown that the marker events of ferroptosis and increased lncRNA-MEG3 expression occurred after the injury induced by OGD combined with hyperglycemic treatment.
    [Show full text]
  • 1L1 an Outsider S Take on Autism Spectrum Disorders
    Plenary Lecture 特別講演 1L1 An outsider’s take on autism spectrum disorders ○Martin Raff MRC LMCB, University College London Autism spectrum disorders（ASDs）are among the commonest neuropsychiatric disorders. Although, until re- cently, ASDs were one of the least understood of these disorders, they are now one of the best understood. Pro- gress has come largely through recent advances in human genetics that have identified rare large!effect muta- tions that cause or greatly increase the risk of these disorders, together with studies of genetic mouse models based on these mutations. Remarkably, in a number of mouse models caused by single mutations, correction of the problem in the adult brain（with either drugs or genetic manipulations）largely reverses many of the behav- ioral and neurobiological abnormalities, providing hope for the development of therapies for individuals with ASDs. In my talk, I will review the basic features of ASDs, using home videos of the development of my 13!year! old autistic grandson as an example, and I will discuss some of the recent advances in ASD research, consider current puzzles, and speculate on possible ways forward. Plenary Lecture 特別講演 2L1 A role of drebrin A in the activity!dependent trafficking of NMDA receptors to the plasma membrane ○Chiye Aoki1，Sho Fujisawa1，Kei Tateyama1，Yi!Wen Chen1，Tomoaki Shirao2 1Center for Neural Science, New York University 2Dept of Neurobiology and Behavior, Gunma Univ Graduate School of Medicine NMDA receptors（NMDARs）are central molecular agents that enable the activity!dependent modification of synaptic strengths at excitatory synapses. However, relatively little is known about the molecular mechanisms regulating NMDAR levels at each synapse.
    [Show full text]
  • Overview on Peroxiredoxin
    Mol. Cells 2016; 39(1): 1-5 http://dx.doi.org/10.14348/molcells.2016.2368 Molecules and Cells http://molcells.org Overview Established in 1990 Overview on Peroxiredoxin Sue Goo Rhee* Peroxiredoxins (Prxs) are a very large and highly con- 2-Cys Prxs Tsa1 and Tsa2, two atypical 2-Cys Prxs Ahp1 and served family of peroxidases that reduce peroxides, with a nTpx (where n stands for nucleus), and one 1-Cys mTpx conserved cysteine residue, designated the “peroxidatic” (where m stands for mitochondria) [see the review by by Tole- Cys (CP) serving as the site of oxidation by peroxides (Hall dano and Huang (2016)]. et al., 2011; Rhee et al., 2012). Peroxides oxidize the CP-SH to cysteine sulfenic acid (CP–SOH), which then reacts with CLASSIFICATION another cysteine residue, named the “resolving” Cys (CR) to form a disulfide that is subsequently reduced by an The CP residue is conserved in all Prx enzymes. On the basis appropriate electron donor to complete a catalytic cycle. of the location or absence of the CR, Prxs are classified into 2- This overview summarizes the status of studies on Prxs Cys, atypical 2-Cys, and 1-Cys Prx subfamilies (Chae et al., and relates the following 10 minireviews. 1994b; Rhee et al., 2001; Wood et al., 2003b). 2-Cys Prx en- 1 zymes are homodimeric and contain two conserved (CP and CR) cysteine residues per subunit. The CP–SOH reacts with the NOMENCLATURE CR–SH of the other subunit to form an intersubunit disulfide. In atypical 2-Cys PrxV, the CP–SOH reacts with the CR–SH of the As in all biology, acronyms are overwhelming in Prx literature.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • The Prognostic Values of the Peroxiredoxins Family in Ovarian Cancer
    Bioscience Reports (2018) 38 BSR20180667 https://doi.org/10.1042/BSR20180667 Research Article The prognostic values of the peroxiredoxins family in ovarian cancer Saisai Li, Xiaoli Hu, Miaomiao Ye and Xueqiong Zhu Department of Obstetrics and Gynecology, the Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325027, Zhejiang, China Correspondence: Xueqiong Zhu ([email protected]) Purpose: Peroxiredoxins (PRDXs) are a family of antioxidant enzymes with six identified mammalian isoforms (PRDX1–6). PRDX expression is up-regulated in various types of solid tumors; however, individual PRDX expression, and its impact on prognostic value in ovarian cancer patients, remains unclear. Methods: PRDXs family protein expression profiles in normal ovarian tissues and ovarian cancer tissues were examined using the Human Protein Atlas database. Then, the prog- nostic roles of PRDX family members in several sets of clinical data (histology, pathological grades, clinical stages, and applied chemotherapy) in ovarian cancer patients were investi- gated using the Kaplan–Meier plotter. Results: PRDXs family protein expression in ovarian cancer tissues was elevated com- pared with normal ovarian tissues. Meanwhile, elevated expression of PRDX3, PRDX5, and PRDX6 mRNAs showed poorer overall survival (OS); PRDX5 and PRDX6 also predicted poor progression-free survival (PFS) for ovarian cancer patients. Furthermore, PRDX3 played sig- nificant prognostic roles, particularly in poor differentiation and late-stage serous ovarian cancer patients. Additionally, PRDX5 predicted a lower PFS in all ovarian cancer patients treated with Platin, Taxol, and Taxol+Platin chemotherapy. PRDX3 and PRDX6 also showed poor PFS in patients treated with Platin chemotherapy. Furthermore, PRDX3 and PRDX5 indicated lower OS in patients treated with these three chemotherapeutic agents.
    [Show full text]