An Assessment of Organ and Intestinal Histomorphology and Cellular Stress Response in Atlantic Salmon (Salmo Salar L.) Fed Genetically Modiﬁed Roundup Ready® Soy

Aquaculture 298 (2009) 101–110

Contents lists available at ScienceDirect

Aquaculture

journal homepage: www.elsevier.com/locate/aqua-online

An assessment of organ and intestinal histomorphology and cellular stress response in Atlantic salmon (Salmo salar L.) fed genetically modiﬁed Roundup Ready® soy

N.H. Sissener a,⁎, A.M. Bakke b,c,J.Gub, M.H. Penn b,c, E. Eie a,d, Å. Krogdahl b,c, M. Sanden a, G.I. Hemre a a National Institute of Seafood and Nutrition Research (NIFES), Bergen, Norway b Norwegian School of Veterinary Science, Oslo, Norway c Aquaculture Protein Centre, a CoE, Norway d Skretting ARC, Stavanger, Norway article info abstract

Article history: This study was conducted to investigate potential differences between genetically modified (GM) Roundup Received 14 August 2009 Ready® soy and its near-isogenic maternal line as feed ingredients for Atlantic salmon, with focus on Received in revised form 7 October 2009 intestinal changes commonly caused by soybean meal, histomorphology of other organs and stress response. Accepted 12 October 2009 A 7-month feeding trial was conducted with an inclusion level of 25% GM soy in the diet. Samples for histology were collected after 4 months, after 6 months, when a cross-over of the diet groups was conducted, Keywords: and at the end of the trial of the crossed-over groups. Histomorphology of spleen, head kidney and mid Atlantic salmon Genetic modification intestine exhibited no differences between the diet groups, while glycogen deposits in liver were decreased Roundup Ready® soy in the GM fed fish at the final sampling. Common soybean meal-induced changes of the distal intestine in Stress Atlantic salmon were observed in both diet groups at all sampling points, within levels expected at the Intestine current inclusion level of soy in the diets. However, mucosal fold height in the distal intestine was lower in the GM fed group at one of the three sampling points, and mucosal fold fusion was more pronounced in this group overall in the trial. A stress test conducted at the end of the trial gave responses in haematological parameters, plasma nutrients and mRNA transcription of heat shock protein (HSP) 27 in both liver and distal intestine, but responses were similar between the two diet groups, indicating similar ability to handle stress. The cross-over design, implemented to look at reversibility of potential GM-effects, proved to be inadequate as the crossing of diet groups in itself caused responses that would obscure possible minor diet effects. In conclusion, minor differences were observed between the diet groups; however, GM soy did not appear to cause any adverse effects on organ morphology or stress response compared to non-GM soy. © 2009 Elsevier B.V. All rights reserved.

1. Introduction resulting in unintended changes in levels of macro- or micronutrients, anti-nutritional factors (ANFs) or production of toxic compounds The potential occurrence of unintended effects of genetic modi- (Cellini et al., 2004). The regulatory process is designed to look for fication is one of the issues to be addressed in safety assessment of these types of changes in GM plants, but this is a targeted approach genetically modified (GM) plants used as feed and food (Kuiper and that will never cover all known and unknown compounds in the plant. Kleter, 2003). Transgene insertion is an imprecise and poorly At present, the EU has approved about 30 GM plant products for use in understood event, and introduction of superfluous DNA, as well as foods and feeds (http://ec.europa.eu/food/dyna/gm_register/ deletions and rearrangements of host DNA at the insertion site, are index_en.cfm). However, knowledge regarding possible health effects common occurrences (Somers and Makarevitch, 2004; Latham et al., in animals and man is still sparse (Pryme and Lembcke, 2003; 2006). This might disrupt transcription of endogenous genes, Domingo, 2007). Most studies conducted with GM plants have been relatively short term and focused on production parameters such as growth, milk production or meat yield, rather than investigating early biomarkers for physiology, health and reproduction parameters. Abbreviations: ALAT, alalanine aminotransferase; ASAT, aspartate aminotransferase; ANF, anti-nutritional factor; Ct, threshold cycle; FFSBM, fullfat soybean meal; GM, Discussions regarding the necessity of evaluating products apparently genetically modified; Hct, haematocrit; Hb, haemoglobin; HSP, heat shock protein; LDH, similar to traditional counterparts (EFSA, 2008), and lack of lactate dehydrogenase; MCH, mean cell haemoglobin; MCHC, mean cell haemoglobin standardized methods for the evaluation of unintended effects concentration; MCV, mean cell volume; MF, mitotic figures; MFH, mucosal fold height; (Kuiper and Kleter, 2003), might be reasons for limited research MMC, melanomacrophage centre; PCR, polymerase chain reaction; RBC, red blood cell; activity in this area. RRS®, Roundup Ready® soy; SBM, soybean meal; TAG, triacylglycerol. ⁎ Corresponding author. NIFES, Postboks 2029 Nordnes 5817 Bergen, Norway. Processed soybeans are the largest source of protein feed and the Tel.: +47 41462385; fax: +47 55905290. second largest source of vegetable oil in the world. Of the global

0044-8486/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2009.10.011 102 N.H. Sissener et al. / Aquaculture 298 (2009) 101–110 acreage planted with soybeans, 64% is now GM (James, 2007). The completes the evaluation of a 7-month feeding trial, where assess- dominating GM variety is Roundup Ready® soy (RRS®), which is ments of growth, body composition, organ sizes, haematology, plasma modified to be tolerant to the herbicide glyphosate (Padgette et al., chemistry, lysozyme levels and performance through the parr-smolt 1995). Soy is commonly used in feed for Atlantic salmon at low levels transformation (Sissener et al., 2009) and liver proteome analysis and has, as a plant protein, a well balanced amino acid profile (Sissener et al., in press), have been conducted to compare RRS® GM compared to the requirements of fish (Gatlin et al., 2007). However, soy and its near-isogenic line as diet ingredients for Atlantic salmon. the levels of standard qualities used in diets for Atlantic salmon are limited due to immunological responses in the intestine which seem 2. Materials and methods to be dose and time dependent (Uran, 2008). Effects of soybean meal (SBM) on the distal intestine of salmon 2.1. Experimental design and sampling include inflammatory responses (enteritis), which seem to be caused by one or several alcohol-soluble ANFs, such as saponins, phytosterols, The 7-month feeding trial was conducted at the Institute of Marine oligosaccharides and/or other unidentified components (Van den Research (Matredal, Norway), and was approved by the National Ingh et al., 1991; Baeverfjord and Krogdahl, 1996; Van den Ingh et al., Animal Research Authority in Norway. Atlantic salmon with an initial 1996). Further, there are decreases in both in total weight and average weight of 39.7 g (SD 4.4) were fed two different diets, with mucosal fold height, while lamina propria is widened and infiltrated four replicate tanks of 120 fish for each diet group. Roundup Ready® by a mixed population of leukocyte cells (Van den Ingh et al., 1991; soy was used in one diet (GM) and its near-isogenic, non-modified Baeverfjord and Krogdahl, 1996; Nordrum et al., 2000). As salmon are maternal line in the other (nGM). Both lines of soybeans were so sensitive to soy inclusion in the diet, even compared to other fish supplied by the Monsanto Company, St. Louis, MO, USA. The diets species (Evans et al., 2005), unintended alterations in GM varieties were compositionally similar in major nutrients (Table 1), and in both could have implications for the suitability of GM soy as a feed diets full fat soybean meal (FFSBM) provided 21% of the total protein. ingredient for this species. Further information on feed analysis, growth data, light regime and In addition to the gastrointestinal tract, which is the first site of other details regarding fish husbandry is given elsewhere (Sissener exposure to diet ingredients, the liver is a target organ in dietary studies. et al., 2009). The feeding trial was initiated the 11th of August, and for The liver is a key metabolic organ and has an important role in response the work presented in this paper samples were collected 13th of to toxicants and immune response (Morin et al., 1993; Benninghoff and December (sampling 1), 2nd of February (sampling 2) and 28th of Williams, 2008; Tintos et al., 2008). Histomorphological changes have February (sampling 3). The fish were transferred from freshwater to been observed in hepatocytes of mice fed GM soy, involving nuclear seawater the day after sampling 1, as they were going through the modifications that were shown to be reversible when mice were parr-smolt transformation, which is a natural part of the salmon life switched to a non-GM soy diet (Malatesta et al., 2002, 2005). Nuclear cycle. Histological evaluation of the mid and distal intestine, spleen, modifications of hepatocytes have also been observed in sheep fed Bt- head kidney and liver before seawater transfer (sampling 1) are maize (Trabalza-Marinucci et al., 2008). Furthermore, histological evaluations of other organs have been used to assess effects of GM Table 1 ingredients in diets for mice and rats (Malatesta et al., 2003; Vecchio Full fat soybean meal (FFSBM) composition, formulation and proximate composition of et al., 2004; Séralini et al., 2007). However, some of these studies have the diets. met criticism, and there are other feeding trials in which no differences nGM GM between animals fed conventional or GM ingredients have been detected (Flachowsky et al., 2007). FFSBM composition Protein (%) 36.7 38.5 Inadequate nutrition or harmful substances might only have an Lipids (%) 22.6 20.4 fi effect when conditions are suboptimal, as the sh will then struggle to Starch (%) 1.8 1.6 maintain homeostasis. Thus, it might be interesting to compare stress Ash (%) 4.8 5.1 response in fish fed non-GM and GM soy. The physiological stress Dry matter (%) 92.6 92.9 1 response entails increases in stress hormones followed by activation Residue (%) 26.7 27.3 of metabolic pathways, such as mobilization of energy reserves to Formulation g kg − 1(2) maintain or attempt to re-establish homeostasis, and physiological Fishmeal 510 510 responses such as alterations in blood chemistry and haematology nGM soy 262 (Barton and Iwama, 1991). On a cellular level, heat shock proteins GM soy 250 Fish oil 150 150 (HSPs) have been proposed as an indicator of stressed states in fish Soy oil 8 (Iwama et al., 2004). Heat shock proteins are a highly conserved group Wheat 75 79 of proteins found in a wide range of organisms from bacteria to Vitamin/mineral mix 3 3 humans (Morimoto et al., 1990, 1992; Welch, 1993; Feder and Hofmann, 1999), including fish (reviewed in Iwarma et al., 1998; Basu Feed composition Dry matter (%) 94.0 93.8 et al., 2002). With the exception of those of low molecular weight, Total protein (%) 46.1 45.8 such as HSP27, these proteins have constitutive functions in the Lipids (%) 24.2 24.6 unstressed cell (Morimoto et al., 1990; Hendrick and Hartl, 1993; Ash (%) 9.8 9.9 Welch, 1993; Fink and Goto, 1998). However, various heat shock Starch (%) 6.1 6.2 Residue (%)1 7.9 7.3 proteins are up-regulated in response to a wide variety of stressors, as Vitamin B6 (mg/kg) 14.7 14.8 they have a role in repair and degradation of misfolded or denatured Gross energy (kJ/g)3 21.5 21.6 proteins (Welch, 1993; Freeman et al., 1999; Rabergh et al., 2000). 1Residue was calculated as dry matter-(protein +lipid+starch+ash). 2The fishmeal Increased levels of HSP70 have been observed in salmon fed soy as a used was Norse-LT 94 Nordic fishmeal, made from 65% blue whiting, 30% sprat and 5% replacement for fishmeal (Bakke-McKellep et al., 2007; Sagstad et al., cuttoffs (fish industry byproducts) (Fiskernes Fiskeindustri, Denmark). Whole 2008). soybeans (RRS® and non-GM near-isogenic maternal line) were kindly supplied by The aim of the current study was to assess whether GM RRS® soy Monsanto and ground to FFSBM by Skretting ARC. Wheat was bought from Dansk Landbrugs Grovvareselskap and the Vitamin/mineral mix from Trouw Nutrition (the affects organ histomorphology and cellular stress response in Atlantic Netherlands). 3Gross energy was calculated according to (Tacon, 1987) using the salmon differently than near-isogenic non-GM soy, focusing on energy content of 39.5 kJg− 1 for lipid, 23.6 for protein and 17.2 for starch. The results commonly observed SBM-induced effects in salmon. This work are presented as the average of two analytical parallels. N.H. Sissener et al. / Aquaculture 298 (2009) 101–110 103 reported herein, but all other results reported in this paper, including (enterocytes) of the intestinal epithelium; (3) cellular infiltration of a further histological evaluation, were from samples taken during the mixed leucocyte population in the central lamina propria within the seawater phase. intestinal folds as well as in the submucosa. A graded examination A cross-over of the diet groups was implemented after the second scheme was used for these various characteristics: 5=normal; sampling, with the intent to investigate the reversibility of potential morphological changes from weak to severe were scored from 4 to 1. diet effects. Twenty fish from each tank were anaesthetised (Benzoak® VET, 0.15 ml/L, ACD Pharmaceuticals, Leknes, Norway), 2.3. Haematology, plasma enzymes and nutrients marked by fin-clipping of the adipose fin to distinguish them from the other fish, and moved to a tank containing the opposite diet group, so Blood was drawn from the caudal vein (Vena caudalis)bymeans that cross-over fish and fish kept on the original diet groups were kept of a heparinized medical syringe. Blood samples were divided so that in the same tanks. The four fish groups—fish fed the GM diet through- about 200 μl were kept as individual samples for haematology, while out the trial (GM), fish fed the non-GM diet throughout the trial the remainder was centrifuged at 3000×g for 10 min to obtain the (nGM), fish switched from the GM to the non-GM diet (GM-nGM) and plasma fraction, which was pooled for each tank, flash frozen in fish switched from the non-GM to the GM diet (nGM-GM)—were liquid nitrogen and stored at −80 °C. Hematocrit (Hct) was fed the respective diets for three weeks before the third and final immediately measured using Vitex Pari micro-haematocrit tubes sampling. on a Hettich centrifuge (type 201424, GMI Inc, MI, USA) at Furthermore, a “stress test” was conducted at the final sampling, 13,000 rpm for 5 min. Red blood cells (RBC) and haemoglobin (Hb) but only on fish that had been fed the same diets throughout the trial were measured on a Cell-Dyn 400 (Sequoia-Turner) according to the (the nGM and GM groups). For this purpose, three replicate tanks per manufacturer's instructions, using Para 12 control blood (Streck, diet were used, due to limitations in the number of fish available. To Omaha, NE, USA) for calibration. The indices mean cell volume stress the fish, the water level was greatly reduced in the tanks, and (MCV), mean cell haemoglobin (MCH) and mean cell haemoglobin the 12–13 fish in each tank were exposed to handling when they were concentration (MCHC) were calculated according to Sandnes et al. netted out and left in a 10-L bucket. Further stress was presumably (1988). Plasma samples were analysed for the enzymes lactate inflicted by crowding. The fish were subjected to this treatment for dehydrogenase (LDH), alanine aminotransferase (ALAT), and aspar- 5 min before they were transferred back into the tank and the water tate aminotransferase (ASAT) and for the nutrients glucose, total level was restored. protein and triacylglycerol (TAG). These analyses were performed on All sampled fish were immobilized by a blow to the head, Maxmat Biomedical Analyser (SM1167, Maxmat S.A., France), using measured (fork length) and weighed. Samples for histological Maxmat reagents and the appropriate calibrators and controls for the evaluation were collected from two fish per tank at all three sampling different methods. points. At the sampling following the cross-over, only fish that had been exposed to a change in diet—nGM to GM and GM to nGM—were sampled for histology. Tissue pieces approximately 0.5×0.5 cm from 2.4. mRNA transcription the mid and distal intestine, spleen, head kidney and liver were placed in 4% buffered formaldehyde solution. At the final sampling, six Total RNA was purified from frozen liver and distal intestine using randomly selected fish per tank (all four groups) were sampled for the EZ1 RNA Universal Tissue Kit on the BioRobot® EZ1 (Qiagen, Hilden, blood, and liver, spleen, head kidney and the different regions of the Germany), including the optional DNase treatment step in the protocol. intestine which were weighed for the calculation of organ indices. Homogenisation in QIAzol lysis reagent from the kit was performed on Prior to weighing, the intestinal tract was cleaned of visceral fat and the bead grinder homogeniser Precellys 24 (Bertin technologies, luminal content, and then divided into proximal (the part of the Montigny-le-Bretonneux, France) for 3×10 s at 6000 rpm for the liver intestine from which the pyloric caeca originate), mid and distal samples and 2×30 s at 6500 rpm for the intestinal samples. RNA intestine. This also served as the “before stress”-sampling point. quantity and quality were assessed with Nanodrop® ND-1000 UV–Vis Before, 3 and 22 h following the stress test, blood samples and tissue spectrophotometer (NanoDrop Technologies, Wilmington, USA) and from liver and distal intestine for mRNA analysis were collected from the Agilent 2100 Bioanalyzer with the RNA 6000 Nano LabChip® kit five fish per tank. The tissues were quickly dissected out, flash frozen (both Agilent Technologies, Pao Alto, USA). All analysed samples had in liquid nitrogen, and stored at −80 °C until analysis. RIN (RNA integrity) values N8, with the majority being N9. Primers and The fish were not fasted before the samplings as this reduces TaqMan probes for the selected reference genes have been used in potential SBM-induced inflammation reactions in the intestine recent studies; EF1α (elongation factor 1-alpha)(Moore et al., 2005), (Baeverfjord and Krogdahl, 1996), as well as change other anatomical beta-actin (Olsvik et al., 2005)andARP (acidic ribosomal phosphoprotein) and physiological parameters (Krogdahl and Bakke-McKellep, 2005). (Hevrøy et al., 2007). The primers and probe for HSP70 were used by Fish were not fed after the stress test, as it was assumed that they Sagstad et al. (2008), while those for HSP27 were designed by Pål Olsvik would not eat. (unpublished). Sequences of the primers (Invitrogen) and probes (Applied Biosystems, Foster City, USA) are given in Table 2. 2.2. Histology Constant amounts of 250 ng RNA were reversely transcribed to cDNA on a GeneAmp® PCR 9700 machine, using the TaqMan® Reverse Tissue samples for histological evaluation were fixed in 4% Transcriptase kit with oligo(dT) primers (all from Applied Biosys- buffered formalin for 24 h and subsequently stored in 70% ethanol tems) in 50μL reactions. Each sample was run in duplicate, and a total at 4 °C until further processing and embedding. The tissues were of three 96-well plates were used per organ. The plates also contained subsequently dehydrated according to standard histological techni- a five point dilution curve in triplicate, non-template and non- ques in a graded ethanol series, ending with absolute ethanol. amplification controls, as well as three samples for inter-plate Sections of 5 μm were cut and stained with haematoxylin and eosin calibration. For real-time PCR, SYBR® Green I Mastermix (Roche (H and E) before blinded examination under a light microscope. Organ Applied Science, Indianapolis, USA), primers, probe and cDNA were morphology was evaluated according to Amin et al. (1992). Distal mixed in 96-well plates manually for all the liver samples and with a intestinal morphology was scored according to the criteria previously Biomek®3000 Laboratory automation workstation (Beckman Coulter, described in Atlantic salmon with SBM-induced enteritis (Baeverfjord Fullerton, USA) for the intestinal samples. Thermal cycling was and Krogdahl, 1996): (1) widening and shortening of the intestinal performed on a LightCycler® 480 System (Roche) for 40cycles of folds; (2) loss of the supranuclear vacuolization in the absorptive cells 10 s denaturation at 95 °C and 30 s annealing at 60 °C. 104 N.H. Sissener et al. / Aquaculture 298 (2009) 101–110

Table 2 Primer and probe sequences and the GenBank accession number from which they were designed.

Gene Forward primer Reverse primer Probe Acc.no.

β-actin CCAAAGCCAACAGGGAGAAG AGGGACAACACTGCCTGGAT TGACCCAGATCATGTTT BG933897 Ef1α CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA ATCGGTGGTATTGGAAC AF321836 ARP GAAAATCATCCAATTGCTGGATG CTTCCCACGCAAGGACAGA CTATCCCAAATGTTTCATTGTCGGCGC AY255630 HSP27 CCAGCTGCCTGAGGATGTG CCTCGGTGCCCAATGATG ACCCCACCTCTGTGACA CV428908 HSP70 CCCCTGTCCCTGGGTATTG CACCAGGCTGGTTGTCTGAGT CGCTGGAGGTGTCATG BG933934

Elongation factor 1α, Ef1α; acidic ribosomal phosphoprotein, ARP; heat shock protein, HSP.

Cycle threshold (Ct)-values were calculated using the second 2.6. Calculations maximum derivative method in the Lightcycler® software. Ampliﬁca- tion efﬁciency was determined using 2-fold dilution curves with the Mean cell volume : MCV = ðHct = rbcÞ⁎10 formula E=10^(−1/slope), with the slope of the linear curve of Ct- values plotted against the log-dilution (Higuchi et al., 1993). The Mean cell haemoglobin : MCH = ðHb = rbcÞ⁎10 stability of the reference genes was evaluated using geNorm VBA applet (Vandesompele et al., 2002) and NormFinder (Andersen et al., 2004). Mean cell haemoglobin concentration : MCHC = ðHb = HctÞ⁎100

2.5. Statistics 3. Results Statistical analyses were performed using Statistica™ 8.0 software (Statsoft, Inc. Tulsa, USA). Data fulfilling the assumptions of No morphological changes were observed in mid intestine or head homogeneity of variance and normal distribution (tested by Levene's kidney of fish fed any of the diets at any of the sampling times. In the and Kolmogorov Smirnov tests respectively) were subjected to distal intestine, moderate to pronounced soybean meal-induced parametrical statistics. Nested (hierarchical) ANOVA was used for changes were observed in all fish (Tables 3 and 4). Changes were not parameters measured on individual fish (nested within their restricted to a single diet group or sampling point, although the degree respective tanks), with tank as random effect and diet as fixed effect. did differ somewhat (see below). The changes included shortening of Tank-to-tank variation was used as the error term as individual fish heights of both simple and complex mucosal folds, fusing of mucosal from the same tank were considered pseudoreplicates, and error folds, widening of lamina propria and submucosa with infiltration of degrees of freedom were computed using the Satterthwaite method. inflammatory cells, increased number of apoptotic bodies and mitotic Conventional ANOVA was used for measurements on pooled plasma figures, decreased degree of enterocyte vacuolization, shift of enterocyte samples from each tank, and also for the histology scores. For the nuclei from basal to a more apical position, as well as large cyst-like latter, ANOVA was carried out on individual values within sampling structures within or between enterocytes at the apical part of the times, as well as collectively across the three samplings (two-way intestinal folds (Fig. 1). These cyst-like structures stained positively for ANOVA) with sampling time and diet as the two factors. Individual cellulose/chitin and were assumed to be microsporidia. values rather than tank means were used as Baeverfjord and Krogdahl At the sampling before seawater transfer (sampling 1 [Dec 13th] in (1996) determined that histological characteristics of SBM-induced Table 3), there were no significant differences between the diet enteritis did not vary between tanks in feeding salmon. The critical groups in morphological changes in the distal intestine. At the level for significance was set at 0.05. However, all p-values below 0.10 sampling before cross-over (sampling 2 [Feb 2nd] in Table 3), mucosal are given in the tables. fold heights in the distal intestine of fish fed the GM diet were A permutation test was used on the mRNA transcription data using significantly shorter than in those fed the non-GM diet (P=0.02). REST©2008 (Relative expression software tool) with 5000 randomi- After diet cross-over (sampling 3 [Feb 28th] in Table 3), the degree of zations. Efficiency correction and normalization to the reference mucosal fold fusion (Fig. 2)infish fed the GM diet was more genes were done within the REST software, with the average Ct-value pronounced than in fish fed the non-GM diet (P=0.031). Considering for each sample as the input variable. all sampling time points together (Table 4), the degree of mucosal fold

Table 3 Mean scores for the morphological changes of distal intestine and liver of Atlantic salmon fed nGM diet or GM diet at each sampling point.

Sampling Diet (DI) MFH (DI) MFF (DI) LW (DI) LPC (DI) SmC (DI) SmW (DI) EV (DI) ENP (DI) MF (DI) AB (LI) DG

1 (Dec 13th) nGM 2.6 4.3 3.7 4.1 2.8 4.8 1.1 3.4 4.8 4.4 2.5 GM 2.7 4.0 4.0 3.8 2.8 4.8 1.0 3.3 4.9 4.3 1.8 Pooled SE 0.14 0.18 0.13 0.19 0.19 0.09 0.04 0.15 0.15 0.19 0.29 P value 0.764 0.230 0.118 0.274 1.000 1.000 0.334 0.577 0.554 0.642 0.090 2 (Feb 2nd) nGM 3.7 a 3.8 3.9 3.2 2.6 4.1 1.2 3.1 3.4 3.1 2.0 GM 2.9 b 3.4 3.9 3.4 2.4 3.9 1.5 3.1 3.9 3.7 2.3 Pooled SE 0.22 0.34 0.11 0.32 0.24 0.21 0.20 0.12 0.36 0.42 0.35 P value 0.020 0.523 1.000 0.585 0.467 0.544 0.287 0.717 0.346 0.310 0.619 3 (Feb 28th) GM to nGM 4.1 4.3 a 3.3 3.6 2.9 3.3 1.8 3.1 4.6 4.3 3.0 a nGM to GM 3.9 3.1 b 3.3 3.3 2.8 3.3 1.5 3.1 4.9 4.3 1.8 b Pooled SE 0.20 0.37 0.15 0.26 0.33 0.24 0.31 0.22 0.16 0.09 0.37 P value 0.523 0.031 0.770 0.319 0.794 0.857 0.492 1.000 0.278 0.642 0.032

For the intestinal scores, lower scores indicate more severe changes (5=normal). Distal intestine, DI; Mucosal fold height, MFH; Mucosal fold fusion, MFF; Lamina width, LW; Lamina propria cellularity, LPC; Submucosa cellularity, SmC; Submucosa width, SmW; Enterocyte vacuolization, EV; enterocyte nucleus position, ENP; mitotic ﬁgure(frequency), MF; Apoptotic bodies(frequency), AB; Liver, LI; Deposit of glycogen, DG. a,bMean values within a column with unlike superscript letters were signiﬁcantly different (Pb0.05). N.H. Sissener et al. / Aquaculture 298 (2009) 101–110 105

Table 4 three sampling points were evaluated collectively, the deposits of Statistical analysis of data from the histological evaluation of distal intestine, liver and glycogen in hepatocytes in the GM diet group were lower than in the spleen in Atlantic salmon pooled according to sampling points (both diet groups non-GM diet group (P=0.047; Table 4), with no effect of time. together) and according to the GM and nGM diet groups (all sampling points together). Melanomacrophage (MM) is a characteristic immune cell type of Sampling Diet (DI) (DI) (DI) (DI) (LI) (SP) teleosts. MMs or melanomacrophage centers (MMCs) are prevalent in MFH MF AB MFF DG MMCs spleen, but also found in head kidney and liver. MMCs in spleen were 1 (Dec 13th) 2.7c 4.8a 4.3a 4.7a significantly more numerous and larger at the second sampling than b b b b 2 (Feb 2nd) 3.3 3.6 3.4 3.8 those at the first and final samplings (P=0.013), but no differences 3 (Feb 28th) 4.0a 4.8a 4.3a 4.5a Pooled SE 0.14 0.17 0.19 0.23 between diet groups were detected (Table 4, Fig. 3). Apart from the P value b0.0001 b0.0001 0.001 0.013 MMCs, no other morphological differences were observed in the nGM 4.1a 2.5a spleen. b b GM 3.5 1.9 When the organ indices, blood- and plasma parameters from after Pooled SE 0.18 0.20 the cross-over were analysed (all four groups), there were systematic P value 0.017 0.047 differences between fish that had been fin clipped and switched to the fi Distal intestine, DI; Mucosal fold height, MFH; Mitotic gure(frequency), MF; Apototic opposite diet group and fish that had not (Table 5). These differences bodies(frequency), AB; Melanomacrophage centers, MMCs ; Mucosal fold fusion, MFF; fi Liver, LI; Deposit of glycogen, DG; Spleen, SP; Melanomacrophage centre, MMC. were unrelated to GM content in the new diet and which diet the sh a,b,c Mean values within a column with unlike superscript letters were significantly had been fed previously, thus the remainder of this paragraph different (Pb0.05). describes differences not related to whether the soy in the diet was GM or not. Despite no differences in growth, the relative sizes (corrected for body weight) of head kidney and proximal- and mid- intestine were significantly lower in the fish that had been crossed- fusions in the distal intestine of fish fed the GM diet was significantly over to the opposite diet group, compared to those that had remained more pronounced than in fish fed the non-GM diet (P=0.017). in the same diet group throughout the trial. Furthermore, RBC Sampling time had a significant effect on mucosal fold heights in the numbers were significantly lower (P=0.01) in the crossed-over distal intestine, with heights increasing from the first to the third fish, while haemoglobin and MCHC (both P=0.09) also showed sampling. Moreover, more mitotic figures and apoptotic bodies were tendencies to be lower. MCV (P=0.009) and MCH (P=0.005) were observed in the distal intestine at the second sampling than after higher in the crossed-over fish. This indicates that the crossed-over cross-over or before seawater transfer (Pb0.0001 and P=0.001, fish had fewer but larger red blood cells, with higher total levels of respectively; Table 4), but there were no differences detected haemoglobin in each cell, thereby maintaining haematocrit. However, between the diet groups. In addition, the large cyst-like structures there was a lower haemoglobin concentration in these larger cells, within or between enterocytes at the apical part of the intestinal folds giving lower haemoglobin in the blood in total. Plasma glucose was (Fig. 1), were significantly more numerous at the first and second also higher in the cross-over fish (P=0.03), and there was a similar samplings than at the final sampling after cross-over, but there was no tendency in plasma protein concentration (P=0.10). There were no significant effect of diet. These cyst-like structures are assumed to be differences detected in the analysed plasma enzymes, but these had caused by a water-borne infection or vertical transmission of an high variability. unknown species of microsporidia. Likewise, haematological parameters from the stress test exhibited Apart from the degree of glycogen deposition within hepatocytes, no differences between the non-GM and GM fed groups, neither in no obvious structural changes were observed in liver. A significantly basal levels nor in the response to stress (Table 6). However, changes lower degree of glycogen deposition was observed in fish fed the GM (which were similar in both diet groups) were apparent when diet compared to those fed the non-GM diet at the final sampling comparing the data from before and the two time-points after the point (P=0.032; Table 3 and Fig. 4). Moreover, when data from the stress test. The number of red blood cells (P=0.03), Hct (Pb0.0001)

Fig. 1. Cyst-like structures in distal intestine (arrow heads), more prominent at the first and second sampling compared to the final sampling, but not different between the diet groups. Compared with normal globet cell (a), cyst-like structures filled with mucin-like material and the nucleus were pushing to the periphery place (b). G, goblet cell; N, nuclei. (H&E.×400). 106 N.H. Sissener et al. / Aquaculture 298 (2009) 101–110

Fig. 2. Morphological changes in distal intestine of Atlantic salmon. Mucosal fold height in fish fed with non-GM diet (a) was higher than those fed the GM diet (b) at the second sampling point. The degree of mucosal fold fusion (MFF) (arrow head) of fish fed the non-GM diet (c) was less severe than those fed the GM diet (d) at the final sampling point. (H&E.×100). and Hb (P=0.003) all decreased following stress, while MCV, MCH after, a total reduction of 60%. No effects of stress were detected on the and MCHC remained similar to the initial values. This indicates that analysed plasma enzymes. changes in Hct and Hb were due to the reduction in RBC numbers, as The mRNA transcription of HSP27 and HSP70 in liver and distal the size of the red blood cells as well as their haemoglobin content intestine did not differ between the two diet groups at any individual remained the same. For Hct and Hb, the status before stress was sampling point; this was also the case when all three time points were significantly different from the values both 3 and 22 h after, while considered together (Table 7). The transcription of HSP70 in both liver these two latter values were not significantly different from each and distal intestine remained stable at all three sampling points in other. RBC before stress was significantly different from 3 h after both diet groups, while the transcription of HSP27 exhibited similar stress, while 22 h after the value was intermediate and not changes after stress in both diet groups. Transcription of HSP27 was significantly different from either. Plasma TAG (P=0.0001) and up-regulated by a factor of 1.30 in the liver, whereas in the distal protein (P=0.002) were reduced after stress. The protein concentra- intestine transcription was down-regulated by a factor of 0.74. In both tion went down by 14% from before to 3 h after stress, and remained cases, the samples collected before stress were significantly different at a similar level 22 h after. The TAG concentration also decreased from those collected after 3 and 22h, while these two latter samplings from before to 3 h after stress, and was reduced even further at 22 h did not differ.

Fig. 3. Morphological changes in spleen of Atlantic salmon. The number and size of melanomacrophage centers (MMCs) in spleen at the second sampling point (b) were signiﬁcantly increased compared to the other two sampling points (a), but there were no differences between the diet groups. (H&E.×50). N.H. Sissener et al. / Aquaculture 298 (2009) 101–110 107

Fig. 4. Deposits of glycogen in hepatocytes were signiﬁcantly lower in Atlantic salmon fed the GM diet (b) compared to the non-GM diet (a) at the ﬁnal sampling and overall in the trial. However, structure of the salmon liver remained normal during whole experiment in both diet groups. (H&E.×100).

4. Discussion Differences in the degree of typical SBM-induced changes in the distal intestine as well as differences in glycogen deposition in the Feeding salmon with a high inclusion level (25%) of GM soy caused liver between the non-GM and the GM fed salmon could be caused by no apparent differences in growth, mortality or measured health differences in ANF concentrations in the two soy lines. These are parameters (haematology, plasma enzymes, lysozyme levels and known to vary extensively between different strains of soy (OECD, differential count of white blood cells) previously reported from this 2001) and can also vary between GM soy and its near-isogenic trial (Sissener et al., 2009). However, dietary inclusion level of FFSBM maternal line (Sagstad et al., 2008). Atlantic salmon fed diets did lead to an inflammatory response in the distal intestine as containing 20% SBM grown in six different locations showed described previously in Atlantic salmon (Van den Ingh et al., 1991; significant variations in all evaluated SBM-induced changes in the Baeverfjord and Krogdahl, 1996; Van den Ingh et al., 1996; Nordrum et distal intestine (Uran et al., 2008), confirming that differences al., 2000; Bakke-McKellep et al., 2007). The observation that mucosal between soy strains can affect the severity of enteritis. Nor can fold heights were shorter (significantly so at sampling 2 [Feb 2nd]) and differences in feed intake (not measured in this trial) be entirely ruled degree of mucosal fold fusion more pronounced in fish fed GM out as a contributing factor. Short term reduction of enteritis has been compared to non-GM soy may indicate that the GM variety elevated shown when smolts were transferred to seawater, most likely due to the degree of inflammation. decreased feed intake (Bakke-McKellep et al., 2006).

Table 5 Cross-over effects.

nGM GM GM−NnGM nGM−NGM Cross-over effect

Weight (g) 187.4 (8.2) 191.6 (7.3) 187.5 (5.7) 187.8 (5.2) n.s.

Organ indices SSI 0.052 (0.003) 0.051 (0.002) 0.051 (0.001) 0.057 (0.002) n.s. HSI 1.12 (0.07) 1.00 (0.02) 1.08 (0.03) 1.09 (0.02) n.s. H-KSI 0.198 (0.011) 0.186 (0.009) 0.178 (0.005) 0.177 (0.004) P=0.04 PISI 3.17 (0.18) 3.17 (0.08) 2.67 (0.05) 2.64 (0.07) P=0.001 MISI 0.270 (0.009) 0.237 (0.006) 0.207 (0.009) 0.208 (0.008) P=0.0007 DISI 0.568 (0.018) 0.550 (0.017) 0.544 (0.033) 0.511 (0.026) n.s.

Haematology Hct (%) 36.2 (0.7) 38.7 (0.6) 37.9 (0.9) 37.7 (1.5) n.s. RBC (1012 L− 1) 1.14 (0.04) 1.25 (0.03) 0.99 (0.03) 1.00 (0.04) P=0.01 Hb (g 100 ml− 1) 7.41 (0.17) 7.73 (0.15) 7.01 (0.16) 7.12 (0.20) n.s., (P=0.09) MCV (1015 L− 1) 329 (15) 313 (8) 386 (13) 385 (21) P=0.009 MCH (10 − 6 g) 66.4 (1.8) 62.3 (0.7) 71.3 (1.9) 71.5 (1.3) P=0.005 MCHC (g 100 ml− 1) 20.6 (0.5) 20.05 (0.3) 18.6 (0.5) 19.3 (0.8) n.s., (P=0.09)

Plasma TAG (mMol) 2.25 (0.22) 2.45 (0.23) 2.16 (0.17) 2.33 (0.16) n.s. Protein (g L− 1) 33.7 (0.8) 35.8 (0.8) 37.0 (1.1) 36.4 (0.9) n.s., (P=0.10) Glucose (g L− 1) 1.11 (0.06) 1.08 (0.02) 1.15 (0.04) 1.13 (0.03) P=0.03 ALAT (u L− 1) 17.3 (2.0) 17.5 (5.3) 18.2 (2.6) 11.5 (2.3) n.s. ASAT (u L− 1) 309 (32) 307 (10) 365 (37) 299 (29) n.s. LDH (u L− 1) 984 (131) 944 (174) 1114 (289) 930 (174) n.s.

Mean (SEM). 6 fish from the original diet groups and 6 cross-over fish were sampled from each tank (24 fish for each of the four treatment groups). Spleen somatic index, SSI; hepato-somatic index, HIS; head kidney somatic index H-KSI; proximal intestine somatic index, PISI; mid intestine somatic index, MISI; distal intestine somatic index, DISI; haematocrit, Hct; red blood cells, RBC; haemoglobin, Hb; mean cell volume, MCV; mean cell haemoglobin, MCH; mean cell haemoglobin concentration, MCHC; triacylglycerol, TAG; lactate dehydrogenase, LDH; alanine aminotransferase, ALAT; aspartate aminotransferase, ASAT. 108 N.H. Sissener et al. / Aquaculture 298 (2009) 101–110

Table 6 Haematology and plasma chemistry from the stress test.

Diet 0 h 3 h 22 h Diet Time

Haematology Hct (%) non-GM 36.2 (0.7) 30.9 (0.9) 32.8 (1.2) n.s. Pb0.0001 GM 38.7 (0.6) 31.6 (1.2) 33.4 (1.2) RBC (1012 L− 1) nGM 1.14 (0.04) 1.03 (0.02) 1.09 (0.04) n.s. P=0.03 GM 1.25 (0.03) 1.06 (0.03) 1.09 (0.03) Hb (g 100 ml− 1) nGM 7.41 (0.17) 6.31 (0.14) 6.78 (0.25) n.s. P=0.003 GM 7.73 (0.15) 6.56 (0.21) 6.90 (0.20) MCV (1015 L− 1) nGM 329 (15) 299 (4) 304 (9) n.s. n.s. GM 313 (8) 298 (8) 308 (12) MCH (10− 6 g) nGM 66.4 (1.8) 61.2 (0.8) 62.4 (0.8) n.s. n.s. GM 62.3 (0.7) 61.8 (0.9) 63.4 (1.4) MCHC (g 100 ml− 1) nGM 20.6 (0.6) 20.5 (0.4) 20.8 (0.6) n.s. n.s. GM 20.05 (0.3) 20.9 (0.5) 20.9 (0.6)

Plasma TAG (mMol) nGM 2.25 (0.22) 2.01 (0.25) 0.95 (0.08) n.s. P=0.0001 GM 2.45 (0.23) 1.45 (0.24) 0.92 (0.07) Protein (g L− 1) nGM 33.7 (0.8) 30.5 (0.9) 30.7 (0.9) n.s. P=0.002 GM 35.8 (0.8) 29.03 (1.2) 31.8 (0.3) Glucose (g L− 1) nGM 1.11 (0.06) 1.19 (0.05) 1.10 (0.03) n.s. n.s. GM 1.08 (0.02) 1.14 (0.06) 1.00 (0.05) ALAT (uL− 1) nGM 17.3 (2.3) 22.7 (5.9) 19.1 (5.2) n.s. n.s. GM 17.5 (5.3) 20.5 (2.8) 25.7 (2.7) ASAT (uL− 1) nGM 309 (32) 437 (77) 315 (49) n.s. n.s. GM 307 (10) 291 (12) 432 (74) LDH (uL− 1) nGM 984 (186) 2010 (972) 1125 (364) n.s.a n.s.a GM 960 (246) 1433 (129) 1194 (14)

Mean (SEM). Haematocrit, Hct; red blood cells, RBC; haemoglobin, Hb; mean cell volume, MCV; mean cell haemoglobin, MCH; mean cell haemoglobin concentration, MCHC; triacylglycerol, TAG; lactate dehydrogenase, LDH; alanine aminotransferase, ALAT; aspartate aminotransferase, ASAT. a LDH deviated from a normal distribution, thus was tested with Kruskal–Wallis ANOVA.

Hepatocytes of Atlantic salmon are large, regularly shaped cells Development of the fish over time had a greater influence on with typical central nuclei, and with moderate cytoplasmic glycogen histological parameters than diet, as observed for other parameters content. Our evaluation of salmon liver, with no changes apart from reported from the same feeding trial (Sissener et al., 2009). Mucosal reduced glycogen deposition in GM fed fish in the last sampling fold height (MFH) appeared to develop with age and/or body size, and period, shows minor changes compared to the studies on mice possibly as a result of transferfromfreshwatertoseawater. mentioned in the introduction. Additionally, glycogen deposits in liver Proliferation (mitotic figures, MF) and apoptosis in distal intestine of mice fed GM and non-GM soy were not reported to be different and the number and size of MMCs in the spleen showed a transitional (Malatesta et al., 2008b), thus there seems to be no similarities to our increase in frequency at the second sampling, just after seawater results. However, the maternal, near-isogenic line, grown under transfer, in both diet groups. Furthermore, more of the large, cyst-like similar conditions with the GM variety, which is recommended as the structures within or between enterocytes at the apical part of the best possible control (ILSI, 2003; EFSA, 2006), was not used in the intestinal fold were observed just before and just after seawater mice studies, and the authors have shown that the effects might be transfer compared to the final sampling. These differences might be due to glyphosate residues rather than the feed ingredients being GM explained by effects of the parr-smolt transformation and seawater (Malatesta et al., 2008a). transfer. Apart from histology of the distal intestine and glycogen deposits The cross-over design turned out to introduce bias that limits the in the liver, no further differences were observed between the GM and value of the results regarding drawing conclusions on diet effects. The non-GM diet groups, consequently, the remainder of this discussion differences between crossed-over fish and fish that were not moved deals with development over time, cross-over and stress-effects, may have been due to use of anaesthetic, fin-clipping, moving of fish which are discussed more briefly than the diet effects, as they are not between tanks, formation of new fish groups with hierarchical the main focus of this paper. changes or a combination of these factors. In a previous study fin- clipping of the adipose did not appear to affect growth or survival of rainbow trout (Gjerde and Refstie, 1988), while anaesthesia has been found to induce stress response in fish (Ortuño et al., 2002; Olsvik Table 7 et al., 2007). Despite its limitations for the original purpose, our cross- Transcription of heat shock protein mRNA in liver and distal intestine. over procedure may serve as an additional stress test, with fish Diet 0 h 3 h 22 h Diet Time showing similar responses regardless of being crossed-over from non- HSP70, liver nGM 21.2 (0.5) 21.3 (0.7) 21.5 (1.0) n.s. n.s. GM or GM soy diets. GM 21.5 (1.2) 21.7 (0.7) 21.7 (0.7) When the haematology results from the cross-over fish (Table 5) HSP70, intestine nGM 21.7 (0.5) 21.8 (0.8) 21.6 (0.9) n.s. n.s. were compared to those from the stress test (Table 6), differences GM 21.7 (1.4) 21.8 (0.7) 21.6 (0.5) between them may be due to the length of time the fish were exposed to HSP27, liver nGM 33.3 (0.6) 32.9 (0.8) 32.9 (0.8) n.s. P=0.006 GM 33.3 (0.4) 32.9 (0.6) 33.1 (1.1) stress. It seemed that the RBC number was generally decreased by stress. HSP27, intestine nGM 30.7 (0.8) 31.3 (0.9) 31.1 (0.7) n.s. P=0.002 However, the long term stress putatively experienced by the fish in the GM 30.8 (1.0) 31.3 (0.6) 31.0 (0.5) cross-over, appeared to lead to either 1) an adaptation with increased Median Ct-values with the interquartile range in parenthesis. size and haemoglobin content of their red blood cells or 2) impaired RBC Heat shock protein, HSP. production, since the large average size could indicate fewer immature N.H. Sissener et al. / Aquaculture 298 (2009) 101–110 109 cells, which are generally smaller and contain less haemoglobin than Basu, N., Todgham, A.E., Ackerman, P.A., Bibeau, M.R., Nakano, K., Schulte, P.M., Iwama, fi fi fi G.K., 2002. Heat shock protein genes and their functional signi cance in sh. Gene mature ones (Sandnes et al., 1988). The sh from the stress test had not 295, 173–183. responded in this manner and were affected by lowered haemoglobin Benninghoff, A.D., Williams, D.E., 2008. Identification of a transcriptional fingerprint of values, which might affect oxygen uptake. It seems that stress can affect estrogen exposure in rainbow trout liver. Toxicol. Sci. 101, 65–80. fi Cellini, F., Chesson, A., Colquhoun, I., Constable, A., Davies, H.V., Engel, K.H., Gatehouse, sh haematology in different ways depending on stressor and possibly A.M.R., Karenlampi, S., Kok, E.J., Leguay, J.J., 2004. Unintended effects and their also on fish species. In sea bass (Dicentrarchus labrax) thermal and detection in genetically modified crops. Food Chem. Toxicol. 42, 1089–1125. physical stress gave increased haematocrit levels, while chemical stress Domingo, J.L., 2007. Toxicity studies of genetically modified plants: a review of the – gave reduced levels, although both resulted in increased plasma cortisol published literature. Crit. Rev. Food Sci. Nutr. 47, 721 733. EFSA, 2006. Guidance document of the Scientific Panel on Genetically Modified (Roche and Bogé, 1996). Organisms for the risk assessment of genetically modified plants and derived food The fact that there was no response in HSP70 transcription after and feed. in: EFSA (Ed.). The EFSA Journal, pp. 1-100. stress treatment, while HSP27 was regulated in opposite directions in EFSA, 2008. Report of the EFSA GMO Panel Working Group on Animal Feeding Trials: safety and nutritional assessment of GM plants and derived food and feed: the role the liver and distal intestine could be explained by the different roles of animal feeding trials. Food Chem. Toxicol. 46, 1–70. of these two HSPs and of the two organs. The main function of HSP27 Evans, J.J., Pasnik, D.J., Peres, H., Lim, C., Klesius, P.H., 2005. No apparent differences in is to protect against protein aggregation by promoting refolding of intestinal histology of channel catfish (Ictalurus punctatus) fed heat-treated and non-heat-treated raw soybean meal. Aqua Nutr. 11, 123–129. denatured proteins (Garrido et al., 2001), while HSP70 functions in Feder, M.E., Hofmann, G.E., 1999. Heat shock proteins, molecular chaperons, and the stress the folding of novel polypeptide chains, and also mediates the repair response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, 243–282. or degradation of altered or denatured proteins (Kiang and Tsokos, Fink, A.I., Goto, Y., 1998. Molecular Chaperones in the Life Cycle of Proteins: Structure, Function and Mode of Action. Mercel Dekker, New York. 1998). High molecular weight HSPs are ATP-dependent chaperones, Flachowsky, G., Aulrich, K., Böhme, H., Halle, I., 2007. Studies on feeds from genetically whereas low molecular weight HSPs such as HSP27 are ATP- modified plants (GMP)—contributions to nutritional and safety assessment. Anim. independent (Parcellier et al., 2003). Varying responses between Feed Sci. Technol. 133, 2–30. fi Freeman, M.E., Borrelli, M.J., Meredith, M.J., Lepock, J.R., 1999. On the path to the heat shock different HSPs and different tissues in sh has also been observed by response: destabilization and formation of partially folded protein intermediates, a others (Lele et al., 1997; Stephensen et al., 2002). consequence of protein thiol modifications. Free Radic. Biol. Med. 26, 737–745. Garrido, C., Gurbuxani, S., Ravagnan, L., Kroemer, G., 2001. Heat shock proteins: endogenous modulators of apoptotic cell death. Biochem. Biophys. Res. Commum. 5. Conclusion 286, 433–442. Gatlin, D.M., Barrows, F.T., Brown, P., Dabrowski, K., Gaylord, T.G., Hardy, R.W., Herman, E., ® Hu, G., Krogdahl, Å., Nelson, R., Overturf, K., Rust, M., Sealey, W., Skonberg, D., Souza, E.J., Effects of the GM Roundup Ready soy diet compared to non-GM Stone, D., Wilson, R., Wurtele, E., 2007. Expanding the utilization of sustainable plant soy were observed as shorter mucosal fold height in the distal products in aquafeeds: a review. Aquac. Res. 38, 551–579. intestine at one sampling point out of three, while mucosal fold fusion Gjerde, B., Refstie, T., 1988. The effect of fin-clipping on growth rate survival and sexual maturity of rainbow trout. Aquaculture 73, 383–389. was more pronounced in the GM group overall in the trial, which Hendrick, J.P., Hartl, F.U., 1993. Molecular chaperone functions of heat shock proteins. could indicate more pronounced soy-induced changes. The inflam- Annu. Rev. Biochem. 62, 349–384. mation observed in both diet groups was consistent with what is Hevrøy, E.M., El-Mowafi, A., Taylor, R.G., Olsvik, P.A., Norberg, B., Espe, M., 2007. Lysine intake affects gene expression of anabolic hormones in Atlantic salmon, Salmo normally observed in Atlantic salmon fed such high inclusion levels of salar. Gen. Comp. Endocrinol. 152, 39–46. SBM. Also, there was lower glycogen deposition in liver of fish fed the Higuchi, R., Fockler, C., Dollinger, G., Watson, R., 1993. Kinetic PCR analysis: real-time GM diet. No other diet-related morphological differences were monitoring of DNA amplification reactions. Nat. Biotech. 11, 1026–1030. detected in any organs, nor were there any differences in the ILSI, 2003. Best practices for the conduct of animal studies to evaluate crops genetically modified for output traits, International Food Biotechnology Committee, International measured stress parameters between the two diet groups. Thus, GM Life Sciences Institute, Washington DC. http://www.ilsi.org/NR/rdonlyres/4A2F7C13- soy at an inclusion level of 25% did not appear to cause any adverse B14AA-14BC19-AEDE-696B694B672E693C694/690/BestPracticesGuidelines.pdf. effect of practical importance on organ morphology or stress response Iwama, G.K., Afonso, L.O.B., Todgham, A., Ackerman, P., Nakano, K., 2004. Are hsps suitable for indicating stressed states in fish? J. Exp. Biol. 207, 15–19. compared to non-GM soy. Iwarma, G.K., Thomas, P.T., Forsyth, R.B., Vijayan, M.M., 1998. Heat shock protein expression in fish. Rev. Fish Biol. Fish 8, 35–36. James, C., 2007. Executive summary: global status of Commercialized Biotech/GM Acknowledgements crops. ISAAA Brief 37. ISAAA, Ithaca, NY. Kiang, J.G., Tsokos, G.C., 1998. Heat shock proteins 70 kDa: molecular biology, biochemistry and physiology. Pharmacol. Ther. 80, 183–201. We would like to thank The Monsanto Company for kindly Krogdahl, Å., Bakke-McKellep, A.M., 2005. Fasting and refeeding cause rapid changes in ® supplying the RRS as well as the near-isogenic maternal soybeans. intestinal tissue mass and digestive enzyme capacities of Atlantic salmon (Salmo We also thank Ivar Helge Matre for skilled technical assistance and salar L.). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 141, 450–460. fi Lise Dyrhovden for care of the fish during the feeding trial. The project Kuiper, H.A., Kleter, G.A., 2003. The scienti c basis for risk assessment and regulation of genetically modified foods. Trends Food Sci. Technol. 14, 277–293. was supported by the Norwegian Research Council, grant no. 172151. Latham, J., Wilson, A.K., Steinbrecher, R.A., 2006. The mutational consequences of plant transformation. J. Biomed. Biotechnol. 25376, 25371–25377. Lele, Z., Engel, S., Krone, P.H., 1997. hsp47 and hsp70 gene expression is differentially References regulated in a stress- and tissue specific manner in zebrafish embryos. Dev. Genet. 21, 123–133. Amin, A.B., Mortensen, L., Poppe, T.T., 1992. Histology Atlas: Normal Structure of Malatesta, M., Caporaloni, C., Gavaudan, S., Rocchi, M.B.L., Serafini, S., Tiberi, C., Salmonids: A Colour Atlas. Akvapatologisk Laboratorium AS, Bodø, Norway. Gazzanelli, G., 2002. Ultrastructural morphometrical and immunocytochemical Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quantitative analyses of hepatocyte nuclei from mice fed on genetically modified soybean. Cell reverse transcription-PCR data: a model-based variance estimation approach to Struct. Funct. 27, 173–180. identify genes suited for normalization, applied to bladder and colon cancer data Malatesta, M., Biggiogera, M., Manuali, E., Rocchi, M.B., Baldelli, B., GAzzanelli, G., 2003. sets. Cancer Res. 64, 5245–5250. Fine structural analysis of pancreatic acinar cell nuclei from mice fed on genetically Baeverfjord, G., Krogdahl, Å., 1996. Development and regression of soybean meal modified soybean. Eur. J. Histochem. 47, 358-358. induced enteritis in Atlantic salmon, Salmo salar L., distal intestine: a comparison Malatesta, M., Baldelli, B., Battistelli, S., Manuali, E., Biggiogera, M., 2005. Reversibility of with the intestines of fasted fish. J. Fish Dis. 19, 375–387. nuclear modifications in mice fed on genetically modified soybean. Eur. J. Histol. 49, Bakke-McKellep, A.M., Refstie, S., Stefansson, S.O., Vanthanouvong, V., Hemre, G.-I., 237–242. Kroghdahl, Å., 2006. Effects of dietary soybean meal and photoperiod cycle on Malatesta, M., Perdoni, F., Santin, G., Battistelli, S., Muller, S., Biggiogera, M., 2008a. osmoregulation following seawater exposure in Atlantic salmon smolts. J. Fish Biol. Hepatoma tissue culture (HTC) cells as a model for investigating the effects of low 69, 1396–1426. concentrations of herbicide on cell structure and function. Toxicol. in Vitro 22, Bakke-McKellep, A.M., Penn, M.H., Salas, P.M., Refstie, S., Sperstad, S., Landsverk, T., 1853–1860. Ringo, E., Krogdahl, Å., 2007. Effects of dietary soyabean meal, inulin and Malatesta, M., Boraldi, F., Annovi, G., Baldelli, B., Battistelli, S., Biggiogera, M., Quaglino, D., oxytetracycline on intestinal microbiota and epithelial cell stress, apoptosis and 2008b. A long-term study on female mice fed on a genetically modified soybean: proliferation in the teleost Atlantic salmon (Salmo salar L.). Br. J. Nutr. 97, 699–713. effects on liver ageing. Histochem. Cell Biol. 130, 967–977. Barton, B.A., Iwama, G.K., 1991. Physiological changes in fish from stress in aquaculture with Moore, L.J., Somamoto, T., Lie, K.K., Dijkstra, J.M., Hordvik, I., 2005. Characterisation of emphasis on the response and effects of corticosteroids. Annu. Rev. Fish Dis. 1, 3–26. salmon and trout CD8[alpha] and CD8[beta]. Mol. Immunol. 42, 1225–1234. 110 N.H. Sissener et al. / Aquaculture 298 (2009) 101–110

Morimoto, R.I., Tissieres, A., Georgopoulus, C., 1990. Stress Proteins in Biology and Séralini, G.-E., Cellier, D., de Vendomois, J., 2007. New analysis of a rat feeding study Medicine. Cold Springs Harbour Press, Cold Springs Harbour. with a genetically modified maize reveals signs of hepatorenal toxicity. Arch. Morimoto, R.I., Sarge, K.D., Abravaya, K., 1992. Transcriptional regulation of heat shock Environ. Contam. Toxicol. 52, 596–602. genes. J. Biol. Chem. 267, 21987–21990. Sissener, N.H., Sanden, M., Bakke, A.M., Kroghdahl, Å., Hemre, G.I., 2009. A long term trial Morin, P.P., Hara, T.J., Eales, J.G., 1993. Thyroid hormone deiodination in brain, liver, gill, with Atlantic salmon (Salmo salar L.) fed genetically modified soy; focusing general heart and muscle of Atlantic salmon (Salmo salar) during photoperiodically- health and performance before, during and after the parr-smolt transformation. induced parr-smolt transformation, I. Outer- and inner-ring thyroxine deiodina- Aquaculture 108–117. tion. Gen. Comp. Endocrinol. 90, 142–156. Sissener, N.H., Martin, S.A.M., Cash, P., Hevrøy, E.M., Sanden, M., Hemre, G.I., 2009. Nordrum, S., Bakke-McKellep, A.M., Krogdahl, Å., Buddington, R.K., 2000. Effects of Proteomic profiling of liver from Atlantic salmon (Salmo salar) fed genetically soybean meal and salinity on intestinal transport of nutrients in Atlantic salmon modified soy compared to the near-isogenic non-GM line. Marine Biotechnol. (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. doi:10.1007/s10126-009-9214-1. B Biochem. Mol. Biol. 125, 317–335. Somers, D.A., Makarevitch, I., 2004. Transgene integration in plants: poking or patching OECD, 2001. Consensus Document on Compositional Considerations for New Varieties holes in promiscuous genomes? Curr. Opin. Biotechnol. 15, 126–131. of Soybean: Key Food and Feed Nutrients and Anti-Nutrients. Series on the safety of Stephensen, E., Sturve, J., Forlin, L., 2002. Effects of redox cycling compounds on novel foods and feeds, No. 2. http://www.olis.oecd.org/olis/2001doc.nsf/LinkTo/ glutathione content and activity of glutathione-related enzymes in rainbow trout NT00005036/$FILE/JT00117705.PDF. liver. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 133, 435–442. Olsvik, P., Lie, K., Jordal, A.-E., Nilsen, T., Hordvik, I., 2005. Evaluation of potential reference Tacon, A.G.J., 1987. The Nutrition and Feeding of Farmed Fish and Shrimp—A Training genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 6, 21. Manual 1. The Essential Nutrients. Food and Agriculture Organization of the United Olsvik, P., Lie, K., Hevrøy, E., 2007. Do anesthetics and sampling strategies affect Nations, GPC/RLA/075/ITA, Brazil, p. 117. transcription analysis of fish tissues? BMC Mol. Biol. 8, 48. Tintos, A., Gesto, M., Míguez, J.M., Soengas, J.L., 2008. Beta-Naphthoflavone and benzo Ortuño, J., Esteban, M.A., Meseguer, J., 2002. Effects of four anaesthetics on the innate (a)pyrene treatment affect liver intermediary metabolism and plasma cortisol immune response of gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. levels in rainbow trout Oncorhynchus mykiss. Ecotoxicol. Environ. Saf. 69, 180–186. 12, 49–59. Trabalza-Marinucci, M., Brandi, G., Rondini, C., Avellini, L., Giammarini, C., Costarelli, S., Padgette, S.R., Kolacz, K.H., Delannay, X., Re, D.B., LaVallee, B.J., Tinius, C.N., Rhodes, W.K., Acuti, G., Orlandi, C., Filippini, G., Chiaradia, E., Malatesta, M., Crotti, S., Antonini, C., Otero, Y.I., Barry, G.F., Eichholtz, D.A., Peschke, V.M., Nida, D.L., Taylor, N.B., Kishore, G.M., Amagliani, G., Manuali, E., Mastrogiacomo, A.R., Moscati, L., Naceur Haouet, M., 1995. Development, identification, and characterization of a glyphosate-tolerant Gaiti, A., Magnani, M., 2008. A three-year longitudinal study on the effects of a diet soybean line. Crop. Sci. 35, 1451–1461. containing genetically modified Bt176 maize on the health status and performance Parcellier, A., Gurbuxani, S., Schmitt, E.1, Solary, E., Garrido, C., 2003. Heat shock of sheep. Livest. Sci. 113, 178–190. proteins, cellular chaperones that modulate mitochondrial cell death pathways. Uran, P.A., 2008. Ethiology of soybean-induced enteritis in fish. PhD thesis, Wageninigen Biochem. Biophys. Res. Commun. 304, 505–512. University. Pryme, I.F., Lembcke, R., 2003. In vivo studies on possible health consequences of Uran, P.A., Schrama, J.W., Jaafari, S., Baardsen, G., Rombout, J.H.W.M., Koppe, W., genetically modified ingredients consisting of genetically modified plants. Nutr. Verreth, J.A.J., 2008. Variation in commercial sources of soybean meal influences Health 17, 1–8. the severity of enteritis in Atlantic salmon (Salmo salar L.). Aqua Nutr. Rabergh, C.M., Airaksinen, S., Soitamo, A., Bjorklund, H.V., Johansson, T., Nikinmaa, M., Van den Ingh, T.S.G.A.M., Krogdahl, Å., Olli, J.J., Hendriks, H.G.C.J.M., Koninkx, J.G.J.F., Sistonen, L., 2000. Tissue-specific expression of zebrafish (Danio rerio) heat shock 1991. Effects of soybean-containing diets on the proximal and distal intestine in factor 1 mRNAs in response to heat stress. J. Exp. Biol. 203, 1817–1824. Atlantic salmon (Salmo salar): a morphological study. Aquaculture 94, 297–305. Roche, H., Bogé, G., 1996. Fish blood parameters as a potential tool for identification of Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., stress caused by environmental factors and chemical intoxication. Mar. Environ. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric Res. 41, 27–43. averaging of multiple internal control genes. Genome Biol. 3 0034.0031-0034.0011. Sagstad, A., Sanden, M., Krogdahl, Å., Bakke-McKellep, A.M., Frøystad, M., Hemre, G.-I., 2008. Vecchio, L., Cisterna, B., Malatesta, M., Martin, T.E., Biggiogera, M., 2004. Ultrastructural Organs development, gene expression and health of Atlantic salmon (Salmo salar L.) fed analysis of testes from mice fed genetically modified soybean. Eur. J. Histochem. 48, genetically modified soybeans compared to the near-isogenic non-modified parental 448–454. line. Aqua Nutr. 14, 556–572. Welch, W.J., 1993. How cells respond to stress. Sci. America 269, 56–64. Sandnes, K., Lie, Ø., Waagbø, R., 1988. Normal ranges of some blood chemistry parameters in adult farmed Atlantic salmon, Salmo salar. J. Fish Biol. 32, 129–136.