LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561

Total Page:16

File Type:pdf, Size:1020Kb

Load more

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA809561 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] Product data: Product Type: Primary Antibodies Clone Name: OTI4E11 Applications: WB Recommended Dilution: WB 1:500~2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-260 of human LHX4 (NP_203129) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 42.9 kDa Gene Name: LIM homeobox 4 Database Link: NP_203129 Entrez Gene 16872 MouseEntrez Gene 360858 RatEntrez Gene 89884 Human Q969G2 Background: This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010] Synonyms: CPHD4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561 Protein Families: Druggable Genome, Transcription Factors Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY LHX4 ([RC204014], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-LHX4 (1:2000). Positive lysates [LY403244] (100ug) and [LC403244] (20ug) can be purchased separately from OriGene. Western blot analysis of extracts (35ug) from HepG2 by using anti-LHX4 monoclonal antibody (1:500). This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Recommended publications
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins

    Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins

    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
  • Specificity Landscapes Unmask Submaximal Binding Site Preferences of Transcription Factors

    Specificity Landscapes Unmask Submaximal Binding Site Preferences of Transcription Factors

    Specificity landscapes unmask submaximal binding site preferences of transcription factors Devesh Bhimsariaa,b,1, José A. Rodríguez-Martíneza,2, Junkun Panc, Daniel Rostonc, Elif Nihal Korkmazc, Qiang Cuic,3, Parameswaran Ramanathanb, and Aseem Z. Ansaria,d,4 aDepartment of Biochemistry, University of Wisconsin–Madison, Madison, WI 53706; bDepartment of Electrical and Computer Engineering, University of Wisconsin–Madison, Madison, WI 53706; cDepartment of Chemistry, University of Wisconsin–Madison, Madison, WI 53706; and dThe Genome Center of Wisconsin, University of Wisconsin–Madison, Madison, WI 53706 Edited by Michael Levine, Princeton University, Princeton, NJ, and approved September 24, 2018 (received for review July 13, 2018) We have developed Differential Specificity and Energy Landscape Here, we report the development of Differential Specificity (DiSEL) analysis to comprehensively compare DNA–protein inter- and Energy Landscapes (DiSEL) to compare experimental actomes (DPIs) obtained by high-throughput experimental plat- platforms, computational methods, and interactomes of TFs, forms and cutting edge computational methods. While high-affinity especially those factors that bind identical consensus motifs. Our DNA binding sites are identified by most methods, DiSEL uncovered results reveal that (i) most high-throughput experimental plat- nuanced sequence preferences displayed by homologous transcription forms reliably identify high-affinity motifs but yield less reliable factors. Pairwise analysis of 726 DPIs uncovered homolog-specific dif- information on submaximal sites; (ii) with few exceptions, com- ferences at moderate- to low-affinity binding sites (submaximal sites). putational methods model DPIs with a focus on high-affinity DiSEL analysis of variants of 41 transcription factors revealed that sites; (iii) submaximal sites improve the annotation of biologi- many disease-causing mutations result in allele-specific changes in cally relevant binding sites across genomes; (iv) among members binding site preferences.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name LIM homeobox 4 Gene Symbol LHX4 Organism Human Gene Summary This gene encodes a member of a large protein family which contains the LIM domain a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. Gene Aliases CPHD4, FLJ22769 RefSeq Accession No. NC_000001.10, NG_008081.1, NT_004487.19 UniGene ID Hs.658487 Ensembl Gene ID ENSG00000121454 Entrez Gene ID 89884 Assay Information Unique Assay ID qHsaCED0002909 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000263726 Amplicon Context Sequence CTATGGAATCCCCCAGTCTCCATCCTCCATATCGTCCCTGCCATCCCACGCTCCT TTGCTCAATGGGCTGGATTACACGGTGGACAGTAATTTGGGCATCATTGC Amplicon Length (bp) 75 Chromosome Location 1:180243462-180243566 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 94 R2 0.9993 cDNA Cq 24.14 cDNA Tm (Celsius) 82.5 gDNA Cq 23.49 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report LHX4, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature

    MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature

    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
  • Genomics 93 (2009) 449–460

    Genomics 93 (2009) 449–460

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 93 (2009) 449–460 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Discovery of transcriptional regulators and signaling pathways in the developing pituitary gland by bioinformatic and genomic approaches Michelle L. Brinkmeier a, Shannon W. Davis a, Piero Carninci b, James W. MacDonald c, Jun Kawai b, Debashis Ghosh e,1, Yoshihide Hayashizaki b, Robert H. Lyons d, Sally A. Camper a,⁎ a Department of Human Genetics, University of Michigan Medical School, Ann Arbor, MI, 48109-5618, USA b Omics Science Center, RIKEN Yokohama Institute, Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan c Affymetrix and cDNA Microarray Core Facility, University of Michigan Cancer Center, Ann Arbor, MI 48109-0946, USA d Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor, MI, 48109-5638, USA e Department of Biostatistics, School of Public Health, University of Michigan, 48109-2029, USA article info abstract Article history: We report a catalog of the mouse embryonic pituitary gland transcriptome consisting of five cDNA libraries Received 13 December 2007 including wild type tissue from E12.5 and E14.5, Prop1df/df mutant at E14.5, and two cDNA subtractions: E14.5 Accepted 24 November 2008 WT–E14.5 Prop1df/df and E14.5 WT–E12.5 WT. DNA sequence information is assembled into a searchable Available online 11 February 2009 database with gene ontology terms representing 12,009 expressed genes. We validated coverage of the libraries by detecting most known homeobox gene transcription factor cDNAs.
  • (Tyk2) on the Expression of Interferon-Responsive and Metabolic Genes

    (Tyk2) on the Expression of Interferon-Responsive and Metabolic Genes

    Vogl et al. BMC Genomics 2010, 11:199 http://www.biomedcentral.com/1471-2164/11/199 RESEARCH ARTICLE Open Access TranscriptomeResearch article analysis reveals a major impact of JAK protein tyrosine kinase 2 (Tyk2) on the expression of interferon-responsive and metabolic genes Claus Vogl*1, Thomas Flatt2, Bernd Fuhrmann1, Elisabeth Hofmann1, Barbara Wallner1, Rita Stiefvater1, Pavel Kovarik3, Birgit Strobl1 and Mathias Müller*1,4 Abstract Background: Tyrosine kinase 2 (Tyk2), a central component of Janus kinase/signal transducer and activator of transcription (JAK/STAT) signaling, has major effects on innate immunity and inflammation. Mice lacking Tyk2 are resistant to endotoxin shock induced by lipopolysaccharide (LPS), and Tyk2 deficient macrophages fail to efficiently induce interferon α/β after LPS treatment. However, how Tyk2 globally regulates transcription of downstream target genes remains unknown. Here we examine the regulatory role of Tyk2 in basal and inflammatory transcription by comparing gene expression profiles of peritoneal macrophages from Tyk2 mutant and wildtype control mice that were either kept untreated or exposed to LPS for six hours. Results: Untreated Tyk2-deficient macrophages exhibited reduced expression of immune response genes relative to wildtype, in particular those that contain interferon response elements (IRF/ISRE), whereas metabolic genes showed higher expression. Upon LPS challenge, IFN-inducible genes (including those with an IRF/ISRE transcription factor binding-site) were strongly upregulated in both Tyk2 mutant and wildtype cells and reached similar expression levels. In contrast, metabolic gene expression was strongly decreased in wildtype cells upon LPS treatment, while in Tyk2 mutant cells the expression of these genes remained relatively unchanged, which exaggerated differences already present at the basal level.
  • REVIEW Novel Mutations Associated with Combined Pituitary Hormone

    REVIEW Novel Mutations Associated with Combined Pituitary Hormone

    R93 REVIEW Novel mutations associated with combined pituitary hormone deficiency Christopher J Romero, Elyse Pine-Twaddell and Sally Radovick Division of Pediatric Endocrinology, Department of Pediatrics, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, CMSC 406, Baltimore, Maryland 21208, USA (Correspondence should be addressed to S Radovick; Email: [email protected]) Abstract The pituitary gland produces hormones that play important roles in both the development and the homeostasis of the body. A deficiency of two or several of these pituitary hormones, known as combined pituitary hormone deficiency, may present in infants or children due to an unknown etiology and is considered congenital or idiopathic. Advancements in our understanding of pituitary development have provided a genetic basis to explain the pathophysiological basis of pituitary hormone disease. Nevertheless, there are several challenges to the precise characterization of abnormal genotypes; these exist secondary to the complexities of several of the hypothalamic/pituitary developmental factors and signals, which ultimately integrate in a temporal and spatial dependent manner to produce a mature gland. Furthermore, the clinical presentation of pituitary hormone disease may be dynamic as subsequent hormone deficiencies may develop over time. The characterization of patients with mutations in genes responsible for pituitary development provides an opportunity to discover potential novel mechanisms responsible for pituitary pathophysiology. The focus of this review is to report the most recent mutations in genes responsible for pituitary development in patients with hypopituitarism and emphasize the importance to physicians and researchers for characterizing these patients. Continuing efforts toward understanding the molecular basis of pituitary development as well as genetic screening of patients with pituitary disease will offer new insights into both diagnostic and potential therapeutic options that will decrease the morbidity and mortality in patients with hypopituitarism.
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection

    Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection

    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
  • Investigation of New Candidate Genes in a Cohort of Patients with Familial Congenital Hypopituitarism And

    Investigation of New Candidate Genes in a Cohort of Patients with Familial Congenital Hypopituitarism And

    Investigation of new candidate genes in a cohort of patients with familial congenital hypopituitarism and associated disorders Louise Cheryl Gregory UCL Doctor of Philosophy Thesis 1 Declaration I, Louise Cheryl Gregory confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Publication arising from this thesis: Gregory, L.C., Humayun, K.N., Turton, J.P., McCabe, M.J., Rhodes, S.J., Dattani, M.T. 2015. Novel Lethal Form of Congenital Hypopituitarism Associated With the First Recessive LHX4 Mutation. J Clin Endocrinol Metab. 100(6): 2158-64. 2 Abstract Congenital hypopituitarism is a complex variable genetic disorder that is known to be caused by multiple mutated genes, both in isolation and in variably penetrant cases of digenic inheritance. In only <10% of cases, a mutation in a known causative gene has been identified in the patient, leaving the vast majority of patients yet to have a genetic mutation detected that is responsible for the pathogenicity and that has functional significance to their condition. This study investigates novel genes and pathways involved in hypothalamo-pituitary development. Our large cohort of consanguineous and non-consanguineous pedigrees with hypothalamo-pituitary disease are routinely screened for variants in the known causative genes. In pedigrees where there are no variants in these particular genes, exome sequencing in collaboration with GOSgene is carried out to uncover novel genes and regions of interest that are abnormal in the individual. Upon the identification of any novel variant in known or novel genes, functional assays are conducted to further show the significance of the change.
  • S12920-021-01005-X.Pdf

    S12920-021-01005-X.Pdf

    Tkatchenko and Tkatchenko BMC Med Genomics (2021) 14:153 https://doi.org/10.1186/s12920-021-01005-x RESEARCH Open Access Genome-wide analysis of retinal transcriptome reveals common genetic network underlying perception of contrast and optical defocus detection Tatiana V. Tkatchenko1 and Andrei V. Tkatchenko1,2,3* Abstract Background: Refractive eye development is regulated by optical defocus in a process of emmetropization. Excessive exposure to negative optical defocus often leads to the development of myopia. However, it is still largely unknown how optical defocus is detected by the retina. Methods: Here, we used genome-wide RNA-sequencing to conduct analysis of the retinal gene expression network underlying contrast perception and refractive eye development. Results: We report that the genetic network subserving contrast perception plays an important role in optical defo- cus detection and emmetropization. Our results demonstrate an interaction between contrast perception, the retinal circadian clock pathway and the signaling pathway underlying optical defocus detection. We also observe that the relative majority of genes causing human myopia are involved in the processing of optical defocus. Conclusions: Together, our results support the hypothesis that optical defocus is perceived by the retina using con- trast as a proxy and provide new insights into molecular signaling underlying refractive eye development. Keywords: Refractive eye development, Myopia, Contrast perception, Optical defocus, Circadian rhythms, Signaling pathways, Gene expression profling, Genetic network, RNA-seq Background compensate for imposed defocus very accurately by Refractive eye development is controlled by both envi- modulating the growth of the posterior segment of the ronmental and genetic factors, which determine the eye via a developmental mechanism called bidirectional optical geometry of the eye and its refractive state by a emmetropization by the sign of optical defocus (BESOD), process called emmetropization [1–8].
  • Protocol for Clustering of Non-Unified Protein Sequences Through Memory-Map Guided Deep Learning

    Protocol for Clustering of Non-Unified Protein Sequences Through Memory-Map Guided Deep Learning

    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.15.252114; this version posted August 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Protocol for clustering of non-unified protein sequences through memory-map guided deep learning Om Prakash Department of Computational Biology The Institute of Mathematical Sciences, Chennai-600113 Email: [email protected], [email protected] ABSTRACT Protocol established and validated for clustering of non-unified protein sequences through memory- map guided deep learning. Data evaluated belongs to the disease causing proteins/genes from human hormonal system. Possibilities for future experiments validation was found for genes as: ACTHR, AGMX1, ATK, BPK, DPDE3, ERBA2, FSHB, GH1, GHSR, GNAS1, GSP, HANF, LCGR, LGR2, LGR3, LHRHR, NR1A2, PKR1, PRKAR1, RNF216, SBP2, SECISBP2, THR1, THRB, TPIT, TRIAD3, TSE1, UBCE7IP1, XAP2, and ZIN. Protocol is recommended for implementation with small to large dataset (protein/ DNA/ RNA sequences of unified or non-unified length) with unclassified data flags. Keywords: Clustering; Deep-learning; Memory-map; Protein; Protocol; Sequences. INTRODUCTION Order of amino acid sequence is the basis of 3D structure and functional specificity of protein. 3D structure of protein sequence represents responsible structure for function of protein. Protein sequences are known to be classified on the basis of sequences of same stretch of length through multiple sequence alignment. But in today’s scenario, when next-generation-sequencing data are being provided into a large scale, then sequences of unclassified data with non-unified length are becoming a challenge.
  • The Transcriptional Regulator CBX2 and Ovarian Function

    The Transcriptional Regulator CBX2 and Ovarian Function

    www.nature.com/scientificreports OPEN The transcriptional regulator CBX2 and ovarian function: A whole genome and whole transcriptome approach Leila Bouazzi1, Patrick Sproll1,3, Wassim Eid2,3 & Anna Biason-Lauber1* The chromobox homolog 2 (CBX2) was found to be important for human testis development, but its role in the human ovary remains elusive. We conducted a genome-wide analysis based on DNA adenine methyltransferase identifcation (DamID) and RNA sequencing strategies to investigate CBX2 in the human granulosa cells. Functional analysis revealed that CBX2 was upstream of genes contributing to ovarian function like folliculogenesis and steroidogenesis (i.e. ESR1, NRG1, AKR1C1, PTGER2, BMP15, BMP2, FSHR and NTRK1/2). We identifed CBX2 regulated genes associated with polycystic ovary syndrome (PCOS) such as TGFβ, MAP3K15 and DKK1, as well as genes implicated in premature ovarian failure (POF) (i.e. POF1B, BMP15 and HOXA13) and the pituitary defciency (i.e. LHX4 and KISS1). Our study provided an excellent opportunity to identify genes surrounding CBX2 in the ovary and might contribute to the understanding of ovarian physiopathology causing infertility in women. Te ovarian development depends on a highly orchestrated chain of genetic events involving multiple tran- scription factors and genetic circuits. Disruption of this orchestrated network can lead to many clinical syn- dromes, including POF, polycystic ovarian syndrome (PCOS), ovarian hyperstimulation syndrome, ovulation defects, poor ovarian reserve, and ovarian cancer1. Te genetic regulatory cascade still lacks a master regulator as an equivalent of SRY (Sex-Determining Region Y) gene2 in the male pathway. Genes such as wingless-type MMTV integration site family, member 4 (WNT4)3, R-spondin1 (RSPO1)4 and Forkhead box L2 (FOXL2)5 are female-specifc genes governing the ovarian pathway in coordination with other genes to promote and maintain oocytes health during fetal ovary development6.