DOCSLIB.ORG

S12920-021-01005-X.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
S12920-021-01005-X.Pdf Tkatchenko and Tkatchenko BMC Med Genomics (2021) 14:153 https://doi.org/10.1186/s12920-021-01005-x RESEARCH Open Access Genome-wide analysis of retinal transcriptome reveals common genetic network underlying perception of contrast and optical defocus detection Tatiana V. Tkatchenko1 and Andrei V. Tkatchenko1,2,3* Abstract Background: Refractive eye development is regulated by optical defocus in a process of emmetropization. Excessive exposure to negative optical defocus often leads to the development of myopia. However, it is still largely unknown how optical defocus is detected by the retina. Methods: Here, we used genome-wide RNA-sequencing to conduct analysis of the retinal gene expression network underlying contrast perception and refractive eye development. Results: We report that the genetic network subserving contrast perception plays an important role in optical defo- cus detection and emmetropization. Our results demonstrate an interaction between contrast perception, the retinal circadian clock pathway and the signaling pathway underlying optical defocus detection. We also observe that the relative majority of genes causing human myopia are involved in the processing of optical defocus. Conclusions: Together, our results support the hypothesis that optical defocus is perceived by the retina using con- trast as a proxy and provide new insights into molecular signaling underlying refractive eye development. Keywords: Refractive eye development, Myopia, Contrast perception, Optical defocus, Circadian rhythms, Signaling pathways, Gene expression profling, Genetic network, RNA-seq Background compensate for imposed defocus very accurately by Refractive eye development is controlled by both envi- modulating the growth of the posterior segment of the ronmental and genetic factors, which determine the eye via a developmental mechanism called bidirectional optical geometry of the eye and its refractive state by a emmetropization by the sign of optical defocus (BESOD), process called emmetropization [1–8]. Various envi- whereby negative optical defocus stimulates eye growth ronmental factors infuence refractive eye development and positive optical defocus suppresses it [12–18]. [8–11]; however, the leading environmental factor driv- BESOD uses optical defocus to match the eye’s axial ing emmetropization is optical defocus [8, 12]. Te eye length to its optical power and can produce either sharp is very sensitive to the sign of optical defocus and can vision (if the eye is exposed to a normal visual environ- ment), myopia (if the eye is exposed to negative optical defocus) or hyperopia (if the eye is exposed to positive *Correspondence: [email protected] optical defocus) [8]. Importantly, animal studies suggest 3 Edward S. Harkness Eye Institute, Research Annex Room 415, 635 W. that the process of emmetropization is controlled locally 165th Street, New York, NY 10032, USA Full list of author information is available at the end of the article by the retina [19–24]. Excessive exposure to negative © The Author(s) 2021. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/. The Creative Commons Public Domain Dedication waiver (http:// creat iveco mmons. org/ publi cdoma in/ zero/1. 0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Tkatchenko and Tkatchenko BMC Med Genomics (2021) 14:153 Page 2 of 23 optical defocus associated with nearwork leads to the chromatic aberrations, whereby the retina uses the con- development of myopia (nearsightedness), which is the trast of the luminance edges to determine focal plane most common ocular disorder in the world, manifesting and color contrast to identify the sign of defocus [54, in children of school age as blurred distance vision [13, 63, 64, 82]. Detection of luminance contrast and color 14, 16–18, 25–33]. contrast in the retina is organized as ON-center/OFF- Although the role of optical defocus in refractive eye surround and OFF-center/ON-surround receptive felds, development is a well-established fact, it is still largely which divide retinal pathways into ON and OFF channels unknown how optical defocus is perceived by the retina. respectively [83, 84]. Te importance of these contrast Several lines of evidence suggest that the absolute level processing retinal channels for refractive eye develop- of visual acuity does not play a signifcant role in opti- ment was demonstrated by experiments in knockout cal defocus detection because a variety of species with mice with ON-pathway mutations and in humans [85– diferent visual acuity ranging from 1.3 cpd in fsh [34], 88]. Anatomically, center-surround receptive felds are 0.6–1.4 cpd in mice [35–37], 2.4 cpd in tree shrews [38, comprised of photoreceptors, bipolar cells, horizontal 39], 2.7 cpd in guinea pigs [40, 41], 5 cpd in cats [42, 43], cells and amacrine cells, where horizontal and amacrine 5 cpd in chickens [44, 45] and 44 cpd in rhesus monkeys cells provide lateral inhibition which is critical for the and humans [46–48] undergo emmetropization and can generation of surround and contrast perception [83, 84]. compensate for imposed optical defocus [13–17, 49–53]. Interestingly, it was shown that amacrine cells play a crit- Moreover, it was demonstrated that accommodation ical role in refractive eye development [89–99] and that and emmetropization are driven by low spatial frequen- loss of amacrine cells negatively afects contrast sensitiv- cies even in species with high visual acuity [54, 55]; and ity [100]. the peripheral retina, which has much lower visual acu- Cronin-Golomb et al. [101] found that genetic factors ity than the central retina [56–61], plays an important have a signifcant contribution to contrast sensitivity in role in defocus detection and emmetropization [8, 22, humans. Te retina converts information about optical 24, 62]. Conversely, perception of contrast is emerging as defocus into molecular signals, which are transmitted an important cue for both defocus-driven accommoda- across the back of the eye via a multilayered signaling cas- tion and emmetropization [54, 63, 64]. Te possible role cade encoded by an elaborate genetic network [12, 102– of contrast perception in emmetropization is highlighted 115]. It is critical to characterize the genetic networks by the fact that species with diferent visual acuity have and signaling pathways underlying contrast perception similar contrast sensitivity at spatial frequencies found and determine their role in refractive eye development. to be critical for emmetropization [65]. Optical defocus Here, we systematically analyzed gene expression net- leads to a proportional degradation of contrast at the works and signaling pathways underlying contrast per- luminance edges of the images projected onto the retina, ception and refractive eye development in a panel of as revealed by the analysis of the efect of defocus on the highly genetically diverse mice, which have diferent eye’s contrast sensitivity [66–69]. Te retina, as revealed baseline refractive errors, diferent susceptibility to form- by in vitro recordings from ganglion cells, exhibits the deprivation myopia and diferent levels of contrast sen- highest sensitivity to contrast at low spatial frequen- sitivity, and determined the contribution of the genetic cies, consistent with what is found for the dependency network subserving contrast perception to baseline of accommodation and emmetropization on low spatial refractive development and optical-defocus-driven eye frequencies [45]. Ganglion cells’ fring rate increases pro- emmetropization. portionally with an increase in both optical focus and contrast, suggesting that contrast may be used by the ret- Methods ina as a proxy to optical defocus [45]. Interestingly, vision Ethics approval and consent to participate across the animal kingdom is tuned to contrast and not A total of 298 mice comprising collaborative cross to visual acuity [65, 70, 71]. Several species have been (129S1/svlmj, A/J, C57BL/6J, CAST/EiJ, NOD/ShiLtJ, shown to possess high contrast sensitivity and undergo NZO/HlLtJ, PWK/PhJ, and WSB/EiJ mice) were used in emmetropization despite low visual acuity [65, 72–75]. this study. Mice were obtained from the Jackson Labo- Retinae of many species adapted asymmetric photore- ratory (Bar Harbor, ME) and were maintained as an in- ceptor distribution which maximizes contrast perception house breeding colony. Food and water were provided across visual space in expense of other important visual ad libitum. All procedures adhered to the Association for functions such as visual acuity and color perception [70, Research in Vision and Ophthalmology (ARVO) state- 71, 76–81]. ment on the use of animals in ophthalmic
Load more

Recommended publications
  • New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
    Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway.
    [Show full text]
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
    [Show full text]
  • Specificity Landscapes Unmask Submaximal Binding Site Preferences of Transcription Factors
    Specificity landscapes unmask submaximal binding site preferences of transcription factors Devesh Bhimsariaa,b,1, José A. Rodríguez-Martíneza,2, Junkun Panc, Daniel Rostonc, Elif Nihal Korkmazc, Qiang Cuic,3, Parameswaran Ramanathanb, and Aseem Z. Ansaria,d,4 aDepartment of Biochemistry, University of Wisconsin–Madison, Madison, WI 53706; bDepartment of Electrical and Computer Engineering, University of Wisconsin–Madison, Madison, WI 53706; cDepartment of Chemistry, University of Wisconsin–Madison, Madison, WI 53706; and dThe Genome Center of Wisconsin, University of Wisconsin–Madison, Madison, WI 53706 Edited by Michael Levine, Princeton University, Princeton, NJ, and approved September 24, 2018 (received for review July 13, 2018) We have developed Differential Specificity and Energy Landscape Here, we report the development of Differential Specificity (DiSEL) analysis to comprehensively compare DNA–protein inter- and Energy Landscapes (DiSEL) to compare experimental actomes (DPIs) obtained by high-throughput experimental plat- platforms, computational methods, and interactomes of TFs, forms and cutting edge computational methods. While high-affinity especially those factors that bind identical consensus motifs. Our DNA binding sites are identified by most methods, DiSEL uncovered results reveal that (i) most high-throughput experimental plat- nuanced sequence preferences displayed by homologous transcription forms reliably identify high-affinity motifs but yield less reliable factors. Pairwise analysis of 726 DPIs uncovered homolog-specific dif- information on submaximal sites; (ii) with few exceptions, com- ferences at moderate- to low-affinity binding sites (submaximal sites). putational methods model DPIs with a focus on high-affinity DiSEL analysis of variants of 41 transcription factors revealed that sites; (iii) submaximal sites improve the annotation of biologi- many disease-causing mutations result in allele-specific changes in cally relevant binding sites across genomes; (iv) among members binding site preferences.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • MUC4/MUC16/Muc20high Signature As a Marker of Poor Prognostic for Pancreatic, Colon and Stomach Cancers
    Jonckheere and Van Seuningen J Transl Med (2018) 16:259 https://doi.org/10.1186/s12967-018-1632-2 Journal of Translational Medicine RESEARCH Open Access Integrative analysis of the cancer genome atlas and cancer cell lines encyclopedia large‑scale genomic databases: MUC4/MUC16/ MUC20 signature is associated with poor survival in human carcinomas Nicolas Jonckheere* and Isabelle Van Seuningen* Abstract Background: MUC4 is a membrane-bound mucin that promotes carcinogenetic progression and is often proposed as a promising biomarker for various carcinomas. In this manuscript, we analyzed large scale genomic datasets in order to evaluate MUC4 expression, identify genes that are correlated with MUC4 and propose new signatures as a prognostic marker of epithelial cancers. Methods: Using cBioportal or SurvExpress tools, we studied MUC4 expression in large-scale genomic public datasets of human cancer (the cancer genome atlas, TCGA) and cancer cell line encyclopedia (CCLE). Results: We identifed 187 co-expressed genes for which the expression is correlated with MUC4 expression. Gene ontology analysis showed they are notably involved in cell adhesion, cell–cell junctions, glycosylation and cell signal- ing. In addition, we showed that MUC4 expression is correlated with MUC16 and MUC20, two other membrane-bound mucins. We showed that MUC4 expression is associated with a poorer overall survival in TCGA cancers with diferent localizations including pancreatic cancer, bladder cancer, colon cancer, lung adenocarcinoma, lung squamous adeno- carcinoma, skin cancer and stomach cancer. We showed that the combination of MUC4, MUC16 and MUC20 signature is associated with statistically signifcant reduced overall survival and increased hazard ratio in pancreatic, colon and stomach cancer.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name LIM homeobox 4 Gene Symbol LHX4 Organism Human Gene Summary This gene encodes a member of a large protein family which contains the LIM domain a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. Gene Aliases CPHD4, FLJ22769 RefSeq Accession No. NC_000001.10, NG_008081.1, NT_004487.19 UniGene ID Hs.658487 Ensembl Gene ID ENSG00000121454 Entrez Gene ID 89884 Assay Information Unique Assay ID qHsaCED0002909 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000263726 Amplicon Context Sequence CTATGGAATCCCCCAGTCTCCATCCTCCATATCGTCCCTGCCATCCCACGCTCCT TTGCTCAATGGGCTGGATTACACGGTGGACAGTAATTTGGGCATCATTGC Amplicon Length (bp) 75 Chromosome Location 1:180243462-180243566 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 94 R2 0.9993 cDNA Cq 24.14 cDNA Tm (Celsius) 82.5 gDNA Cq 23.49 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report LHX4, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
    [Show full text]
  • Diversification of Behavior and Postsynaptic Properties by Netrin-G
    Zhang et al. Molecular Brain (2016) 9:6 DOI 10.1186/s13041-016-0187-5 RESEARCH Open Access Diversification of behavior and postsynaptic properties by netrin-G presynaptic adhesion family proteins Qi Zhang, Hiromichi Goto, Sachiko Akiyoshi-Nishimura, Pavel Prosselkov, Chie Sano, Hiroshi Matsukawa, Kunio Yaguchi, Toshiaki Nakashiba and Shigeyoshi Itohara* Abstract Background: Vertebrate-specific neuronal genes are expected to play a critical role in the diversification and evolution of higher brain functions. Among them, the glycosylphosphatidylinositol (GPI)-anchored netrin-G subfamily members in the UNC6/netrin family are unique in their differential expression patterns in many neuronal circuits, and differential binding ability to their cognate homologous post-synaptic receptors. Results: To gain insight into the roles of these genes in higher brain functions, we performed comprehensive behavioral batteries using netrin-G knockout mice. We found that two netrin-G paralogs that recently diverged in evolution, netrin-G1 and netrin-G2 (gene symbols: Ntng1 and Ntng2, respectively), were responsible for complementary behavioral functions. Netrin-G2, but not netrin-G1, encoded demanding sensorimotor functions. Both paralogs were responsible for complex vertebrate-specific cognitive functions and fine-scale regulation of basic adaptive behaviors conserved between invertebrates and vertebrates, such as spatial reference and working memory, attention, impulsivity and anxiety etc. Remarkably, netrin-G1 and netrin-G2 encoded a genetic “division of labor” in behavioral regulation, selectively mediating different tasks or even different details of the same task. At the cellular level, netrin-G1 and netrin-G2 differentially regulated the sub-synaptic localization of their cognate receptors and differentiated the properties of postsynaptic scaffold proteins in complementary neural pathways.
    [Show full text]
  • UFD1 Mouse Monoclonal Antibody [Clone ID: OTI4C7] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA804306 UFD1 Mouse Monoclonal Antibody [Clone ID: OTI4C7] Product data: Product Type: Primary Antibodies Clone Name: OTI4C7 Applications: IHC, WB Recommended Dilution: WB 1:2000, IHC 1:150 Reactivity: Human Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Full length human recombinant protein of human UFD1L (NP_005650) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 34.3 kDa Gene Name: ubiquitin fusion degradation 1 like (yeast) Database Link: NP_005650 Entrez Gene 7353 Human Q92890 Background: The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009] This product is to be used for laboratory only.
    [Show full text]
  • LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA809561 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] Product data: Product Type: Primary Antibodies Clone Name: OTI4E11 Applications: WB Recommended Dilution: WB 1:500~2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-260 of human LHX4 (NP_203129) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 42.9 kDa Gene Name: LIM homeobox 4 Database Link: NP_203129 Entrez Gene 16872 MouseEntrez Gene 360858 RatEntrez Gene 89884 Human Q969G2 Background: This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010] Synonyms: CPHD4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561 Protein Families: Druggable Genome, Transcription Factors Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY LHX4 ([RC204014], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • 562 a 22Q11.2 Deletion That Excludes UFD1L and CDC45L in a Patient
    562 Letters to the Editor L, Schwartz C, et al. (1997) Determination of the genomic phenotype (Shaikh et al. 1999; Yamagishi et al. 1999). structure of the XNP/ATR-X gene, encoding a potential zinc- However, several of the aforementioned patients (some finger helicase. Genomics 43:149–155 of whom have cardiac and craniofacial defects) have Villard L, Saugier-Veber P, Gecz J, Matte´i JF, Munnich A, Lyon- deletions that do not include the region containing these net S, Fonte´s M (1996b) XNP mutation in a large family genes. These observations suggest that additional se- with Juberg-Marsidi syndrome. Nat Genet 12:359–360 quences within the TDR affect early craniofacial and Villard L, Toutain A, Lossi AM, Gecz J, Houdayer C, Moraine C, Fonte´s M (1996c) Splicing mutation in the ATR-X gene cardiac morphogenesis. Additionally, a patient with fea- can lead to a mental retardation phenotype without alpha- tures of DGS and with a microdeletion that falls outside thalassemia. Am J Hum Genet 58:499–505 the TDR but that does not overlap with any of the known deletions was recently described (Rauch et al. Address for correspondence and reprints: Dr. M. Fonte´s, INSERM U491, 1999). This patient had craniofacial abnormalities and Faculte´deMe´decine La Timone, 27 Boulevard J. Moulin 13385 Marseille Cedex 5, France; E-mail: [email protected] an interrupted aortic arch (type B) with truncus arter- *The first two authors contributed equally to this work. iosus, the same defect seen in the patient described by ᭧ 1999 by The American Society of Human Genetics.
    [Show full text]